WO2020130269A1 - 신규한 dna 앱타머 및 이의 용도 - Google Patents

신규한 dna 앱타머 및 이의 용도 Download PDF

Info

Publication number
WO2020130269A1
WO2020130269A1 PCT/KR2019/009956 KR2019009956W WO2020130269A1 WO 2020130269 A1 WO2020130269 A1 WO 2020130269A1 KR 2019009956 W KR2019009956 W KR 2019009956W WO 2020130269 A1 WO2020130269 A1 WO 2020130269A1
Authority
WO
WIPO (PCT)
Prior art keywords
aptamer
cancer
dna aptamer
present disclosure
seq
Prior art date
Application number
PCT/KR2019/009956
Other languages
English (en)
French (fr)
Inventor
김윤희
허균
최선일
김인후
Original Assignee
국립암센터
주식회사 제이피바이오에이
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 국립암센터, 주식회사 제이피바이오에이 filed Critical 국립암센터
Priority to EP19900348.4A priority Critical patent/EP3901287A4/en
Priority to JP2021536744A priority patent/JP7391971B2/ja
Priority to US17/416,858 priority patent/US20220090081A1/en
Priority to CN201980092801.6A priority patent/CN113646442A/zh
Publication of WO2020130269A1 publication Critical patent/WO2020130269A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/13—Applications; Uses in screening processes in a process of directed evolution, e.g. SELEX, acquiring a new function
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/205—Aptamer

Definitions

  • the present disclosure relates to novel DNA aptamers. Specifically, it relates to a DNA aptamer selected as specifically binding to cancer cells from a cancer DNA library using Cell-SELEX. In addition, the present disclosure relates to a composition for targeting cancer tissue, a composition for diagnosing cancer, or a composition for treating cancer, including a novel DNA aptamer.
  • This disclosure is derived from research conducted as part of the National Cancer Center's institutional research project and the Small and Medium Business Venture's TIPS program (private investment-led technology start-up support project).
  • An aptamer refers to a single-stranded DNA or RNA oligonucleotide that has a unique three-dimensional structure and specifically binds to a target target similarly to an antibody. In general, aptamer has a high binding strength even at low concentrations ranging from nanomolar to picomolar.
  • Aptamers are often compared to antibodies due to their target-specific binding properties. Compared to antibodies, aptamers can be easily prepared by chemical synthesis without biological processes using cells or animals, are relatively stable at high temperatures, and have a small size. Excellent access to targets. Furthermore, various modifications can be easily made in the chemical synthesis process, and it has advantages in terms of non-immunity and non-toxicity compared to antibodies in the possibility of use as a therapeutic agent. However, the aptamer is degraded by a nucleic acid degrading enzyme (nuclease) present in the living body, and has a short half-life. This drawback can be overcome using various chemical modifications.
  • nucleic acid degrading enzyme nuclease
  • pancreatic cancer is the worst type of carcinoma, and the mortality rate within one year after diagnosis of cancer is the number one among all carcinomas.
  • the 2-year survival rate is around 10%, and the 5-year survival rate is only within 8%.
  • the 5-year survival rate has increased significantly in almost all cancers, but pancreatic cancer has shown very gloomy results, increasing from 3% in 1997 to 8% in 2016.
  • pancreatic cancer patients the patient group that can be operated is around 20%, and even if the tumor size is less than 1 cm and there is no lymph node metastasis or distant metastasis, a high survival rate of 90% or more can be expected after surgery. This is the case when surgery cannot be performed. When surgery is impossible, most rely on chemotherapy or radiation therapy, but there is no clearly standardized treatment, so it is important to diagnose pancreatic cancer as early as possible to increase survival.
  • pancreatic cancer Early symptoms of pancreatic cancer rarely appear, and when the patient feels the symptoms, most of the stages have progressed to a significant level, so early diagnosis of pancreatic cancer is very difficult.
  • pancreatic cancer There are virtually no early diagnostic markers available for pancreatic cancer.
  • pancreatic cancer is generally defined as having a tumor size of less than 2 cm, localized within the pancreas, and no infiltration and lymph node metastasis. However, even if the pancreatic cancer size was less than 2 cm, which is the standard for early pancreatic cancer, metastasis was accompanied when it reached 50%. When classifying the stages of pancreatic cancer according to tumor size, lymph node metastasis, and distant metastasis, invasion occurs in the upper mesenteric vein or portal vein connection site in stage II classified as early pancreatic cancer, and initial metastasis by a small number of cells Is often found. In this case, surgery is not possible.
  • Distant metastases are often found within a short period after surgery, even if surgery is performed because it is determined that the tumor is localized to the pancreas, and no distant metastases have been found. In this case, even if surgery is performed, the likelihood of recurrence is very high, and since there is no clear anticancer agent, the average survival rate after diagnosis is only 6 to 12 months. Therefore, even for early surgical resection, the only method for curing pancreatic cancer, it is necessary to diagnose early pancreatic cancer before full-scale distant metastasis or early metastasis by a small number of cells.
  • the development of a specific probe for a cell surface protein can be used to develop an antibody using this as an antigen after separating and purifying only the outer part of the cell surface protein with a recombinant protein, or as a material for selecting an aptamer.
  • the method of screening for aptamer selection is generally referred to as a systemic evolution of ligands by exponential enrichment (SELEX) technique.
  • SELEX systemic evolution of ligands by exponential enrichment
  • most of these methods use recombinant proteins separately, where the three-dimensional structure of the cell surface protein is likely to be modified, and when the three-dimensional structure of the protein is important for binding to the target protein, the actual cell surface The target protein may not be able to bind.
  • a DNA aptamer having a high binding force to pancreatic cancer was selected using the Cell-SELEX method for pancreatic cancer cells, and additional studies were conducted to increase cell and tissue targeting efficiency and blood stability for the selected aptamer. Completed the present disclosure by confirming that it can specifically bind to various cancer types such as pancreatic cancer, colon cancer, liver cancer, lung cancer, brain tumor, oral cancer, ovarian cancer, and breast cancer.
  • Patent Document 1 Korean Registered Patent No. 10-1458947
  • Patent Document 2 Korean Registered Patent No. 10-1250557
  • the present disclosure aims to provide novel DNA aptamers.
  • the novel DNA aptamer is a cancer-specific DNA aptamer.
  • Another object of the present disclosure is to provide a method for diagnosing or treating cancer using a DNA aptamer that specifically binds cancer.
  • the present disclosure is intended to develop an aptamer useful for cancer cell detection, and an aptamer specifically binding to a pancreatic cancer cell membrane was selected using the Cell-SELEX method. Specifically, the present disclosure used target cells CMLu-1 isolated from metastasized pancreatic cancer tissue as target cells, and normal pancreatic tissue cells HPNE as control cells to select aptamers that specifically bind to pancreatic cancer cells.
  • the present disclosure provides a DNA aptamer comprising the nucleotide sequence of SEQ ID NO: 6, and in one aspect, the present disclosure provides a sequence homology of 90% or more or 95% or more with the nucleotide sequence of SEQ ID NO:6.
  • Branches provide a DNA aptamer comprising a base sequence.
  • the DNA aptamer may be cancer-specific binding.
  • the DNA aptamer may be composed of the nucleotide sequence of SEQ ID NO: 6.
  • the present disclosure provides, in one aspect, a DNA aptamer consisting of a nucleotide sequence having 90% or more, or 95% or more sequence homology with the nucleotide sequence of SEQ ID NO:4.
  • the DNA aptamer may be composed of the nucleotide sequence of SEQ ID NO: 4.
  • base sequence having a sequence homology of 90% or more refers to a base showing similar cancer specific binding ability as one to several nucleotides are added, deleted, or substituted to have similarity to sequences of 90% or more and less than 100%. Means sequence.
  • having a sequence homology of 90% or more with the base sequence of SEQ ID NO: 4 does not correspond to the base sequence of SEQ ID NO: 6 among the base sequences of SEQ ID NO: 4, but SEQ ID NO: It may mean having a base sequence different from the base sequence of 4.
  • DNA aptamer is a short single-stranded oligonucleotide, which has a property of binding to a target target with high affinity and specificity, and may mean that each has a unique three-dimensional structure. Through repeated ex vivo screening and concentration processes, it is possible to select a DNA molecule that specifically binds to a specific target target from a DNA aptamer library, that is, select a DNA aptamer.
  • 11 aptamer families (SQ1 to SQ11) were classified as a result of analyzing aptamer sequences of the DNA pool enriched through the Cell-SELEX process and grouping similar sequences.
  • SQ7 was identified as a group having high binding ability to CMLu-1, a metastatic cancer cell derived from pancreatic cancer, and an aptamer having a highly similar sequence having a different base sequence in the SQ7 family was also included (SQ7a in Table 3).
  • SQ7b aptamer SQ7b aptamer
  • synthetic aptamers 32 mer
  • the inventors of the present disclosure determined that the SQ7-1 aptamer is a site that plays an important role in cancer cell and cancer tissue targeting ability in the sequence of the SQ7 aptamer, and further experiments were conducted based on this.
  • the present disclosure provides a modified DNA aptamer in which modifications have been introduced to have DNase resistance to the DNA aptamer of the present disclosure, and the modification may occur at 10% or more of bases in SEQ ID NO: 6 ,
  • the DNA aptamer may have any one of SEQ ID NOs: 8, 12 or 14.
  • modifications introduced to have DNase resistance include -Me (methyl), -OMe, -NH2, -F (fluorine) at the 2'carbon position of the sugar structure in one or more nucleotides, -O-2-methoxyethyl-O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido or It may be a modification by substitution with -O-dimethylamidooxyethyl.
  • the internal 2'-O-methyl-modified aptamer (internal 2'-O-methyl-) is divided into regions in the secondary structure of SQ7-1 aptamer using SQ7-1 aptamer as a template. modified aptamers) to measure their half-life in serum to confirm stability. As a result, it was confirmed that the serum half-life of some modified aptamers increased more than 90 times compared to SQ7-1 aptamers.
  • the target cells used for Cell-SELEX were CMLu-1 obtained from pancreatic cancer tissues metastasized through an allograft experiment.
  • the present disclosure may be particularly useful for the diagnosis of pancreatic cancer.
  • the present disclosure provides a composition for targeting cancer tissue comprising the aptamer.
  • the composition comprising the DNA aptamer may further include an active ingredient having the same or similar function to the above component, or a component that stabilizes the composition formulation or enhances the stability of the aptamer.
  • the composition may be a pharmaceutical composition.
  • the present disclosure provides a composition for diagnosing cancer comprising an aptamer according to an aspect of the present disclosure.
  • the DNA aptamer can be used in combination with an agonist moiety.
  • the agonist moiety can be a cytotoxic agent, an immunosuppressant, an imaging agent (eg, a fluorophore or chelator), a nanosynthetic material, or a toxin polypeptide.
  • the cytotoxic agent may be a chemotherapeutic agent.
  • the present disclosure may relate to a composition for treating cancer, comprising a new DNA aptamer according to an aspect of the present disclosure and an anticancer agent combined with the DNA aptamer.
  • the cancer may be pancreatic cancer, colon cancer, liver cancer, lung cancer, brain tumor, oral cancer, ovarian cancer, or breast cancer, but is not limited thereto.
  • the anti-cancer agent is monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), calicheamicin, mertansine (DM1), ravtansine (DM4), teserin ( tesirine; SCX), doxorubicin, Cisplatin, SN-38, Duocarmycin, and pyrrolobenzodiazepine (PBD).
  • MMAE monomethyl auristatin E
  • MMAF monomethyl auristatin F
  • calicheamicin calicheamicin
  • DM1 mertansine
  • DM4 ravtansine
  • SCX teserin
  • doxorubicin Cisplatin
  • SN-38 SN-38
  • Duocarmycin pyrrolobenzodiazepine
  • the DNA aptamer is polyethylene glycol (PEG) or derivatives thereof, diacylglycerol (DAG) or derivatives thereof, antibodies, dendrimers or zwitterion-containing biocompatible polymers (e.g., phosphorylcholine) Containing polymer).
  • PEG polyethylene glycol
  • DAG diacylglycerol
  • antibodies dendrimers or zwitterion-containing biocompatible polymers (e.g., phosphorylcholine) Containing polymer).
  • the composition may further include a physiologically acceptable excipient, carrier, or additive, including starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, and hydrogen phosphate.
  • a physiologically acceptable excipient, carrier, or additive including starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, and hydrogen phosphate.
  • Calcium, lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, opadry, sodium starch glycolate, carnauba lead, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate , Calcium stearate, white sugar, dextrose, sorbitol and talc may be used, but are not limited thereto.
  • the composition may be administered to a subject in various forms according to a selected route of administration, as understood by those skilled in the art.
  • it can be administered by topical, enteral or parenteral application.
  • Topical applications include, but are not limited to, application through the epidermis, inhalation, enema, eye drops, ear drops and mucosal membranes within the body.
  • Intestinal applications include oral administration, rectal administration, vaginal administration, and gastric feeding tubes.
  • Parenteral administration is intravenous, intraarterial, intrathecal, intraorbital, intracardiac, intradermal, coronary, subcutaneous, intraarticular, subcutaneous, subarachnoid, intrathecal, epidural, intrasternal, intraperitoneal, subcutaneous, Intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, rectal and topical modes of administration.
  • the composition may be formulated in an appropriate form according to a route of administration or the like.
  • it may be prepared using diluents or excipients, such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, but is not limited thereto.
  • the composition is administered according to an aspect of the present disclosure in an amount determined by a person skilled in the art to be effective according to an administration route and a subject's weight, age, sex, health condition, diet, administration time, excretion rate, and the like.
  • DNA aptamers may be included.
  • DNA aptamers selected and optimized as having high binding ability to cancer cells of the present disclosure have improved targeting efficiency of target cells and tissues, have high blood stability, and can be effectively used for diagnosis and treatment of cancer.
  • Figure 1 relates to the form of the nucleotides included in the DNA library of the present disclosure, and the form of the forward and rear primers that can be used to amplify or identify them.
  • the nucleotides included in the DNA library had 20 general nucleotides at the 5'-end, 40 random nucleotide sequences in the middle, and additional 20 general nucleotides at the 3'-end.
  • the 5'-end of the front primer was labeled with Cy5 (5'-Cy5-sequence-3'), and the 5th-end of the rear primer was labeled with biotin (5'-biotin-sequence-3').
  • FIG. 3 is a diagram schematically illustrating a process for screening aptamers through the Cell-SELEX method using metastatic pancreatic cancer cells in the present disclosure.
  • FIG. 5 is a diagram illustrating a secondary structure according to the sequence of SQ7 aptamer obtained by screening aptamer through the Cell-SELEX method using metastatic pancreatic cancer cells in the present disclosure.
  • Figure 6a is the result of confirming the target cell binding force of the SQ7 aptamer of the present disclosure by flow cytometry (FACS). Specifically, SQ7 aptamer and a control group were treated with untreated control (NT), DNA pool library, and target cell binding capacity of SQ8-Comp aptamer.
  • FACS flow cytometry
  • Figure 6b is the result of confirming the target cell binding capacity of the SQ7-1 aptamer of the present disclosure by flow cytometry (FACS). Specifically, SQ7 aptamer and SQ7-1 aptamer and control were measured as untreated control (NT), DNA pool library, and target cell binding capacity of SQ8-Comp aptamer.
  • FACS flow cytometry
  • FIG. 7 is a diagram schematically illustrating the secondary structure of the SQ7-1 aptamer manufactured based on the SQ7 aptamer of the present disclosure.
  • the gray oval portion represents the nucleus
  • the brightest white portion represents the aptamer that is bound to the cell surface or internalized into the cell.
  • the gray oval portion represents the nucleus
  • the brightest white portion represents the aptamer that is bound to the cell surface or internalized into the cell.
  • FIG. 10 is a view confirming targeting patterns of SQ7 aptamers of the present disclosure to pancreatic cancer tissues through bioluminescence imaging experiments in a xenograft mouse model of a human pancreatic cancer cell line.
  • FIG. 11 is a view confirming targeting patterns of SQ7-1 aptamer of the present disclosure to pancreatic cancer tissue through a bioluminescence imaging experiment in a xenograft mouse model of a human pancreatic cancer cell line.
  • FIG. 12A to 12D are internal 2'-O-methyl-modified aptamers SQ7-1(1), SQ7-1(2), and SQ7-1(3) manufactured based on the SQ7-1 aptamer of the present disclosure. ), SQ7-1(4), SQ7-1(5), SQ7-1(6), and SQ7-1(1, 5) are diagrams of secondary structures and deformation positions of aptamers.
  • FIG. 12A schematically depicts the internal 2'-O-methyl-modified region in a square shape, and FIGS. 12B to 12D specifically disclose each sequence of the internal 2'-O-methyl-modified position.
  • 13A to 13D are the results of measuring the half-life in serum of SQ7-1, SQ7-1(1), SQ7-1(5), and SQ7-1(1,5) aptamers of the present disclosure.
  • FIG. 15 is a xenograft mouse model for pancreatic cancer cells in a human pancreatic cancer patient, and is a diagram confirming a targeting pattern of SQ7-1 aptamer of the present disclosure to pancreatic cancer tissue through a bioluminescence imaging experiment.
  • 16A and 16B are results of confirming the binding ability of the SQ7-1 aptamer of the present disclosure to various pancreatic cancer cell lines by flow cytometry (FACS).
  • FIG. 17 is a graph showing the geometric mean value of the relative fluorescence intensity of SQ7-1 aptamer relative to SQ7-1-Rev aptamer in multiples based on the results of FIG. 16.
  • FIG. 18 shows the relative fluorescence intensity of SQ7-1 aptamer to SQ7-1-Rev aptamer based on the results of confirming the binding ability of the SQ7-1 aptamer of the present disclosure to various cancer cell lines by flow cytometry (FACS). It is a graph showing the geometric mean value in multiples.
  • pancreatic cancer cell line CMLu-1 was isolated from tissues to which cancer had metastasized by transplanting the pancreatic cancer cells into animals (FIG. 3A).
  • An ssDNA library was prepared, and CMLu-1 cells, a pancreatic cancer cell line, were used as target cells (positive cells), and screened using hTERT/HPNE (Human Pancreatic Nestin Expressing cells) as control cells (negative cells).
  • the selected ssDNA pools were cloned, sequenced and grouped by repeating the ssDNA selection process, which does not bind to control cells but binds only to pancreatic cancer cells.
  • Metastasized pancreatic cancer cell CMLu-1 was obtained by the following method. Specifically, an orthotopic mouse model was created using NOD/SCID mice. First, in constructing an animal model that can mimic the metastasis of pancreatic cancer, pancreatic cancer, a cell line in which firefly luciferase is continuously expressed to non-invasively monitor the tumor formation situation over time. Cell lines (CFPAC-1-Luci cells) were established and used. The pancreatic cancer cell line CFPAC-1-Luci was ortho-grafted to NOD/SCID mice, and after 43 days, the tumor tissue was extracted from the lung tissue metastasized from the pancreas to perform genotyping to determine the genetic properties of the metastasized cells.
  • CMLu-1 cells isolated from metastatic tumor tissue, RPMI-1640 (Hyclone) containing 10% fetal bovine serum (FBS, Thermo Fisher Scientific, USA) and 100 IU/mL of Anti-Anti (antibiotic-antimycotic; Gibco) , Logan, UT, USA).
  • the CMLu-1 cells thus obtained were used as cells for positive selection in Cell-SELEX, and negative selection of Human Pancreatic duct Normal Epithelial cells (HPNE) purchased from ATCC Inc. It was used as a control cell for negative selection.
  • HPNE Human Pancreatic duct Normal Epithelial cells
  • the DNA library for pancreatic cancer-specific aptamer Cell-SELEX use was a pool of DNA sequences consisting of a combination of generic and unique nucleotides. There were 20 general nucleotides at the 5'-end, 40 random nucleotide sequences in the middle, and an additional 20 general nucleotides at the 3'-end.
  • the 5'-terminus was labeled with Cy5, and the 3'-terminus was used to monitor the enrichment of the selection using a fluorescence-activated cell sorter ("FACS"; aka'flow cytometer').
  • FACS fluorescence-activated cell sorter
  • the 5'-end of the forward primer was labeled with Cy5 (5'-Cy5-sequence-3'), and the 5th-end of the rear primer was labeled with biotin (5'-biotin-sequence-3').
  • the DNA forms included in the DNA library and the types of the front and rear primers used are shown in Table 1 below.
  • DNA library nucleotide form (SEQ ID NO: 1) 5'-ATA CCA GCT TAT TCA ATT -[nucleotide 40(N40)]- AGA TAG TAA GTG CAA TCT-3' Forward primer (5'-primer) (SEQ ID NO: 2) 5'-Cy5- ATA CCA GCT TAT TCA ATT-3' Reverse primer (3'-primer) (SEQ ID NO: 3) 5'-Biotin- AGA TTG CAC TTA CTA TCT-3'
  • PCR was used to amplify each eluted pool. Streptavidin-biotin binding captures the complementary strand biotinylated, and the double-stranded DNA is isolated ssDNA through denaturation with NaOH. The PCR mixture was prepared and PCR reaction was performed according to the manufacturer's instructions.
  • CMLu-1 cells were used as target cells (positive cells), and screening was performed using hTERT/HPNE (Human Pancreatic Nestin Expressing cells) as control cells (negative cells).
  • hTERT/HPNE Human Pancreatic Nestin Expressing cells
  • a 10 nmol DNA library was dissolved in 1,000 ⁇ L of binding buffer, Dulbecco's PBS (Hyclone, USA) containing 5 mM MgCl 2 , 0.1 mg/mL tRNA, and 1 mg/mL bovine serum albumin.
  • the DNA library or concentrated pool was denatured at 95°C for 10 minutes, cooled on ice for 10 minutes, and then incubated with CMLu-1 cells at 4°C for 1 hour with an orbital shaker. After washing the CMLu-1 three times to remove the non-adhered DNA sequence, the bound DNA was eluted through a centrifuge at 95°C for 15 minutes using 1,000 ⁇ L of binding buffer.
  • each aptamer pool was incubated with hTERT/HPNE for 1 hour, and then supernatant was collected to perform negative selection.
  • the concentrated pool was monitored using FACS, and cloned into Escherichia coli using the Quiagen Cloning Kit for sequencing (Quiegen, Germany) to identify aptamer candidates.
  • the ssDNA pool enriched 5 times was cloned and sequenced for selection of candidate sequences.
  • the ssDNA pool was amplified by PCR using unmodified primers, ligated to pGEM-T easy vector (Promega, USA), and cloned into HITTM-DH5 ⁇ receptor cells (Propetent, Promega, USA). Accordingly, 200 cloned sequences were analyzed through Cosmogenetech (Seoul, Korea) and aligned with ClustalX 1.83.
  • the processes (1) to (4) are schematically illustrated in FIG. 3.
  • the aptamers sequenced through this process were grouped into aptamers with similar sequences, and through this, 11 Cy5-labeled aptamer family candidates (SQ1 to SQ11) were identified. Content in the entire pool of the aptamer family is shown in Table 2 below.
  • Cy5-labeled aptamer family candidate was incubated for 1 hour in 4 ⁇ C binding buffer used in Cell-SELEX with 3 ⁇ 10 5 CMLu-1 cells and hTERT/HPNE cells. Cells were washed three times with binding buffer containing 0.1% NaN 3 and the pellet with the bound sequence was resuspended in binding buffer. Fluorescence analysis was performed by measuring 10,000 cells through BD FACSCallibur TM and FACSVerse TM (BD Biosciences, USA), and the data were analyzed using FlowJo software v10.0.7.
  • the results of measuring the target cell binding capacity of each Cy5-labeled aptamer family candidate are shown in FIG. 4.
  • the target target cell, metastasized pancreatic cancer cell (CMLu-1), has the highest binding specificity, aptamer SQ7, and its sequence is as follows.
  • the aptamer sequences included in the SQ7 family are as follows.
  • SQ7 and SQ7-subtype Aptamer order Number % SQ7 AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACCAACTCTTGCCCTATGCGTGCTACCGTGAA 3 4.03 SQ7a AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACCAACTCTT CT CCTATGCGTGCTACCGTGA (SEQ ID NO: 15) One SQ7b AGCAACACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACC C ACTCTTG T CCTATGCGTGCTACCGTGAA (SEQ ID NO: 16) 2
  • the result of confirming the secondary structure according to the sequence of the SQ7 aptamer selected through Example 2 is as shown in FIG. 5.
  • SQ7 aptamer and control as an untreated control (NT), DNA pool library and SQ8-Comp aptamer (aptamer having a nucleic acid sequence complementary to SQ8 aptamer and a portion; SEQ ID NO: 5 ) was prepared, and the target cell binding force was measured using FACS in the same manner as in Experimental Example 2.
  • various aptamers including a part of the SQ7 aptamers were prepared to confirm whether there is a particularly important part for pancreatic cancer specific binding, and binding ability with target cells was confirmed. If the overall aptamer size can be reduced while maintaining the cell binding ability, it will be possible to increase the penetration force in the cell while lowering the manufacturing cost. As a result, it was confirmed that the SQ7-1 aptamer of the following Table 4 sequence has excellent endocytosis ability while almost maintaining target cell binding ability.
  • the target cell binding strength of SQ7 aptamer, SQ7-1 aptamer, untreated control (NT), DNA pool library, and SQ8-Comp aptamer was measured using FACS in the same manner as in Experimental Example 2.
  • SQ7-1-Rev aptamer (aptamer having a sequence opposite to SQ7-1; SEQ ID NO: 7) was prepared for use as a control of SQ7-1 aptamer.
  • FIGS. 8 and 9 The results of confocal microscopy experiments of SQ7 and SQ7-1 aptamer are shown in FIGS. 8 and 9.
  • the brightest white part indicates that the aptamer has a lot of aptamers. 8 and 9, it was confirmed that SQ7 and SQ7-1 aptamer target pancreatic cancer cells better than control cells, and endocytosis (internalization) of cells is also well performed.
  • mice Female Hsd : Athymic nude-Foxn1 nude mice (6 weeks old) were Harlan Laboratories, Inc. (France). They were stored in a specific pathogen free (SPF) environment with controlled light and humidity, and were fed with feed and water at the National Cancer Center animal facility. All animal experiments were conducted with permission from the National Institute of Cancer Center (NCCRI, unit number: NCC-16-163D) by the Institutional Animal Care and Use Committee (IACUC). NCCRI is an accredited body accredited by the International Association of Laboratory Animal Care Assessments.
  • mice An orthotopic xenograft mouse model of pancreatic cancer was constructed by injecting CFPAC-1 cells (1 ⁇ 10 6 cells) purchased from ATCC into the mouse pancreas (tail of pancreas). After 3 weeks of inoculation, mice were treated with two groups depending on treatment (Cy5.5-SQ8-Comp aptamer vs Cy5.5-SQ7 aptamer or Cy5.5-SQ7-1-Rev aptamer vs Cy5.5-SQ7-1 app) Tamer) and the above Cy5.5-labeled aptamer (300 pmol/50 ul PBS) was administered intravenously.
  • CFPAC-1 cells 1 ⁇ 10 6 cells
  • mice were treated with two groups depending on treatment (Cy5.5-SQ8-Comp aptamer vs Cy5.5-SQ7 aptamer or Cy5.5-SQ7-1-Rev aptamer vs Cy5.5-SQ7-1 app) Tamer) and the above Cy5.5-labeled aptamer (
  • mice were dissected at 15 minutes or 3 hours post administration. Tumor tissue was obtained and imaged by bioluminescence imaging using IVIS Lumina (Caliper Life Science, Hopkinton, MA, USA). All image data were analyzed using software (Living Image Acquisition and Analysis software).
  • the 5 ug of the internal 2'-O-methyl-modified aptamer thus prepared was cultured in mouse serum at 37°C for 0, 0.1, 0.5, 2, 6, and 24 hours. At each time point, 0.5 M EDTA was added to the samples to stop DNase activity, and EtOH-NaOAc was added to precipitate. DNA-aptamer-precipitate samples were analyzed by HPLC.
  • the half lives of SQ7-1(1), SQ7-1(5), and SQ7-1(1,5) aptamers were significantly increased.
  • the half-lives of the SQ7-1(1), SQ7-1(5), and SQ7-1(1,5) aptamers are 91, 145, and It was confirmed that the increase was 760 times.
  • Their binding capacity to the target cells was slightly reduced compared to SQ7-1 aptamer, but was high enough to be clearly distinguished compared to the DNA pool library (fine leftmost line in the graph) (FIG. 14).
  • the DNA aptamer according to the present disclosure has a characteristic of having high binding power to pancreatic cancer and specifically binding, reducing the size of the selected aptamer to increase targeting efficiency for target cells or tissues, and to DNase It was confirmed that it is possible to increase the stability of the blood through a modification that improves resistance to the disease.
  • PDOX model patient-derived orthotopic xenograft model
  • a patient-derived orthotopic xenograft was constructed by direct transplantation into the pancreas.
  • a primary tumor sample hereinafter referred to as "HPT”
  • HPT liver metastasis tissue biopsy sample
  • the female Hsd: athymic nude-Foxn1 nude mouse (obtained in the same manner as in Experiment 4) was excised and sutured to the pancreas of the pancreas (PDOX 1st generation, F1) ). Thereafter, the size of the tumor was measured periodically through abdominal palpation and MRI imaging equipment. When the tumor size reached 3000 mm 3 , mice were sacrificed to obtain tumor tissue, and then a certain size (3 mm * 3 mm * 3) mm) tumor tissues were orthotografted to nude mice of several individuals to form the next generation (F2, F3, F4..) and amplified population.
  • the patient-derived orthotopic xenograft mouse model constructed in 4th generation (F4) was divided into two groups of three, each of which was Cy5.5-labeled aptamer (300 pmol/50 ul PBS) SQ7-1 aptamer and SQ7.
  • -1-Rev aptamer was administered intravenously. After 15 minutes of administration, mice were sacrificed and dissected to obtain tumor tissue, and then imaged by bioluminescence imaging using IVIS Lumina (Caliper Life Science, Hopkinton, MA, USA). All image data were analyzed using software (Living Image Acquisition and Analysis software). The results of the bioluminescence imaging experiment are the same as the gray scale picture of FIG. 15, and the total flux obtained from the imaging results is graphically shown in FIG. 15.
  • the aptamer of the present disclosure has a remarkably excellent targeting efficiency even in a PDOX model that has patient tumor tissue complexity and heterogeneity.
  • SQ7-1 aptamers labeled with Digoxigenin at 250 nM concentration and anti-digoxigenin-antibodies at 125 nM concentration were used. Put together and mix for 30 minutes at room temperature.
  • Flow cytometry was performed in the same manner as in Experimental Example 2, but the antibody-binding aptamer prepared above was used, and the secondary antibody was labeled with Alexa 488 anti-mouse-immunoglobulin G (anti -mouse IgG) (Invitrogen, USA) was used at a concentration of 4 ⁇ g/ml.
  • Cells are CFPAC-1 cell line, SNU-213 cell line, SNU-410 cell line, Capan-2 cell line, HPAF-II cell line, AsPC-1 cell line, Capan-1 cell line, MIA PaCa cell line, BxPC-3 cell line, and PANC-1 Cell lines were used respectively. All of these cell lines were purchased from ATCC.
  • FIGS. 16 and 17 show the geometric mean value of the relative fluorescence intensity of SQ7-1 aptamer relative to SQ7-1-Rev aptamer in multiples.
  • the SQ7-1 aptamer of the present disclosure binds better and specifically to all pancreatic cancer cell lines, compared to the SQ7-1-Rev aptamer.
  • the aptamer of the present disclosure will specifically bind to various types of pancreatic cancer cells.
  • the SQ7 aptamer contains the SQ7-1 aptamer, it will likewise specifically bind to various types of pancreatic cancer cells.
  • Cells are U87 cell line, U251 cell line, CAL27 cell line, HEP3B cell line, A549 cell line, HCT116 cell line, SK-OV3 cell line, ES-2 cell line, MCF7 cell line, SK-BR3 cell line, NCI-N87 cell line, KPL4 cell line, BT-474 cell line , MDA-MB231 cell line, and HCC1938 cell line were used, respectively. All of these cell lines were purchased from ATCC.
  • FIG. 18 shows the geometric mean value of the relative fluorescence intensity of SQ7-1 aptamer relative to SQ7-1-Rev aptamer in multiples.
  • SQ7-1 aptamer of the present disclosure is superior to SQ7-1-Rev aptamer for various cancer cell lines, namely, colon cancer, liver cancer, lung cancer, brain tumor, oral cancer, ovarian cancer, and breast cancer cell lines. It can be confirmed that it specifically binds. When synthesized with the results of Salpin Experimental Examples 4 and 6, it can be confirmed that the aptamer of the present disclosure will specifically bind to various types of cancer cells.
  • the SQ7 aptamer contains the SQ7-1 aptamer, it will likewise specifically bind to various types of cancer cells.
  • cancer cells isolated from tumor tissue can form cell lines capable of infinitely proliferating without transformation, and reflect the clinical and molecular biological characteristics of patients. It is believed to be possible.
  • human tissue dissociation kit (Miltenyi Biotech Inc.) containing collagenase to separate cells from connective tissue after fragmenting the tumor tissue extracted from the pancreatic cancer PDOX mouse into 3 mm * 4 mm. ) And reacted for 1 hour in a tissue dissociation device (Gentle Macs, Miltenyi Biotech Inc).
  • the enzyme activity is inhibited with RPMI medium containing fetal bovine serum (FBS), and then centrifuged to obtain a precipitate of cells dissociated from the tissue.
  • FBS fetal bovine serum
  • Established a PDOX-derived cancer cell line for each pancreatic cancer patient by suspending it with RPMI medium containing fetal bovine serum and spreading cells evenly at 2 x 10 6 levels in a 10 cm culture dish and removing medium fibroblasts and dead cells while replacing the medium every two days. Did. The naming of each established cell line is identical to that of the resulting PDOX.
  • FIG. 19 shows the geometric mean value of the relative fluorescence intensity of SQ7-1 aptamer relative to SQ7-1-Rev aptamer in multiples.
  • the SQ7-1 aptamer of the present disclosure binds better and specifically to various PDOX-derived cell lines derived from pancreatic cancer tissue obtained from several patients, compared to the SQ7-1-Rev aptamer. Can. Comparing with the results of Salpin Experimental Examples 4 and 6 above, it can be confirmed that the aptamer of the present disclosure will specifically bind to pancreatic cancer tissue of a patient in actual clinical practice.
  • the SQ7 aptamer contains the SQ7-1 aptamer, it will likewise specifically bind to the patient's pancreatic cancer tissue.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicinal Preparation (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 개시는 신규한 DNA 앱타머 및 이의 용도에 관한 것으로, 구체적으로 Cell-SELEX 방법을 이용하여 수득된 DNA 라이브러리에서 암 세포에 특이적으로 결합하는 것으로 선별된 DNA 앱타머에 관한 것이다. 본 개시의 암에 높은 결합력을 가지는 것으로 선별되고 최적화된 DNA 앱타머는 표적 세포 및 조직 타겟팅 효율이 증진되고 높은 혈중 안정성을 가져, 암 진단 등에 효과적으로 사용될 수 있다.

Description

신규한 DNA 앱타머 및 이의 용도
본 개시는 신규한 DNA 앱타머에 관한 것이다. 구체적으로 Cell-SELEX를 이용하여 암 DNA 라이브러리로부터 암 세포에 특이적으로 결합하는 것으로 선별된 DNA 앱타머에 관한 것이다. 또한, 본 개시는 신규한 DNA 앱타머를 포함하는 암 조직 타겟팅용 조성물, 암 진단용 조성물 또는 암 치료용 조성물에 관한 것이다. 본 개시는 국립암센터의 기관고유연구사업 및 중소벤처기업부의 TIPS 프로그램(민간투자주도형 기술창업지원사업)의 일환으로 수행한 연구로부터 도출된 것이다.
[과제고유번호 : NCC-1210080, 연구과제명 : Cell-SELEX를 활용한 췌장암 특이적 전이 인자 발굴]
[과제고유번호 : NCC-1410270, 연구과제명 : 압타머-항체 융합체 플랫폼기술 구축을 통한 신개념 항암제 개발]
[과제고유번호 : S2562351, 연구과제명 : 압타머-항체-약물 융합체를 이용한 췌장암 치료제 개발]
앱타머(aptamer)란, 독특한 3차원 구조를 가지고 항체와 유사하게 대상 표적에 특이적으로 결합하는 단일-가닥 DNA 또는 RNA 올리고뉴클레오티드를 말한다. 일반적으로 앱타머는 나노몰 내지 피코몰에 이르는 낮은 농도에서도 높은 결합력을 가지는 특징을 가진다.
앱타머는 타겟-특이적 결합 특성으로 인하여 흔히 항체와 비교되는데, 항체에 비하여, 앱타머는 세포 내지 동물을 이용한 생물학적 공정없이 화학적 합성으로 쉽게 제조가능하고, 높은 온도에서도 비교적 안정하며, 작은 사이즈를 가져 대상 표적에의 접근성이 우수하다. 나아가, 화학적 합성 과정에서 쉽게 다양한 변형이 가능하고, 비-면역성 및 무독성이라는 점에서 치료제로 사용 가능성에 있어서 항체에 비해 유리한 장점을 가진다. 다만, 앱타머는 생체 내에 존재하는 핵산 분해 효소(뉴클레아제)에 의해 분해되어 반감기가 짧다는 단점을 가지고 있다. 이러한 단점은 다양한 화학적 변형을 이용하여 극복될 수 있다.
암은 조기에 발견하여 치료할 필요가 있다. 특히, 췌장암은 예후가 가장 좋지 않은 암종으로서, 암 진단 후 1년 이내 사망률이 전체 암종에서 1위이다. 2년 생존율이 10% 정도이고, 5년 생존율은 8% 이내에 불과하다. 최근 20년간 거의 모든 암에서 5년 생존율이 큰 폭으로 증가하였으나 췌장암은 1997년 집계된 5년 생존율 3%에서 2016년 8% 정도까지만 증가하는 매우 암울한 결과를 보이고 있다.
실제 췌장암 환자에서 수술이 가능한 환자군은 20% 내외이며, 이나마도 종양의 크기가 1 cm 이하이고 림프절 전이 및 원격 전이가 없어야만 수술 후 90% 이상의 높은 생존율을 기대할 수 있으나 대부분의 환자는 진단 시 이미 수술을 시행할 수 없는 경우에 해당한다. 수술이 불가능한 경우 대부분 항암제나 방사선 치료에 의존하고 있지만 명확히 표준화된 치료법이 없어서, 가능한 췌장암을 조기에 진단하는 것이 생존율을 높이는데 중요하다.
췌장암은 조기 증상이 거의 나타나지 않을 뿐만 아니라, 환자가 증상을 느끼게 되면 상당한 수준으로 진행된 상태가 대부분이어서, 췌장암의 조기 진단은 매우 어렵다. 현재는 췌장암에 사용할 수 있는 조기 진단 마커가 사실상 없는 상황이다.
조기 췌장암은 종양 크기가 2 cm 미만이며 췌장 내에 국한되어 있고 침윤 및 림프절 전이가 없는 경우로 일반적으로 정의된다. 그러나, 췌장암 크기가 조기 췌장암의 기준인 2 cm미만이라 해도, 50%에 달하는 경우에 전이가 동반되었다. 종양의 크기, 림프절 전이, 원격 전이 여부에 따라 췌장암의 병기를 구분할 때, 조기 췌장암으로 분류하는 제II 병기에서도 상장간막 정맥이나 간문맥 연결 부위에 침윤이 생기는 경우가 많으며, 소수의 세포에 의한 초기 전이가 발견되는 경우가 많다. 이런 경우에는 수술이 불가능하다. 영상학적으로 원격전이가 발견되지 않고 종양이 췌장에 국한되어 있는 것으로 판단되어 수술이 시행된 경우에도, 수술 후 단기간 내에 원격전이가 발견되는 경우가 흔하다. 이 경우 수술을 시행하더라도 재발가능성이 매우 높으며, 효과가 뚜렷한 항암제가 없기 때문에 진단 후 평균 생존율이 6~12개월에 불과하다. 이에, 췌장암 완치를 위한 유일한 방법인 조기 수술적 절제를 위해서라도, 본격적인 원격 전이나, 소수의 세포에 의한 초기 전이 이전의 조기 췌장암을 진단할 필요가 있다.
세포 표면 단백질에 대한 특이적 프로브의 개발은 세포 표면 단백질의 세포 외부 부분만을 재조합 단백질로 분리 정제한 후 이를 항원으로 한 항체를 개발하거나, 앱타머 선택을 위한 소재로 사용될 수 있다. 앱타머 선별을 위한 스크리닝 수행 방법을 일반적으로 SELEX(systematic evolution of ligands by exponential enrichment) 기법이라 부른다. 그러나, 이러한 방법은 재조합 단백질을 분리하여 사용하는 경우가 대부분인데, 이 때 세포 표면 단백질의 삼차원적 구조가 변형될 가능성이 높고, 단백질의 삼차원적 구조가 표적 단백질과의 결합에 중요한 경우 실제 세포 표면의 표적 단백질에는 결합하지 못하는 상황이 생길 수 있다.
기존 SELEX 기법과 달리 살아있는 세포를 이용하여 세포막 특이적으로 앱타머를 선별하는 Cell-SELEX 방법을 사용할 경우에는 이들 한계를 극복할 가능성이 높다.
본 개시에서는 췌장암 세포를 대상으로 Cell-SELEX 방법을 이용하여 췌장암에 높은 결합력을 가지는 DNA 앱타머를 선별하고, 선별된 앱타머에 대하여 세포 및 조직 타겟팅 효율과 혈중 안정성을 높이기 위한 추가 연구를 진행하였고, 췌장암뿐만 아니라 대장암, 간암, 폐암, 뇌종양, 구강암, 난소암 및 유방암 등 다양한 암 종에 특이적으로 결합할 수 있음을 확인하여 본 개시를 완성하였다.
[선행기술문헌]
(특허문헌 1) 대한민국 등록특허 제10-1458947호
(특허문헌 2) 대한민국 등록특허 제10-1250557호
본 개시는 신규한 DNA 앱타머를 제공하는 것을 목적으로 한다. 구체적으로 상기 신규한 DNA 앱타머는 암 특이적으로 결합하는 DNA 앱타머이다.
본 개시의 다른 목적은 암 특이적으로 결합하는 DNA 앱타머를 이용하여 암의 진단 방법 또는 치료 방법을 제공하는데 있다.
본 개시는 암 세포 탐지에 유용한 앱타머를 개발하기 위한 것으로 췌장암 세포막에 특이적으로 결합하는 앱타머를, Cell-SELEX 방법을 이용하여 선별하였다. 구체적으로, 본 개시는 전이된 췌장암 조직으로부터 분리한 표적 세포 CMLu-1을 표적 세포로 사용하고, 정상 췌장 조직 세포 HPNE를 대조군 세포로 사용하여 췌장암 세포에 특이적으로 결합하는 앱타머를 선별하였다.
본 개시는 일 측면에 있어서 서열번호 6의 염기 서열을 포함하는 DNA 앱타머를 제공하며, 본 개시는 일 측면에 있어서, 서열번호 6의 염기 서열과 90% 이상, 또는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함하는 DNA 앱타머를 제공한다. 본 개시의 일 측면에 있어서, DNA 앱타머는 암 특이적으로 결합하는 것일 수 있다. 본 개시의 일 측면에 있어서, DNA 앱타머는 서열번호 6의 염기 서열로 이루어진 것일 수 있다.
또한, 본 개시는 일 측면에 있어서 서열번호 4의 염기 서열과 90% 이상, 또는 95% 이상의 서열 상동성을 가지는 염기 서열로 이루어진 DNA 앱타머를 제공한다. 본 개시의 일 측면에 있어서, DNA 앱타머는 서열번호 4의 염기 서열로 이루어진 것일 수 있다.
본 개시에서, "90% 이상의 서열 상동성을 가지는 염기 서열"이란 일 내지 수개의 뉴클레오티드가 추가, 결실 또는 치환되어 90% 이상 100% 미만의 서열에 공통성이 있는 것으로 유사한 암 특이적 결합능을 보이는 염기 서열을 의미한다.
본 개시의 일 측면에 있어서, 서열번호 4의 염기 서열과 90% 이상의 서열 상동성을 가지는 것은, 서열번호 4의 염기 서열 중 서열번호 6의 염기 서열에 대응되는 위치가 아닌, 다른 위치에서 서열번호 4의 염기 서열과 상이한 염기 서열을 가지는 것을 의미할 수 있다.
본 개시에서 "DNA 앱타머"는 짧은 단일가닥 올리고뉴클레오티드로 높은 친화도와 특이성으로 대상 표적에 결합하는 특성을 가지며, 각기 독특한 3차원 구조를 가지는 것을 의미할 수 있다. 반복된 생체 외 선별 및 농축 과정을 통해 DNA 앱타머 라이브러리로부터 특정 대상 표적에 특이적으로 결합하는 DNA 분자, 즉 DNA 앱타머의 선별이 가능하다.
본 개시의 한 실험예에서, Cell-SELEX 과정을 통해 농축된 DNA 풀의 앱타머 서열을 분석하여 유사한 서열끼리 그룹화한 결과 11개의 앱타머 패밀리(SQ1 내지 SQ11)가 분류되었다. 이 중에서, 췌장암 유래 전이된 암 세포인 CMLu-1에 대해 결합력이 높은 그룹으로 SQ7이 확인되었고, SQ7 패밀리 내에는 일부 염기 서열이 상이한 유사성 높은 서열을 가지는 앱타머도 포함되어 있었다(표 3의 SQ7a 및 SQ7b 앱타머).
또한, 췌장암 조직 유래 세포에 특이적으로 결합하는 SQ7(서열번호 4) 앱타머(80 mer)를 주형으로 합성수율 증진 및 합성비용 절감을 위해 이의 잘라진 형태의 앱타머(32 mer)를 제작하였다. 구체적으로 표적 세포 CMLu-1에의 결합력을 거의 유지하면서도 사이즈를 반 이상으로 줄인 SQ7-1 앱타머를 제작하였다(서열번호 6). 본 개시의 발명자는 해당 SQ7-1 앱타머가 SQ7 앱타머의 서열에서 암세포 및 암 조직 타겟팅 능력에 중요한 기능을 하는 부위인 것으로 판단하고 이를 바탕으로 추가 실험을 진행하였다.
본 개시는 일 측면에 있어서, 상기 본 개시의 DNA 앱타머에 대하여 DNase 저항성을 가지도록 변형이 도입된 변형 DNA 앱타머를 제공하며, 상기 변형이 서열번호 6 중에서 10% 이상의 염기에서 일어나는 것일 수 있고, 해당 DNA 앱타머는 서열번호 8, 12 또는 14 중 어느 한 서열을 갖는 것일 수 있다.
본 개시의 일측면에 있어서, 상기 DNase 저항성을 갖도록 도입되는 변형은 하나 이상의 뉴클레오티드 내 당 구조의 2' 탄소 위치에서 -OH기가 -Me(메틸), -OMe, -NH2, -F(불소), -O-2-메톡시에틸-O-프로필, -O-2-메틸티오에틸(methylthioethyl), -O-3-아미노프로필, -O-3-디메틸아미노프로필, -O-N-메틸아세트아미도 또는 -O-디메틸아미도옥시에틸로의 치환에 의한 변형일 수 있다.
본 개시의 한 실시예에서, SQ7-1 앱타머를 주형으로 하여 SQ7-1 앱타머의 2차 구조에서 영역을 나누어 내부 2'-O-메틸-변형 앱타머(internal 2'-O-methyl-modified aptamers)를 제조하여 이들의 혈청 내 반감기를 측정하여 안정성을 확인하였다. 그 결과 일부 변형 앱타머의 혈청 내 반감기가 SQ7-1 앱타머에 비해 90배 이상 증가하는 것을 확인하였다.
한편, 본 개시의 실시예에서 Cell-SELEX에 사용한 표적 세포는 동소이식 실험을 통해 전이된 췌장암 조직에서 수득한 CMLu-1이었다. 이에 본 개시는 특히 췌장암의 진단에 유용할 수 있다.
본 개시는 상기 앱타머를 포함하는 암 조직 타겟팅용 조성물을 제공한다. 본 개시의 일 측면에 있어서, DNA 앱타머를 포함하는 조성물은 상기 성분에 추가로 동일 또는 유사한 기능을 하는 유효 성분, 또는 조성물 제형을 안정화시키거나 앱타머의 안정성을 증진시키는 성분이 추가로 포함할 수 있다. 본 개시의 일 측면에 있어서, 조성물은 제약 조성물 일 수 있다.
또한, 본 개시는 본 개시의 일측면에 따른 앱타머를 포함하는 암 진단용 조성물을 제공한다.
본 개시의 일 측면에 있어서, DNA 앱타머는 작용제 모이어티와 결합되어 사용될 수 있다.
본 개시의 일 측면에 있어서, 작용제 모이어티는 세포독성제, 면역억제제, 영상화제(예를 들어, 형광단 또는 킬레이터), 나노합성물질 또는 독소 폴리펩티드일 수 있다. 여기서 세포독성제는 화학요법제 일 수 있다.
본 개시는 일 측면에 있어서, 본 개시의 일 측면에 따른 신규 DNA 앱타머 및 상기 DNA 앱타머와 결합된 항암제를 포함하는, 암 치료용 조성물에 관한 것일 수 있다.
본 개시의 일 측면에 있어서, 암은 췌장암, 대장암, 간암, 폐암, 뇌종양, 구강암, 난소암, 또는 유방암일 수 있으나, 이에 제한되는 것은 아니다.
본 개시의 일 측면에 있어서, 항암제는 MMAE(monomethyl auristatin E), MMAF(monomethyl auristatin F), 칼리키마이신(Calicheamicin), 메르탄신(mertansine; DM1), 라브탄신(ravtansine; DM4), 테시린(tesirine; SCX), 독소루비신(Doxorubicin), 시스플라틴(Cisplatin), SN-38, 듀오카르마이신(Duocarmycin), 및 피롤로벤조디아제핀(pyrrolobenzodiazepine; PBD)으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지는 않는다.
본 개시의 일 측면에 있어서, DNA 앱타머는 폴리에틸렌글리콜(PEG) 또는 이의 유도체, 디아실글리세롤(DAG) 또는 이의 유도체, 항체, 덴드리머 또는 쯔비터이온-함유 생체적합성 중합체(예를 들어, 포스포릴콜린 함유 중합체)와 결합된 것일 수 있다.
본 개시의 일 측면에 있어서, 조성물은 생리학적으로 허용 가능한 부형제, 담체, 또는 첨가제를 더 포함할 수 있으며, 이에는 전분, 젤라틴화 전분, 미결정셀룰로오스, 유당, 포비돈, 콜로이달실리콘디옥사이드, 인산수소칼슘, 락토스, 만니톨, 엿, 아라비아고무, 전호화전분, 옥수수전분, 분말셀룰로오스, 히드록시프로필셀룰로오스, 오파드라이, 전분글리콜산나트륨, 카르나우바 납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산알루미늄, 스테아린산칼슘, 백당, 덱스트로스, 소르비톨 및 탈크 등이 사용될 수 있으나, 이에 제한되지 않는다.
한편, 본 개시의 일 측면에 있어서, 조성물은 관련 기술 분야의 통상의 기술자에 의해 이해된 바와 같이 선택된 투여 경로에 따라 다양한 형태로 대상체에 투여될 수 있다. 예를 들어, 국소, 경장 또는 비경구 적용에 의해 투여될 수 있다. 국소 적용은 표피, 흡입, 관장제, 점안제, 점이제 및 신체 내의 점막을 통한 적용을 포함하나, 이에 제한되지 않는다. 경장 적용은 경구 투여, 직장 투여, 질 투여 및 위 영양 공급 튜브 등을 포함한다. 비경구 투여는 정맥내, 동맥내, 피막내, 안와내, 심장내, 피내, 경기관, 각피하, 관절내, 피막하, 지주막하, 척수내, 경막외, 흉골내, 복강내, 피하, 근육내, 경상피, 비강, 폐내, 척수강내, 직장 및 국소 투여 방식을 포함할 수 있다.
아울러, 본 개시의 일 측면에 있어서, 조성물은 투여 경로 등에 따라 적절한 형태로 제제화될 수 있다. 제제화할 경우에는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제 등을 사용하여 조제될 수 있으나, 이에 제한되지 않는다.
본 개시의 일 측면에 있어서, 조성물에는 투여 경로와, 대상체의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 배설률 등에 따라 통상의 기술자가 유효하다고 판단하는 양의 본 개시의 일 측면에 따른 DNA 앱타머가 포함될 수 있다.
본 개시의 암 세포에 높은 결합력을 가지는 것으로 선별되고 최적화된 DNA 앱타머는 표적 세포 및 조직 타겟팅 효율이 증진되고 높은 혈중 안정성을 가져, 암의 진단 및 치료 등에 효과적으로 사용될 수 있다.
도 1은 본 개시의 DNA 라이브러리에 포함된 뉴클레오티드의 형태, 및 이를 증폭 또는 동정하는데 사용될 수 있는 전방 프라이머 및 후방 프라이머 형태에 대한 것이다. 구체적으로 DNA 라이브러리에 포함된 뉴클레오티드는 5'-말단에 20개 일반 뉴클레오티드가 있고, 중반에 40개 무작위 염기 서열을 가지며, 3'-말단에 추가로 20개 일반 뉴클레오티드로 이루어졌다. 전방 프라이머는 5'-말단을 Cy5로 표지하였고(5'-Cy5-서열-3'), 후방 프라이머는 5'-말단을 비오틴으로 표지하였다(5'-비오틴-서열-3').
도 2는 본 개시의 DNA 라이브러리에 포함된, 췌장암 세포 결합력을 가진 ssDNA 풀을 농축시키고 반복횟수에 따라 세포 결합력의 증가 여부를 유세포 분석기(FACS)로 확인한 결과이다.
도 3은 본 개시에서 전이성 췌장암 세포를 이용한 Cell-SELEX 방법을 통해 앱타머를 스크리닝하는 과정을 도식화한 도면이다.
도 4는 본 개시에서 전이성 췌장암 세포를 이용한 Cell-SELEX 방법을 통해 앱타머를 스크리닝하여 얻은 각 Cy5-표지 앱타머 후보들의 세포 결합력을 측정한 결과이다.
도 5는 본 개시에서 전이성 췌장암 세포를 이용한 Cell-SELEX 방법을 통해 앱타머를 스크리닝하여 얻은 SQ7 앱타머의 서열에 따른 2차 구조를 도식화한 도면이다.
도 6a는 본 개시의 SQ7 앱타머의 표적 세포 결합력을 유세포 분석기(FACS)로 확인한 결과이다. 구체적으로 SQ7 앱타머와 대조군으로 미처리 대조예(NT), DNA 풀 라이브러리와 SQ8-Comp 앱타머의 표적 세포 결합력을 측정하였다.
도 6b는 본 개시의 SQ7-1 앱타머의 표적 세포 결합력을 유세포 분석기(FACS)로 확인한 결과이다. 구체적으로 SQ7 앱타머 및 SQ7-1 앱타머와 대조군으로 미처리 대조예(NT), DNA 풀 라이브러리와 SQ8-Comp 앱타머의 표적 세포 결합력을 측정하였다.
도 7는 본 개시의 SQ7 앱타머를 바탕으로 제조한 SQ7-1 앱타머의 2차 구조를 도식화한 도면이다.
도 8은 공초점 현미경을 통해 본 개시의 SQ7 앱타머의 표적 세포에의 타겟팅 양상을 확인한 도면이다. 회색 타원형으로 표시된 부분이 핵을 나타내며, 가장 밝게 하얀 색으로 표시된 부분이 세포 표면에 결합하거나 또는 세포로 내재화된 앱타머를 나타낸다.
도 9는 공초점 현미경을 통해 본 개시의 SQ7-1 앱타머의 표적 세포에의 타겟팅 양상을 확인한 도면이다. 회색 타원형으로 표시된 부분이 핵을 나타내며, 가장 밝게 하얀 색으로 표시된 부분이 세포 표면에 결합하거나 또는 세포로 내재화된 앱타머를 나타낸다.
도 10은 인간 췌장암 세포주의 이종이식 마우스 모델에서, 생체 발광 이미징 실험을 통해 본 개시의 SQ7 앱타머의 췌장암 조직에의 타겟팅 양상을 확인한 도면이다.
도 11은 인간 췌장암 세포주의 이종이식 마우스 모델에서, 생체 발광 이미징 실험을 통해 본 개시의 SQ7-1 앱타머의 췌장암 조직에의 타겟팅 양상을 확인한 도면이다.
도 12a 내지 도 12d는 본 개시의 SQ7-1 앱타머를 기반으로 제조한 내부 2'-O-메틸-변형 앱타머인 SQ7-1(1), SQ7-1(2), SQ7-1(3), SQ7-1(4), SQ7-1(5), SQ7-1(6), 및 SQ7-1(1, 5) 앱타머의 2차 구조 및 변형 위치를 도식화한 도면이다. 도 12a는 내부 2'-O-메틸-변형 영역을 사각형으로 도식화하였고, 도 12b 내지 도 12d는 내부 2'-O-메틸-변형 위치의 각 서열을 구체적으로 개시하였다.
도 13a 내지 도 13d는 본 개시의 SQ7-1, SQ7-1(1), SQ7-1(5), 및 SQ7-1(1,5) 앱타머의 혈청 내 반감기를 측정한 결과이다.
도 14는 본 개시의 SQ7-1, SQ7-1(1), SQ7-1(5), 및 SQ7-1(1,5) 앱타머의 표적 세포 결합력을 유세포 분석기로 측정한 결과이다.
도 15는 인간 췌장암 환자의 췌장암 세포에 대한 이종이식 마우스 모델에서, 생체 발광 이미징 실험을 통해 본 개시의 SQ7-1 앱타머의 췌장암 조직에의 타겟팅 양상을 확인한 도면이다.
도 16a 및 도 16b는 본 개시의 SQ7-1 앱타머의 다양한 췌장암 세포주에 대한 결합력을 유세포 분석기(FACS)로 확인한 결과이다.
도 17은 도 16의 결과를 기초로, SQ7-1-Rev 앱타머에 대한 SQ7-1 앱타머의 상대적인 형광 강도의 기하 평균 값을 배수로 나타낸 그래프이다.
도 18는 본 개시의 SQ7-1 앱타머의 다양한 암 세포주에 대한 결합력을 유세포 분석기(FACS)로 확인한 결과를 기초로, SQ7-1-Rev 앱타머에 대한 SQ7-1 앱타머의 상대적인 형광 강도의 기하 평균 값을 배수로 나타낸 그래프이다.
도 19는 본 개시의 SQ7-1 앱타머의 다양한 췌장암 PDOX-유래 세포주에 대한 결합력을 유세포 분석기(FACS)로 확인한 결과를 기초로, SQ7-1-Rev 앱타머에 대한 SQ7-1 앱타머의 상대적인 형광 강도의 기하 평균 값을 배수로 나타낸 그래프이다.
본 개시는 전술한 측면들 및 후술하는 실험예 또는 실시예를 통해 더욱 명확해질 것이다. 이하에서는 본 개시의 첨부된 표를 참조하여 기술되는 실시예들을 통해 해당 업계의 통상의 기술자가 용이하게 이해하고 구현할 수 있도록 상세히 설명하기로 한다. 그러나, 이들 실험예 또는 실시예는 본 개시를 예시적으로 설명하기 위한 것으로 본 개시의 범위가 이들 실험예 또는 실시예에 한정되는 것은 아니다.
[ 실험예 1] Cell- SELEX를 이용한 앱타머 스크리닝
Cell-SELEX 기법을 이용하여 췌장암 세포 특이적으로 결합하는 앱타머를 스크리닝하기 위한 실험 방법을 도 3에 개략적으로 기재하였다.
상술하면, 먼저 췌장암의 특징적인 세포막 단백질을 표현하는 살아있는 세포주를 얻기 위하여, 췌장암 세포를 동물에 이식하여 암이 전이된 조직으로부터 췌장암 세포주 CMLu-1를 단리하였다 (도 3A).
ssDNA 라이브러리를 제작하고, 이에 대하여 췌장암 세포주인 CMLu-1 세포를 표적 세포(양성 세포)로 사용하였고, 대조군 세포(음성 세포)로 hTERT/HPNE(Human Pancreatic Nestin Expressing cells)를 사용하여 스크리닝하였다. 대조군 세포에는 결합하지 않고 췌장암 세포에만 결합하는 ssDNA 선별과정을 반복하여 선택된 농축된 ssDNA 풀을 클로닝하고 서열분석한 후 그룹화하였다.
(1) 인간 췌장암 세포주의 이종이식 마우스 모델로부터 전이된 췌장암 세포주 구축
전이된 췌장암 세포 CMLu-1은 하기의 방법으로 얻었다. 구체적으로 NOD/SCID 마우스를 이용하여 동소이식(orthotopic) 마우스 모델을 만들었다. 먼저, 췌장암의 전이 상황을 모사(mimic)할 수 있는 동물 모델을 구축함에 있어서, 시기에 따른 종양형성 상황을 비침습적으로 모니터링 할 수 있도록 반딧불이 루시퍼라제(firefly luciferase)가 지속적으로 발현되는 세포주인 췌장암 세포주(CFPAC-1-Luci cells)를 확립하여 사용하였다. 췌장암 세포주 CFPAC-1-Luci를 NOD/SCID 마우스에 동소이식하고, 43일이 지난 후 췌장으로부터 전이된 폐 조직으로부터 종양 조직을 적출하여 유전형 분석(genotyping)을 수행하여 전이된 세포의 유전적 성질이 췌장암 세포와 같다는 것을 확인한 후 단일 세포(single cell)로 분리하여 배양하였다. 전이 종양 조직으로부터 분리해낸 CMLu-1 세포를, 10% 소태아 혈청(FBS, Thermo Fisher Scientific, USA) 및 100 IU/mL의 Anti-Anti (antibiotic-antimycotic; Gibco)을 포함하는 RPMI-1640(Hyclone, Logan, UT, USA) 배지에서 배양·유지하였다.
이렇게 얻은 CMLu-1 세포를 Cell-SELEX에서 양성 선택(positive selection)을 위한 세포로 사용하였고, ATCC Inc.로부터 구입한 인간 췌장관 상피 정상 세포(Human Pancreatic duct Normal Epithelial cells; HPNE)를 음성 선택(negative selection)을 위한 대조군 세포(control cell)로 사용하였다.
(2) ssDNA 라이브러리 제작 및 Cell- SELEX를 위한 프라이머 제작
췌장암-특이적 앱타머 Cell-SELEX 사용을 위한 DNA 라이브러리는 일반 및 독특한 뉴클레오티드의 조합으로 구성된 DNA 서열의 풀(pool)이었다. 5'-말단에 20개 일반 뉴클레오티드가 있고, 중반에 40개 무작위 염기 서열을 가지며, 3'-말단에 추가로 20개 일반 뉴클레오티드로 이루어졌다. 형광-활성화 세포 분류기(Fluorescence-activated cell sorter; "FACS"; 일명, '유세포 분석기')를 이용하여 선택(selection)의 농축을 모니터링하기 위해 5'-말단을 Cy5로 표지하였고, 3'-말단은 ssDNA 정제를 위해 비오틴으로 표지하였다(도 1). 아울러, 전방 프라이머는 5'-말단을 Cy5로 표지하였고(5'-Cy5-서열-3'), 후방 프라이머는 5'-말단을 비오틴으로 표지하였다(5'-비오틴-서열-3'). DNA 라이브러리에 포함된 DNA 형태와 사용되는 전방 및 후방 프라이머의 형태는 하기 표 1과 같다.
DNA 라이브러리뉴클레오티드 형태 (서열번호 1) 5'-ATA CCA GCT TAT TCA ATT -[뉴클레오티드 40(N40)]- AGA TAG TAA GTG CAA TCT-3'
전방 프라이머(forward primer;5'-primer)(서열번호 2) 5'-Cy5- ATA CCA GCT TAT TCA ATT-3'
후방 프라이머(reverse primer;3'-primer)(서열번호 3) 5'-비오틴- AGA TTG CAC TTA CTA TCT-3'
각 용출된 풀을 증폭시키기 위해 PCR이 사용되었다. 스트렙트아비딘-비오틴 결합으로 비오틴화된 상호 보완 가닥을 포획하고, 이중-가닥 DNA는 NaOH로 변성시키는 것을 통해 ssDNA를 분리하였다. PCR 혼합물을 준비하여, 제조사의 지시에 따라 PCR 반응을 수행하였다.
(3) Cell- SELEX (systematic evolution of ligands by exponential enrichment)를 통한 라이브러리 스크리닝
상기 제작된 ssDNA 라이브러리에 대하여 CMLu-1 세포를 표적 세포(양성 세포)로 사용하였고, hTERT/HPNE(Human Pancreatic Nestin Expressing cells)를 대조군 세포(음성 세포)로 사용하여 스크리닝을 수행하였다.
10 nmol의 DNA 라이브러리를 5 mM MgCl2, 0.1 mg/mL tRNA, 및 1 mg/mL 우혈청 알부민을 포함하는 Dulbecco's PBS (Hyclone, USA)인, 결합 완충액(binding buffer) 1,000 μL에 용해시켰다. DNA 라이브러리 또는 농축된 풀을 95 ℃에서 10분간 변성시키고, 얼음 위에서 10분간 냉각시킨 후, 궤도 혼합기(orbital shaker)로 4 ℃ 에서 1시간 동안 CMLu-1 세포와 함께 배양하였다. 붙지 않은 DNA 서열을 제거하기 위해 CMLu-1을 3차례 세척한 후, 결합한 DNA는 1,000 μL 의 결합 완충액을 이용하여 95 ℃에서 15분 동안 원심 분리기를 통해 용출하였다. 대항 선택(counter selection)을 수행하기 위해서, 각 앱타머 풀을 hTERT/HPNE을 1시간 동안 배양하고, 그 후 음성 선택을 수행을 위해 상등액을 채취하였다. 농축된 풀은 FACS를 이용하여 모니터링 되었고, 앱타머 후보를 동정하기 위해 시퀀싱용 퀴아젠 클로닝 키트(Quiagen Cloning Kit for sequencing; Quiagen,Germany)을 이용하여 대장균(Escherichia coli)에 클로닝하였다.
(4) 농축된 ssDNA 풀의 클로닝 및 시퀀싱 및 다중 서열 정렬 분석
후보 서열의 선택을 위해 5번 농축된 ssDNA 풀을 클로닝하고 시퀀싱하였다. ssDNA 풀은 변형되지 않은 프라이머를 이용하여 PCR로 증폭되고, pGEM-T easy vector (Promega, USA)에 라이게이션하고, HITTM-DH5 α 수용 세포(competent cell; Promega, USA)에 클로닝하였다. 이에 따라, 200개의 클로닝된 서열이 코스모진텍 (서울, 한국)을 통해 분석되었고, ClustalX 1.83으로 정렬되었다.
각 농축 횟수에 따른 농축 정도를 확인한 결과는 도 2와 같다.
상기 (1) 내지 (4) 의 과정은 도 3으로 도식화되었다. 이 과정을 통해 서열확인된 앱타머들을 유사한 서열을 가진 앱타머들로 그룹화하였고, 이를 통해 Cy5-표지 앱타머 패밀리 후보 11개(SQ1 내지 SQ11)가 확인되었다. 해당 앱타머 패밀리들의 전체 풀에서의 함량은 하기 표 2와 같았다.
앱타머 패밀리 농축 DNA 풀 내 함량 (%)
SQ1 14.09
SQ2 13.42
SQ3 5.37
SQ4 4.70
SQ5 4.70
SQ6 3.36
SQ7 2.01
SQ8 2.68
SQ9 1.34
SQ10 1.34
SQ11 1.34
[ 실험예 2] 농축된 앱타머 패밀리 후보들의 표적 세포 결합 특이성 확인
실험예 1의 (4)에서 얻어진 농축된 앱타머 패밀리 후보의 CMLu-1 표적 세포 결합 특이성을 유세포 분석(FACS)을 통해 확인하였다.
각 Cy5-표지 앱타머 패밀리 후보들을 3 x 105 CMLu-1 세포 및 hTERT/HPNE 세포와 함께 Cell-SELEX에서 사용된 4℃의 결합 완충액에서 1시간 동안 배양하였다. 세포를 0.1 % NaN3를 포함하는 결합 완충액으로 3차례 세척하고, 결합된 서열을 가지는 펠릿을 결합 완충액에 재현탁시켰다. BD FACSCalliburTM 및 FACSVerseTM (BD Biosciences, USA)을 통해 10,000개의 세포를 측정하여 형광 분석을 진행하였고, 데이터는 FlowJo software v10.0.7을 이용해서 분석하였다.
각 Cy5-표지 앱타머 패밀리 후보들의 타겟 세포 결합력을 측정한 결과는 도 4와 같다. 대상 타겟 세포인 전이된 췌장암 세포(CMLu-1)에 결합 특이성이 가장 높은 앱타머인 SQ7을 확인하였고, 이의 서열은 하기와 같다.
*SQ7 앱타머 서열
5'-AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACCAACTCTTGCCCTATGCGTGCTACCGTGAA-3' (서열번호 4)
한편, 해당 SQ7 패밀리에 포함되었던 앱타머 서열들은 다음과 같다.
SQ7 및 SQ7-서브타입(subtype)의 서열
앱타머 서열 수 %
SQ7 AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACCAACTCTTGCCCTATGCGTGCTACCGTGAA 3 4.03
SQ7a AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACCAACTCTT CT CCTATGCGTGCTACCGTGA(서열번호 15) 1
SQ7b AGCAACACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACC C ACTCTTG T CCTATGCGTGCTACCGTGAA(서열번호 16) 2
[ 실험예 3] SQ7 앱타머 분석 및 앱타머 단편 기능 확인
상기 실시예 2를 통해 선정된 SQ7 앱타머의 서열에 따른 2차 구조를 확인한 결과는 도 5와 같다. 아울러, 세포 결합력을 재확인하기 위하여, SQ7 앱타머와 대조군으로 미처리 대조예(NT), DNA 풀 라이브러리 및 SQ8-Comp 앱타머(SQ8 앱타머와 일부분에서 상보적인 핵산 서열을 가지는 앱타머; 서열번호 5)를 제조하여 표적 세포 결합력을 실험예 2와 동일한 방법으로 FACS를 이용하여 측정하였다. 그 결과는 도 6에서 확인할 수 있는 바와 같이 대조군인 NT, DNA 풀 라이브러리, 및 SQ8-Comp 앱타머는 유사한 수준의 낮은 결합력을 보인 반면, SQ7 앱타머는 표적 세포 결합력이 현저히 우수하였다.
SQ7 앱타머 중 췌장암 특이적 결합에 특히 중요한 부분이 존재하는지 확인하기 위하여 SQ7 앱타머의 일 부분을 포함하는 다양한 앱타머를 제조하여 표적 세포와의 결합력을 확인하였다. 세포 결합력은 유지하면서 전체 앱타머 크기를 줄일 수 있다면, 앱타며 제조 비용은 낮추면서 세포 내 침투력을 증진시킬 수 있을 것이다. 결과적으로 하기 표 4 서열의 SQ7-1 앱타머가 표적 세포 결합력을 거의 유지하면서도 우수한 엔도사이토시스(endocytosis) 능력을 가지는 것을 확인하였다. 이에 추가적으로 SQ7 앱타머, SQ7-1 앱타머, 미처리 대조예(NT), DNA 풀 라이브러리 및 SQ8-Comp 앱타머의 표적 세포 결합력을 실험예 2와 동일한 방법으로 FACS를 이용하여 측정하였다. 그 결과는 도 6b에서 확인할 수 있는 바와 같이 대조군인 NT, DNA 풀 라이브러리, 및 SQ8-Comp 앱타머는 유사한 수준의 낮은 결합력을 보인 반면, SQ7-1 앱타머는 SQ7 앱타머와 유사하게 표적 세포 결합력이 현저히 우수하였다.
해당 SQ7-1 앱타머의 서열은 하기와 같고(서열번호 6) 해당하는 2차 구조는 도 7과 같다. 아울러, 이어지는 실험에서 SQ7-1 앱타머의 대조군으로 사용하기 위해 SQ7-1-Rev 앱타머(SQ7-1의 반대 방향의 서열을 가지는 앱타머; 서열번호 7)를 제조하였다.
앱타머 서열
SQ7 5'-AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTGGAACCAACTCTTGCCCTATGCGTGCTACCGTGAA-3'
SQ7-1 5'-GTTGGTATATACTTCTTTAGCTTGGAACCAAC-3'(서열번호 6)
SQ7-1-Rev 5'-CAACCATATATGAAGAAATCGAACCTTGGTTG-3'(서열번호 7)
[ 실험예 4] 선택된 앱타머의 세포 및 조직 내 효율적인 타겟팅의 확인
(1) 선택된 앱타머의 엔도사이토시스 ( endocytosis ) 효율을 공초점 현미경 이 미징을 통해 확인하였다.
1x104 세포/웰의 대조군 세포(HPNE)와 표적 세포(C-MLu-1)를 poly-L-lysine(Sigma, USA)으로 코팅된 8-웰 챔버 슬라이드(Thermo scientific, USA)에 실험 4시간 전에 플레이팅하였다. 세척 완충액으로 세척한 후에, 4℃의 결합 완충액 200 ul에 Cy5-표지 앱타머(250 nM), 또는 DNA 풀 라이브러리를 첨가하여 배양하였다. 두 차례 세척한 후, 4% 파라포름알데히드를 이용하여 세포를 고정시켰으며, Hoechst33342로 핵을 염색하였다. 이 후, 세포를 공초점 현미경 (LSM780, Carl Zeiss, Germany)를 이용해 영상화하였고, 이미지는 소프트웨어(Zen blue edition)로 분석하였다.
SQ7과 SQ7-1 앱타머의 공초점 현미경 실험 결과는 도 8 및 도 9와 같다. 도면에서 가장 밝게 보이는 하얀색 부분이 앱타머가 많이 모여있는 것을 앱타머를 나타낸다. 도 8 및 도 9에서 보듯이, SQ7 및 SQ7-1 앱타머가 대조군 세포에 비하여 췌장암 세포를 잘 타겟팅하며, 세포 내 엔도사이토시스(내재화)도 잘되는 것을 확인할 수 있었다.
(2) 생체 내( in vivo ) 및 생체 외( ex vivo ) 형광 이미징을 통해 앱타머의 췌장암 타게팅을 확인하였다.
암컷 Hsd : 무흉선 누드-Foxn1 누드 마우스(Athymic nude-Foxn1 nude mice: 6주령)을 Harlan Laboratories, Inc. (프랑스)로부터 구매하였다. 이들을 빛과 습도가 제어되는 조건의 무특이 병원체(specific pathogen free; SPF) 환경에 보관하고, 국립 암센터 동물 시설에서 사료와 물을 공급받았다. 모든 동물 실험은 국립 암센터 연구소(NCCRI, unit number : NCC-16-163D)의 실험동물 운영위원회(Institutional Animal Care and Use Committee; IACUC)로부터 허가받아 진행하였다. NCCRI는 국제 실험 동물 관리 평가 인증 협회로부터 인가된 기관이다.
췌장암의 동소 이종이식 마우스 모델은 ATCC로부터 구입한 CFPAC-1 세포(1x106 세포)를 마우스 췌미(tail of pancreas)에 주사하여 구축하였다. 접종 3주 후에 마우스들은 치료에 따라 두 그룹(Cy5.5-SQ8-Comp 앱타머vs Cy5.5-SQ7 앱타머 또는 Cy5.5-SQ7-1-Rev 앱타머 vs Cy5.5-SQ7-1 앱타머)으로 나뉘고 위의 Cy5.5-표지 앱타머(300 pmol/ 50 ul의 PBS)를 정맥 내 투여하였다.
생체 외 실험을 위해서는, 투여 후 15분 또는 3시간 후 마우스를 희생하여 해부하였다. 종양 조직을 수득하여, IVIS Lumina (Caliper Life Science, Hopkinton, MA, USA)를 이용해 생체 발광 이미징으로 영상화하였다. 모든 영상 데이터는 소프트웨어(Living Image Acquisition and Analysis software)를 이용하여 분석하였다.
SQ7과 SQ7-1 앱타머의 생체 발광 이미징 실험 결과는 도 10 및 도 11의 그레이 스케일(Gray scale) 그림과 같다. 또한 이미징 결과로부터 수득한 전체 플럭스(total flux)를 도 10 및 도 11에 그래프로 나타내었다.
각 도면 상단의 이미징 결과에서는 흰색으로 밝게 나타날수록 세포에 앱타머가 많이 결합하였다는 것을 의미한다. SQ7 및 SQ7-1 앱타머가 다른 앱타머에 비하여 이미징 결과가 흰색으로 나타나는 것을 확인할 수 있다.
따라서 본 개시의 앱타머가 다른 대조군 앱타머(SQ1 앱타머(서열번호 17), SQ8-Comp 앱타머, 및 SQ7-1-Rev 앱타머)들에 비해, 췌장암 조직에 특이적으로 이동하여 결합한다는 것을 확인할 수 있고, 췌장암 조직에 대한 현저히 우수한 타겟팅 효율을 가지는 것을 확인할 수 있었다.
[ 실험예 5 앱타머의 혈청 내 안정성 증진을 위한 변형체 제조 및 확인
상기 실험예를 통해 제조한 SQ7-1 앱타머를 기반으로 앱타머의 혈청 내 안정성을 증진시키기 위해 내부 2'-O-메틸-변형 앱타머(internal 2'-O-methyl-modified aptamers)를 제조하였다. 구체적으로 SQ7-1 앱타머의 2차 구조에서 영역을 나누어 SQ7-1(1), SQ7-1(2), SQ7-1(3), SQ7-1(4), SQ7-1(5), SQ7-1(6), 및 SQ7-1(1, 5) 앱타머를 제조하였다(도 12a 내지 도 12d).
제조한 내부 2'-O-메틸-변형 앱타머의 서열을 정리하면 하기 표 5와 같다.
앱타머 서열 2'-O-메틸-변형된 [A,G,C,U] 개수
SQ7-1 5'-GTTGGTATATACTTCTTTAGCTTGGAACCAAC-3'(서열번호 6) 0
SQ7-1(1) 5'-[2'-O-Methyl(G)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(G)][2'-O-Methyl(G)][2'-O-Methyl(U)]ATATACTTCTTTAGCTTGGAACCAAC-3'(서열번호 8) 6
SQ7-1(2) GTTGGT[2'-O-Methyl(A)][2'-O-Methyl(U)][2'-O-Methyl(A)][2'-O-Methyl(U)][2'-O-Methyl(A)]CTTCTTTAGCTTGGAACCAAC(서열번호 9) 5
SQ7-1(3) GTTGGTATATACT[2'-O-Methyl(U)][2'-O-Methyl(C)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(U)]AGCTTGGAACCAAC(서열번호 10) 5
SQ7-1(4) GTTGGTATATACTTCTTTAG[2'-O-Methyl(C)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(G)][2'-O-Methyl(G)][2'-O-Methyl(A)]ACCAAC(서열번호 11) 6
SQ7-1(5) GTTGGTATATACTTCTTTAGCTTGGA[2'-O-Methyl(A)][2'-O-Methyl(C)][2'-O-Methyl(C)][2'-O-Methyl(A)][2'-O-Methyl(A)][2'-O-Methyl(C)](서열번호 12) 6
SQ7-1(6) GTTGGT[2'-O-Methyl(A)][2'-O-Methyl(U)][2'-O-Methyl(A)][2'-O-Methyl(U)][2'-O-Methyl(A)][2'-O-Methyl(C)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(C)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(A)][2'-O-Methyl(G)][2'-O-Methyl(C)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(G)][2'-O-Methyl(G)][2'-O-Methyl(A)]ACCAAC(서열번호 13) 20
SQ7-1(1,5) [2'-O-Methyl(G)][2'-O-Methyl(U)][2'-O-Methyl(U)][2'-O-Methyl(G)][2'-O-Methyl(G)][2'-O-Methyl(U)]ATATACTTCTTTAGCTTGGA[2'-O-Methyl(A)][2'-O-Methyl(C)][2'-O-Methyl(C)][2'-O-Methyl(A)][2'-O-Methyl(A)][2'-O-Methyl(C)](서열번호 14) 12
이렇게 제조한 5 ug의 내부 2'-O-메틸-변형 앱타머를 37 ℃에서 마우스 혈청에 0, 0.1, 0.5, 2, 6, 및 24 시간 동안 배양하였다. 각각의 시점에 샘플들에 DNase 활성을 멈추기 위하여 0.5 M EDTA를 첨가하였고, EtOH-NaOAc를 첨가하여 침전시켰다. DNA-앱타머- 침전물 샘플들은 HPLC로 분석하였다.
크로마토그래피 분석은 가변 파장 측정기(variable wavelength detector; VWD)인 Quatpump이 장착된 Waters e2695 HPLC system(MA, USA)에서 수행되었다. LC를 위한 Empower3 personal single system software를 장착한 개인용 컴퓨터를 크로마토그래프 데이터를 처리하는데 사용하였다. 분석물들은 Agela Technologies In. (베이징, 중국)으로부터 구매한 Venusil, XBP C18 컬럼(250 mm x 4.6 mm, 5 um)를 이용하여 분리되었다. 이동상은 메탄올-물(55:45, 부피비) 혼합물이고, 유속은 0.5 mL/분이었다. 컬럼 온도는 30 ℃이고, 측정 파장은 260 nm였다. Shanghai GaoGe Industrial and Trading Co., Ltd. (상하이, 중국)에서 구매한 15 uL LC 마이크로시린지를 주사로 사용하였다.
그 결과 SQ7-1(1), SQ7-1(5), 및 SQ7-1(1,5) 앱타머의 반감기가 현저히 증가하였다. 구체적으로 도 13에서 보듯이 SQ7-1(1), SQ7-1(5), 및 SQ7-1(1,5) 앱타머의 반감기가 SQ7-1 앱타머에 비해 각각 91배, 145배, 및 760배 증가하는 것을 확인하였다. 이들의 표적 세포에 대한 결합력은 SQ7-1 앱타머에 비해 다소 감소하였으나, DNA 풀 라이브러리(그래프 제일 왼쪽의 가는 실선)에 비해서는 확연히 구별될 정도로 높았다(도 14).
정리하면, 상기 언급한 대로 본 개시에 따른 DNA 앱타머는 췌장암에 높은 결합력을 갖고 특이적으로 결합하는 특징을 가지며, 선별된 앱타머의 사이즈를 줄여 표적 세포 또는 조직에 대한 타겟팅 효율을 높이고, DNase에 대한 저항성을 증진시키는 변형을 통해 혈중 안정성을 높일 수 있음을 확인하였다.
[ 실험예 6] 인간 환자 췌장암 조직의 마우스 동소 이종이식 모델(Patient-Derived Orthotopic Xenograft Model; PDOX 모델)에서의 타겟팅 확인
본 개시의 앱타머가 환자 종양 조직의 복잡성(complexity) 및 이질성(heterogeneity)을 반영할 수 있는 환자-유래 동소 이종이식 모델("PDOX 모델")에서도 우수한 타겟팅 효율을 가지는지 확인하기 위하여 형광 이미징을 이용한 생체 내(in vivo) 검증 실험을 수행하였다.
국립암센터 의생명연구심의위원회(Institutional Review Board; "IRB")의 심의를 거친 후, 연구에 동의한 환자를 대상으로 검체를 확보하여 누드 마우스(Harlan Laboratories, Inc. (프랑스)로부터 구매함) 췌장에 직접 이식한 환자-유래 동소 이종이식 모델 (patient-derived orthotopic xenograft, PDOX)을 제작하였다. 췌장암 환자의 원발성 종양검체(이하 "HPT"로 명명함)는 수술적 절제 직후에, 수술이 불가능한 진행성 췌장암 환자의 경우는 환자로부터 간 전이 조직 생검 검체(이하 "GUN"로 명명함)를 채취한 직후에, 배지에 담긴 튜브에 담아 이동하여 최대한 신속하게 암컷 Hsd: 무흉선 누드-Foxn1 누드 마우스(실험예 4와 동일하게 입수)의 췌장의 췌미에 절제 및 봉합하여 이식하였다(PDOX 1세대, F1). 이후 주기적으로 복부 촉진 및 MRI 영상 장비를 통하여 종양의 크기를 측정하였고, 종양의 크기가 3000 mm3에 도달하면, 마우스를 희생하여 종양 조직을 수득한 후, 일정크기 (3 mm * 3 mm * 3 mm)의 종양조직을 여러 개체의 누드마우스에 동소 재이식하여 다음 세대(F2, F3, F4..) 형성시키고 개체 수를 증폭하였다.
4세대(F4)에서 구축된 환자-유래 동소 이종이식 마우스 모델을 세 마리씩 두 그룹으로 나누어, 각각 Cy5.5가 표지된 앱타머(300 pmol/ 50 ul의 PBS)인 SQ7-1 앱타머와 SQ7-1-Rev 앱타머를 정맥 투여하였다. 투여 15분 후 마우스를 희생한 후 해부하여 종양 조직을 수득한 후, IVIS Lumina (Caliper Life Science, Hopkinton, MA, USA)를 이용해 생체 발광 이미징으로 영상화하였다. 모든 영상 데이터는 소프트웨어(Living Image Acquisition and Analysis software)를 이용하여 분석하였다. 생체 발광 이미징 실험 결과는 도 15의 그레이 스케일(Gray scale) 그림과 같으며, 이미징 결과로부터 수득한 전체 플럭스(total flux)를 도 15에 그래프로 나타내었다.
도 10 및 도 11에서와 같이, 도 15에서도 도면 상단의 이미징 결과에서는 흰색으로 밝게 나타날수록 세포에 앱타머가 많이 결합하였다는 것을 의미하며, SQ7-1 앱타머는 SQ7-1-Rev 앱타머에 비하여 흰색 수준이 매우 높은 것을 확인할 수 있다.
즉, 본 개시의 앱타머는 환자 종양 조직의 복잡성(complexity) 및 이질성(heterogeneity)을 보유하고 있는 PDOX 모델에서도 현저히 우수한 타겟팅 효율을 가지고 있음을 확인할 수 있었다.
[ 실험예 7] 다양한 췌장암 세포주에서의 결합능 확인
다양한 종류의 췌장암 세포주에 대한 본 개시의 앱타머의 결합능을 확인하기 위해 추가적인 유세포 분석(FACS) 실험을 수행하였다.
[항체 결합 앱타머의 제조]
항체 결합 앱타머의 제조를 위하여 디그옥시제닌(Digoxigenin)으로 표지된 250 nM 농도의 SQ7-1 압타머와 125 nM 농도의 항-디그옥시제닌-항체(Abcam; Cat. No. ab420, USA)를 함께 넣어 상온에서 30분간 섞어주었다.
실험예 2와 동일한 방법으로 유세포 분석을 수행하되, 상기 제조한 항체 결합 앱타머를 사용하였고, 2차 항체(secondary antibody)는 알렉사(Alexa) 488로 표지된 항-마우스-이뮤노글로블린 G (anti-mouse IgG) (Invitrogen, USA)를 4 μg/ml 농도로 사용하였다. 세포는 CFPAC-1 세포주, SNU-213 세포주, SNU-410 세포주, Capan-2 세포주, HPAF-II 세포주, AsPC-1 세포주, Capan-1 세포주, MIA PaCa 세포주, BxPC-3 세포주, 및 PANC-1 세포주를 각각 이용하였다. 이러한 세포주는 모두 ATCC 로부터 구입하였다.
다양한 췌장암 세포주에 대한, 앱타머들의 결합력을 측정한 결과를 도 16 및 도 17에 나타내었다. 도 17는 SQ7-1-Rev 앱타머에 대한 SQ7-1 앱타머의 상대적인 형광 강도의 기하 평균 값을 배수로 나타낸 것이다.
도 16 및 17의 결과에 따르면 본 개시의 SQ7-1 앱타머는 SQ7-1-Rev 앱타머에 비하여, 모든 췌장암 세포주에 대해 더 우수하고 특이적으로 결합하는 것을 확인할 수 있다. 앞서 살핀 실험예 4 및 6의 결과와 종합하면, 본 개시의 앱타머는 다양한 유형의 췌장암 세포에 특이적으로 결합할 것임을 확인할 수 있다.
더불어 SQ7 앱타머는 SQ7-1 앱타머를 포함하는 것이므로, 마찬가지로 다양한 유형의 췌장암 세포에 특이적으로 결합할 것이다.
[ 실험예 8] 다양한 암종 세포주에서의 결합능 확인
다양한 암종의 세포주에 대한 본 개시의 앱타머의 결합능을 확인하기 위해 추가적인 유세포 분석(FACS) 실험을 수행하였다.
실험예 2와 동일한 방법으로 유세포 분석을 수행하되, 실험예 7에서 사용한 항체 결합 앱타머와 2차 항체를 동일하게 사용하였다. 세포는 U87 세포주, U251 세포주, CAL27 세포주, HEP3B 세포주, A549 세포주, HCT116 세포주, SK-OV3 세포주, ES-2 세포주, MCF7 세포주, SK-BR3 세포주, NCI-N87 세포주, KPL4 세포주, BT-474 세포주, MDA-MB231 세포주, 및 HCC1938 세포주를 각각 이용하였다. 이러한 세포주는 모두 ATCC 로부터 구입하였다.
다양한 암 세포주에 대한, 앱타머들의 결합력을 측정한 결과를 도 18에 나타내었다. 도 18는 SQ7-1-Rev 앱타머에 대한 SQ7-1 앱타머의 상대적인 형광 강도의 기하 평균 값을 배수로 나타낸 것이다.
도 18의 결과에 따르면 본 개시의 SQ7-1 앱타머는 SQ7-1-Rev 앱타머에 비하여, 다양한 암 세포주, 즉 대장암, 간암, 폐암, 뇌종양, 구강암, 난소암 및 유방암 세포주에 대해 더 우수하고 특이적으로 결합하는 것을 확인할 수 있다. 앞서 살핀 실험예 4 및 6의 결과와 종합하면, 본 개시의 앱타머는 다양한 유형의 암 세포에 특이적으로 결합할 것임을 확인할 수 있다.
더불어 SQ7 앱타머는 SQ7-1 앱타머를 포함하는 것이므로, 마찬가지로 다양한 유형의 암 세포에 특이적으로 결합할 것이다.
[ 실험예 9] 췌관 선암종의 PDOX -유래 세포주에서의 결합능 확인
본 개시의 앱타머가, 실제 임상 환자의 췌장암 세포에 특이적으로 잘 결합 할 수 있는 가능성을 가지는지 여부를 확인하기 위해, 추가적인 유세포 분석(FACS) 실험을 수행하였다.
한정된 세포 분열 후 사멸하는 정상세포와는 달리 암세포는 무한분열의 특성을 가지고 있으므로 종양조직으로부터 분리된 암세포는 형질전환 없이도 무한증식이 가능한 세포주를 형성할 수 있으며 환자의 임상적, 분자생물학적 특성을 반영할 수 있다고 여겨진다. 본 실험에서, 췌장암 PDOX 마우스로부터 적출한 종양조직을 3 mm * 4 mm로 조각 낸 후, 세포를 결합조직으로부터 분리해내기 위하여 콜라게나제(collagenase)가 포함된 Human cell dissociation kit(Miltenyi Biotech Inc.)과 혼합하여 조직해리장치(Gentle Macs, Miltenyi Biotech Inc)에서 1시간 동안 반응시킨다. 반응 종료 후, 소태아혈청(fetal bovine serum; FBS)이 포함된 RPMI 배지로 효소활성을 억제하고, 이어 원심 분리하면 조직으로부터 해리된 세포의 침전물을 얻을 수 있다. 소태아혈청이 포함된 RPMI 배지로 이를 현탁하여 10cm 배양접시에 2 x106 개 수준으로 세포를 고르게 깔고 이틀마다 배지를 교환하면서 정상 섬유아세포와 죽은 세포들을 제거하여 췌장암 환자별 PDOX유래 암세포주를 확립하였다. 확립된 각 세포주의 명명은 유래한 PDOX의 명명과 동일하다.
간 전이 환자 생검 조직을 이용한 PDOX 모델(GUN#13, GUN#16, GUN#20, GUN#34, GUN#38, GUN#41 및 GUN#46), 초음파 내시경 미세 검체를 이용한 PDOX 모델(EUS#16), 및 수술적 절제 검체를 이용한 PDOX 모델(HPT#19, HPT#22, HPT#43, HPT#45, 및 HPT#48)의 종양조직으로부터 분리한 암세포주를 대상으로 실험예 2와 동일한 방법으로 유세포 분석을 수행하되, 실험예 7에서 사용한 항체 결합 앱타머를 동일하게 사용하였다.
다양한 PDOX-유래 세포주에 대한, 앱타머들의 결합력을 측정한 결과를 도 19에 나타내었다. 도 19는 SQ7-1-Rev 앱타머에 대한 SQ7-1 앱타머의 상대적인 형광 강도의 기하 평균 값을 배수로 나타낸 것이다.
도 19의 결과에 따르면 본 개시의 SQ7-1 앱타머는 SQ7-1-Rev 앱타머에 비하여, 여러 환자로부터 얻은 췌장암 조직으로부터 유래한 다양한 PDOX-유래 세포주에 대해 더 우수하고 특이적으로 결합하는 것을 확인할 수 있다. 앞서 살핀 실험예 4 및 6의 결과와 종합하면, 본 개시의 앱타머는 실제 임상에서 환자의 췌장암 조직에 특이적으로 결합할 것임을 확인할 수 있다.
더불어 SQ7 앱타머는 SQ7-1 앱타머를 포함하는 것이므로, 마찬가지로 환자의 췌장암 조직에 특이적으로 결합할 것이다.
이상 일부 실시예들과 첨부된 도면에 도시된 예에 의해 본 개시의 기술적 사상이 설명되었지만, 본 개시가 속하는 기술 분야에서 통상의 지식을 가진 자가 이해할 수 있는 본 개시의 기술적 사상 및 범위를 벗어나지 않는 범위에서 다양한 치환, 변형 및 변경이 이루어질 수 있다는 점을 알아야 할 것이다. 또한, 그러한 치환, 변형 및 변경은 첨부된 청구범위 내에 속하는 것으로 생각되어야 한다.

Claims (15)

  1. 서열번호 6의 염기 서열과 90% 이상의 서열 상동성을 가지는 염기 서열을 포함하는 DNA 앱타머.
  2. 제1항에 있어서,서열번호 6의 염기 서열을 포함하는 DNA 앱타머.
  3. 제1항에 있어서,상기 앱타머는 DNase에 저항성을 가지도록 변형이 일어난 것을 특징으로 하는 DNA 앱타머.
  4. 제3항에 있어서,상기 변형은 하나 이상의 뉴클레오티드 내 당 구조의 2' 탄소 위치에서 -OH기가 -Me(메틸), -OMe, -NH2, -F(불소), -O-2-메톡시에틸-O-프로필, -O-2-메틸티오에틸(methylthioethyl), -O-3-아미노프로필, -O-3-디메틸아미노프로필, -O-N-메틸아세트아미도 또는 -O-디메틸아미도옥시에틸로의 치환에 의한 변형인 것인 DNA 앱타머.
  5. 제3항에 있어서,상기 변형은 서열번호 6 중에서 10% 이상의 염기에서 일어나는 것인 DNA 앱타머.
  6. 제3항에 있어서,상기 DNA 앱타머는 서열번호 8, 12 또는 14 중 어느 한 서열을 갖는 것인 DNA 앱타머.
  7. 제1항에 있어서,서열번호 4의 염기 서열과 90% 이상의 서열 상동성을 가지는 염기 서열로 이루어진 DNA 앱타머.
  8. 제1항에 있어서,서열번호 4의 염기 서열로 이루어진 DNA 앱타머.
  9. 제1항 내지 제8항 중 어느 한 항에 따른 DNA 앱타머를 포함하는, 암 조직 타겟팅용 조성물.
  10. 제1항 내지 제8항 중 어느 한 항에 따른 DNA 앱타머를 포함하는, 암 진단용 조성물.
  11. 제1항 내지 제8항 중 어느 한 항에 따른 DNA 앱타머를 포함하는, 암 치료용 조성물.
  12. 제11항에 있어서, 상기 암은 췌장암, 대장암, 간암, 폐암, 뇌종양, 구강암, 난소암, 또는 유방암인, 암 치료용 조성물.
  13. 제11항에 있어서, 상기 DNA 앱타머와 결합된 항암제를 더 포함하는, 암 치료용 조성물.
  14. 제13항에 있어서, 상기 항암제가 MMAE(monomethyl auristatin E), MMAF(monomethyl auristatin F), 칼리키마이신, 메르탄신, 라브탄신, 테시린, 독소루비신, 시스플라틴, SN-38, 듀오카르마이신, 및 피롤로벤조디아제핀으로 이루어진 군으로부터 선택된 하나 이상인 것인, 암 치료용 조성물.
  15. 제11항에 있어서, 상기 DNA 앱타머는 폴리에틸렌글리콜(PEG) 또는 이의 유도체, 디아실글리세롤(DAG) 또는 이의 유도체, 덴드리머, 항체 또는 포스포릴콜린 함유 중합체와 결합된 것인, 암 치료용 조성물.
PCT/KR2019/009956 2018-12-21 2019-08-08 신규한 dna 앱타머 및 이의 용도 WO2020130269A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP19900348.4A EP3901287A4 (en) 2018-12-21 2019-08-08 NEW DNA APTAMER AND ITS USE
JP2021536744A JP7391971B2 (ja) 2018-12-21 2019-08-08 新規のｄｎａアプタマー及びこれの用途
US17/416,858 US20220090081A1 (en) 2018-12-21 2019-08-08 Novel dna aptamer and use thereof
CN201980092801.6A CN113646442A (zh) 2018-12-21 2019-08-08 新型dna适配体及其用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180167948 2018-12-21
KR10-2018-0167948 2018-12-21

Publications (1)

Publication Number Publication Date
WO2020130269A1 true WO2020130269A1 (ko) 2020-06-25

Family

ID=71100532

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2019/001416 WO2020130225A1 (ko) 2018-12-21 2019-02-01 췌장암 특이적으로 결합하는 dna 앱타머 및 이의 용도
PCT/KR2019/009956 WO2020130269A1 (ko) 2018-12-21 2019-08-08 신규한 dna 앱타머 및 이의 용도

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/001416 WO2020130225A1 (ko) 2018-12-21 2019-02-01 췌장암 특이적으로 결합하는 dna 앱타머 및 이의 용도

Country Status (6)

Country Link
US (1) US20220090081A1 (ko)
EP (1) EP3901287A4 (ko)
JP (1) JP7391971B2 (ko)
KR (1) KR102324242B1 (ko)
CN (1) CN113646442A (ko)
WO (2) WO2020130225A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020130225A1 (ko) * 2018-12-21 2020-06-25 국립암센터 췌장암 특이적으로 결합하는 dna 앱타머 및 이의 용도
KR102506295B1 (ko) 2020-08-28 2023-03-08 국립암센터 디그옥시제닌에 대한 인간화 항체 및 이의 용도
KR102506288B1 (ko) * 2020-09-07 2023-03-06 국립암센터 디그옥시제닌에 대한 항체를 포함하는 복합체, 및 이들의 용도

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101189790B1 (ko) * 2009-06-01 2012-10-11 성균관대학교산학협력단 췌장암 세포 또는 조직에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도
KR101250557B1 (ko) 2011-05-18 2013-04-03 국립암센터 Ｐａｕｆ 특이적 앱타머 및 이를 포함하는 췌장암 치료용 조성물
KR101458947B1 (ko) 2013-03-05 2014-11-12 국립암센터 인터루킨-８ 앱타머 및 이의 용도
KR101568400B1 (ko) * 2012-08-09 2015-11-12 연세대학교 산학협력단 암 줄기세포에 특이적으로 결합하는 핵산 앱타머 및 이의 용도
KR101699105B1 (ko) * 2012-04-02 2017-01-23 성균관대학교산학협력단 Ａｌｐｐｌ２ 단백질을 이용한 췌장암 진단 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7041517B2 (ja) * 2015-10-30 2022-03-24 エージェンシー フォー サイエンス，テクノロジー アンド リサーチ 癌細胞に結合するｄｎａアプタマー
WO2020130225A1 (ko) * 2018-12-21 2020-06-25 국립암센터 췌장암 특이적으로 결합하는 dna 앱타머 및 이의 용도
KR102506295B1 (ko) * 2020-08-28 2023-03-08 국립암센터 디그옥시제닌에 대한 인간화 항체 및 이의 용도
KR102506288B1 (ko) * 2020-09-07 2023-03-06 국립암센터 디그옥시제닌에 대한 항체를 포함하는 복합체, 및 이들의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101189790B1 (ko) * 2009-06-01 2012-10-11 성균관대학교산학협력단 췌장암 세포 또는 조직에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도
KR101250557B1 (ko) 2011-05-18 2013-04-03 국립암센터 Ｐａｕｆ 특이적 앱타머 및 이를 포함하는 췌장암 치료용 조성물
KR101699105B1 (ko) * 2012-04-02 2017-01-23 성균관대학교산학협력단 Ａｌｐｐｌ２ 단백질을 이용한 췌장암 진단 방법
KR101568400B1 (ko) * 2012-08-09 2015-11-12 연세대학교 산학협력단 암 줄기세포에 특이적으로 결합하는 핵산 앱타머 및 이의 용도
KR101458947B1 (ko) 2013-03-05 2014-11-12 국립암센터 인터루킨-８ 앱타머 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DANIELS, D. A. ET AL.: "A tenascin-C aptamer identified by tumor cell SELEX. Systematic evolution of ligands by exponential enrichment", PNAS, vol. 100, no. 26, 23 December 2003 (2003-12-23), pages 15416 - 1 5421, XP002341306, DOI: 10.1073/pnas.2136683100 *
DUA, P. ET AL.: "Alkaline phosphatase ALPPL-2 is a novel pancreatic carcinoma-associated protein", THERAPEUTICS, TARGETS, AND CHEMICAL BIOLOGY, vol. 73, no. 6, 15 March 2013 (2013-03-15), pages 1934 - 1945, XP055628388, DOI: 10.1158/0008-5472.CAN-12-3682 *
KIM, INHU: "Development of New-concept Anti-tumor Drugs through Construction of Aptamer-antibody Complex Platform Technology", RESEARCH REPORT, 10 November 2016 (2016-11-10), National Cancer Center, pages 1 - 39 *
See also references of EP3901287A4

Also Published As

Publication number Publication date
WO2020130225A1 (ko) 2020-06-25
US20220090081A1 (en) 2022-03-24
EP3901287A4 (en) 2022-10-26
JP2022516054A (ja) 2022-02-24
JP7391971B2 (ja) 2023-12-05
EP3901287A1 (en) 2021-10-27
KR102324242B1 (ko) 2021-11-11
KR20200078303A (ko) 2020-07-01
CN113646442A (zh) 2021-11-12

Similar Documents

Publication Publication Date Title
WO2018124835A1 (ko) 신규 엑소좀 계열 항암제
WO2020130269A1 (ko) 신규한 dna 앱타머 및 이의 용도
EP2673004B1 (en) Hydrophobic modified peptides and their use for liver specific targeting
Karampelas et al. GnRH-Gemcitabine conjugates for the treatment of androgen-independent prostate cancer: pharmacokinetic enhancements combined with targeted drug delivery
TWI838345B (zh) 外顯子18及/或外顯子21突變型egfr之選擇性抑制劑
CN110023333B (zh) 高亲和力的可溶性pd-1分子
JP2020535171A (ja) 去勢抵抗性前立腺癌
WO2018085460A2 (en) Compositions and methods for cell delivery
WO2014046423A1 (ko) 종양선택적 투과기능성을 가지는 펩타이드 및 그 용도
WO2022005179A1 (ko) 혈액-뇌 장벽 침투 압타머 및 이의 이용
KR102579284B1 (ko) 신규의 cd47 바인더와 폴리뉴클레오티드를 포함하는 암 치료를 위한 리포좀 복합체
CN108350459A (zh) 结合癌细胞的dna适配体
TWI837266B (zh) L718及/或l792突變型治療抗性egfr抑制劑
WO2020180144A1 (ko) 트레일 트라이머와 암표적 펩타이드를 멀티디스플레이하는 페리틴 나노케이지 및 이의 항암제로서의 용도
WO2021010534A1 (ko) 신규한 dna 앱타머 및 이의 용도
US20190083638A1 (en) Niclosamide-conjugated polypeptide nanoparticles
WO2022139071A1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
WO2022034946A1 (ko) 항암활성을 갖는 면역조절 단백질-siRNA 복합체
WO2022139070A1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
WO2022065724A1 (ko) 암 치료를 위한 cd47 바인더 및 리포좀 복합체
WO2022086058A1 (ko) Pd-l1 결합 펩타이드 1을 융합한 페리틴 나노케이지 및 이의 항암면역치료제로서의 용도
WO2023132380A1 (ko) 5'-뉴클레오티다아제 변형 단백질을 암호화하는 암 치료를 위한 폴리뉴클레오티드
WO2024196072A1 (ko) Lag-3에 결합하는 펩타이드 및 이의 용도
WO2022065725A1 (ko) 5'-뉴클레오티다아제 변형 단백질을 암호화하는 암 치료를 위한 폴리뉴클레오티드
WO2023014193A1 (ko) 비천연 핵산 리간드를 유효성분으로 포함하는 삼중음성 유방암의 치료를 위한 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19900348

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021536744

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019900348

Country of ref document: EP

Effective date: 20210721