WO2020122430A1 - Expression system for hyaluronic acid production using non-pathogenic bacteria and hyaluronic acid production method using same expression system - Google Patents

Expression system for hyaluronic acid production using non-pathogenic bacteria and hyaluronic acid production method using same expression system Download PDF

Info

Publication number
WO2020122430A1
WO2020122430A1 PCT/KR2019/015082 KR2019015082W WO2020122430A1 WO 2020122430 A1 WO2020122430 A1 WO 2020122430A1 KR 2019015082 W KR2019015082 W KR 2019015082W WO 2020122430 A1 WO2020122430 A1 WO 2020122430A1
Authority
WO
WIPO (PCT)
Prior art keywords
hyaluronic acid
expression system
promoter
strain
gene
Prior art date
Application number
PCT/KR2019/015082
Other languages
French (fr)
Korean (ko)
Inventor
고건
최영준
이인현
장준희
이한원
이한구
Original Assignee
대화제약 주식회사
(주)리독스바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190016267A external-priority patent/KR102152625B1/en
Application filed by 대화제약 주식회사, (주)리독스바이오 filed Critical 대화제약 주식회사
Priority to CN201980077146.7A priority Critical patent/CN113166735A/en
Publication of WO2020122430A1 publication Critical patent/WO2020122430A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins

Definitions

  • the present invention relates to an expression system using a constitutive expression promoter for producing hyaluronic acid using a non-pathogenic bacterium, a non-pathogenic bacterium comprising the expression system, and a method for producing hyaluronic acid using the same.
  • Hyaluronic acid is a biopolymer composed of disaccharide units of D-gluconic acid and N-acetyl-D-glucosamine, according to molecular weight, filler for molding, and treatment for arthritis And anti-adhesion agents.
  • the hyaluronic acid may be produced through fermentation of the Streptococcus spp. strain, and the Streptococcus strain is an infectious microorganism, and there is a possibility that pyrogens and the like are contaminated in the purification process.
  • a method of producing hyaluronic acid by transforming a GRAS (Generally Recognized As Safe) strain with a recombinant vector has been developed.
  • An object of the present invention is to provide an expression system or recombinant vector capable of synthesizing hyaluronic acid without a derivative in a non-pathogenic strain.
  • Another object of the present invention is to provide a method for producing hyaluronic acid using the strain and the strain transformed by the recombinant vector or the strain into which the expression system is introduced.
  • the present invention is an expression system for production of hyaluronic acid comprising a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene, preferably, a operably linked transcription promoter, a hyaluronic acid synthase gene UDP-glucose 6 -Dehydrogenase gene ribosome binding site (RBS), UDP-glucose 6- It provides an expression system for producing hyaluronic acid containing a 6-dehydrogenase gene.
  • the present inventors tried to make a system for constant expression with high production yield of hyaluronic acid (constitutive expression system), and selected optimal promoters through various promoter selection as described below, and also tuaD in an operon composed of hasA gene and tuaD gene
  • RBS ribosome binding sites
  • An example of the present invention relates to an expression system for producing hyaluronic acid, comprising a transcription promoter, a ribosome binding site, a UDP-glucose 6-dihydrogenase gene, and a hyaluronic acid synthase gene, which are operably linked.
  • the UDP-glucose 6-dehydrogenase gene and the hyaluronic acid synthase gene preferably constitute one operon, and more preferably, the hyaluronic acid synthase gene sequentially in the 5'to 3'direction, UDP-glucose RBS of the 6-dehydrogenase gene and UDP-glucose 6-dehydrogenase gene may be linked.
  • Another embodiment of the present invention relates to a transforming strain for producing hyaluronic acid, preferably a non-pathogenic bacterium, comprising the expression system for producing hyaluronic acid.
  • a further example relates to a hyaluronic acid-producing transforming strain comprising the expression system for producing hyaluronic acid, preferably a composition for producing hyaluronic acid comprising non-pathogenic bacteria.
  • the present invention relates to a method for producing hyaluronic acid comprising the step of culturing a transforming strain for producing hyaluronic acid, preferably a non-pathogenic bacterium, comprising the expression system for producing hyaluronic acid.
  • the expression system for producing hyaluronic acid according to the present invention improves the production yield of hyaluronic acid and the molecular weight of hyaluronic acid, increases the safety in synthesizing hyaluronic acid, and reduces production cost by not using expensive IPTG derivatives.
  • the hyaluronic acid produced according to the present invention has a merit of excellent moisturizing effect, viscosity increase, joint lubrication action, water absorption ability, elastic ability, etc. in a molecular weight range of 500 kDa to 10000 kDa.
  • An example of the present invention is an expression system for producing hyaluronic acid, preferably comprising a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene. It relates to an expression system for producing hyaluronic acid comprising a transcriptional promoter, a ribosome binding site (RBS), a UDP-glucose 6-dehydrogenase gene, and a hyaluronic acid synthase gene, which are operably linked.
  • RBS ribosome binding site
  • the expression system for producing hyaluronic acid includes both the UDP-glucose 6-dihydrogenase and hyaluronic acid synthase gene necessary for the synthesis of hyaluronic acid, and provides the RBS and constitutive expression promoters required for expression of the genes. By providing, it is possible to produce hyaluronic acid without a separate derivative.
  • the expression system for producing hyaluronic acid according to the present invention may be applied to a strain of the genus Bacillus, and may be, for example, Bacillus subtilis or Bacillus licheniformis, but is not limited thereto.
  • the transcription promoter applicable to the expression system of the present invention may be a constitutive expression promoter used in Bacillus strains, and the expression system produces hyaluronic acid synthase that is always expressed without an expression inducer.
  • the transcription promoter may be one having a high transcription level having a hyaluronic acid production amount of 1.1 to 10 times compared to a transformed strain having an expression system including the P43 promoter.
  • the constant expression promoter may be, for example, P43, Pmsm, Ppbp, Pylb, Pyob, Pyqe or Pyvl, preferably Psigx, Pyob, or Pyqe, but is not limited thereto, and compared to an inducible promoter. Any similar or high hyaluronic acid yield can be obtained and used without limitation.
  • the Psigx promoter may be obtained by PCR from the genome of Bacillus subtilis 168 strain (Bacillus Genetic Stock Center) with primers of SEQ ID NOs: 53 and 54.
  • the Psigx, Pyob, or Pyqe promoter may each include a nucleotide sequence of SEQ ID NO: 62, SEQ ID NO: 63, or SEQ ID NO: 64, respectively.
  • Specific examples of the promoters usable in the present invention are shown in Table 1 below, and specific primer sets used for the production of each promoter are shown in Table 2 below.
  • the hyaluronic acid yield was almost the same as when using an inducible promoter requiring an IPTG derivative (FIG. 4). Accordingly, it can be seen that the Psigx promoter is a promoter for constant expression suitable for hyaluronic acid production.
  • the transcription promoter is 1.1 to 10 times, 1.15 to 10 times, 1.5 to 10 times, 2 to 10 times, 3 to 10 times, 4 to 10 times the hyaluronic acid production amount compared to a transformed strain having an expression system containing the P43 promoter.
  • Pear 5-10 times, 1.1-9 times, 1.15-9 times, 1.5-9 times, 2-9 times, 3-9 times, 4-9 times, 5-9 times, 1.1-8 times, 1.15-8 Pear, 1.5-8 times, 2-8 times, 3-8 times, 4-8 times, 5-8 times, 1.1-7 times, 1.15-7 times, 1.5-7 times, 2-7 times, 3-7 Pear, 4 to 7 times, 5 to 7 times, 1.1 to 6.5 times, 1.15 to 6.5 times, 1.5 to 6.5 times, 2 to 6.5 times, 3 to 6.5 times, 4 to 6.5 times, 5 to 6.5 times, 1.1 to 6 times Pear, 1.15 to 6 times, 1.5 to 6 times, 2 to 6 times, 3 to 6 times, 4 to 6 times, 5 to 6 times, 1.1 to 5.5 times, 1.15 to 5.5 times, 1.5 to 5.5 times, 2 to 5.5 times It may be a fold, 3 to 5.5 fold, 4 to 5.5 fold, or 5 to 5.5 fold promoter.
  • the ribosome binding site (RBS) applicable to the expression system of the present invention is capable of producing hyaluronic acid in Bacillus by expressing the tuaD gene together with the hasA gene.
  • the RBS may be capable of translating the UDP-glucose 6-dehydrogenase coding gene to a high level, and the ribosome binding site is 1.1 to 3 times, 1.15 to 3 times, and 1.2 to 1 when compared with the tuaD RBS.
  • the RBS, BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035, RBS of the tuaD gene (tuaD RBS), or may be RBS of the pET plasmid, each comprising a nucleotide sequence of SEQ ID NOs: 65-72 It may be, and if specifically indicated, it is as shown in Table 3 below.
  • BBa_B0034 when BBa_B0034 was used as RBS, it exhibited a better yield than when using tuaD RBS, and unlike BBA_B0035 was previously known to exhibit superior expression efficiency compared to BBa_B0034, the BBa_B0034 RBS sequence was used. When shown, the highest yield of hyaluronic acid was produced (FIG. 5).
  • the expression system for hyaluronic acid production includes a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene, and the two The gene is preferably composed of one operon, more preferably 5'to 3'direction sequentially hyaluronic acid synthase gene, RBS and UDP-glucose 6-di of UDP-glucose 6-dehydrogenase gene It may be an operon to which the hydrogenase gene is linked.
  • the UDP-glucose 6-dehydrogenase gene according to the present invention may be, for example, a tuaD gene or a variant thereof.
  • the tuaD gene may be a tuaD gene derived from a species known to have a tuaD gene, without limitation, and may be, for example, a Bacillus strain, preferably a tuaD gene derived from Bacillus subtilis.
  • the tuaD gene may be a tuaD gene of Bacillus subtilis 2217 strain, but is not limited thereto, and may be a tuaD gene into which an appropriate mutation is introduced, if necessary, of UDP-glucose 6-dehydrogenase. It can be freely modified and used within a range that does not affect the activity.
  • the tuaD gene may include the nucleotide sequence of SEQ ID NO: 73.
  • the ribosomal binding site and tuaD were obtained from a Bacillus subtilis 2217 strain through a polymerase chain reaction (PCR) using primer pairs of SEQ ID NOs: 37 and 38.
  • the hyaluronic acid synthase gene may be, for example, a hasA gene or a variant gene thereof.
  • the hasA gene may use a hasA gene derived from a species known to have a hasA gene without limitation, for example, a strain of the genus Streptococcus, preferably a strain derived from Streptococcus juepidemicus.
  • the mutant gene of the hasA gene may include a mutation on all genes in a range in which hyaluronic acid synthesis activity is maintained.
  • the hasA gene may be a gene encoding a protein consisting of the amino acid sequence of SEQ ID NO: 74 or 76, and preferably may include the nucleotide sequence of SEQ ID NO: 75 or 77.
  • a hasA gene is obtained through a PCR-based two-step DNA synthesis method using the primers of SEQ ID NOs: 1 to 36 (Table 4) from Streptococcus jupipidemicus. Did.
  • DNA fragments 1 were prepared using primers of SEQ ID NOs: 1 to 12, and DNA fragments 2 and 3 were produced using SEQ ID NOs: 12 to 24 and SEQ ID NOs: 25 to 36, respectively.
  • the obtained DNA fragment 1, fragment 2 and fragment 3 were mixed and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36.
  • An example of the present invention may be a transformation strain or a recombinant strain for producing hyaluronic acid, including the expression system for producing hyaluronic acid.
  • the strain may be a GRAS grade strain, and may be a Gram-positive bacterium, for example, Bacillus strain, preferably Bacillus subtilis or Bacillus licheniformis .
  • Bacillus strain preferably Bacillus subtilis or Bacillus licheniformis
  • the expression system for producing hyaluronic acid was introduced into the Bacillus subtilis 2217 strain to obtain a hyaluronic acid producing strain without a derivative such as IPTG.
  • the present invention relates to a method for producing hyaluronic acid using a non-pathogenic bacterium comprising culturing a transforming strain for producing hyaluronic acid containing the hyaluronic acid expression system. More specifically, the method for producing hyaluronic acid according to the present invention may further include the step of separating and/or purifying hyaluronic acid in addition to the step of culturing the transforming strain for producing hyaluronic acid, for example, in a culture medium. The method may include removing the strain and precipitating hyaluronic acid in the culture medium from which the strain is removed.
  • a transcription promoter In the transforming strain for producing hyaluronic acid and the method for producing hyaluronic acid, a transcription promoter, a hyaluronan synthase gene, a ribosome binding site for UDP-glucose 6-dehydrogenase gene expression, and UDP-glucose 6-di Hydrogenase genes and the like are as described above.
  • the method for producing hyaluronic acid using the recombinant strain according to the present invention may exhibit a hyaluronic acid yield equal to or higher than that of using an inducible promoter through an expression promoter at all times without a derivative such as IPTG.
  • the step of culturing the strain may use sucrose as a carbon source, but is not limited thereto.
  • the culture of the strain, the removal of the strain and the precipitation step of hyaluronic acid can be performed by methods known in the art, and can be used by appropriate modifications by a person skilled in the art as necessary.
  • the method of producing hyaluronic acid may further include a step of concentration, purification, or concentration and purification of hyaluronic acid after the precipitation step of hyaluronic acid.
  • the hyaluronic acid obtained using the above production method may have a molecular weight of 100 to 10,000 kDa, 500 to 10,000 kDa, 500 to 8,000 kDa, 3,000 to 8,000 kDa, or 5,000 to 6,000 kDa.
  • a hyaluronic acid having a maximum peak of 5,455 kDa from Bacillus bacteria incorporating the hyaluronic acid synthesis system.
  • the polymer hyaluronic acid has excellent properties such as moisturizing effect, viscosity increase, joint lubrication, water absorption ability, elasticity, etc., compared to low molecular hyaluronic acid. Therefore, high-molecular hyaluronic acid has high utility value as a medicine, such as injections for knee joints, eye drops, and fillers for molding.
  • ultra-high molecular weight hyaluronic acid of 3000 kDa or higher such as hyaluronic acid produced by using the expression system provided by the present invention, can be used as an anti-adhesion agent due to a slow decomposition rate in the body.
  • the strain for synthesizing hyaluronic acid of the present invention is a non-pathogenic strain, which increases safety during hyaluronic acid synthesis, and does not use expensive IPTG derivatives as an expression inducing agent, thereby reducing production costs.
  • 1 shows a vector map of the pHCMC02-hasA-RBS34-tuaD plasmid prepared according to an example of the present invention.
  • Figure 2 is a schematic diagram of the cloning process for the production of pHCMC02-hasA-RBS34-tuaD plasmid prepared according to an example of the present invention.
  • FIG. 3 is a graph showing the concentration of hyaluronic acid produced after introducing an expression system including various promoters into a Bacillus strain according to an embodiment of the present invention.
  • FIG. 4 is a graph showing the concentration of hyaluronic acid produced in the case of using the always-expressing promoter Psigx and the IPTC-inducing promoter Pgrac according to an embodiment of the present invention.
  • FIG. 5 is a graph showing the relative concentration of hyaluronic acid produced when various ribosome binding sites are used according to an embodiment of the present invention.
  • FIG. 6 is a diagram showing the results of infrared spectrum analysis of hyaluronic acid purified from a culture of a recombinant strain according to an example of the present invention and a commercially available hyaluronic acid standard.
  • Streptococcus zooepidemicus-derived hyaluronic acid synthase gene (hasA, Genbank No. AY173078 base sequences 1 to 1254) (SEQ ID NO: 75) shows the primers from SEQ ID NOS: 1 to 36 shown in Table 4 It was synthesized by PCR-based two-step DNA synthesis (PTDS; Xiong, 2004, Nucleic Acids Research 32:e98). Specifically, DNA fragments 1 were prepared using SEQ ID NOs: 1 to 12, and DNA fragments 2 and 3 were prepared using SEQ ID NOs: 13 to 24 and 25 to 36, respectively.
  • the obtained DNA fragment 1, fragment 2 and fragment 3 were mixed and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36 to obtain the hasA gene.
  • PCR conditions were performed 25 times in total for 15 seconds at 94°C, 15 seconds at 55°C, 15 minutes at 55°C, and stretching at 72°C for 1 minute and 30 seconds using Veriti® Thermal Cycler (applied biosystem).
  • Veriti® Thermal Cycler applied biosystem.
  • As the hyaluronic acid synthase gene a hasA gene derived from Streptococcus jupie epidemius was used, and the full length hasA gene was obtained using primers (SEQ ID NO: 4) of SEQ ID NOS: 1 to 36 in the manner described above.
  • the obtained full-length hasA gene was digested with restriction enzymes BamHI and XbaI, and linked to a pHCMC02 (Bacillus Genetic Stock Center) plasmid digested with BamHI and XbaI using T4 DNA ligase (NEB).
  • the vector was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pHCMC02-hasA was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin.
  • the obtained plasmid pHCMC02-hasA was confirmed that the normal hasA gene was cloned through sequencing.
  • the DNA of Bacillus subtilis 2217 strain (Bioresource Center (KCTC)) is used as a template for the RBS_tuaD_forward primer of SEQ ID NO: 37 and SEQ ID NO: 38.
  • RBS_tuaD_reverse primer the tuaD gene was amplified to include RBS34 (BioBrick BBa_B0034) at the 5'-end of the tuaD gene. PCR was performed 30 times in total by denaturing at 94°C for 15 seconds, binding at 55°C for 15 seconds, and stretching at 72°C for 1 minute and 30 seconds using a Veriti® Thermal Cycler (applied biosystem).
  • SEQ ID NO: 37 5'-aatctagaaagaggagaaatactagatgaaaaaatagctgtcattgg-3'
  • SEQ ID NO: 38 5'-gggttataaattgacgcttcccaagtctttagccaatt-3'
  • the amplified RBS34-tuaD gene was digested with restriction enzymes XbaI, and linked to pBluescriptII SK+ (Stratagene) plasmids cut with XbaI and SmaI using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pBSIISK-RBS34-tuaD was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The obtained plasmid pBSIISK-RBS34-tuaD was analyzed by sequencing to Genbank No. It was confirmed that the base sequences of AF015609 3599 to 4984 bp (protein coding region of the tuaD gene, SEQ ID NO: 73) were cloned normally.
  • the pBSIISK-RBS34-tuaD obtained in Example 1-2 was digested with restriction enzymes XbaI and SmaI, and the truncated RBS34-tuaD gene was treated with the same restriction enzyme.
  • the pHCMC02-hasA plasmid obtained in 1-1 was ligated using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pHCMC02-hasA-RBS34-tuaD plasmid was isolated from the ampicillin resistant transformant obtained by plating on a plate medium containing ampicillin.
  • 1 and 2 show schematic diagrams of the vector map and cloning process for the pHCMC02-hasA-RBS34-tuaD, respectively.
  • Example 2 Selection of a promoter for the expression of hasA-tuaD operon
  • the expression of the hasA-tuaD operon is regulated by the PlepA promoter, which is known to have weak activity. Accordingly, the promoter having high hasA-tuaD operon expression activity was selected by replacing the PlepA promoter with various promoters.
  • the candidate promoters were selected as those having higher expression activity than P43, which is a constitutive expression promoter used in Bacillus strains (Yu, 2015, Scientific Reports, 5:18405; Song, 2016, PLoS One. 11:e0158447).
  • each promoter was amplified by PCR using the primers shown in Table 2 above as a template for Bacillus subtilis 168 strain DNA (Bacillus Genetic Stock Center). Specifically, forward and reverse primers of the PP43 promoter (SEQ ID NOs: 39 and 40), forward and reverse primers of the Pmsm promoter (SEQ ID NOs: 41 and 42), forward and reverse primers of the Ppbp promoter (SEQ ID NOs: 43 and 44), Forward and reverse primers of the Pylb promoter (SEQ ID NOs: 45 and 46), forward and reverse primers of the pyob promoter (SEQ ID NOs: 47 and 48), forward and reverse primers of the Pyqe promoter (SEQ ID NOs: 49 and 50), and Pyvl promoter Forward and reverse primers (SEQ ID NOs: 51 and 52), forward and reverse primers (SEQ ID NOs: 53 and 54) of the Psigx promoter were used.
  • Each promoter amplified through PCR was digested with restriction enzymes NheI and BamHI, and linked to pHCMC02-hasA-RBS34-tuaD of Example 1 digested with the same restriction enzyme using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and each plasmid was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. Through sequencing, it was confirmed that each promoter was cloned normally into each isolated plasmid.
  • Plasmids having different promoters were introduced into the Bacillus 2217 strain by electroporation (Sun, 2015, Applied Microbiology and Biotechnology, 99:5151-5162) to prepare transforming strains having chloroamphenicol resistance.
  • each transformed strain was inoculated into LB medium and cultured overnight. 50 mL of 50 mM potassium phosphate (pH7.) containing 20 mL sucrose medium (50 g sucrose per 1 L, 20 g yeast extract, 1.5 g magnesium sulfate (MgSO4)) in a 250 mL Erlenmeyer flask containing 0.2 mL of overnight cultured strain. After inoculation at 0)), the cells were shaken and cultured at 180 rpm at a temperature of 37° C. Each culture was taken at 65 hours after the start of culture, and centrifuged at 10,000 rpm for 1 minute, and then passed through a 0.45 ⁇ m filter to remove the strain.
  • 50 mM potassium phosphate pH7.
  • sucrose medium 50 g sucrose per 1 L, 20 g yeast extract, 1.5 g magnesium sulfate (MgSO4)
  • MgSO4 magnesium sulfate
  • hyaluronic acid was precipitated by centrifugation at 15,000 rpm for 10 minutes at a temperature of 4°C. After drying the precipitated hyaluronic acid and dissolving it in water, the hyaluronic acid content was measured using a HA quantitative Test Kit (Corgenix, Riverside, CO, USA), and containing P43, which is a constant expression promoter.
  • the content of hyaluronic acid produced by the transformed strain (g/L) is set to 100, and the content of hyaluronic acid produced by the transformed strain containing the test promoter is relatively displayed, and the percentages thereof are shown in Table 5 and FIG. 3. Showed.
  • the Psigx promoter of the pSigx-hasA-RBS34-tuaD plasmid was used as the IPTG-derived Pgrac Pgrac-hasA-RBS34-tuaD was produced by replacing with a promoter.
  • the pHT01 plasmid (Mobitec) was cut with restriction enzymes NheI and BamHI to separate the Laci and Pgrac promoters, and the T4 DNA was cut into pSigx-hasA-RBS34-tuaD with the same restriction enzyme removed to remove the Psigx promoter. Connection was made using ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the Pgrac-hasA-RBS34-tuaD plasmid was isolated from an ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The isolated plasmid was introduced into the Bacillus 2217 strain by electroporation, and a transformant strain having chloramphenicol resistance was completed.
  • Each strain was cultured in substantially the same manner as in Example 2, and the culture solution was taken at 65 hours of culture. However, in the case of the IPTG-derived type, the strain cultured overnight was inoculated into sucrose medium to induce the expression of syntheses, and IPTG was added so that IPTG became 0.5 mM after 2 hours, and in the case of the induced type, the culture solution was taken at 72 hours. Did.
  • the results of measuring the hyaluronic acid production of the two strains in substantially the same manner as in Example 2 are shown in FIG. 4.
  • Example 4 RBS screening for overexpression of tuaD gene
  • D-glucuronic acid is a component of hyaluronic acid and can be produced by the tuaD gene originally possessed by Bacillus, but over-expression of the tuaD gene is required for efficient hyaluronic acid production.
  • the hasA gene and the tuaD gene are produced in the form of an operon to induce overexpression of the tuaD gene together with the hasA gene.
  • a highly active RBS sequence exists at the 5'end of the tuaD gene, and thus the translation of the tuaD gene must be controlled.
  • RBS Since the activity of RBS is sequence context-dependent to the surrounding sequence, it may vary according to the sequence of the gene to be regulated (Mutalik, 2013, Nature Methods, 10:347-353). For this reason, it is advantageous for the translation of the actual tuaD, and as a result, an RBS selection process suitable for hyaluronic acid production was performed.
  • RBS RBS screening
  • 6 synthetic RBSs BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035
  • native RBS tuaD RBS
  • RBS plasmids commonly used as pET RBS
  • Table 8 shows the 8 RBS sequences tested.
  • PCR was performed using the DNA of Bacillus subtilis 168 strain (Bacillus Genetic Stock Center) as a template using the primers shown in Table 4 and SEQ ID NO: 38. .
  • the tuaD gene containing each amplified RBS was digested with XbaI, and then cut with XbaI and SmaI to connect pSigx-hasA-RBS34-tuaD plasmid with RBS34-tuaD removed using T4 DNA ligase (NEB).
  • NEB T4 DNA ligase
  • Plasmids having different RBSs obtained above were introduced into Bacillus subtilis 2217 strain by electroporation, and transformed strains having chloroamphenicol resistance were prepared. Next, the method and practical method of Example 2 were prepared. In the same way, each transformed strain was cultured and the culture solution was taken to measure the hyaluronic acid content, and the content (g/L) of the hyaluronic acid produced by the transformed strain using RBS of the pET plasmid was set to 100, The hyaluronic acid content produced by the transformed strain containing the test RBS sequence is relatively displayed, and the results are shown in Table 7 and FIG. 5.
  • BBa_B0035 has more expression efficiency compared to BBa_B0034 (corresponding to RBS of Example 1-2). It is known to be excellent.
  • the expression system according to the present invention confirmed the highest yield of hyaluronic acid production when using the BBa_B0034 RBS sequence.
  • the hyaluronic acid produced in the same manner as the method described in Example 2 was purified through ultrafiltration, and then the molecular weight was measured.
  • the process of purifying the produced hyaluronic acid is as follows.
  • the culture solution was centrifuged at 10,000 rpm for 10 minutes and then passed through a 0.45 ⁇ m filter to remove the strain.
  • the culture solution from which the strain was removed was filtered through an ultrafiltration membrane having a cut-off value of 100 kDa to obtain a product.
  • Cetyl trimethyl ammonium bromide was added to a concentration of 1% (v/v) in the obtained total product, followed by stirring and centrifuging for 1 hour (7,000 rpm, 30 minutes) to obtain a precipitate.
  • the precipitate was dissolved in a 0.25M sodium iodide solution for 10 minutes and dissolved to allow cetyl trimethyl ammonium bromide to react with iodine and sodium.
  • the reaction solution was centrifuged (7,000 rpm, 30 minutes) and the supernatant was taken to remove the reactant of cetyl trimethyl ammonium bromide and sodium iodide.
  • Purified samples were obtained by adding 2% activated carbon to the supernatant and stirring for 1 hour to adsorb impurities and passing through a 0.22 ⁇ m filter.
  • the purified sample was confirmed to be consistent with the hyaluronic acid standard (sigma) through an infrared spectrum, and the spectrum analysis results are shown in FIG. 6.
  • the molecular weight of the purified hyaluronic acid showed a peak in the range of 1,000 to 7,000 kDa belonging to the ultra-high molecular range, and the main peak was measured at 5,455 kDa.
  • the polymer hyaluronic acid has excellent properties such as moisturizing effect, viscosity increase, joint lubrication, water absorption ability, elasticity, etc., compared to low molecular hyaluronic acid.
  • the decomposition rate in the body is slow and may be used as an anti-adhesion agent.

Abstract

The present invention provides a hyaluronic acid synthase expression system that enables the synthesis of hyaluronic acid in non-pathogenic strains and constitutive expression even in the absence of an inducing agent, a transformed strain containing the expression system, and a hyaluronic acid production method using the transformed strain.

Description

비병원성 세균을 이용하여 히알루론산 생산을 위한 발현 시스템 및 상기 발현 시스템을 이용한 히알루론산 생산방법Expression system for producing hyaluronic acid using non-pathogenic bacteria and method for producing hyaluronic acid using the expression system
본 발명은 비병원성 세균을 이용하여 히알루론산을 생산하기 위한 항시 발현 프로모터(constitutive expression promoter)를 이용한 발현 시스템, 상기 발현 시스템을 포함하는 비병원성 세균, 및 이를 이용한 히알루론산의 생상방법에 관한 것이다.The present invention relates to an expression system using a constitutive expression promoter for producing hyaluronic acid using a non-pathogenic bacterium, a non-pathogenic bacterium comprising the expression system, and a method for producing hyaluronic acid using the same.
히알루론산은 D-글루쿠론산(D-gluconic acid)과 N-아세틸-D-글루코사민(N-acetyl-D-glucosamine)의 이당체단위로 이루어진 생체 고분자로 분자량에 따라, 성형용 필러, 관절염 치료제 및 유착방지제 등 다양한 용도로 활용되고 있다. Hyaluronic acid is a biopolymer composed of disaccharide units of D-gluconic acid and N-acetyl-D-glucosamine, according to molecular weight, filler for molding, and treatment for arthritis And anti-adhesion agents.
이러한, 히알루론산은 스트렙토코커스 속(Streptococcus spp.) 균주의 발효를 통해 생산할 수 있는데, 스트렙토코커스 속 균주는 감염성 미생물로 발열성 물질 등이 정제과정에서 오염될 가능성이 있다. 이러한 점을 개선하고자, GRAS(Generally Recognized As Safe) 균주를 재조합벡터로 형질전환시켜 히알루론산을 생산하는 방법이 개발되었다. The hyaluronic acid may be produced through fermentation of the Streptococcus spp. strain, and the Streptococcus strain is an infectious microorganism, and there is a possibility that pyrogens and the like are contaminated in the purification process. To improve this point, a method of producing hyaluronic acid by transforming a GRAS (Generally Recognized As Safe) strain with a recombinant vector has been developed.
등록특허 10-0879908 과 등록특허 10-0885163 (US 2003/175902)에서는 항시발현용 프로모터 (바실러스 아밀로리쿼파시엔스(Bacillus amyloliquefaciens) 알파-아밀라제 유전자 (amyQ) 프로모터)에 의해 조절되는 오페론 (스트렙토코커스 에퀴시미리스(Streptococcus equisimilis) 유래의 히알루론산 합성효소 유전자 (hasA), 바실러스 서브틸리스(Bacillus subtilis) 유래의 UDP-글루코스 6-디하이드로제나아제(UDP-glucose 6-dehydrogenase) 유전자 (tuaD) 및 UDP-글루코스 피로포스포리라아제 (UDP-glucose pyrophosphorylase, gtaB)로 구성)을 바실러스 서브틸리스 게놈에 삽입시켜 히알루론산 생산이 가능하게 하였다.In Patent Nos. 10-0879908 and 10-0885163 (US 2003/175902), the operon (Streptococcus) regulated by the promoter for constant expression ( Bacillus amyloliquefaciens alpha-amylase gene (amyQ) promoter) Hyaluronic acid synthase gene ( hasA ) from Streptococcus equisimilis , UDP-glucose 6-dehydrogenase gene from Bacillus subtilis (tuaD) And UDP-glucose pyrophosphorylase (consisting of UDP-glucose pyrophosphorylase (gtaB)) into the Bacillus subtilis genome to enable hyaluronic acid production.
이후, US2016/0237465에서는 히알루론산 생산 수율과 히알루론산 분자량을 향상시키고자, IPTG 유도용이며 강력한 프로모터 (Pgrac)에 의해 조절되는 오페론 (스트렙토코커스 쥬에피데미쿠스 유래의 hasA 유전자와 바실러스 서브틸리스 유래의 tuaD 유전자로 구성)을 포함하는 플라스미드를 이용하여 바실러스 서브틸리스를 형질전환하였고, 향상된 수율과 분자량을 보인 바 있다. Then, in US2016/0237465, in order to improve the hyaluronic acid production yield and hyaluronic acid molecular weight, the operon (Streptococcus jupiidemicus-derived hasA gene and Bacillus subtilis derived from IPTG induction and regulated by a powerful promoter (Pgrac)) Bacillus subtilis was transformed using a plasmid comprising the tuaD gene of .), and improved yield and molecular weight were shown.
하지만, IPTG유도형의 경우 고가의 유도체 IPTG를 사용해야 할 뿐 아니라, 유도체 처리를 위한 생산공정이 추가적으로 이루어져야 한다. 그러므로, 히알루론산 수율이 낮지 않다면 항시 발현 형태가 보다 바람직하다.However, in the case of the IPTG-derived type, not only the expensive derivative IPTG must be used, but also a production process for the treatment of the derivative must be additionally performed. Therefore, the expression form is always preferred if the hyaluronic acid yield is not low.
본 발명의 목적은 비병원성 균주에서 유도체 없이 히알루론산을 합성할 수 있는 발현 시스템 또는 재조합 벡터를 제공하는 것이다.An object of the present invention is to provide an expression system or recombinant vector capable of synthesizing hyaluronic acid without a derivative in a non-pathogenic strain.
본 발명의 또 다른 목적은 상기 발현 시스템이 도입된 균주 또는 상기 재조합 벡터에 의하여 형질전환된 균주 및 상기 균주를 이용한 히알루론산의 제조 방법을 제공하는 것이다.Another object of the present invention is to provide a method for producing hyaluronic acid using the strain and the strain transformed by the recombinant vector or the strain into which the expression system is introduced.
본 발명은 UDP-글루코스 6-디하이드로제나아제 유전자 및 히알루론산 합성효소 유전자를 포함하는 히알루론산 생산용 발현 시스템, 바람직하게는, 작동 가능하도록 연결된, 전사 프로모터, 히알루론산 합성효소 유전자 UDP-글루코스 6-디하이드로제나아제 유전자의 리보솜 결합부위(RBS), UDP-글루코스 6-디하이드로제나아제 유전자를 포함하는 히알루론산 생산용 발현 시스템을 제공한다. The present invention is an expression system for production of hyaluronic acid comprising a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene, preferably, a operably linked transcription promoter, a hyaluronic acid synthase gene UDP-glucose 6 -Dehydrogenase gene ribosome binding site (RBS), UDP-glucose 6- It provides an expression system for producing hyaluronic acid containing a 6-dehydrogenase gene.
본 발명자들은 히알루론산 생산 수율이 높은 항시 발현용 시스템(constitutive expression system)을 만들고자 노력하여, 후술할 바와 같이 다양한 프로모터 선별을 통해 최적의 프로모터를 선별하였으며, 또한 hasA 유전자와 tuaD 유전자로 구성된 오페론에서 tuaD 유전자 발현에 필요한 다양한 리보솜 인식서열 (ribosome binding site, RBS)을 비교한 결과 적합한 서열을 확인하였다. 그 결과, IPTG유도형의 Pgrac 프로모터를 사용할 때에 비해 히알루론산 생산 효율이 높은 프로모터와 RBS로 구성된 히알루론산 생산용 발현 시스템 및 이를 포함하는 비병원성 균주를 제작하고 이를 이용하여 히알루론산을 생산하는 방법을 개발하여, 본 발명을 완성하였다.The present inventors tried to make a system for constant expression with high production yield of hyaluronic acid (constitutive expression system), and selected optimal promoters through various promoter selection as described below, and also tuaD in an operon composed of hasA gene and tuaD gene As a result of comparing various ribosome binding sites (RBS) required for gene expression, appropriate sequences were identified. As a result, an expression system for producing hyaluronic acid composed of a promoter and RBS having a high production efficiency of hyaluronic acid and a non-pathogenic strain comprising the same, and a method for producing hyaluronic acid using the same, are developed when using the IPTG-derived Pgrac promoter. Thus, the present invention was completed.
본 발명의 일예는 작동 가능하도록 연결된, 전사 프로모터, 리보솜 결합부위, UDP-글루코스 6-디하이드로제나아제 유전자 및 히알루론산 합성효소 유전자를 포함하는, 히알루론산 생산용 발현 시스템에 관한 것이다. 상기 UDP-글루코스 6-디하이드로제나아제 유전자 및 히알루론산 합성효소 유전자는 하나의 오페론을 구성하는 것이 바람직하며, 더욱 바람직하게는 5'에서 3'방향으로 순차적으로 히알루론산 합성효소 유전자, UDP-글루코스 6-디하이드로제나아제 유전자의 RBS 및 UDP-글루코스 6-디하이드로제나아제 유전자가 연결된 것일 수 있다.An example of the present invention relates to an expression system for producing hyaluronic acid, comprising a transcription promoter, a ribosome binding site, a UDP-glucose 6-dihydrogenase gene, and a hyaluronic acid synthase gene, which are operably linked. The UDP-glucose 6-dehydrogenase gene and the hyaluronic acid synthase gene preferably constitute one operon, and more preferably, the hyaluronic acid synthase gene sequentially in the 5'to 3'direction, UDP-glucose RBS of the 6-dehydrogenase gene and UDP-glucose 6-dehydrogenase gene may be linked.
본 발명의 또다른 일예는 상기 히알루론산 생산용 발현 시스템을 포함하는 히알루론산 생산용 형질전환 균주, 바람직하게는 비병원성 세균에 관한 것이다. Another embodiment of the present invention relates to a transforming strain for producing hyaluronic acid, preferably a non-pathogenic bacterium, comprising the expression system for producing hyaluronic acid.
추가 일예는, 상기 히알루론산 생산용 발현 시스템을 포함하는 히알루론산 생산용 형질전환 균주, 바람직하게는 비병원성 세균을 포함하는 히알루론산 생산용 조성물에 관한 것이다. 또한, 본 발명은, 상기 히알루론산 생산용 발현 시스템을 포함하는 히알루론산 생산용 형질전환 균주, 바람직하게는 비병원성 세균을 배양하는 단계를 포함하는 히알루론산의 생산방법에 관한 것이다. A further example relates to a hyaluronic acid-producing transforming strain comprising the expression system for producing hyaluronic acid, preferably a composition for producing hyaluronic acid comprising non-pathogenic bacteria. In addition, the present invention relates to a method for producing hyaluronic acid comprising the step of culturing a transforming strain for producing hyaluronic acid, preferably a non-pathogenic bacterium, comprising the expression system for producing hyaluronic acid.
본 발명에 따른 히알루론산 생산용 발현 시스템은 히알루론산 생산 수율과 히알루론산 분자량을 향상시키며, 히알루론산 합성시의 안전성이 증가하며, 값비싼 IPTG 유도체를 사용하지 않아 생산 비용 절감 효과를 가진다. 본 발명에 따라 생산된 히알루론산은 분자량이 500kDa 내지 10000kDa범위로서 보습 효과, 점도 상승, 관절 윤활 작용, 수분 흡수 능력, 탄성 능력 등이 우수한 장점이 있다. The expression system for producing hyaluronic acid according to the present invention improves the production yield of hyaluronic acid and the molecular weight of hyaluronic acid, increases the safety in synthesizing hyaluronic acid, and reduces production cost by not using expensive IPTG derivatives. The hyaluronic acid produced according to the present invention has a merit of excellent moisturizing effect, viscosity increase, joint lubrication action, water absorption ability, elastic ability, etc. in a molecular weight range of 500 kDa to 10000 kDa.
이하, 본 발명을 더욱 자세히 설명하고자 한다. Hereinafter, the present invention will be described in more detail.
본 발명의 일예는 UDP-글루코스 6-디하이드로제나아제 유전자 및 히알루론산 합성효소 유전자를 포함하는 히알루론산 생산용 발현 시스템, 바람직하게는. 작동 가능하도록 연결된, 전사 프로모터, 리보솜 결합부위(RBS), UDP-글루코스 6-디하이드로제나아제 유전자 및 히알루론산 합성효소 유전자를 포함하는 히알루론산 생산용 발현 시스템에 관한 것이다. An example of the present invention is an expression system for producing hyaluronic acid, preferably comprising a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene. It relates to an expression system for producing hyaluronic acid comprising a transcriptional promoter, a ribosome binding site (RBS), a UDP-glucose 6-dehydrogenase gene, and a hyaluronic acid synthase gene, which are operably linked.
본 발명에서 제공되는 히알루론산 생산용 발현 시스템은, 히알루론산 합성에 필요한 UDP-글루코스 6-디하이드로제나아제 및 히알루론산 합성효소 유전자를 모두 포함하며, 상기 유전자들의 발현에 필요한 RBS 및 항시발현 프로모터를 제공함으로써, 별도의 유도체 없이도 히알루론산을 생산할 수 있다. The expression system for producing hyaluronic acid provided in the present invention includes both the UDP-glucose 6-dihydrogenase and hyaluronic acid synthase gene necessary for the synthesis of hyaluronic acid, and provides the RBS and constitutive expression promoters required for expression of the genes. By providing, it is possible to produce hyaluronic acid without a separate derivative.
본 발명에 따른 히알루론산 생산용 발현 시스템은 바실러스속 균주에 적용되는 것일 수 있으며, 예를 들면 바실러스 서브틸리스 또는 바실러스 리케니포르미스일 수 있으나 이에 한정되지 않는다. The expression system for producing hyaluronic acid according to the present invention may be applied to a strain of the genus Bacillus, and may be, for example, Bacillus subtilis or Bacillus licheniformis, but is not limited thereto.
본 발명의 발현 시스템에 적용 가능한 전사 프로모터는 바실러스속 균주에서 사용되는 항시 발현용 프로모터(constitutive expression promoter)일 수 있어, 상기 발현 시스템은 발현 유도제가 없이 항시 발현되는 히알루론산 합성효소를 생산하는 것이다. 또한, 상기 전사 프로모터는 P43 프로모터를 포함하는 발현 시스템을 갖는 형질전환 균주에 비해 히알루론산 생산량이 1.1 내지 10배를 갖는 높은 전사 수준을 갖는 것일 수 있다. The transcription promoter applicable to the expression system of the present invention may be a constitutive expression promoter used in Bacillus strains, and the expression system produces hyaluronic acid synthase that is always expressed without an expression inducer. In addition, the transcription promoter may be one having a high transcription level having a hyaluronic acid production amount of 1.1 to 10 times compared to a transformed strain having an expression system including the P43 promoter.
상기 항시 발현 프로모터는 예를 들어, P43, Pmsm, Ppbp, Pylb, Pyob, Pyqe 또는 Pyvl일 수 있으며, 바람직하게는 Psigx, Pyob, 또는 Pyqe일 수 있으나 이에 한정되는 것은 아니며, 유도형 프로모터와 비교하여 유사하거나 높은 히알루론산 수율을 얻을 수 있다면 제한 없이 선택하여 사용할 수 있다. 상기 Psigx 프로모터는 서열번호 53 및 54의 프라이머로 바실러스 서브틸리스 168 균주(Bacillus Genetic Stock Center)의 유전체로부터 PCR을 통해 얻은 것일 수 있다. 상기 Psigx, Pyob, 또는 Pyqe프로모터는 각각 서열번호 62, 서열번호 63, 또는 서열번호 64의 염기서열을 포함하는 것일 수 있다. 본 발명에 사용 가능한 프로모터의 구체적인 일 예를 하기 표 1에 기재하고, 각각의 프로모터 제조를 위해 사용한 구체적인 프라이머 세트를 하기 표 2에 나타낸다. The constant expression promoter may be, for example, P43, Pmsm, Ppbp, Pylb, Pyob, Pyqe or Pyvl, preferably Psigx, Pyob, or Pyqe, but is not limited thereto, and compared to an inducible promoter. Any similar or high hyaluronic acid yield can be obtained and used without limitation. The Psigx promoter may be obtained by PCR from the genome of Bacillus subtilis 168 strain (Bacillus Genetic Stock Center) with primers of SEQ ID NOs: 53 and 54. The Psigx, Pyob, or Pyqe promoter may each include a nucleotide sequence of SEQ ID NO: 62, SEQ ID NO: 63, or SEQ ID NO: 64, respectively. Specific examples of the promoters usable in the present invention are shown in Table 1 below, and specific primer sets used for the production of each promoter are shown in Table 2 below.
명명denomination SEQ ID NOSEQ ID NO 염기서열 Sequence
Psigx_promoter Psigx_promoter 6262 gggtgcttttgatgtcgccgctttatgcggaatcgcacgtcagaggagcggttgccgtactgcgtgacatgacagaagaacgccgccttgataagctgcgggaggactttatcgcaaatgtcagtcatgagctgagaacaccgatctccatgcttcagggatacagtgaagcaattgtcgatgacattgcaagctctgaagaagaccggaaagaaattgcccaaatcatttatgacgaatcgctccgaatgggccgtttagttaatgatttgcttgatttagcccgaatggaatcaggccatacaggcttacattatgaaaaaatcaatgtgaatgagtttttagaaaagatcattcggaagttttccggtgttgcgaaagaaaaaaatattgctttagatcatgacatttctctcacagaagaggaatttatgtttgatgaagacaagatggagcaggtatttaccaatttgattgataacgcgctgcggcatacttcagccggcggcagtgtctccatttcagtccattctgtgaaggatggattgaaaattgatatcaaagactccgggtctggcataccggaagaagatctgccatttatctttgagcggttttataaggcagataaagcgcggacaaggggcagagcaggaaccgggttagggctggctatcgttaaaaatatcgtggaagcccacaacggatcaattactgtgcacagccgaatagataaaggaacaacattttctttttatattccgacaaaacggtaaaatcgagtctgaatttgccgaagaatcttgttccataagaaacacccgctgactgagcgggtgtttttttaatagccaacattaataaaatttaaggatatgttaatataaattcccttccaaattccagttactcgtaatatagttgtaatgtaacttttcaagctattcatacgacaaaaaagtgaacggaggggtttcaagggtgcttttgatgtcgccgctttatgcggaatcgcacgtcagaggagcggttgccgtactgcgtgacatgacagaagaacgccgccttgataagctgcgggaggactttatcgcaaatgtcagtcatgagctgagaacaccgatctccatgcttcagggatacagtgaagcaattgtcgatgacattgcaagctctgaagaagaccggaaagaaattgcccaaatcatttatgacgaatcgctccgaatgggccgtttagttaatgatttgcttgatttagcccgaatggaatcaggccatacaggcttacattatgaaaaaatcaatgtgaatgagtttttagaaaagatcattcggaagttttccggtgttgcgaaagaaaaaaatattgctttagatcatgacatttctctcacagaagaggaatttatgtttgatgaagacaagatggagcaggtatttaccaatttgattgataacgcgctgcggcatacttcagccggcggcagtgtctccatttcagtccattctgtgaaggatggattgaaaattgatatcaaagactccgggtctggcataccggaagaagatctgccatttatctttgagcggttttataaggcagataaagcgcggacaaggggcagagcaggaaccgggttagggctggctatcgttaaaaatatcgtggaagcccacaacggatcaattactgtgcacagccgaatagataaaggaacaacattttctttttatattccgacaaaacggtaaaatcgagtctgaatttgccgaagaatcttgttccataagaaacacccgctgactgagcgggtgtttttttaatagccaacattaataaaatttaaggatatgttaatataaattcccttccaaattccagttactcgtaatatagttgtaatgtaacttttcaagctattcatacgacaaaaaagtgaacggaggggtttcaa
Pyob_promoter Pyob_promoter 6363 attcggcgttttggttttaggctacaactttgatcatgcatcagttgtaaatagaactaatgaatataaagaacactatggccttactgatggacttgtggttattgaagatgttgattactttgcttactgtctagatacaaataaaatgaaagacggagaatgccctgtagttgaatgggatagggtaattggttatcaagatactgttgcagacagctttattgaatttttttataataagattcaggaagcgaaagatgactgggatgaggatgaagactgggacgattaagcaaaagtattgctatagcgcaatagaaggcttgagttgcacatcctcaatctaaataaaataagctctcgcaatgagagcttattttattggattaaataattaaagtgacagaagttttctagtcccgttttatatgaaaccttttttattttagcccgtattaaaagtaaattcagagagaaggggagaagcttaaattcggcgttttggttttaggctacaactttgatcatgcatcagttgtaaatagaactaatgaatataaagaacactatggccttactgatggacttgtggttattgaagatgttgattactttgcttactgtctagatacaaataaaatgaaagacggagaatgccctgtagttgaatgggatagggtaattggttatcaagatactgttgcagacagctttattgaatttttttataataagattcaggaagcgaaagatgactgggatgaggatgaagactgggacgattaagcaaaagtattgctatagcgcaatagaaggcttgagttgcacatcctcaatctaaataaaataagctctcgcaatgagagcttattttattggattaaataattaaagtgacagaagttttctagtcccgttttatatgaaaccttttttattttagcccgtattaaaagtaaattcagagagaaggggagaagcttaa
Pyqe_promoterPyqe_promoter 6464 cttcttgagcgtctcaaccaggatatgaagctgtatatgaaaaaccgtgagaaagacaaactgactgtcgttcgaatggttaaggcttcacttcaaaatgaagcaattaagcttaagaaagacagtttgaccgaggatgaggaactcactgtcctttctcgtgaacttaagcaacgtaaagactccctccaggaattttcaaacgctaatcgtttagatttagtagataaagttcaaaaagagctggacattttagaagtttatttacctgagcagctgtcagaagaagagctgcgtacaatcgtaaatgaaaccatcgcggaggtcggtgcgagctcaaaagcggacatgggcaaagtgatgggggcaattatgcctaaagtaaaaggtaaagctgacggaagtttaattaataagcttgtgagcagtcaactgtcttaaatggcaaagaaaaggacatctttctaagagagatgtctttttttatacataaaaaaatgaaacctttgatacatttgttacgtatgaagagaaggcacttattataaaaggaaggagggatacaccgcccttgcttcaaatcaaaggacttcttgagcgtctcaaccaggatatgaagctgtatatgaaaaaccgtgagaaagacaaactgactgtcgttcgaatggttaaggcttcacttcaaaatgaagcaattaagcttaagaaagacagtttgaccgaggatgaggaactcactgtcctttctcgtgaacttaagcaacgtaaagactccctccaggaattttcaaacgctaatcgtttagatttagtagataaagttcaaaaagagctggacattttagaagtttatttacctgagcagctgtcagaagaagagctgcgtacaatcgtaaatgaaaccatcgcggaggtcggtgcgagctcaaaagcggacatgggcaaagtgatgggggcaattatgcctaaagtaaaaggtaaagctgacggaagtttaattaataagcttgtgagcagtcaactgtcttaaatggcaaagaaaaggacatctttctaagagagatgtctttttttatacataaaaaaatgaaacctttgatacatttgttacgtatgaagagaaggcacttattataaaaggaaggagggatacaccgcccttgcttcaaatcaaagga
프로모터Promoter 서열번호Sequence number 염기서열(5'-> 3')Base sequence (5'-> 3')
P43P43 3939 gatcgctagctgataggtggtatgttttcggatcgctagctgataggtggtatgttttcg
4040 gatcggatccgtgtacattcctctcttacctataagatcggatccgtgtacattcctctcttacctataa
PmsmPmsm 4141 gatcgctagcagtgtctgcgaaaacattacgatcgctagcagtgtctgcgaaaacattac
4242 gatcggatccctaacatccccctttgttatgatcggatccctaacatccccctttgttat
PpbpPpbp 4343 gatcgctagcagatggcaagttagttacgcgatcgctagcagatggcaagttagttacgc
4444 gatcggatcctcctccacctcccatatctcgatcggatcctcctccacctcccatatctc
PylbPylb 4545 gatcgctagccatcgtcgaacgcgctccatgatcgctagccatcgtcgaacgcgctccat
4646 gatcggatccacgttctacctttgtcaaacaagatcggatccacgttctacctttgtcaaacaa
pyobpyob 4747 gatcgctagcattcggcgttttggttttaggcgatcgctagcattcggcgttttggttttaggc
4848 gatcggatccttaagcttctccccttctctgatcggatccttaagcttctccccttctct
PyqePyqe 4949 gatcgctagccttcttgagcgtctcaaccagatcgctagccttcttgagcgtctcaacca
5050 gatcggatcctcctttgatttgaagcaagggatcggatcctcctttgatttgaagcaagg
PyvlPyvl 5151 gatcgctagcttcaaaacaaaaaaggcaagatgatcgctagcttcaaaacaaaaaaggcaagat
5252 gatcggatccttcattccacactcctattggatcggatccttcattccacactcctattg
Psigx Psigx 5353 gatcgctagcaggttataaatttgaggtcggcggatcgctagcaggttataaatttgaggtcggcg
5454 gatcggatccttgaaacccctccgttcactttgatcggatccttgaaacccctccgttcacttt
본 발명의 일 실시예에서, Psigx 프로모터를 사용한 오페론을 포함하는 벡터를 바실러스 서브틸리스에 형질전환시킨 결과, IPTG 유도체를 필요로 하는 유도형 프로모터를 사용한 경우와 히알루론산 수율이 거의 동일하였다(도 4). 따라서, Psigx 프로모터가 히알루론산 생산에 적절한 항시 발현용 프로모터임을 알 수 있다.In one embodiment of the present invention, as a result of transforming a vector containing an operon using the Psigx promoter into Bacillus subtilis, the hyaluronic acid yield was almost the same as when using an inducible promoter requiring an IPTG derivative (FIG. 4). Accordingly, it can be seen that the Psigx promoter is a promoter for constant expression suitable for hyaluronic acid production.
상기 전사 프로모터는 P43 프로모터를 포함하는 발현 시스템을 갖는 형질전환 균주에 비해 히알루론산 생산량이 1.1 내지 10배, 1.15 내지 10배, 1.5 내지 10배, 2 내지 10배, 3 내지 10배, 4 내지 10배, 5 내지 10배, 1.1 내지 9배, 1.15 내지 9배, 1.5 내지 9배, 2 내지 9배, 3 내지 9배, 4 내지 9배, 5 내지 9배, 1.1 내지 8배, 1.15 내지 8배, 1.5 내지 8배, 2 내지 8배, 3 내지 8배, 4 내지 8배, 5 내지 8배, 1.1 내지 7배, 1.15 내지 7배, 1.5 내지 7배, 2 내지 7배, 3 내지 7배, 4 내지 7배, 5 내지 7배, 1.1 내지 6.5배, 1.15 내지 6.5배, 1.5 내지 6.5배, 2 내지 6.5배, 3 내지 6.5배, 4 내지 6.5배, 5 내지 6.5배, 1.1 내지 6배, 1.15 내지 6배, 1.5 내지 6배, 2 내지 6배, 3 내지 6배, 4 내지 6배, 5 내지 6배, 1.1 내지 5.5배, 1.15 내지 5.5배, 1.5 내지 5.5배, 2 내지 5.5배, 3 내지 5.5배, 4 내지 5.5배, 또는 5 내지 5.5배인 프로모터일 수 있다.The transcription promoter is 1.1 to 10 times, 1.15 to 10 times, 1.5 to 10 times, 2 to 10 times, 3 to 10 times, 4 to 10 times the hyaluronic acid production amount compared to a transformed strain having an expression system containing the P43 promoter. Pear, 5-10 times, 1.1-9 times, 1.15-9 times, 1.5-9 times, 2-9 times, 3-9 times, 4-9 times, 5-9 times, 1.1-8 times, 1.15-8 Pear, 1.5-8 times, 2-8 times, 3-8 times, 4-8 times, 5-8 times, 1.1-7 times, 1.15-7 times, 1.5-7 times, 2-7 times, 3-7 Pear, 4 to 7 times, 5 to 7 times, 1.1 to 6.5 times, 1.15 to 6.5 times, 1.5 to 6.5 times, 2 to 6.5 times, 3 to 6.5 times, 4 to 6.5 times, 5 to 6.5 times, 1.1 to 6 times Pear, 1.15 to 6 times, 1.5 to 6 times, 2 to 6 times, 3 to 6 times, 4 to 6 times, 5 to 6 times, 1.1 to 5.5 times, 1.15 to 5.5 times, 1.5 to 5.5 times, 2 to 5.5 times It may be a fold, 3 to 5.5 fold, 4 to 5.5 fold, or 5 to 5.5 fold promoter.
본 발명의 발현 시스템에 적용 가능한 리보솜 결합 부위(RBS)는 상기 tuaD 유전자를 hasA 유전자와 함께 발현시킴으로써 바실러스에서 히알루론산을 생산할 수 있게 된다. 상기 RBS는 UDP-글루코스 6-디하이드로제나아제 암호화 유전자를 높은 수준으로 번역할 수 있는 것일 수 있으며, 상기 리보솜결합부위는 tuaD RBS를 사용하였을 때보다 1.1 내지 3배, 1.15 내지 3배, 1.2 내지 3배, 1.1 내지 2.5배, 1.15 내지 2.5배, 1.2 내지 2.5배, 1.1 내지 2배, 1.15 내지 2배, 1.2 내지 2배, 1.1 내지 1.5배, 1.15 내지 1.5배, 1.15 내지 1.5배, 1.1 내지 1.3배, 1.15 내지 1.3배 또는 1.2 내지 1.3배의 히알루론산 수율을 갖는 것일 수 있다. The ribosome binding site (RBS) applicable to the expression system of the present invention is capable of producing hyaluronic acid in Bacillus by expressing the tuaD gene together with the hasA gene. The RBS may be capable of translating the UDP-glucose 6-dehydrogenase coding gene to a high level, and the ribosome binding site is 1.1 to 3 times, 1.15 to 3 times, and 1.2 to 1 when compared with the tuaD RBS. 3 times, 1.1 to 2.5 times, 1.15 to 2.5 times, 1.2 to 2.5 times, 1.1 to 2 times, 1.15 to 2 times, 1.2 to 2 times, 1.1 to 1.5 times, 1.15 to 1.5 times, 1.15 to 1.5 times, 1.1 to It may have a hyaluronic acid yield of 1.3 times, 1.15 to 1.3 times, or 1.2 to 1.3 times.
예를 들면, 상기 RBS는, BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035, tuaD 유전자의 RBS(tuaD RBS), 또는 pET 플라스미드의 RBS일 수 있으며, 각각 서열번호 65 내지 72의 염기서열을 포함하는 것일 수 있으며 구체적으로 표시하면 하기 표 3에 나타낸 것과 같다.For example, the RBS, BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035, RBS of the tuaD gene (tuaD RBS), or may be RBS of the pET plasmid, each comprising a nucleotide sequence of SEQ ID NOs: 65-72 It may be, and if specifically indicated, it is as shown in Table 3 below.
명명denomination SEQ ID NOSEQ ID NO 염기서열 Sequence
BBa_B0030-RBSBBa_B0030-RBS 6565 attaaagaggagaaatactagattaaagaggagaaatactag
BBa_B0031-RBSBBa_B0031-RBS 6666 tcacacaggaaacctactagtcacacaggaaacctactag
BBa_B0032-RBSBBa_B0032-RBS 6767 tcacacaggaaagtactagtcacacaggaaagtactag
BBa_B0033-RBSBBa_B0033-RBS 6868 tcacacaggactactagtcacacaggactactag
BBa_B0034-RBSBBa_B0034-RBS 6969 aaagaggagaaatactagaaagaggagaaatactag
BBa_B0035-RBSBBa_B0035-RBS 7070 attaaagaggagaatactagattaaagaggagaatactag
RBS_tuaDRBS_tuaD 7171 gacactgcgaccattataaattggaagatcattttacaggagagggttgagcgctgacactgcgaccattataaattggaagatcattttacaggagagggttgagcgct
RBS_pETRBS_pET 7272 aataattttgtttaactttaagaaggagatatacataataattttgtttaactttaagaaggagatatacat
본 발명의 일 실시예에서, BBa_B0034를 RBS로 사용하였을 때 tuaD RBS를 사용한 경우보다 우수한 수율을 나타냈으며, 기존에 BBa_B0035가 BBa_B0034에 비해 우수한 발현 효율을 보이는 것으로 알려졌던 것과는 달리, BBa_B0034 RBS 서열을 사용하였을 때 가장 높은 히알루론산 생산 수율을 나타내었다(도 5).본 발명에 따른 히알루론산 생산용 발현 시스템은 UDP-글루코스 6-디하이드로제나아제 유전자와 히알루론산 합성효소 유전자를 포함하며, 상기 두 가지 유전자는 하나의 오페론을 구성하는 것이 바람직하며, 더욱 바람직하게는 5'에서 3'방향으로 순차적으로 히알루론산 합성효소 유전자, UDP-글루코스 6-디하이드로제나아제 유전자의 RBS 및 UDP-글루코스 6-디하이드로제나아제 유전자가 연결된 오페론일 수 있다.In one embodiment of the present invention, when BBa_B0034 was used as RBS, it exhibited a better yield than when using tuaD RBS, and unlike BBA_B0035 was previously known to exhibit superior expression efficiency compared to BBa_B0034, the BBa_B0034 RBS sequence was used. When shown, the highest yield of hyaluronic acid was produced (FIG. 5). The expression system for hyaluronic acid production according to the present invention includes a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene, and the two The gene is preferably composed of one operon, more preferably 5'to 3'direction sequentially hyaluronic acid synthase gene, RBS and UDP-glucose 6-di of UDP-glucose 6-dehydrogenase gene It may be an operon to which the hydrogenase gene is linked.
본 발명에 따른 상기 UDP-글루코스 6-디하이드로제나아제 유전자는, 예를 들어 tuaD 유전자 또는 이의 변이체일 수 있다. 상기 tuaD 유전자는 tuaD 유전자를 가지는 것으로 알려져 있는 종으로부터 유래된 tuaD 유전자를 제한 없이 사용할 수 있으며, 예를 들어 바실러스속 균주, 바람직하게는 바실러스 서브틸리스 균에서 유래한 tuaD 유전자일 수 있다. 상기 tuaD 유전자는 바람직하게는 바실러스 서브틸리스 2217 균주의 tuaD 유전자일 수 있으나, 이에 제한되는 것은 아니며, 필요에 따라 적절한 돌연변이가 도입된 tuaD 유전자일 수 있고, UDP-글루코스 6-디하이드로제나아제의 활성에 영향을 주지 않는 범위에서 자유롭게 변형되어 사용될 수 있다. 본 발명의 일예에서, tuaD 유전자는 서열번호 73 의 염기서열을 포함할 수 있다.The UDP-glucose 6-dehydrogenase gene according to the present invention may be, for example, a tuaD gene or a variant thereof. The tuaD gene may be a tuaD gene derived from a species known to have a tuaD gene, without limitation, and may be, for example, a Bacillus strain, preferably a tuaD gene derived from Bacillus subtilis. The tuaD gene may be a tuaD gene of Bacillus subtilis 2217 strain, but is not limited thereto, and may be a tuaD gene into which an appropriate mutation is introduced, if necessary, of UDP-glucose 6-dehydrogenase. It can be freely modified and used within a range that does not affect the activity. In one embodiment of the present invention, the tuaD gene may include the nucleotide sequence of SEQ ID NO: 73.
본 발명의 일 실시예에서, 상기 리보솜결합부위 및 tuaD는 바실러스 서브틸리스 2217 균주로부터 서열번호 37 및 38의 프라이머쌍을 사용하여 중합효소연쇄반응(PCR)을 통해 수득되었다.In one embodiment of the present invention, the ribosomal binding site and tuaD were obtained from a Bacillus subtilis 2217 strain through a polymerase chain reaction (PCR) using primer pairs of SEQ ID NOs: 37 and 38.
상기 히알루론산 합성효소 유전자는, 예를 들어 hasA 유전자 또는 이의 변이 유전자일 수 있다. 상기 hasA 유전자는, hasA 유전자를 가지는 것으로 알려져 있는 종으로부터 유래된 hasA 유전자를 제한 없이 사용할 수 있으며, 예를 들어, 스트렙토코커스 속의 균주, 바람직하게는 스트렙토코커스 쥬에피데미쿠스로부터 유래된 것일 수 있다. 상기 hasA 유전자의 변이 유전자는, 히알루론산 합성 활성이 유지되는 범위에서의 모든 유전자 상의 변이를 포함하는 것일 수 있다. 본 발명의 일예에서, hasA 유전자는 서열번호 74 또는 76의 아미노산 서열로 이루어진 단백질을 코딩하는 유전자일 수 있으며, 바람직하게는 서열번호 75 또는 77의 염기서열을 포함할 수 있다. The hyaluronic acid synthase gene may be, for example, a hasA gene or a variant gene thereof. The hasA gene may use a hasA gene derived from a species known to have a hasA gene without limitation, for example, a strain of the genus Streptococcus, preferably a strain derived from Streptococcus juepidemicus. The mutant gene of the hasA gene may include a mutation on all genes in a range in which hyaluronic acid synthesis activity is maintained. In one embodiment of the present invention, the hasA gene may be a gene encoding a protein consisting of the amino acid sequence of SEQ ID NO: 74 or 76, and preferably may include the nucleotide sequence of SEQ ID NO: 75 or 77.
본 발명의 일 실시예에서, 상기 히알루론산 합성효소 유전자로서 스트렙토코커스 쥬피에피데미쿠스로부터 서열번호 1 내지 36번의 프라이머 (표 4)를 사용하여 PCR-based two step DNA synthesis 방법을 통하여 hasA 유전자를 획득하였다.In one embodiment of the present invention, as the hyaluronic acid synthase gene, a hasA gene is obtained through a PCR-based two-step DNA synthesis method using the primers of SEQ ID NOs: 1 to 36 (Table 4) from Streptococcus jupipidemicus. Did.
구체적으로, 서열번호 1 내지 12까지의 프라이머를 이용하여 DNA 단편 1을 제작하고, 서열번호 12부터 24, 서열번호 25부터 36까지를 이용하여 각각 DNA 단편 2와 3을 제작하였다. 전체 길이의 hasA 유전자를 얻기 위해, 상기 얻어진 DNA 단편 1, 단편 2 및 단편 3을 혼합하고 서열번호 1 및 서열번호 36으로 구성된 프라이머쌍을 이용하여 PCR을 진행하였다. Specifically, DNA fragments 1 were prepared using primers of SEQ ID NOs: 1 to 12, and DNA fragments 2 and 3 were produced using SEQ ID NOs: 12 to 24 and SEQ ID NOs: 25 to 36, respectively. In order to obtain the full length hasA gene, the obtained DNA fragment 1, fragment 2 and fragment 3 were mixed and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36.
명명denomination 서열번호Sequence number hasA CDS증폭부위hasA CDS amplification site 염기서열(5'-> 3')Base sequence (5'-> 3')
hasA_frag1_forward1hasA_frag1_forward1 1One (1~42)(1~42) cgggatccatgagaacattaaaaaacctcataactgttgtggcctttagtcgggatccatgagaacattaaaaaacctcataactgttgtggcctttagt
hasA_frag1_forward2hasA_frag1_forward2 22 (28~77)(28-77) gttgtggcctttagtattttttgggtactgttgatttacgtcaatgtttagttgtggcctttagtattttttgggtactgttgatttacgtcaatgttta
hasA_frag1_forward3hasA_frag1_forward3 33 (63~112)(63-112) ttacgtcaatgtttatctctttggtgctaaaggaagcttgtcaatttatgttacgtcaatgtttatctctttggtgctaaaggaagcttgtcaatttatg
hasA_frag1_forward4hasA_frag1_forward4 44 (98~147)(98~147) gcttgtcaatttatggctttttgctgatagcttacctattagtcaaaatggcttgtcaatttatggctttttgctgatagcttacctattagtcaaaatg
hasA_frag1_forward5hasA_frag1_forward5 55 (133~182)(133-182) ctattagtcaaaatgtccttatcctttttttacaagccatttaagggaagctattagtcaaaatgtccttatcctttttttacaagccatttaagggaag
hasA_frag1_forward6hasA_frag1_forward6 66 (168~217)(168~217) gccatttaagggaagggctgggcaatataaggttgcagccattattccctgccatttaagggaagggctgggcaatataaggttgcagccattattccct
hasA_frag1_reverse1hasA_frag1_reverse1 77 (203~252)(203~252) ggtctctagcaatgactcagcatcttcgttataagagggaataatggctgggtctctagcaatgactcagcatcttcgttataagagggaataatggctg
hasA_frag1_reverse2hasA_frag1_reverse2 88 (238~287)(238-287) gctaggggataggtttgctgctgaacactttttaaggtctctagcaatgagctaggggataggtttgctgctgaacactttttaaggtctctagcaatga
hasA_frag1_reverse3hasA_frag1_reverse3 99 (273~322)(273~322) catcagcacttccatcgtcaacaacataaatttctgctaggggataggttcatcagcacttccatcgtcaacaacataaatttctgctaggggataggtt
hasA_frag1_reverse4hasA_frag1_reverse4 1010 (308~357)(308-357) acgcacatagtcttcaatgcgcttaatacctgtctcatcagcacttccatacgcacatagtcttcaatgcgcttaatacctgtctcatcagcacttccat
hasA_frag1_reverse5hasA_frag1_reverse5 1111 (343~392)(343~392) tgaacaatgacattgcttgataggtcaccagtgtcacgcacatagtcttctgaacaatgacattgcttgataggtcaccagtgtcacgcacatagtcttc
hasA_frag1_reverse6hasA_frag1_reverse6 1212 (378~427)(378~427) gtgcatgacgctttccttgatttttctctgaccgatgaacaatgacattggtgcatgacgctttccttgatttttctctgaccgatgaacaatgacattg
hasA_frag2_forward1hasA_frag2_forward1 1313 (413~462)(413-462) gaaagcgtcatgcacaggcctgggcctttgaaagatcagacgctgatgtcgaaagcgtcatgcacaggcctgggcctttgaaagatcagacgctgatgtc
hasA_frag2_forward2hasA_frag2_forward2 1414 (448~497)(448~497) tcagacgctgatgtctttttgaccgttgactcagatacttatatctaccctcagacgctgatgtctttttgaccgttgactcagatacttatatctaccc
hasA_frag2_forward3hasA_frag2_forward3 1515 (483~532)(483~532) tacttatatctaccctgatgctttagaggagttgttaaaaacctttaatgtacttatatctaccctgatgctttagaggagttgttaaaaacctttaatg
hasA_frag2_forward4hasA_frag2_forward4 1616 (518~567)(518~567) taaaaacctttaatgacccaactgtttttgctgcgacgggtcaccttaattaaaaacctttaatgacccaactgtttttgctgcgacgggtcaccttaat
hasA_frag2_forward5hasA_frag2_forward5 1717 (553~602)(553~602) acgggtcaccttaatgtcagaaatagacaaaccaatctcttaacacgcttacgggtcaccttaatgtcagaaatagacaaaccaatctcttaacacgctt
hasA_frag2_forward6hasA_frag2_forward6 1818 (588~637)(588~637) tctcttaacacgcttgacagatattcgctatgataatgcttttggcgttgtctcttaacacgcttgacagatattcgctatgataatgcttttggcgttg
hasA_frag2_reverse1hasA_frag2_reverse1 1919 (623~672)(623~672) aaggatattacctgtaacggattgggcagctcgttcaacgccaaaagcataaggatattacctgtaacggattgggcagctcgttcaacgccaaaagcat
hasA_frag2_reverse2hasA_frag2_reverse2 2020 (658~707)(658~707) tcgcgtctgtaaacgctaagcggacctgagcaaacaaggatattacctgttcgcgtctgtaaacgctaagcggacctgagcaaacaaggatattacctgt
hasA_frag2_reverse3hasA_frag2_reverse3 2121 (693~742)(693~742) ggttgatgtatctatctatgttaggaacaaccacctcgcgtctgtaaacgggttgatgtatctatctatgttaggaacaaccacctcgcgtctgtaaacg
hasA_frag2_reverse4hasA_frag2_reverse4 2222 (728~777)(728~777) atcaccaatacttacaggaatacccaggaaggtctggttgatgtatctatatcaccaatacttacaggaatacccaggaaggtctggttgatgtatctat
hasA_frag2_reverse5hasA_frag2_reverse5 2323 (763~812)(763~812) cctaaatcagttgcatagttggtcaagcacctgtcatcaccaatacttaccctaaatcagttgcatagttggtcaagcacctgtcatcaccaatacttac
hasA_frag2_reverse6hasA_frag2_reverse6 2424 (798~847)(798~847) taatacatttagcagtggattgataaacagtctttcctaaatcagttgcataatacatttagcagtggattgataaacagtctttcctaaatcagttgca
hasA_frag3_forward1hasA_frag3_forward1 2525 (833~882)(833~882) ctgctaaatgtattacagatgttcctgacaagatgtctacttacttgaagctgctaaatgtattacagatgttcctgacaagatgtctacttacttgaag
hasA_frag3_forward2hasA_frag3_forward2 2626 (868~917)(868~917) tctacttacttgaagcagcaaaaccgctggaacaagtccttctttagagatctacttacttgaagcagcaaaaccgctggaacaagtccttctttagaga
hasA_frag3_forward3hasA_frag3_forward3 2727 (903~952)(903~952) gtccttctttagagagtccattatttctgttaagaaaatcatgaacaatcgtccttctttagagagtccattatttctgttaagaaaatcatgaacaatc
hasA_frag3_forward4hasA_frag3_forward4 2828 (938~987)(938~987) aaatcatgaacaatccttttgtagccctatggaccatacttgaggtgtctaaatcatgaacaatccttttgtagccctatggaccatacttgaggtgtct
hasA_frag3_forward5hasA_frag3_forward5 2929 (973~1022)(973~1022) atacttgaggtgtctatgtttatgatgcttgtttattctgtggtggatttatacttgaggtgtctatgtttatgatgcttgtttattctgtggtggattt
hasA_frag3_forward6hasA_frag3_forward6 3030 (1008~1057)(1008~1057) ttctgtggtggatttctttgtaggcaatgtcagagaatttgattggctcattctgtggtggatttctttgtaggcaatgtcagagaatttgattggctca
hasA_frag3_reverse1hasA_frag3_reverse1 3131 (1043~1092)(1043~1092) aacaatgaagataatcaccagaaaggctaaaaccctgagccaatcaaattaacaatgaagataatcaccagaaaggctaaaaccctgagccaatcaaatt
hasA_frag3_reverse2hasA_frag3_reverse2 3232 (1078~1127)(1078~1127) tgcttaagcatgtaatgaatgttccgacacagggcaacaatgaagataattgcttaagcatgtaatgaatgttccgacacagggcaacaatgaagataat
hasA_frag3_reverse3hasA_frag3_reverse3 3333 (1113~1162)(1113~1162) ccccataaaacggagataacaagaaggacagcgggtgcttaagcatgtaaccccataaaacggagataacaagaaggacagcgggtgcttaagcatgtaa
hasA_frag3_reverse4hasA_frag3_reverse4 3434 (1148~1197)(1148~1197) taatttcaagggctgtaggacaaacaaatgcagcaccccataaaacggagtaatttcaagggctgtaggacaaacaaatgcagcaccccataaaacggag
hasA_frag3_reverse5hasA_frag3_reverse5 3535 (1183~1232)(1183~1232) ccccagtcagcatttctaatagtaaaaagagaatataatttcaagggctgccccagtcagcatttctaatagtaaaaagagaatataatttcaagggctg
hasA_frag3_reverse6hasA_frag3_reverse6 3636 (1218~1254)(1218~1254) gctctagattataataattttttacgtgttccccagtcagcatttgctctagattataataattttttacgtgttccccagtcagcattt
본 발명의 일예는 상기 히알루론산 생산용 발현 시스템을 포함하는 히알루론산 생산용 형질전환 균주 또는 재조합 균주일 수 있다. 상기 균주는 GRAS 등급의 균주일 수 있으며, 그람 양성균, 예를 들어, 바실러스속 균주, 바람직하게는 바실러스 서브틸리스 또는 바실러스 리케니포르미스(B. licheniformis)일 수 있다. GRAS 등급의 균주를 사용함으로써 히알루론산 합성시의 안전성이 증가할 수 있다. 본 발명의 일 실시예에서는 바실러스 서브틸리스 2217 균주에 상기 히알루론산 생산용 발현 시스템을 도입시켜 IPTG와 같은 유도체 없이도 히알루론산을 생산하는 균주를 획득하였다. An example of the present invention may be a transformation strain or a recombinant strain for producing hyaluronic acid, including the expression system for producing hyaluronic acid. The strain may be a GRAS grade strain, and may be a Gram-positive bacterium, for example, Bacillus strain, preferably Bacillus subtilis or Bacillus licheniformis . By using a strain of GRAS grade, the safety during hyaluronic acid synthesis can be increased. In an embodiment of the present invention, the expression system for producing hyaluronic acid was introduced into the Bacillus subtilis 2217 strain to obtain a hyaluronic acid producing strain without a derivative such as IPTG.
본 발명은 상기 히알루론산 발현 시스템을 포함하는 히알루론산 생산용 형질전환 균주를 배양하는 단계를 포함하는 비병원성 세균을 이용한 히알루론산 생산방법에 관한 것이다. 더욱 자세하게는, 본 발명에 따른 히알루론산 생산방법은 히알루론산 생산용 형질전환 균주를 배양하는 단계에 더하여, 히알루론산을 분리 및/또는 정제하는 단계를 추가로 포함할 수 있으며, 예를 들면 배양액에서 균주를 제거하는 단계 및 상기 균주가 제거된 배양액에서 히알루론산을 침전시키는 단계를 포함할 수 있다. The present invention relates to a method for producing hyaluronic acid using a non-pathogenic bacterium comprising culturing a transforming strain for producing hyaluronic acid containing the hyaluronic acid expression system. More specifically, the method for producing hyaluronic acid according to the present invention may further include the step of separating and/or purifying hyaluronic acid in addition to the step of culturing the transforming strain for producing hyaluronic acid, for example, in a culture medium. The method may include removing the strain and precipitating hyaluronic acid in the culture medium from which the strain is removed.
상기 히알루론산 생산용 형질전환 균주 및 히알루론산 생산방법에서, 전사 프로모터, 히알루론난 합성효소(hyaluronan synthase) 유전자, UDP-글루코스 6-디하이드로제나아제 유전자 발현용 리보솜 결합부위 및 UDP-글루코스 6-디하이드로제나아제 유전자 등에 대해서는 상술한 바와 같다. In the transforming strain for producing hyaluronic acid and the method for producing hyaluronic acid, a transcription promoter, a hyaluronan synthase gene, a ribosome binding site for UDP-glucose 6-dehydrogenase gene expression, and UDP-glucose 6-di Hydrogenase genes and the like are as described above.
본 발명에 따른 재조합 균주를 이용한 히알루론산의 생산 방법은 IPTG 등의 유도체 없이도 항시 발현 프로모터를 통해 유도형 프로모터를 사용한 경우보다 동등하거나 그 이상의 히알루론산 수율을 나타낼 수 있다. The method for producing hyaluronic acid using the recombinant strain according to the present invention may exhibit a hyaluronic acid yield equal to or higher than that of using an inducible promoter through an expression promoter at all times without a derivative such as IPTG.
상기 균주를 배양하는 단계는 탄소원으로 수크로즈를 사용할 수 있으나 이에 제한되는 것은 아니다. 상기 균주의 배양, 균주 제거 및 히알루론산의 침전 단계는 당업계에 알려진 방법으로 수행될 수 있으며, 필요에 따라 통상의 기술자가 적절히 변형하여 사용할 수 있다.The step of culturing the strain may use sucrose as a carbon source, but is not limited thereto. The culture of the strain, the removal of the strain and the precipitation step of hyaluronic acid can be performed by methods known in the art, and can be used by appropriate modifications by a person skilled in the art as necessary.
상기 히알루론산의 생산 방법은 히알루론산의 침전단계 이후 히알루론산의 농축, 정제, 또는 농축 및 정제 단계를 추가로 포함할 수 있다. The method of producing hyaluronic acid may further include a step of concentration, purification, or concentration and purification of hyaluronic acid after the precipitation step of hyaluronic acid.
상기 제조 방법을 사용하여 수득된 히알루론산은 분자량이 100 내지 10,000kDa, 500 내지 10,000kDa, 500 내지 8,000kDa, 3,000 내지 8,000kDa, 또는 5,000 내지 6,000kDa일 수 있다. The hyaluronic acid obtained using the above production method may have a molecular weight of 100 to 10,000 kDa, 500 to 10,000 kDa, 500 to 8,000 kDa, 3,000 to 8,000 kDa, or 5,000 to 6,000 kDa.
본 발명의 일 실시예에서, 상기 히알루론산 합성 시스템을 도입한 바실러스 균으로부터 최대 피크 5,455kDa의 초고분자 히알루론산을 수득할 수 있었다. 이러한 고분자 히알루론산은 저분자 히알루론산에 비해 보습 효과, 점도 상승, 관절 윤활 작용, 수분 흡수 능력, 탄성 능력 등이 우수한 특성을 가진다. 따라서 고분자 히알루론산은 슬관절 주사제, 점안제, 성형용 필러 등의 의약품으로의 활용 가치가 높다. 특히 본 발명이 제공하는 발현 시스템을 이용하여 제작된 히알루론산과 같은 3000kDa 이상의 초고분자 히알루론산은 체내 분해 속도가 느려서 유착 방지제로 사용 가능하다.In one embodiment of the present invention, it was possible to obtain a hyaluronic acid having a maximum peak of 5,455 kDa from Bacillus bacteria incorporating the hyaluronic acid synthesis system. The polymer hyaluronic acid has excellent properties such as moisturizing effect, viscosity increase, joint lubrication, water absorption ability, elasticity, etc., compared to low molecular hyaluronic acid. Therefore, high-molecular hyaluronic acid has high utility value as a medicine, such as injections for knee joints, eye drops, and fillers for molding. In particular, ultra-high molecular weight hyaluronic acid of 3000 kDa or higher, such as hyaluronic acid produced by using the expression system provided by the present invention, can be used as an anti-adhesion agent due to a slow decomposition rate in the body.
또한 저분자 히알루론산을 고분자 히알루론산으로 변환하기 위해서는 가교제 또는 화합물을 처리하고 복잡한 과정을 거쳐야 하는 번거로움이 있는 반면, 고분자 히알루론산을 저분자 히알루론산으로 변환하는 과정은 물리적 또는 화학적 방법을 사용하여 비교적 용이한 장점을 가진다.In addition, in order to convert low-molecular hyaluronic acid to high-molecular hyaluronic acid, there is a hassle of processing a crosslinking agent or a compound and undergoing a complicated process, whereas the process of converting high-molecular hyaluronic acid to low-molecular hyaluronic acid is relatively easy using physical or chemical methods. It has one advantage.
본 발명의 히알루론산 합성을 위한 균주는 비병원성 균주로서, 히알루론산 합성시의 안전성이 증가하며, 발현 유도제로서 값비싼 IPTG 유도체를 사용하지 않아 생산 비용 절감 효과를 가진다. The strain for synthesizing hyaluronic acid of the present invention is a non-pathogenic strain, which increases safety during hyaluronic acid synthesis, and does not use expensive IPTG derivatives as an expression inducing agent, thereby reducing production costs.
도 1은 본 발명의 일예에 따라 제조된 pHCMC02-hasA-RBS34-tuaD 플라스미드의 벡터 맵을 나타낸다. 1 shows a vector map of the pHCMC02-hasA-RBS34-tuaD plasmid prepared according to an example of the present invention.
도 2는 본 발명의 일예에 따라 제조된 pHCMC02-hasA-RBS34-tuaD 플라스미드의 제조를 위한 클로닝 과정의 모식도이다.Figure 2 is a schematic diagram of the cloning process for the production of pHCMC02-hasA-RBS34-tuaD plasmid prepared according to an example of the present invention.
도 3은 본 발명의 일예에 따라 다양한 프로모터를 포함하는 발현 시스템을 바실러스속 균주에 도입한 후 생산된 히알루론산의 농도를 상대적으로 표시한 그래프이다. 3 is a graph showing the concentration of hyaluronic acid produced after introducing an expression system including various promoters into a Bacillus strain according to an embodiment of the present invention.
도 4는 본 발명의 일예에 따라 항시 발현형 프로모터인 Psigx와 IPTC 유도형 프로모터인 Pgrac을 사용한 경우에 생산된 히알루론산의 농도를 상대적으로 나타낸 그래프이다.4 is a graph showing the concentration of hyaluronic acid produced in the case of using the always-expressing promoter Psigx and the IPTC-inducing promoter Pgrac according to an embodiment of the present invention.
도 5는 본 발명의 일예에 따라 다양한 리보솜 결합부위를 사용한 경우에 생산된 히알루론산의 상대적 농도를 나타낸 그래프이다.5 is a graph showing the relative concentration of hyaluronic acid produced when various ribosome binding sites are used according to an embodiment of the present invention.
도 6은 상업적으로 구입한 히알루론산 표준품과 본 발명의 일예에 따라 재조합 균주의 배양액으로부터 정제한 히알루론산의 적외부스펙트럼 분석 결과를 나타낸 그림이다.6 is a diagram showing the results of infrared spectrum analysis of hyaluronic acid purified from a culture of a recombinant strain according to an example of the present invention and a commercially available hyaluronic acid standard.
도 7은 본 발명의 일예에 따라 재조합 균주의 배양액으로부터 정제된 히알루론산의 분자량을 다각도 레이저 광 산란 측정기(MALLS)로 측정한 결과이다.7 is a result of measuring the molecular weight of hyaluronic acid purified from a culture medium of a recombinant strain according to an embodiment of the present invention with a multi-angle laser light scattering meter (MALLS).
이하 실시예를 통해 본 발명을 더욱 상세히 설명한다. 그러나 하기 실시예는 본 발명을 설명하기 위한 것이고, 하기 실시예의 기재에 의해 본 발명의 범위가 제한되는 것은 아니다. The present invention will be described in more detail through the following examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not limited by the description of the following examples.
실시예 1: hasA 및 tuaD 오페론의 클로닝 Example 1: Cloning of hasA and tuaD operons
1-1: 히알루론산 합성효소 유전자 (hasA)의 클로닝1-1: Cloning of the hyaluronic acid synthase gene (hasA)
스트렙토코커스 쥬에피데미쿠스(Streptococcus zooepidemicus) 유래의 히알루론산 합성효소 유전자 (hasA, Genbank No. AY173078의 염기서열 1~1254) (서열번호 75)는 표 4에 나타낸 서열번호 1부터 36까지의 프라이머들을 이용하여, PCR 기반의 2단계 DNA 합성 방식(PCR-based two step DNA synthesis, PTDS; Xiong, 2004, Nucleic Acids Research 32:e98)으로 합성하였다. 구체적으로, 서열번호 1부터 12까지를 이용하여 DNA 단편 1을 만들고, 마찬가지로 서열번호 13부터 24까지, 25부터 36까지를 이용하여 각각 DNA 단편 2와 단편 3을 제조하였다. 전체 길이의 hasA 유전자를 얻기 위해, 상기 얻어진 DNA 단편 1, 단편 2 및 단편 3을 혼합하고 서열번호 1 및 서열번호 36로 구성된 프라이머쌍을 이용하여 PCR을 진행하여, hasA 유전자를 획득하였다. PCR조건은 Veriti® Thermal Cycler (applied biosystem)을 이용하여 94℃에서 15초 변성, 55℃에서 15초 결합, 72℃에서 1분30초 신장하는 단계를 총 25회 실시하였다. 상기 히알루론산 합성효소 유전자로서 스트렙토코커스 쥬피에피데미쿠스로부터 유래한 hasA 유전자를 사용하였으며, 상기 기재한 방법으로 서열번호 1 내지 36번의 프라이머 (표 4)를 사용하여 전장 hasA 유전자를 얻었다. 획득한 전체 길이의 hasA 유전자를 제한효소 BamHI과 XbaI으로 절단하고, BamHI과 XbaI으로 절단된 pHCMC02 (Bacillus Genetic Stock Center) 플라스미드에 T4 DNA 라이게이즈 (NEB)를 사용하여 연결하였다. 상기 벡터를 E. coli DH5alpha (Enzynomics)에 도입하였고, 엠피실린이 포함된 평판배지에 도말하여 얻어진 엠피실린 내성 형질전환체로부터 플라스미드 pHCMC02-hasA를 분리하였다. 확보된 플라스미드 pHCMC02-hasA는 염기서열 분석을 통해 정상적인 hasA 유전자가 클로닝되었음을 확인하였다. Streptococcus zooepidemicus-derived hyaluronic acid synthase gene (hasA, Genbank No. AY173078 base sequences 1 to 1254) (SEQ ID NO: 75) shows the primers from SEQ ID NOS: 1 to 36 shown in Table 4 It was synthesized by PCR-based two-step DNA synthesis (PTDS; Xiong, 2004, Nucleic Acids Research 32:e98). Specifically, DNA fragments 1 were prepared using SEQ ID NOs: 1 to 12, and DNA fragments 2 and 3 were prepared using SEQ ID NOs: 13 to 24 and 25 to 36, respectively. To obtain the full length hasA gene, the obtained DNA fragment 1, fragment 2 and fragment 3 were mixed and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36 to obtain the hasA gene. PCR conditions were performed 25 times in total for 15 seconds at 94°C, 15 seconds at 55°C, 15 minutes at 55°C, and stretching at 72°C for 1 minute and 30 seconds using Veriti® Thermal Cycler (applied biosystem). As the hyaluronic acid synthase gene, a hasA gene derived from Streptococcus jupie epidemius was used, and the full length hasA gene was obtained using primers (SEQ ID NO: 4) of SEQ ID NOS: 1 to 36 in the manner described above. The obtained full-length hasA gene was digested with restriction enzymes BamHI and XbaI, and linked to a pHCMC02 (Bacillus Genetic Stock Center) plasmid digested with BamHI and XbaI using T4 DNA ligase (NEB). The vector was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pHCMC02-hasA was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The obtained plasmid pHCMC02-hasA was confirmed that the normal hasA gene was cloned through sequencing.
1-2: UDP-글루코스 6-디하이드로제나아제 유전자(tuaD)의 클로닝1-2: Cloning of the UDP-glucose 6-dehydrogenase gene (tuaD)
바실러스속 균주에서 히알루론산을 생산하기 위해서는 히알루론산 합성효소만으로는 부족하고, UDP-글루코스 6-디하이드로제나아제(UDP-glucose 6-dehydrogenase)가 동시에 발현되어야 하며 (Winder, 2005, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 71:3747-3752), 이를 위해서는 hasA와 tuaD로 이루어진 오페론을 완성하여야 한다. In order to produce hyaluronic acid in Bacillus strains, hyaluronic acid synthase alone is insufficient, and UDP-glucose 6-dehydrogenase must be simultaneously expressed (Winder, 2005, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 71:3747-3752), in order to do this, an operon consisting of hasA and tuaD must be completed.
상기 오페론을 구성하기 위해서는 tuaD 유전자 앞에 RBS (ribosome binding site)가 존재해야 하므로, 바실러스 서브틸리스 2217 균주 (생물자원센터(KCTC))의 DNA를 주형으로 서열번호 37의 RBS_tuaD_forward primer 및 서열번호 38의 RBS_tuaD_reverse primer를 이용하여, tuaD 유전자의 5'-말단에 RBS34 (BioBrick BBa_B0034)가 포함되도록 tuaD 유전자를 증폭하였다. PCR은 Veriti® Thermal Cycler (applied biosystem)를 이용하여 94℃에서 15초 변성, 55℃에서 15초 결합, 72℃에서 1분30초 신장하는 단계를 총 30회 실시하였다.In order to construct the operon, since the ribasome binding site (RBS) must be present in front of the tuaD gene, the DNA of Bacillus subtilis 2217 strain (Bioresource Center (KCTC)) is used as a template for the RBS_tuaD_forward primer of SEQ ID NO: 37 and SEQ ID NO: 38. Using the RBS_tuaD_reverse primer, the tuaD gene was amplified to include RBS34 (BioBrick BBa_B0034) at the 5'-end of the tuaD gene. PCR was performed 30 times in total by denaturing at 94°C for 15 seconds, binding at 55°C for 15 seconds, and stretching at 72°C for 1 minute and 30 seconds using a Veriti® Thermal Cycler (applied biosystem).
서열번호 37: 5'-aatctagaaaagaggagaaatactagatgaaaaaaatagctgtcattgg-3'SEQ ID NO: 37: 5'-aatctagaaaagaggagaaatactagatgaaaaaaatagctgtcattgg-3'
서열번호 38: 5'-gggttataaattgacgcttcccaagtctttagccaatt-3'SEQ ID NO: 38: 5'-gggttataaattgacgcttcccaagtctttagccaatt-3'
증폭된 RBS34-tuaD 유전자는 제한 효소 XbaI로 절단하였고, XbaI과 SmaI으로 절단된 pBluescriptII SK+ (Stratagene) 플라스미드에 T4 DNA 라이게이즈 (NEB)를 사용하여 연결하였다. 이를 E. coli DH5alpha (Enzynomics)에 도입하였고, 엠피실린이 포함된 평판배지에 도말하여 얻어진 엠피실린 내성 형질전환체로부터 플라스미드 pBSIISK-RBS34-tuaD를 단리하였다. 확보된 플라스미드 pBSIISK-RBS34-tuaD는 염기서열 분석을 통해 Genbank No. AF015609의 염기서열 3599~4984 bp(tuaD 유전자의 단백질 코딩 부위, 서열번호 73)가 정상적으로 클로닝되었음을 확인하였다.The amplified RBS34-tuaD gene was digested with restriction enzymes XbaI, and linked to pBluescriptII SK+ (Stratagene) plasmids cut with XbaI and SmaI using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pBSIISK-RBS34-tuaD was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The obtained plasmid pBSIISK-RBS34-tuaD was analyzed by sequencing to Genbank No. It was confirmed that the base sequences of AF015609 3599 to 4984 bp (protein coding region of the tuaD gene, SEQ ID NO: 73) were cloned normally.
1-3: hasA 및 tuaD 오페론의 클로닝1-3: Cloning of hasA and tuaD operons
hasA와 tuaD유전자로 구성된 오페론을 완성하기 위해서, 실시예 1-2에서 얻어진 pBSIISK-RBS34-tuaD를 제한효소 XbaI과 SmaI으로 절단하고, 절단된 RBS34-tuaD유전자를 동일한 제한효소로 처리된, 실시예 1-1에서 얻어진 pHCMC02-hasA 플라스미드에 T4 DNA 라이게이즈 (NEB)를 사용하여 연결하였다. 이를 E. coli DH5alpha (Enzynomics)에 도입하였고, 엠피실린이 포함된 평판배지에 도말하여 얻어진 엠피실린 내성 형질전환체로부터 플라스미드 pHCMC02-hasA-RBS34-tuaD 플라스미드를 단리하였다. 상기 pHCMC02-hasA-RBS34-tuaD에 대한 벡터 맵과 클로닝 과정의 모식도를 도 1 및 도 2에 각각 나타냈다. To complete the operon composed of hasA and tuaD genes, the pBSIISK-RBS34-tuaD obtained in Example 1-2 was digested with restriction enzymes XbaI and SmaI, and the truncated RBS34-tuaD gene was treated with the same restriction enzyme. The pHCMC02-hasA plasmid obtained in 1-1 was ligated using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pHCMC02-hasA-RBS34-tuaD plasmid was isolated from the ampicillin resistant transformant obtained by plating on a plate medium containing ampicillin. 1 and 2 show schematic diagrams of the vector map and cloning process for the pHCMC02-hasA-RBS34-tuaD, respectively.
실시예 2: hasA-tuaD 오페론 발현용 프로모터 선별Example 2: Selection of a promoter for the expression of hasA-tuaD operon
실시예 1에서 제조된 플라스미드 pHCMC02-hasA-RBS34-tuaD에서 hasA-tuaD 오페론의 발현은 PlepA 프로모터에 의해 조절되는데, PlepA 프로모터는 활성이 약한 것으로 알려져 있다. 이에, PlepA 프로모터를 다양한 프로모터로 교체하여 hasA-tuaD 오페론 발현 활성이 높은 프로모터를 선별하였다. 상기 후보 프로모터들은 바실러스속 균주에서 사용되는 항시 발현용 프로모터(constitutive expression promoter)인 P43에 비해 발현 활성이 높은 것들로 선정하였다 (Yu, 2015, Scientific Reports, 5:18405; Song, 2016, PLoS One. 11:e0158447).In the plasmid pHCMC02-hasA-RBS34-tuaD prepared in Example 1, the expression of the hasA-tuaD operon is regulated by the PlepA promoter, which is known to have weak activity. Accordingly, the promoter having high hasA-tuaD operon expression activity was selected by replacing the PlepA promoter with various promoters. The candidate promoters were selected as those having higher expression activity than P43, which is a constitutive expression promoter used in Bacillus strains (Yu, 2015, Scientific Reports, 5:18405; Song, 2016, PLoS One. 11:e0158447).
상기 시험된 각 프로모터에 의해 조절되는 플라스미드를 제작하기 위해서, 바실러스 서브틸리스 168 균주 DNA (Bacillus Genetic Stock Center)를 주형으로 상기 표 2에 기재된 프라이머를 이용하여 각각의 프로모터들을 PCR로 증폭하였다. 구체적으로 PP43 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 39 및 40), Pmsm 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 41 및 42), Ppbp 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 43 및 44), Pylb 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 45 및 46), pyob 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 47 및 48), Pyqe 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 49 및 50), Pyvl 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 51 및 52), Psigx 프로모터의 정방향 프라이머 및 역방향 프라이머(서열번호 53 및 54) 를 사용하였다. To prepare a plasmid regulated by each of the tested promoters, each promoter was amplified by PCR using the primers shown in Table 2 above as a template for Bacillus subtilis 168 strain DNA (Bacillus Genetic Stock Center). Specifically, forward and reverse primers of the PP43 promoter (SEQ ID NOs: 39 and 40), forward and reverse primers of the Pmsm promoter (SEQ ID NOs: 41 and 42), forward and reverse primers of the Ppbp promoter (SEQ ID NOs: 43 and 44), Forward and reverse primers of the Pylb promoter (SEQ ID NOs: 45 and 46), forward and reverse primers of the pyob promoter (SEQ ID NOs: 47 and 48), forward and reverse primers of the Pyqe promoter (SEQ ID NOs: 49 and 50), and Pyvl promoter Forward and reverse primers (SEQ ID NOs: 51 and 52), forward and reverse primers (SEQ ID NOs: 53 and 54) of the Psigx promoter were used.
PCR을 통해 증폭된 각각의 프로모터를 제한효소 NheI과 BamHI으로 절단하고, 동일한 제한효소로 절단된 실시예 1의 pHCMC02-hasA-RBS34-tuaD에 T4 DNA 라이게이즈 (NEB)를 사용하여 연결하였다. 이를 E. coli DH5alpha (Enzynomics)에 도입하였고, 엠피실린이 포함된 평판배지에 도말하여 얻어진 엠피실린 내성 형질전환체로부터 각각의 플라스미드를 단리하였다. 염기서열 분석을 통해 단리된 각각의 플라스미드들에 정상적으로 각 프로모터들이 클로닝되었음을 확인하였다. Each promoter amplified through PCR was digested with restriction enzymes NheI and BamHI, and linked to pHCMC02-hasA-RBS34-tuaD of Example 1 digested with the same restriction enzyme using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and each plasmid was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. Through sequencing, it was confirmed that each promoter was cloned normally into each isolated plasmid.
서로 다른 프로모터를 가지고 있는 플라스미드들을 전기천공법(Sun, 2015, Applied Microbiology and Biotechnology, 99:5151-5162)에 의해 바실러스 2217 균주에 도입하여, 클로로암페니콜 내성을 가지는 형질전환 균주들을 제조하였다. Plasmids having different promoters were introduced into the Bacillus 2217 strain by electroporation (Sun, 2015, Applied Microbiology and Biotechnology, 99:5151-5162) to prepare transforming strains having chloroamphenicol resistance.
다음으로, 각각의 형질전환 균주들을 LB배지에 접종하고 밤샘 배양을 하였다. 밤샘 배양된 균주 0.2 mL을 250mL 삼각플라스크에 들어 있는 20 mL sucrose배지 (1L당 50g 의 수크로즈, 20g 의 효모추출물, 1.5g 의 황산마그네슘 (MgSO4)이 포함된 50mM 인산칼륨 (potassium phosphate (pH7.0))에 접종한 후, 37℃ 온도에서 180rpm으로 진탕 배양하였다. 배양시작 후 65시간에 각각의 배양액을 취하고, 10,000 rpm으로 1분간 원심분리 후 0.45 μm 필터를 통과시켜 균주를 제거하였다. Next, each transformed strain was inoculated into LB medium and cultured overnight. 50 mL of 50 mM potassium phosphate (pH7.) containing 20 mL sucrose medium (50 g sucrose per 1 L, 20 g yeast extract, 1.5 g magnesium sulfate (MgSO4)) in a 250 mL Erlenmeyer flask containing 0.2 mL of overnight cultured strain. After inoculation at 0)), the cells were shaken and cultured at 180 rpm at a temperature of 37° C. Each culture was taken at 65 hours after the start of culture, and centrifuged at 10,000 rpm for 1 minute, and then passed through a 0.45 μm filter to remove the strain.
균주가 제거된 배양액에 3배 부피의 에탄올을 첨가하고 4℃ 온도에서 2 시간 동안 정치시키고, 4 ℃ 온도에서 15,000 rpm으로 10분간 원심분리하여 히알루론산을 침전시켰다. 침전된 히알루론산을 건조시키고, 물에 녹인 후, HA quantitative Test Kit (Corgenix, Westminster, CO, USA)를 사용하여 히알루론산 함량을 측정하고, 항시 발현용 프로모터(constitutive expression promoter)인 P43을 포함하는 형질전환 균주가 생산하는 히알루론산의 함량(g/L)을 100으로 설정하고, 시험 프로모터를 포함하는 형질전환 균주가 생산하는 히알루론산 함량을 상대적으로 표시하여 그 % 비율을 표 5와 도 3에 나타냈다.3 times the volume of ethanol was added to the culture medium from which the strain was removed, and the mixture was left standing at a temperature of 4°C for 2 hours, and hyaluronic acid was precipitated by centrifugation at 15,000 rpm for 10 minutes at a temperature of 4°C. After drying the precipitated hyaluronic acid and dissolving it in water, the hyaluronic acid content was measured using a HA quantitative Test Kit (Corgenix, Westminster, CO, USA), and containing P43, which is a constant expression promoter. The content of hyaluronic acid produced by the transformed strain (g/L) is set to 100, and the content of hyaluronic acid produced by the transformed strain containing the test promoter is relatively displayed, and the percentages thereof are shown in Table 5 and FIG. 3. Showed.
프로모터Promoter 상대적 히알루론산의 생산량(%)Relative hyaluronic acid production (%)
P43P43 100.0 ± 4.2100.0 ± 4.2
PmsmPmsm 15.1 ± 1.915.1 ± 1.9
PpbpPpbp 3.9 ± 0.83.9 ± 0.8
PylbPylb 38.1 ± 2.338.1 ± 2.3
pyobpyob 31.6 ± 7.131.6 ± 7.1
PyqePyqe 134.3 ± 6.7134.3 ± 6.7
PyvlPyvl 15.0 ± 11.115.0 ± 11.1
PsigxPsigx 488.2 ± 13.4488.2 ± 13.4
도 3에는 각 프로모터를 포함하는 형질전환 균주가 생산하는 상대적 히알루론산의 함량을 그래프로 나타내었다. Psigx 프로모터(서열번호 62), Pyob 프로모터(서열번호 63), 및 pyqe 프로모터(서열번호 64)가 P43 프로모터 보다 발현양이 높았으며, 특히 Psigx 프로모터가 다른 프로모터에 비해 히알루론산 생산에 효과적임을 확인하였다. 이후 Psigx 프로모터가 클로닝된 플라스미드를 pSigx-hasA-RBS34-tuaD로 명명하였다. In Figure 3, the relative content of hyaluronic acid produced by the transformed strain containing each promoter is shown graphically. The Psigx promoter (SEQ ID NO: 62), the Pyob promoter (SEQ ID NO: 63), and the pyqe promoter (SEQ ID NO: 64) had higher expression levels than the P43 promoter, and it was confirmed that the Psigx promoter was more effective in producing hyaluronic acid than other promoters. . The plasmid cloned with the Psigx promoter was named pSigx-hasA-RBS34-tuaD.
실시예 3: Psigx 프로모터의 히알루론산 수율Example 3: Hyaluronic acid yield of Psigx promoter
IPTG유도형 프로모터인 Pgrac과, 실시예2에서 항시 발현용 프로모터로서 발현 효율이 높은 것으로 선별된 Psigx 프로모터의 발현 효율을 비교하기 위해서, pSigx-hasA-RBS34-tuaD 플라스미드의 Psigx 프로모터를 IPTG유도형 Pgrac 프로모터로 교체하여 pgrac-hasA-RBS34-tuaD를 제작하였다. In order to compare the expression efficiency of the IPTG-inducible promoter Pgrac and the Psigx promoter selected as a high expression efficiency in Example 2 at all times, the Psigx promoter of the pSigx-hasA-RBS34-tuaD plasmid was used as the IPTG-derived Pgrac Pgrac-hasA-RBS34-tuaD was produced by replacing with a promoter.
구체적으로, 프로모터 교체를 위해서 pHT01 플라스미드 (Mobitec)를 제한효소 NheI과 BamHI으로 절단하여 Laci와 Pgrac 프로모터를 분리하고, 동일한 제한효소로 절단되어 Psigx 프로모터가 제거된 pSigx-hasA-RBS34-tuaD에 T4 DNA 라이게이즈 (NEB)를 사용하여 연결하였다. 이를 E. coli DH5alpha (Enzynomics)에 도입하였고, 엠피실린이 포함된 평판배지에 도말하여 얻어진 엠피실린 내성 형질전환체로부터 Pgrac-hasA-RBS34-tuaD 플라스미드를 단리하였다. 단리된 플라스미드를 전기천공법에 의해 바실러스 2217 균주에 도입하고, 클로람페니콜 내성을 가지는 형질전환 균주를 완성하였다. Specifically, in order to replace the promoter, the pHT01 plasmid (Mobitec) was cut with restriction enzymes NheI and BamHI to separate the Laci and Pgrac promoters, and the T4 DNA was cut into pSigx-hasA-RBS34-tuaD with the same restriction enzyme removed to remove the Psigx promoter. Connection was made using ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the Pgrac-hasA-RBS34-tuaD plasmid was isolated from an ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The isolated plasmid was introduced into the Bacillus 2217 strain by electroporation, and a transformant strain having chloramphenicol resistance was completed.
완성된 IPTG유도형 Pgrac 프로모터에 의해 히알루론산 생산에 관련된 합성효소들의 발현이 조절되는 형질전환 균주와, 실시예 2에 따른 Psigx 프로모터에 히알루론산 생산관련 합성효소들이 항시 발현되는 균주의 히알루론산 생산 수율을 비교하였다. 실시예 2와 실질적으로 동일한 방법으로 각 균주를 배양하고, 배양 65시간에 배양액을 취하였다. 다만, IPTG유도형의 경우 합성효소들의 발현을 유도하기 위해 밤샘 배양된 균주를 수크로스 배지에 접종하고 2시간 후에 IPTG가 0.5mM이 되도록 IPTG를 첨가하였고, 유도형의 경우 72시간에 배양액을 취하였다. 실시예 2와 실질적으로 동일한 방법으로 두 균주의 히알루론산 생산량을 측정한 결과를 도 4에 나타내었다. Hyaluronic acid production yield of the transformed strain in which the expression of the synthetic enzymes related to hyaluronic acid production is regulated by the completed IPTG-derived Pgrac promoter, and the strains in which hyaluronic acid production-related synthases are always expressed in the Psigx promoter according to Example 2 Compared. Each strain was cultured in substantially the same manner as in Example 2, and the culture solution was taken at 65 hours of culture. However, in the case of the IPTG-derived type, the strain cultured overnight was inoculated into sucrose medium to induce the expression of syntheses, and IPTG was added so that IPTG became 0.5 mM after 2 hours, and in the case of the induced type, the culture solution was taken at 72 hours. Did. The results of measuring the hyaluronic acid production of the two strains in substantially the same manner as in Example 2 are shown in FIG. 4.
도 4에 나타낸 바와 같이, 두 균주는 거의 동일한 수율을 갖는 것임을 확인할 수 있었다. 이를 통해 고가의 IPTG를 사용하는 유도형에 비해 저렴하고 간단하게 히알루론산을 생산하는 방법을 구축하였다.As shown in Figure 4, it was confirmed that the two strains have almost the same yield. Through this, the method of producing hyaluronic acid was constructed cheaper and simpler than the induction type using expensive IPTG.
실시예 4: tuaD 유전자의 과발현용 RBS 선별Example 4: RBS screening for overexpression of tuaD gene
D-글루쿠론산은 히알루론산의 구성요소로 본래 바실러스가 가지고 있는 tuaD 유전자에 의해 생성될 수 있지만, 효율적인 히알루론산 생산을 위해서는 tuaD 유전자의 과발현이 필요하다. 이를 위해 전술한 바와 같이 hasA 유전자와 tuaD 유전자를 오페론 형태로 제작하여 hasA 유전자와 함께 tuaD 유전자의 과발현을 유도한다. 오페론을 구성하기 위해서는 tuaD 유전자 5'말단에 활성이 높은 RBS서열이 존재하여 tuaD 유전자의 번역을 조절해야 한다. RBS의 활성도는 주변 서열에 상황 의존적(sequence context-dependent)이므로, 조절받는 유전자의 서열에 따라 다를 수 있다 (Mutalik, 2013, Nature Methods, 10:347-353). 이러한 이유로 실제 tuaD의 번역에 유리하며 결과적으로 히알루론산 생산에 적합한 RBS 선별과정을 진행하였다.D-glucuronic acid is a component of hyaluronic acid and can be produced by the tuaD gene originally possessed by Bacillus, but over-expression of the tuaD gene is required for efficient hyaluronic acid production. To this end, as described above, the hasA gene and the tuaD gene are produced in the form of an operon to induce overexpression of the tuaD gene together with the hasA gene. In order to construct an operon, a highly active RBS sequence exists at the 5'end of the tuaD gene, and thus the translation of the tuaD gene must be controlled. Since the activity of RBS is sequence context-dependent to the surrounding sequence, it may vary according to the sequence of the gene to be regulated (Mutalik, 2013, Nature Methods, 10:347-353). For this reason, it is advantageous for the translation of the actual tuaD, and as a result, an RBS selection process suitable for hyaluronic acid production was performed.
구체적으로, RBS 선별에는 BioBrick Registry of standard biological parts로부터 6개의 합성 RBS (BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035), tuaD 유전자 본래의 RBS (tuaD RBS), 그리고 pET 와 같이 일반적으로 사용되는 플라스미드의 RBS (RBS)를 비교하였다. 상기 시험한 8개 RBS 서열을 표 3에 나타냈다. 각각의 RBS서열이 5'말단에 포함된 tuaD 유전자를 확보하기 위해서 표 4에 나타낸 프라이머 및 서열번호 38을 사용하여 바실러스 서브틸리스 168 균주 (Bacillus Genetic Stock Center)의 DNA를 주형으로 PCR을 진행하였다. Specifically, in the RBS screening, 6 synthetic RBSs (BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035), native RBS (tuaD RBS) from the BioBrick Registry of standard biological parts, and plasmids commonly used as pET RBS (RBS) was compared. Table 8 shows the 8 RBS sequences tested. In order to secure the tuaD gene in which each RBS sequence was included at the 5'end, PCR was performed using the DNA of Bacillus subtilis 168 strain (Bacillus Genetic Stock Center) as a template using the primers shown in Table 4 and SEQ ID NO: 38. .
증폭된 각각의 RBS를 포함한 tuaD유전자는 XbaI으로 절단하였고, XbaI과 SmaI으로 절단하여 RBS34-tuaD가 제거된 pSigx-hasA-RBS34-tuaD 플라스미드에 T4 DNA 라이게이즈 (NEB)를 사용하여 연결하였다. 이를 E. coli DH5alpha (Enzynomics)에 도입하였고, 엠피실린이 포함된 평판배지에 도말하여 얻어진 엠피실린 내성 형질전환체로부터 각각의 플라스미드를 단리하였다. 염기서열 분석을 통해 단리된 각각의 플라스미드들에 정상적으로 해당하는 RBS를 포함한 tuaD유전자가 클로닝 되었음을 확인하였다.The tuaD gene containing each amplified RBS was digested with XbaI, and then cut with XbaI and SmaI to connect pSigx-hasA-RBS34-tuaD plasmid with RBS34-tuaD removed using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and each plasmid was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. Through sequencing, it was confirmed that the tuaD gene containing RBS corresponding to each plasmid isolated was cloned.
명명denomination 서열번호Sequence number 염기서열 (5'->3')Base sequence (5'->3')
BBa_B0030-RBSBBa_B0030-RBS 6565 attaaagaggagaaatactagattaaagaggagaaatactag
BBa_B0031-RBSBBa_B0031-RBS 6666 tcacacaggaaacctactagtcacacaggaaacctactag
BBa_B0032-RBSBBa_B0032-RBS 6767 tcacacaggaaagtactagtcacacaggaaagtactag
BBa_B0033-RBSBBa_B0033-RBS 6868 tcacacaggactactagtcacacaggactactag
BBa_B0034-RBSBBa_B0034-RBS 6969 aaagaggagaaatactagaaagaggagaaatactag
BBa_B0035-RBSBBa_B0035-RBS 7070 attaaagaggagaatactagattaaagaggagaatactag
tuaD RBStuaD RBS 7171 gacactgcgaccattataaattggaagatcattttacaggagagggttgagcgctgacactgcgaccattataaattggaagatcattttacaggagagggttgagcgct
pET RBSpET RBS 7272 aataattttgtttaactttaagaaggagatatacataataattttgtttaactttaagaaggagatatacat
BBa_B0030-PCRBBa_B0030-PCR 5555 aatctagaattaaagaggagaaatactagatgaaaaaaatagctgtcaatctagaattaaagaggagaaatactagatgaaaaaaatagctgtc
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
BBa_B0031-PCRBBa_B0031-PCR 5656 aatctagatcacacaggaaacctactagatgaaaaaaatagctgtcaatctagatcacacaggaaacctactagatgaaaaaaatagctgtc
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
BBa_B0032-PCRBBa_B0032-PCR 5757 aatctagatcacacaggaaagtactagatgaaaaaaatagctgtcaatctagatcacacaggaaagtactagatgaaaaaaatagctgtc
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
BBa_B0033-PCRBBa_B0033-PCR 5858 aatctagatcacacaggactactagatgaaaaaaatagctgtcaatctagatcacacaggactactagatgaaaaaaatagctgtc
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
BBa_B0034-PCRBBa_B0034-PCR 3737 aatctagaaaagaggagaaatactagatgaaaaaaatagctgtcattgg aatctagaaaagaggagaaatactagatgaaaaaaatagctgtcattgg
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
BBa_B0035-PCRBBa_B0035-PCR 5959 aatctagaattaaagaggagaatactagatgaaaaaaatagctgtcaatctagaattaaagaggagaatactagatgaaaaaaatagctgtc
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
tuaD-RBS-PCRtuaD-RBS-PCR 6060 aatctagagacactgcgaccattataaattggaatctagagacactgcgaccattataaattgg
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
pET-RBS-PCRpET-RBS-PCR 6161 aatctagaaataattttgtttaactttaagaaggagatatacatatgaaaaaaatagctgtcaatctagaaataattttgtttaactttaagaaggagatatacatatgaaaaaaatagctgtc
3838 gggttataaattgacgcttcccaagtctttagccaattgggttataaattgacgcttcccaagtctttagccaatt
상기에서 얻어진, 서로 다른 RBS를 가지고 있는 플라스미드들을 전기천공법으로 바실러스 서브틸리스 2217 균주에 도입하고, 클로로암페니콜 내성을 가지는 형질전환 균주들을 제조하였다.다음으로, 실시예 2의 방법과 실질적으로 동일한 방법으로, 각각의 형질전환 균주들을 배양하고 배양액을 취하여 히알루론산 함량을 측정하였으며, pET 플라스미드의 RBS를 사용한 형질전환 균주가 생산하는 히알루론산의 함량(g/L)을 100으로 설정하고, 시험 RBS 서열을 포함하는 형질전환 균주가 생산하는 히알루론산 함량을 상대적으로 표시하여 그 결과를 표 7과 도 5에 나타냈다.Plasmids having different RBSs obtained above were introduced into Bacillus subtilis 2217 strain by electroporation, and transformed strains having chloroamphenicol resistance were prepared. Next, the method and practical method of Example 2 were prepared. In the same way, each transformed strain was cultured and the culture solution was taken to measure the hyaluronic acid content, and the content (g/L) of the hyaluronic acid produced by the transformed strain using RBS of the pET plasmid was set to 100, The hyaluronic acid content produced by the transformed strain containing the test RBS sequence is relatively displayed, and the results are shown in Table 7 and FIG. 5.
RBS 종류RBS type 상대적 히알루론산의 생산량(%)Relative hyaluronic acid production (%)
BBa_B0030-RBSBBa_B0030-RBS 83.6 ± 8.983.6 ± 8.9
BBa_B0031-RBSBBa_B0031-RBS 4.2 ± 1.44.2 ± 1.4
BBa_B0032-RBSBBa_B0032-RBS 4.7 ± 0.54.7 ± 0.5
BBa_B0033-RBSBBa_B0033-RBS 5.7 ± 0.95.7 ± 0.9
BBa_B0034-RBSBBa_B0034-RBS 123.3 ± 1.8123.3 ± 1.8
BBa_B0035-RBSBBa_B0035-RBS 80.5 ± 1.080.5 ± 1.0
tuaD RBStuaD RBS 75.7 ± 9.575.7 ± 9.5
pET RBSpET RBS 100.0 ± 6.4100.0 ± 6.4
BioBrick Registry of standard biological parts (http://parts.igem.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Community_Collection)의 비교 결과에 따르면 BBa_B0035가 BBa_B0034 (실시예 1-2의 RBS에 해당)에 비해 더욱 발현 효율이 우수한 것으로 알려져 있다. 그러나, 본 실시예의 실험결과에 따르면 RBS 자체 특성과 달리, 본 발명에 따른 발현시스템의 경우 BBa_B0034 RBS서열을 사용할 때 가장 높은 히알루론산 생산 수율을 확인하였다.According to the comparison result of BioBrick Registry of standard biological parts (http://parts.igem.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Community_Collection), BBa_B0035 has more expression efficiency compared to BBa_B0034 (corresponding to RBS of Example 1-2). It is known to be excellent. However, according to the experimental results of this example, unlike the characteristics of RBS itself, the expression system according to the present invention confirmed the highest yield of hyaluronic acid production when using the BBa_B0034 RBS sequence.
실시예 5: 생산된 히알루론산의 분자량 측정Example 5: Molecular weight measurement of the produced hyaluronic acid
실시예 2에 기재된 방법과 동일한 방법으로 생산된 히알루론산을 한외여과를 통해 정제한 후 분자량을 측정하였다. 먼저, 생산된 히알루론산을 정제하는 과정은 다음과 같다. 배양액을 10,000 rpm으로 10분간 원심분리 후 0.45 μm 필터를 통과시켜 균주를 제거하였다. 균주가 제거된 배양액을 컷-오프(cut-off)값이 100 kDa인 한외여과막으로 여과하여 산물을 얻었다. 상기 얻어진 전체 산물에서 1%(v/v) 농도가 되도록 브롬화세틸 트리메틸 암모늄을 첨가하고 1시간 교반 및 원심분리(7,000 rpm, 30분)하여 침전물을 획득하였다. 상기 침전물을 0.25M 요오드화 나트륨 용액에 10분간 교반하며 녹여 브롬화세틸 트리메틸 암모늄이 요오드와 나트륨과 반응하도록 하였다. 반응액을 원심분리(7,000rpm, 30분)하고 상등액을 취하여 브롬화세틸 트리메틸 암모늄과 요오드화 나트륨 반응물을 제거하였다. 상등액에 2% 활성탄소를 첨가하고 1시간동안 교반하여 불순물을 흡착시키고, 0.22 μm 필터를 통과시켜 정제 시료를 획득하였다. The hyaluronic acid produced in the same manner as the method described in Example 2 was purified through ultrafiltration, and then the molecular weight was measured. First, the process of purifying the produced hyaluronic acid is as follows. The culture solution was centrifuged at 10,000 rpm for 10 minutes and then passed through a 0.45 μm filter to remove the strain. The culture solution from which the strain was removed was filtered through an ultrafiltration membrane having a cut-off value of 100 kDa to obtain a product. Cetyl trimethyl ammonium bromide was added to a concentration of 1% (v/v) in the obtained total product, followed by stirring and centrifuging for 1 hour (7,000 rpm, 30 minutes) to obtain a precipitate. The precipitate was dissolved in a 0.25M sodium iodide solution for 10 minutes and dissolved to allow cetyl trimethyl ammonium bromide to react with iodine and sodium. The reaction solution was centrifuged (7,000 rpm, 30 minutes) and the supernatant was taken to remove the reactant of cetyl trimethyl ammonium bromide and sodium iodide. Purified samples were obtained by adding 2% activated carbon to the supernatant and stirring for 1 hour to adsorb impurities and passing through a 0.22 μm filter.
정제된 시료는 적외부스펙트럼을 통해 히알루론산 표준품 (sigma)과 일치함이 확인되었고, 스펙트럼 분석 결과를 도 6에 나타내었다. The purified sample was confirmed to be consistent with the hyaluronic acid standard (sigma) through an infrared spectrum, and the spectrum analysis results are shown in FIG. 6.
다음으로, 다각도 레이저광 산란 측정기 (MALLS, multi-angle laser light scattering)를 이용하여 정제시료의 분자량을 측정하였다. 측정 조건은 아래 표 8과 같으며 분석 결과는 도 7에 나타냈다. Next, the molecular weight of the purified sample was measured using a multi-angle laser light scattering (MALLS). Measurement conditions are shown in Table 8 below, and the analysis results are shown in FIG. 7.
도 7에 나타낸 다각도 레이저광 산란 측정결과, 정제된 히알루론산의 분자량은 초고분자 범위에 속하는 1,000 내지 7,000 kDa 범위에서 피크가 나타났으며, 특히 5,455 kDa에서 메인 피크가 측정되었다. 이러한 고분자 히알루론산은 저분자 히알루론산에 비해 보습 효과, 점도 상승, 관절 윤활 작용, 수분 흡수 능력, 탄성 능력 등이 우수한 특성을 가진다. 특히 본 발명의 발현 시스템을 이용하여 제작된 히알루론산과 같은 3000kDa 이상의 초고분자 히알루론산의 경우, 체내 분해 속도가 느려 유착 방지제로 사용될 수 있다. As a result of measuring the multi-angle laser light scattering shown in FIG. 7, the molecular weight of the purified hyaluronic acid showed a peak in the range of 1,000 to 7,000 kDa belonging to the ultra-high molecular range, and the main peak was measured at 5,455 kDa. The polymer hyaluronic acid has excellent properties such as moisturizing effect, viscosity increase, joint lubrication, water absorption ability, elasticity, etc., compared to low molecular hyaluronic acid. Particularly, in the case of ultra-high molecular weight hyaluronic acid of 3000 kDa or more, such as hyaluronic acid produced by using the expression system of the present invention, the decomposition rate in the body is slow and may be used as an anti-adhesion agent.
MALLS 측정기MALLS meter Wyatt Technology, DAWN HELEOS Wyatt Technology, DAWN HELEOS
칼럼column Ultrahydrogel analytical column 120, 120 7.8 x 300 mm (Waters, WAT011520)Ultrahydrogel analytical column 250, 250 7.8 x 300 mm (Waters, WAT011525)Ultrahydrogel analytical column 1000, 1000 7.8 x 300 mm (Waters, WAT011535)Ultrahydrogel analytical column 120, 120 7.8 x 300 mm (Waters, WAT011520)Ultrahydrogel analytical column 250, 250 7.8 x 300 mm (Waters, WAT011525)Ultrahydrogel analytical column 1000, 1000 7.8 x 300 mm (Waters, WAT011535)
칼럼 온도 Column temperature 30℃30℃
용출제Eluent 100mM sodium phosphate buffer pH7.2100mM sodium phosphate buffer pH7.2
유속Flow rate 0.5 mL/분0.5 mL/min
주입 부피Injection volume 100 μL100 μL
레이저 파장Laser wavelength 662.0 nm662.0 nm
라인 필터Line filter 0.22 ㎛0.22 μm
다각도 피팅 방법Multi-angle fitting method ZimmZimm

Claims (16)

  1. 작동 가능하도록 연결된, 전사 프로모터, 히알루론산 합성효소(hyaluronan synthase) 유전자, UDP-글루코스 6-디하이드로제나아제 유전자 발현용 리보솜 결합부위 및 UDP-글루코스 6-디하이드로제나아제 유전자를 포함하는, 바실러스속 균주에서 히알루론산 생산용 발현 시스템.Bacillus, comprising a transcriptional promoter, a hyaluronic acid synthase gene, a ribosome binding site for expression of the UDP-glucose 6-dehydrogenase gene, and a UDP-glucose 6-dehydrogenase gene, operably linked Expression system for producing hyaluronic acid in a strain.
  2. 제1항에 있어서, 상기 발현 시스템은 발현 유도제가 없이 항시 발현되는 히알루론산 합성효소를 생산하는 것인, 발현 시스템.The expression system of claim 1, wherein the expression system produces hyaluronic acid synthase that is always expressed without an expression inducer.
  3. 제1항에 있어서, 상기 발현 시스템은 바실러스 서브틸리스 또는 바실러스 리케니포르미스에서 히알루론산을 생산하는 것인, 발현 시스템.The expression system of claim 1, wherein the expression system produces hyaluronic acid in Bacillus subtilis or Bacillus licheniformis.
  4. 제1항에 있어서, 상기 전사 프로모터는 P43 프로모터 포함 발현 시스템을 갖는 형질전환 균주에 비해 히알루론산 생산량이 1.1 배 내지 10배인 프로모터인, 발현 시스템. The expression system of claim 1, wherein the transcription promoter is a promoter having a hyaluronic acid production amount of 1.1 to 10 times compared to a transformed strain having an expression system including a P43 promoter.
  5. 제1항에 있어서, 상기 전사 프로모터는 바실러스속 균주에서 항시 발현 프로모터(constitutive expression promoter)인 것인 발현 시스템.The expression system of claim 1, wherein the transcription promoter is a constitutive expression promoter in a Bacillus strain.
  6. 제1항에 있어서, 상기 전사 프로모터는 Psigx 프로모터, Pyob 프로모터, 또는 Pyqe 프로모터인 발현 시스템.The expression system of claim 1, wherein the transcription promoter is a Psigx promoter, a Pyob promoter, or a Pyqe promoter.
  7. 제1항에 있어서, 상기 리보솜 결합부위는 BBa_B0030(서열번호 65), BBa_B0031(서열번호 66), BBa_B0032(서열번호 67), BBa_B0033(서열번호 68), BBa_B0034(서열번호 69), 또는 BBa_B0035(서열번호 70)인 것인, 발현 시스템.According to claim 1, wherein the ribosome binding site is BBa_B0030 (SEQ ID NO: 65), BBa_B0031 (SEQ ID NO: 66), BBa_B0032 (SEQ ID NO: 67), BBa_B0033 (SEQ ID NO: 68), BBa_B0034 (SEQ ID NO: 69), or BBa_B0035 (SEQ ID NO: No. 70), the expression system.
  8. 제1항에 있어서, 상기 리보솜 결합부위(RBS)는 tuaD의 자체 RBS에 비해 1.1 내지 3배의 히알루론산 수율을 나타내는 것인, 발현 시스템.The expression system of claim 1, wherein the ribosome binding site (RBS) exhibits a hyaluronic acid yield of 1.1 to 3 times that of tuaD's own RBS.
  9. 제8항에 있어서, 상기 리보솜 결합부위는 서열번호 69 의 염기서열로 이루어지는 BBa_B0034인, 발현 시스템.The expression system of claim 8, wherein the ribosome binding site is BBa_B0034 consisting of the nucleotide sequence of SEQ ID NO: 69.
  10. 제1항에 있어서, 상기 UDP-글루코스 6-디하이드로제나아제 유전자는 바실러스 서브틸리스 유래의 tuaD 유전자인 것인, 발현 시스템.The expression system of claim 1, wherein the UDP-glucose 6-dehydrogenase gene is a tuaD gene derived from Bacillus subtilis.
  11. 제1항에 있어서, 상기 히알루론산 합성효소 유전자는 스트렙토코커스속 균주유래된 hasA인 것인, 발현 시스템.The expression system of claim 1, wherein the hyaluronic acid synthase gene is hasA derived from a strain of the genus Streptococcus.
  12. 제1항 내지 제11항 중 어느 한 항에 따른 히알루론산 생산용 발현 시스템을 포함하는 히알루론산 생산용 재조합 균주.A recombinant strain for producing hyaluronic acid comprising the expression system for producing hyaluronic acid according to any one of claims 1 to 11.
  13. 제11항에 있어서, 상기 균주는 바실러스 서브틸리스 또는 바실러스 리케니포르미스인 것인, 히알루론산 합성용 재조합 균주.The recombinant strain for synthesizing hyaluronic acid according to claim 11, wherein the strain is Bacillus subtilis or Bacillus licheniformis.
  14. 제1항 내지 제11항 중 어느 한 항에 따른 히알루론산 생산용 발현 시스템을 포함하는 히알루론산 생산용 재조합 균주를 배양하여 배양물을 얻는 단계 및 상기 배양물에서 히알루론산을 얻는 단계를 포함하는, 재조합 균주를 이용한 히알루론산의 생산 방법.A method of obtaining a culture by culturing a recombinant strain for producing hyaluronic acid comprising the expression system for producing hyaluronic acid according to any one of claims 1 to 11, and obtaining hyaluronic acid from the culture, Method for producing hyaluronic acid using a recombinant strain.
  15. 제14항에 있어서, 상기 균주는 바실러스 서브틸리스 또는 바실러스 리케니포르미스인 것인, 생산 방법.The method of claim 14, wherein the strain is Bacillus subtilis or Bacillus licheniformis.
  16. 제14항에 있어서, 상기 히알루론산은 분자량이 100 kDa 내지 10,000kDa범위를 갖는 것인 생산 방법.The production method according to claim 14, wherein the hyaluronic acid has a molecular weight in the range of 100 kDa to 10,000 kDa.
PCT/KR2019/015082 2018-12-10 2019-11-07 Expression system for hyaluronic acid production using non-pathogenic bacteria and hyaluronic acid production method using same expression system WO2020122430A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201980077146.7A CN113166735A (en) 2018-12-10 2019-11-07 Expression system for producing hyaluronic acid using non-pathogenic bacteria and method for producing hyaluronic acid using the same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0158627 2018-12-10
KR20180158627 2018-12-10
KR10-2019-0016267 2019-02-12
KR1020190016267A KR102152625B1 (en) 2018-12-10 2019-02-12 Expression system for production of hyaluronic acid by using non-pathogenic bacteria and method of preparing hyaluronic acid using the same

Publications (1)

Publication Number Publication Date
WO2020122430A1 true WO2020122430A1 (en) 2020-06-18

Family

ID=71076942

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/015082 WO2020122430A1 (en) 2018-12-10 2019-11-07 Expression system for hyaluronic acid production using non-pathogenic bacteria and hyaluronic acid production method using same expression system

Country Status (1)

Country Link
WO (1) WO2020122430A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030175902A1 (en) * 2001-12-21 2003-09-18 Novozymes Biotech, Inc. Methods for producing hyaluronan in a recombinant host cell
US20100136630A1 (en) * 2006-02-15 2010-06-03 Novozymes Biopolymer A/S Production of low molecular weight hyaluronic acid
CN104293726A (en) * 2014-10-17 2015-01-21 江南大学 Recombinant bacillus subtilis producing micromolecular hyaluronic acid
US20170073719A1 (en) * 2015-09-10 2017-03-16 Jiangnan University Method of constructing a recombinant Bacillus subtilis that can produce specific-molecular-weight hyaluronic acids
WO2017136795A1 (en) * 2016-02-04 2017-08-10 Synlogic, Inc. Bacteria engineered to treat diseases associated with tryptophan metabolism

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030175902A1 (en) * 2001-12-21 2003-09-18 Novozymes Biotech, Inc. Methods for producing hyaluronan in a recombinant host cell
US20100136630A1 (en) * 2006-02-15 2010-06-03 Novozymes Biopolymer A/S Production of low molecular weight hyaluronic acid
CN104293726A (en) * 2014-10-17 2015-01-21 江南大学 Recombinant bacillus subtilis producing micromolecular hyaluronic acid
US20170073719A1 (en) * 2015-09-10 2017-03-16 Jiangnan University Method of constructing a recombinant Bacillus subtilis that can produce specific-molecular-weight hyaluronic acids
WO2017136795A1 (en) * 2016-02-04 2017-08-10 Synlogic, Inc. Bacteria engineered to treat diseases associated with tryptophan metabolism

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SEGALL-SHAPIRO, THOMAS H ET AL.: "Engineered promoters enable constant gene expression at any copy number in bacteria", NATURE BIOTECHNOLOGY, vol. 36, no. 4, 19 March 2018 (2018-03-19), pages 352 - 358, XP055717604 *
YU , XIAOXIA ET AL.: "Identification of a highly efficient stationary phase promoter in Bacillus subtilis", SCIENTIFIC REPORTS, vol. 5, no. 18405, 2015, pages 1 - 9, XP055660977 *

Similar Documents

Publication Publication Date Title
AU2007214856B2 (en) Production of low molecular weight hyaluronic acid
AU2002366711B2 (en) Methods for producing hyaluronan in a recombinant host cell
WO2019027267A2 (en) Atp phosphoribosyltransferase mutant and l-histidine production method using same
US20050221446A1 (en) Methods for producing hyaluronic acid in a Bacillus cell
WO2014175655A1 (en) Psicose epimerase mutant and method for preparing psicose by using same
WO2018093153A1 (en) Novel d-psicose 3-epimerase and method for preparing d-psicose using same
KR20100017307A (en) Chondroitin-producing bacterium and method of producing chondroitin
WO2015056923A1 (en) Agarooligosaccharide hydrolase and method for producing 3,6-anhydro-l-galactose and galactose from agarose by using same
WO2017176010A1 (en) Novel method for purifying 3,6-anhydro-l-galactose by using microorganisms
Sumida-Yasumoto et al. Replication of ϕX174 DNA: In Vitro Synthesis of ϕX RFI DNA and Circular, Single-stranded DNA
Seong et al. Methylome analysis of two Xanthomonas spp. using single-molecule real-time sequencing
WO2017122931A1 (en) Mutant microorganism for producing l-cysteine and method for producing l-cysteine using same
WO2012087038A2 (en) Novel o-acetylhomoserine sulfhydrylase or variant thereof, and method for transforming methionine using same
WO2020122430A1 (en) Expression system for hyaluronic acid production using non-pathogenic bacteria and hyaluronic acid production method using same expression system
KR20200070968A (en) Expression system for production of hyaluronic acid by using non-pathogenic bacteria and method of preparing hyaluronic acid using the same
WO2020122429A1 (en) Hyaluronic acid synthase mutant protein and hyaluronic acid production method using same
KR102135044B1 (en) Mutant protein of hyaluronic acid synthase and method of producing hyaluronic acid using the system
WO2014171636A1 (en) Novel ribitol dehydrogenase and method for preparing l-ribulose using same
WO2015190633A1 (en) Mutant sugar isomerase with improved activity, derived from e. coli, and production of l-gulose using same
KR100330688B1 (en) Gene Coding for Heat-resistant Alanine Racemase of Aquifex pyrophilus, Heat-resistant Alanine Racemase Expressed therefrom, and Method for Preparing the Same
WO2023128004A1 (en) Novel promoter variant for constitutive expression and use thereof
WO2014182054A1 (en) Recombinant microorganism metabolizing 3,6-anhydride-l-galactose and a use thereof
EP4347625A1 (en) Recombinant expression of klebsiella pneumoniae o-antigens in escherichia coli
WO2018230952A1 (en) Novel polypeptide having turanose production activity and method for producing turanose using same
WO2016036209A1 (en) Microorganism with improved l-threonine productivity, and method for producing l-threonine by using same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19895953

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19895953

Country of ref document: EP

Kind code of ref document: A1