KR20200070968A - Expression system for production of hyaluronic acid by using non-pathogenic bacteria and method of preparing hyaluronic acid using the same - Google Patents

Abstract

The present invention relates to a hyaluronic acid synthase expression system which is capable of synthesizing hyaluronic acid in a non-pathogenic strain, and is always expressed without a derivative, a transformed strain comprising the expression system, and a method for producing hyaluronic acid using the transformed strain.

Description

Expression system for production of hyaluronic acid using non-pathogenic bacteria and production method of hyaluronic acid using the expression system {using the non-pathogenic bacteria and method of preparing hyaluronic acid using the same}

The present invention relates to an expression system using a constitutive expression promoter for producing hyaluronic acid using a non-pathogenic bacterium, a non-pathogenic bacterium comprising the expression system, and a method for producing hyaluronic acid using the same.

Hyaluronic acid is a biopolymer composed of disaccharide units of D-gluconic acid and N-acetyl-D-glucosamine, according to molecular weight, filler for molding, and treatment for arthritis And anti-adhesion agents.

The hyaluronic acid may be produced through fermentation of the Streptococcus spp. strain, and the Streptococcus strain is an infectious microorganism, and there is a possibility that pyrogens and the like are contaminated in the purification process. To improve this point, a method of producing hyaluronic acid by transforming a GRAS (Generally Recognized As Safe) strain with a recombinant vector has been developed.

In Patent Nos. 10-0879908 and 10-0885163 (US 2003/175902), the operon (Streptococcus) regulated by the promoter for constant expression ( Bacillus amyloliquefaciens alpha-amylase gene (amyQ) promoter) Hyaluronic acid synthase gene ( hasA ) from Streptococcus equisimilis , UDP-glucose 6-dehydrogenase gene from Bacillus subtilis (tuaD) And UDP-glucose pyrophosphorylase (consisting of UDP-glucose pyrophosphorylase (gtaB)) into the Bacillus subtilis genome to enable hyaluronic acid production.

Then, in US2016/0237465, in order to improve the hyaluronic acid production yield and hyaluronic acid molecular weight, the operon (Streptococcus jupiidemicus-derived hasA gene and Bacillus subtilis derived from IPTG induction and regulated by a powerful promoter (Pgrac)) Bacillus subtilis was transformed using a plasmid comprising the tuaD gene of .), and improved yield and molecular weight were shown.

However, in the case of the IPTG-derived type, not only the expensive derivative IPTG must be used, but also a production process for the treatment of the derivative must be additionally performed. Therefore, the expression form is always preferred if the hyaluronic acid yield is not low.

An object of the present invention is to provide an expression system or recombinant vector capable of synthesizing hyaluronic acid without a derivative in a non-pathogenic strain.

Another object of the present invention is to provide a method for producing hyaluronic acid using the strain and the strain transformed by the recombinant vector or the strain into which the expression system is introduced.

The present invention is an expression system for production of hyaluronic acid comprising a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene, preferably, a operably linked transcription promoter, a hyaluronic acid synthase gene UDP-glucose 6 -Dehydrogenase gene ribosome binding site (RBS), UDP-glucose 6- It provides an expression system for producing hyaluronic acid containing a 6-dehydrogenase gene.

The present inventors tried to make a system for constant expression with high production yield of hyaluronic acid (constitutive expression system), and selected optimal promoters through various promoter selection as described below, and also tuaD in an operon composed of hasA gene and tuaD gene As a result of comparing various ribosome binding sites (RBS) required for gene expression, appropriate sequences were identified. As a result, an expression system for producing hyaluronic acid composed of a promoter and RBS having a high production efficiency of hyaluronic acid and a non-pathogenic strain comprising the same, and a method for producing hyaluronic acid using the same, are developed when using the IPTG-derived Pgrac promoter. Thus, the present invention was completed.

An example of the present invention relates to an expression system for producing hyaluronic acid, comprising a transcription promoter, a ribosome binding site, a UDP-glucose 6-dihydrogenase gene, and a hyaluronic acid synthase gene, which are operably linked. The UDP-glucose 6-dehydrogenase gene and the hyaluronic acid synthase gene preferably constitute one operon, and more preferably, the hyaluronic acid synthase gene sequentially in the 5'to 3'direction, UDP-glucose RBS of the 6-dehydrogenase gene and UDP-glucose 6-dehydrogenase gene may be linked.

Another embodiment of the present invention relates to a transforming strain for producing hyaluronic acid, preferably a non-pathogenic bacterium, comprising the expression system for producing hyaluronic acid.

A further example relates to a hyaluronic acid-producing transforming strain comprising the expression system for producing hyaluronic acid, preferably a composition for producing hyaluronic acid comprising non-pathogenic bacteria. In addition, the present invention relates to a method for producing hyaluronic acid comprising the step of culturing a transforming strain for producing hyaluronic acid, preferably a non-pathogenic bacterium, comprising the expression system for producing hyaluronic acid.

The expression system for producing hyaluronic acid according to the present invention improves the production yield of hyaluronic acid and the molecular weight of hyaluronic acid, increases the safety in synthesizing hyaluronic acid, and reduces production cost by not using expensive IPTG derivatives. The hyaluronic acid produced according to the present invention has a merit of excellent moisturizing effect, viscosity increase, joint lubrication action, water absorption ability, elastic ability, etc. in a molecular weight range of 500 kDa to 10000 kDa.

Hereinafter, the present invention will be described in more detail.

An example of the present invention is an expression system for producing hyaluronic acid, preferably comprising a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene. It relates to an expression system for producing hyaluronic acid comprising a transcriptional promoter, a ribosome binding site (RBS), a UDP-glucose 6-dehydrogenase gene, and a hyaluronic acid synthase gene, which are operably linked.

The expression system for producing hyaluronic acid provided in the present invention includes both the UDP-glucose 6-dihydrogenase and hyaluronic acid synthase gene necessary for the synthesis of hyaluronic acid, and provides the RBS and constitutive expression promoters required for expression of the genes. By providing, it is possible to produce hyaluronic acid without a separate derivative.

The expression system for producing hyaluronic acid according to the present invention may be applied to a strain of the genus Bacillus, and may be, for example, Bacillus subtilis or Bacillus licheniformis, but is not limited thereto.

The transcription promoter applicable to the expression system of the present invention may be a constitutive expression promoter used in Bacillus strains, and the expression system produces hyaluronic acid synthase that is always expressed without an expression inducer. In addition, the transcription promoter may be one having a high transcription level having a hyaluronic acid production amount of 1.1 to 10 times compared to a transformed strain having an expression system including the P43 promoter.

The constant expression promoter may be, for example, P43, Pmsm, Ppbp, Pylb, Pyob, Pyqe or Pyvl, preferably Psigx, Pyob, or Pyqe, but is not limited thereto, and compared to an inducible promoter. Any similar or high hyaluronic acid yield can be obtained and used without limitation. The Psigx promoter may be obtained by PCR from the genome of Bacillus subtilis 168 strain (Bacillus Genetic Stock Center) with primers of SEQ ID NOs: 53 and 54. The Psigx, Pyob, or Pyqe promoter may each include a nucleotide sequence of SEQ ID NO: 62, SEQ ID NO: 63, or SEQ ID NO: 64, respectively. Specific examples of the promoters usable in the present invention are shown in Table 1 below, and specific primer sets used for the production of each promoter are shown in Table 2 below.

denomination SEQ ID NO Sequence Psigx_promoter 62 aggttataaatttgaggtcggcgctgaatgaaattttggaaaagcgtagtaggcaagctgtggtttacgatcctttcactcgtcttgatcgtattgttcattttaacggttcttttgctggagtttattgaaaactaccatgtggaagaagctgagaatgatttaacacagcttgcgaataaagttgctgtcatcctagaaaatcacgaggaccaggcactggcaaggtcaatcacttgggaactcgctgataacttaacaagcattgccatcatccaggatgagaagaaccactggtattctccgaatgataaaaatcgcctgtcgtctattacggttgagcaaatacagcatgacaaagacttaaataaagctctcaaagaccataaaaaagtaagcaaacggacgggactgagcgatacagacacggataatgaacgcctgattgtaggtgtcccgtatgaaaaagacggaaagaaaggcatggtctttttatcccagtctttgcttgccgttaaagatacaacaaaacatacgacccgctatatttttcttgccgctggaattgcgattgtgctgaccacatttttcgcattctttttatcaagcagggtcacgtaccctctccgaaaaatgagagaaggcgcgcaggatttggcgaagggcaagttcgatacaaaaatcccgattttaactcaggatgaaatcggtgaactggcgaccgcttttaatcaaatgggccggcagcttaactttcatatcaatgcgctcaatcaagaaaaagagcagctttctaacattttgagcagtatggctgacggggttattaccattaatattgacggtacgattcttgtgaccaacccgccggctgaacgttttcttcaggcttggtattatgaacagaacatgaatatcaaagaaggcgacaatcttccgcctgaagcaaaagagctgtttcaaaacgctgtcagcactgaaaaagaacaaatgattgaga tgacgcttcaaggcagatcatgggtgcttttgatgtcgccgctttatgcggaatcgcacgtcagaggagcggttgccgtactgcgtgacatgacagaagaacgccgccttgataagctgcgggaggactttatcgcaaatgtcagtcatgagctgagaacaccgatctccatgcttcagggatacagtgaagcaattgtcgatgacattgcaagctctgaagaagaccggaaagaaattgcccaaatcatttatgacgaatcgctccgaatgggccgtttagttaatgatttgcttgatttagcccgaatggaatcaggccatacaggcttacattatgaaaaaatcaatgtgaatgagtttttagaaaagatcattcggaagttttccggtgttgcgaaagaaaaaaatattgctttagatcatgacatttctctcacagaagaggaatttatgtttgatgaagacaagatggagcaggtatttaccaatttgattgataacgcgctgcggcatacttcagccggcggcagtgtctccatttcagtccattctgtgaaggatggattgaaaattgatatcaaagactccgggtctggcataccggaagaagatctgccatttatctttgagcggttttataaggcagataaagcgcggacaaggggcagagcaggaaccgggttagggctggctatcgttaaaaatatcgtggaagcccacaacggatcaattactgtgcacagccgaatagataaaggaacaacattttctttttatattccgacaaaacggtaaaatcgagtctgaatttgccgaagaatcttgttccataagaaacacccgctgactgagcgggtgtttttttaatagccaacattaataaaatttaaggatatgttaatataaattcccttccaaattccagttactcgtaatatagttgtaatgtaacttttcaagctattcatacgacaaaaaagtgaacggaggggtttcaa Pyob_promoter 63 attcggcgttttggttttaggctacaactttgatcatgcatcagttgtaaatagaactaatgaatataaagaacactatggccttactgatggacttgtggttattgaagatgttgattactttgcttactgtctagatacaaataaaatgaaagacggagaatgccctgtagttgaatgggatagggtaattggttatcaagatactgttgcagacagctttattgaatttttttataataagattcaggaagcgaaagatgactgggatgaggatgaagactgggacgattaagcaaaagtattgctatagcgcaatagaaggcttgagttgcacatcctcaatctaaataaaataagctctcgcaatgagagcttattttattggattaaataattaaagtgacagaagttttctagtcccgttttatatgaaaccttttttattttagcccgtattaaaagtaaattcagagagaaggggagaagcttaa Pyqe_promoter 64 cttcttgagcgtctcaaccaggatatgaagctgtatatgaaaaaccgtgagaaagacaaactgactgtcgttcgaatggttaaggcttcacttcaaaatgaagcaattaagcttaagaaagacagtttgaccgaggatgaggaactcactgtcctttctcgtgaacttaagcaacgtaaagactccctccaggaattttcaaacgctaatcgtttagatttagtagataaagttcaaaaagagctggacattttagaagtttatttacctgagcagctgtcagaagaagagctgcgtacaatcgtaaatgaaaccatcgcggaggtcggtgcgagctcaaaagcggacatgggcaaagtgatgggggcaattatgcctaaagtaaaaggtaaagctgacggaagtttaattaataagcttgtgagcagtcaactgtcttaaatggcaaagaaaaggacatctttctaagagagatgtctttttttatacataaaaaaatgaaacctttgatacatttgttacgtatgaagagaaggcacttattataaaaggaaggagggatacaccgcccttgcttcaaatcaaagga

Promoter Sequence number Base sequence (5'-> 3') P43 39 gatcgctagctgataggtggtatgttttcg 40 gatcggatccgtgtacattcctctcttacctataa Pmsm 41 gatcgctagcagtgtctgcgaaaacattac 42 gatcggatccctaacatccccctttgttat Ppbp 43 gatcgctagcagatggcaagttagttacgc 44 gatcggatcctcctccacctcccatatctc Pylb 45 gatcgctagccatcgtcgaacgcgctccat 46 gatcggatccacgttctacctttgtcaaacaa pyob 47 gatcgctagcattcggcgttttggttttaggc 48 gatcggatccttaagcttctccccttctct Pyqe 49 gatcgctagccttcttgagcgtctcaacca 50 gatcggatcctcctttgatttgaagcaagg Pyvl 51 gatcgctagcttcaaaacaaaaaaggcaagat 52 gatcggatccttcattccacactcctattg Psigx 53 gatcgctagcaggttataaatttgaggtcggcg 54 gatcggatccttgaaacccctccgttcacttt

In one embodiment of the present invention, as a result of transforming a vector containing an operon using the Psigx promoter into Bacillus subtilis, the hyaluronic acid yield was almost the same as when using an inducible promoter requiring an IPTG derivative (FIG. 4). Accordingly, it can be seen that the Psigx promoter is a promoter for constant expression suitable for hyaluronic acid production.

The transcription promoter is 1.1 to 10 times, 1.15 to 10 times, 1.5 to 10 times, 2 to 10 times, 3 to 10 times, 4 to 10 times the hyaluronic acid production amount compared to a transformed strain having an expression system containing the P43 promoter. Pear, 5-10 times, 1.1-9 times, 1.15-9 times, 1.5-9 times, 2-9 times, 3-9 times, 4-9 times, 5-9 times, 1.1-8 times, 1.15-8 Pear, 1.5-8 times, 2-8 times, 3-8 times, 4-8 times, 5-8 times, 1.1-7 times, 1.15-7 times, 1.5-7 times, 2-7 times, 3-7 Pear, 4 to 7 times, 5 to 7 times, 1.1 to 6.5 times, 1.15 to 6.5 times, 1.5 to 6.5 times, 2 to 6.5 times, 3 to 6.5 times, 4 to 6.5 times, 5 to 6.5 times, 1.1 to 6 times Pear, 1.15 to 6 times, 1.5 to 6 times, 2 to 6 times, 3 to 6 times, 4 to 6 times, 5 to 6 times, 1.1 to 5.5 times, 1.15 to 5.5 times, 1.5 to 5.5 times, 2 to 5.5 times It may be a fold, 3 to 5.5 fold, 4 to 5.5 fold, or 5 to 5.5 fold promoter.

The ribosome binding site (RBS) applicable to the expression system of the present invention is capable of producing hyaluronic acid in Bacillus by expressing the tuaD gene together with the hasA gene. The RBS may be capable of translating the UDP-glucose 6-dehydrogenase coding gene to a high level, and the ribosome binding site is 1.1 to 3 times, 1.15 to 3 times, and 1.2 to 1 when compared with the tuaD RBS. 3 times, 1.1 to 2.5 times, 1.15 to 2.5 times, 1.2 to 2.5 times, 1.1 to 2 times, 1.15 to 2 times, 1.2 to 2 times, 1.1 to 1.5 times, 1.15 to 1.5 times, 1.15 to 1.5 times, 1.1 to It may have a hyaluronic acid yield of 1.3 times, 1.15 to 1.3 times, or 1.2 to 1.3 times.

For example, the RBS, BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035, RBS of the tuaD gene (tuaD RBS), or may be RBS of the pET plasmid, each comprising a nucleotide sequence of SEQ ID NOs: 65-72 It may be, and if specifically indicated, it is as shown in Table 3 below.

denomination SEQ ID NO Sequence BBa_B0030-RBS 65 attaaagaggagaaatactag BBa_B0031-RBS 66 tcacacaggaaacctactag BBa_B0032-RBS 67 tcacacaggaaagtactag BBa_B0033-RBS 68 tcacacaggactactag BBa_B0034-RBS 69 aaagaggagaaatactag BBa_B0035-RBS 70 attaaagaggagaatactag RBS_tuaD 71 gacactgcgaccattataaattggaagatcattttacaggagagggttgagcgct RBS_pET 72 aataattttgtttaactttaagaaggagatatacat

In one embodiment of the present invention, when BBa_B0034 was used as RBS, it exhibited a better yield than when using tuaD RBS, and unlike BBA_B0035 was previously known to exhibit superior expression efficiency compared to BBa_B0034, the BBa_B0034 RBS sequence was used. When it showed the highest yield of hyaluronic acid production (Fig. 5).

The expression system for producing hyaluronic acid according to the present invention includes a UDP-glucose 6-dehydrogenase gene and a hyaluronic acid synthase gene, and the two genes preferably constitute one operon, and more preferably It may be an operon to which the hyaluronic acid synthase gene, RBS of the UDP-glucose 6-dehydrogenase gene, and the UDP-glucose 6-dehydrogenase gene are sequentially connected in the 5'to 3'direction.

The UDP-glucose 6-dehydrogenase gene according to the present invention may be, for example, a tuaD gene or a variant thereof. The tuaD gene may be a tuaD gene derived from a species known to have a tuaD gene, without limitation, and may be, for example, a Bacillus strain, preferably a tuaD gene derived from Bacillus subtilis. The tuaD gene may be a tuaD gene of Bacillus subtilis 2217 strain, but is not limited thereto, and may be a tuaD gene into which an appropriate mutation is introduced, if necessary, of UDP-glucose 6-dehydrogenase. It can be freely modified and used within a range that does not affect the activity. In one embodiment of the present invention, the tuaD gene may include the nucleotide sequence of SEQ ID NO: 73.

In one embodiment of the present invention, the ribosomal binding site and tuaD were obtained from a Bacillus subtilis 2217 strain through a polymerase chain reaction (PCR) using primer pairs of SEQ ID NOs: 37 and 38.

The hyaluronic acid synthase gene may be, for example, a hasA gene or a variant gene thereof. The hasA gene may use a hasA gene derived from a species known to have a hasA gene without limitation, for example, a strain of the genus Streptococcus, preferably a strain derived from Streptococcus juepidemicus. The mutant gene of the hasA gene may include a mutation on all genes in a range in which hyaluronic acid synthesis activity is maintained. In one embodiment of the present invention, the hasA gene may be a gene encoding a protein consisting of the amino acid sequence of SEQ ID NO: 74 or 76, and preferably may include the nucleotide sequence of SEQ ID NO: 75 or 77.

In one embodiment of the present invention, as the hyaluronic acid synthase gene, a hasA gene is obtained through a PCR-based two-step DNA synthesis method using the primers of SEQ ID NOs: 1 to 36 (Table 4) from Streptococcus jupipidemicus. Did.

Specifically, DNA fragments 1 were prepared using primers of SEQ ID NOs: 1 to 12, and DNA fragments 2 and 3 were produced using SEQ ID NOs: 12 to 24 and SEQ ID NOs: 25 to 36, respectively. In order to obtain the full length hasA gene, the obtained DNA fragment 1, fragment 2 and fragment 3 were mixed and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36.

denomination order
number hasA CDS
Amplification site Base sequence (5'-> 3') hasA_frag1_forward1 One (1~42) cgggatccatgagaacattaaaaaacctcataactgttgtggcctttagt hasA_frag1_forward2 2 (28-77) gttgtggcctttagtattttttgggtactgttgatttacgtcaatgttta hasA_frag1_forward3 3 (63-112) ttacgtcaatgtttatctctttggtgctaaaggaagcttgtcaatttatg hasA_frag1_forward4 4 (98~147) gcttgtcaatttatggctttttgctgatagcttacctattagtcaaaatg hasA_frag1_forward5 5 (133-182) ctattagtcaaaatgtccttatcctttttttacaagccatttaagggaag hasA_frag1_forward6 6 (168~217) gccatttaagggaagggctgggcaatataaggttgcagccattattccct hasA_frag1_reverse1 7 (203~252) ggtctctagcaatgactcagcatcttcgttataagagggaataatggctg hasA_frag1_reverse2 8 (238-287) gctaggggataggtttgctgctgaacactttttaaggtctctagcaatga hasA_frag1_reverse3 9 (273~322) catcagcacttccatcgtcaacaacataaatttctgctaggggataggtt hasA_frag1_reverse4 10 (308-357) acgcacatagtcttcaatgcgcttaatacctgtctcatcagcacttccat hasA_frag1_reverse5 11 (343~392) tgaacaatgacattgcttgataggtcaccagtgtcacgcacatagtcttc hasA_frag1_reverse6 12 (378~427) gtgcatgacgctttccttgatttttctctgaccgatgaacaatgacattg hasA_frag2_forward1 13 (413-462) gaaagcgtcatgcacaggcctgggcctttgaaagatcagacgctgatgtc hasA_frag2_forward2 14 (448~497) tcagacgctgatgtctttttgaccgttgactcagatacttatatctaccc hasA_frag2_forward3 15 (483~532) tacttatatctaccctgatgctttagaggagttgttaaaaacctttaatg hasA_frag2_forward4 16 (518~567) taaaaacctttaatgacccaactgtttttgctgcgacgggtcaccttaat hasA_frag2_forward5 17 (553~602) acgggtcaccttaatgtcagaaatagacaaaccaatctcttaacacgctt hasA_frag2_forward6 18 (588~637) tctcttaacacgcttgacagatattcgctatgataatgcttttggcgttg hasA_frag2_reverse1 19 (623~672) aaggatattacctgtaacggattgggcagctcgttcaacgccaaaagcat hasA_frag2_reverse2 20 (658~707) tcgcgtctgtaaacgctaagcggacctgagcaaacaaggatattacctgt hasA_frag2_reverse3 21 (693~742) ggttgatgtatctatctatgttaggaacaaccacctcgcgtctgtaaacg hasA_frag2_reverse4 22 (728~777) atcaccaatacttacaggaatacccaggaaggtctggttgatgtatctat hasA_frag2_reverse5 23 (763~812) cctaaatcagttgcatagttggtcaagcacctgtcatcaccaatacttac hasA_frag2_reverse6 24 (798~847) taatacatttagcagtggattgataaacagtctttcctaaatcagttgca hasA_frag3_forward1 25 (833~882) ctgctaaatgtattacagatgttcctgacaagatgtctacttacttgaag hasA_frag3_forward2 26 (868~917) tctacttacttgaagcagcaaaaccgctggaacaagtccttctttagaga hasA_frag3_forward3 27 (903~952) gtccttctttagagagtccattatttctgttaagaaaatcatgaacaatc hasA_frag3_forward4 28 (938~987) aaatcatgaacaatccttttgtagccctatggaccatacttgaggtgtct hasA_frag3_forward5 29 (973~1022) atacttgaggtgtctatgtttatgatgcttgtttattctgtggtggattt hasA_frag3_forward6 30 (1008~1057) ttctgtggtggatttctttgtaggcaatgtcagagaatttgattggctca hasA_frag3_reverse1 31 (1043~1092) aacaatgaagataatcaccagaaaggctaaaaccctgagccaatcaaatt hasA_frag3_reverse2 32 (1078~1127) tgcttaagcatgtaatgaatgttccgacacagggcaacaatgaagataat hasA_frag3_reverse3 33 (1113~1162) ccccataaaacggagataacaagaaggacagcgggtgcttaagcatgtaa hasA_frag3_reverse4 34 (1148~1197) taatttcaagggctgtaggacaaacaaatgcagcaccccataaaacggag hasA_frag3_reverse5 35 (1183~1232) ccccagtcagcatttctaatagtaaaaagagaatataatttcaagggctg hasA_frag3_reverse6 36 (1218~1254) gctctagattataataattttttacgtgttccccagtcagcattt

An example of the present invention may be a transforming strain or a recombinant strain for producing hyaluronic acid including the expression system for producing hyaluronic acid.

The strain may be a GRAS grade strain, and may be a Gram-positive bacterium, for example, Bacillus strain, preferably Bacillus subtilis or Bacillus licheniformis . By using a strain of GRAS grade, the safety during hyaluronic acid synthesis can be increased. In an embodiment of the present invention, the expression system for producing hyaluronic acid was introduced into the Bacillus subtilis 2217 strain to obtain a hyaluronic acid producing strain without a derivative such as IPTG.

The present invention relates to a method for producing hyaluronic acid using a non-pathogenic bacterium comprising culturing a transforming strain for producing hyaluronic acid containing the hyaluronic acid expression system. More specifically, the method for producing hyaluronic acid according to the present invention may further include the step of separating and/or purifying hyaluronic acid in addition to the step of culturing the transforming strain for producing hyaluronic acid, for example, in a culture medium. The method may include removing the strain and precipitating hyaluronic acid in the culture medium from which the strain is removed.

In the transforming strain for producing hyaluronic acid and the method for producing hyaluronic acid, a transcription promoter, a hyaluronan synthase gene, a ribosome binding site for UDP-glucose 6-dehydrogenase gene expression, and UDP-glucose 6-di Hydrogenase genes and the like are as described above.

The method for producing hyaluronic acid using the recombinant strain according to the present invention may exhibit a hyaluronic acid yield equal to or higher than that of using an inducible promoter through an expression promoter at all times without a derivative such as IPTG.

The step of culturing the strain may use sucrose as a carbon source, but is not limited thereto. The culture of the strain, the removal of the strain and the precipitation step of hyaluronic acid can be performed by methods known in the art, and can be used by appropriate modifications by a person skilled in the art as necessary.

The method of producing hyaluronic acid may further include a step of concentration, purification, or concentration and purification of hyaluronic acid after the precipitation step of hyaluronic acid.

The hyaluronic acid obtained using the above production method may have a molecular weight of 100 to 10,000 kDa, 500 to 10,000 kDa, 500 to 8,000 kDa, 3,000 to 8,000 kDa, or 5,000 to 6,000 kDa.

In one embodiment of the present invention, it was possible to obtain a hyaluronic acid having a maximum peak of 5,455 kDa from Bacillus bacteria incorporating the hyaluronic acid synthesis system. The polymer hyaluronic acid has excellent properties such as moisturizing effect, viscosity increase, joint lubrication, water absorption ability, elasticity, etc., compared to low molecular hyaluronic acid. Therefore, high-molecular hyaluronic acid has high utility value as a medicine, such as injections for knee joints, eye drops, and fillers for molding. In particular, ultra-high molecular weight hyaluronic acid of 3000 kDa or higher, such as hyaluronic acid produced by using the expression system provided by the present invention, can be used as an anti-adhesion agent due to a slow decomposition rate in the body.

In addition, in order to convert low-molecular hyaluronic acid to high-molecular hyaluronic acid, there is a hassle of processing a crosslinking agent or a compound and undergoing a complicated process, whereas the process of converting high-molecular hyaluronic acid to low-molecular hyaluronic acid is relatively easy using physical or chemical methods. It has one advantage.

The strain for synthesizing hyaluronic acid of the present invention is a non-pathogenic strain, which increases safety during hyaluronic acid synthesis, and does not use expensive IPTG derivatives as an expression inducing agent, thereby reducing production costs.

1 shows a vector map of the pHCMC02-hasA-RBS34-tuaD plasmid prepared according to an example of the present invention.
Figure 2 is a schematic diagram of the cloning process for the production of pHCMC02-hasA-RBS34-tuaD plasmid prepared according to an example of the present invention.
3 is a graph showing the concentration of hyaluronic acid produced after introducing an expression system including various promoters into a Bacillus strain according to an embodiment of the present invention.
4 is a graph showing the concentration of hyaluronic acid produced in the case of using the always-expressed promoter Psigx and the IPTC-inducible promoter Pgrac according to an embodiment of the present invention.
5 is a graph showing the relative concentration of hyaluronic acid produced when various ribosome binding sites are used according to an embodiment of the present invention.
6 is a diagram showing the results of infrared spectrum analysis of hyaluronic acid purified from a culture of a recombinant strain according to an example of the present invention and a commercially available hyaluronic acid standard.
7 is a result of measuring the molecular weight of hyaluronic acid purified from a culture medium of a recombinant strain according to an embodiment of the present invention with a multi-angle laser light scattering meter (MALLS).

The present invention will be described in more detail through the following examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not limited by the description of the following examples.

Example 1: Cloning of hasA and tuaD operons

1-1: Cloning of the hyaluronic acid synthase gene (hasA)

Streptococcus zooepidemicus-derived hyaluronic acid synthase gene (hasA, Genbank No. AY173078 base sequences 1 to 1254) (SEQ ID NO: 75) shows the primers from SEQ ID NOS: 1 to 36 shown in Table 4 It was synthesized by PCR-based two-step DNA synthesis (PTDS; Xiong, 2004, Nucleic Acids Research 32:e98). Specifically, DNA fragments 1 were prepared using SEQ ID NOs: 1 to 12, and DNA fragments 2 and 3 were prepared using SEQ ID NOs: 13 to 24 and 25 to 36, respectively. To obtain the full length hasA gene, the obtained DNA fragment 1, fragment 2 and fragment 3 were mixed and PCR was performed using a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 36 to obtain the hasA gene. PCR conditions were performed 25 times in total for 15 seconds at 94°C, 15 seconds at 55°C, 15 minutes at 55°C, and stretching at 72°C for 1 minute and 30 seconds using Veriti® Thermal Cycler (applied biosystem). As the hyaluronic acid synthase gene, a hasA gene derived from Streptococcus jupie epidemius was used, and the full length hasA gene was obtained using primers (SEQ ID NO: 4) of SEQ ID NOS: 1 to 36 in the manner described above. The obtained full-length hasA gene was digested with restriction enzymes BamHI and XbaI, and linked to a pHCMC02 (Bacillus Genetic Stock Center) plasmid digested with BamHI and XbaI using T4 DNA ligase (NEB). The vector was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pHCMC02-hasA was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The obtained plasmid pHCMC02-hasA was confirmed that the normal hasA gene was cloned through sequencing.

1-2: Cloning of the UDP-glucose 6-dehydrogenase gene (tuaD)

In order to produce hyaluronic acid in Bacillus strains, hyaluronic acid synthase alone is insufficient, and UDP-glucose 6-dehydrogenase must be simultaneously expressed (Winder, 2005, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 71:3747-3752), in order to do this, an operon consisting of hasA and tuaD must be completed.

In order to construct the operon, since the ribasome binding site (RBS) must be present in front of the tuaD gene, the DNA of Bacillus subtilis 2217 strain (Bioresource Center (KCTC)) is used as a template for the RBS_tuaD_forward primer of SEQ ID NO: 37 and SEQ ID NO: 38. Using the RBS_tuaD_reverse primer, the tuaD gene was amplified to include RBS34 (BioBrick BBa_B0034) at the 5'-end of the tuaD gene. PCR was performed 30 times in total by denaturing at 94°C for 15 seconds, binding at 55°C for 15 seconds, and stretching at 72°C for 1 minute and 30 seconds using a Veriti® Thermal Cycler (applied biosystem).

SEQ ID NO: 37: 5'-aatctagaaaagaggagaaatactagatgaaaaaaatagctgtcattgg-3'

SEQ ID NO: 38: 5'-gggttataaattgacgcttcccaagtctttagccaatt-3'

The amplified RBS34-tuaD gene was digested with restriction enzymes XbaI, and linked to pBluescriptII SK+ (Stratagene) plasmids cut with XbaI and SmaI using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pBSIISK-RBS34-tuaD was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The obtained plasmid pBSIISK-RBS34-tuaD was analyzed by sequencing to Genbank No. It was confirmed that the base sequences of AF015609 3599 to 4984 bp (protein coding region of the tuaD gene, SEQ ID NO: 73) were cloned normally.

1-3: Cloning of hasA and tuaD operons

To complete the operon composed of hasA and tuaD genes, the pBSIISK-RBS34-tuaD obtained in Example 1-2 was digested with restriction enzymes XbaI and SmaI, and the truncated RBS34-tuaD gene was treated with the same restriction enzyme. The pHCMC02-hasA plasmid obtained in 1-1 was ligated using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the plasmid pHCMC02-hasA-RBS34-tuaD plasmid was isolated from the ampicillin resistant transformant obtained by plating on a plate medium containing ampicillin. 1 and 2 show schematic diagrams of the vector map and cloning process for the pHCMC02-hasA-RBS34-tuaD, respectively.

Example 2: Selection of a promoter for the expression of hasA-tuaD operon

In the plasmid pHCMC02-hasA-RBS34-tuaD prepared in Example 1, the expression of the hasA-tuaD operon is regulated by the PlepA promoter, which is known to have weak activity. Accordingly, the promoter having high hasA-tuaD operon expression activity was selected by replacing the PlepA promoter with various promoters. The candidate promoters were selected as those having higher expression activity than P43, which is a constitutive expression promoter used in Bacillus strains (Yu, 2015, Scientific Reports, 5:18405; Song, 2016, PLoS One. 11:e0158447).

To prepare a plasmid regulated by each of the tested promoters, each promoter was amplified by PCR using the primers shown in Table 2 above as a template for Bacillus subtilis 168 strain DNA (Bacillus Genetic Stock Center). Specifically, forward and reverse primers of the PP43 promoter (SEQ ID NOs: 39 and 40), forward and reverse primers of the Pmsm promoter (SEQ ID NOs: 41 and 42), forward and reverse primers of the Ppbp promoter (SEQ ID NOs: 43 and 44), Forward and reverse primers of the Pylb promoter (SEQ ID NOs: 45 and 46), forward and reverse primers of the pyob promoter (SEQ ID NOs: 47 and 48), forward and reverse primers of the Pyqe promoter (SEQ ID NOs: 49 and 50), and Pyvl promoter Forward and reverse primers (SEQ ID NOs: 51 and 52), forward and reverse primers (SEQ ID NOs: 53 and 54) of the Psigx promoter were used.

Each promoter amplified through PCR was digested with restriction enzymes NheI and BamHI, and linked to pHCMC02-hasA-RBS34-tuaD of Example 1 digested with the same restriction enzyme using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and each plasmid was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. Through sequencing, it was confirmed that each promoter was cloned normally into each isolated plasmid.

Plasmids having different promoters were introduced into the Bacillus 2217 strain by electroporation (Sun, 2015, Applied Microbiology and Biotechnology, 99:5151-5162) to prepare transforming strains having chloroamphenicol resistance.

Next, each transformed strain was inoculated into LB medium and cultured overnight. 50 mL of 50 mM potassium phosphate (pH7.) containing 20 mL sucrose medium (50 g sucrose per 1 L, 20 g yeast extract, 1.5 g magnesium sulfate (MgSO4)) in a 250 mL Erlenmeyer flask containing 0.2 mL of overnight cultured strain. After inoculation at 0)), the cells were shaken and cultured at 180 rpm at a temperature of 37° C. Each culture was taken at 65 hours after the start of culture, and centrifuged at 10,000 rpm for 1 minute, and then passed through a 0.45 μm filter to remove the strain.

3 times the volume of ethanol was added to the culture medium from which the strain was removed, and the mixture was left standing at a temperature of 4°C for 2 hours, and hyaluronic acid was precipitated by centrifugation at 15,000 rpm for 10 minutes at a temperature of 4°C. After drying the precipitated hyaluronic acid and dissolving it in water, the hyaluronic acid content was measured using a HA quantitative Test Kit (Corgenix, Westminster, CO, USA), and containing P43, which is a constant expression promoter. The content of hyaluronic acid produced by the transformed strain (g/L) is set to 100, and the content of hyaluronic acid produced by the transformed strain containing the test promoter is relatively displayed, and the percentages thereof are shown in Table 5 and FIG. 3. Showed.

Promoter Relative hyaluronic acid production (%) P43 100.0 ± 4.2 Pmsm 15.1 ± 1.9 Ppbp 3.9 ± 0.8 Pylb 38.1 ± 2.3 pyob 31.6 ± 7.1 Pyqe 134.3 ± 6.7 Pyvl 15.0 ± 11.1 Psigx 488.2 ± 13.4

In Figure 3, the relative content of hyaluronic acid produced by the transformed strain containing each promoter is shown graphically. The Psigx promoter (SEQ ID NO: 62), the Pyob promoter (SEQ ID NO: 63), and the pyqe promoter (SEQ ID NO: 64) had higher expression levels than the P43 promoter, and it was confirmed that the Psigx promoter was more effective in producing hyaluronic acid than other promoters. . The plasmid cloned with the Psigx promoter was named pSigx-hasA-RBS34-tuaD.

Example 3: Hyaluronic acid yield of Psigx promoter

In order to compare the expression efficiency of the IPTG-inducible promoter Pgrac and the Psigx promoter selected as a high expression efficiency in Example 2 at all times, the Psigx promoter of the pSigx-hasA-RBS34-tuaD plasmid was used as the IPTG-derived Pgrac Pgrac-hasA-RBS34-tuaD was produced by replacing with a promoter.

Specifically, in order to replace the promoter, the pHT01 plasmid (Mobitec) was cut with restriction enzymes NheI and BamHI to separate the Laci and Pgrac promoters, and the T4 DNA was cut into pSigx-hasA-RBS34-tuaD with the same restriction enzyme removed to remove the Psigx promoter. Connection was made using ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and the Pgrac-hasA-RBS34-tuaD plasmid was isolated from an ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. The isolated plasmid was introduced into the Bacillus 2217 strain by electroporation, and a transformant strain having chloramphenicol resistance was completed.

Hyaluronic acid production yield of the transformed strain in which the expression of the synthetic enzymes related to hyaluronic acid production is regulated by the completed IPTG-derived Pgrac promoter, and the strains in which hyaluronic acid production-related synthases are always expressed in the Psigx promoter according to Example 2 Compared. Each strain was cultured in substantially the same manner as in Example 2, and the culture solution was taken at 65 hours of culture. However, in the case of the IPTG-derived type, the strain cultured overnight was inoculated into sucrose medium to induce the expression of syntheses, and IPTG was added so that IPTG became 0.5 mM after 2 hours, and in the case of the induced type, the culture solution was taken at 72 hours. Did. The results of measuring the hyaluronic acid production of the two strains in substantially the same manner as in Example 2 are shown in FIG. 4.

As shown in Figure 4, it was confirmed that the two strains have almost the same yield. Through this, the method of producing hyaluronic acid was constructed cheaper and simpler than the induction type using expensive IPTG.

Example 4: RBS screening for overexpression of tuaD gene

D-glucuronic acid is a component of hyaluronic acid and can be produced by the tuaD gene originally possessed by Bacillus, but over-expression of the tuaD gene is required for efficient hyaluronic acid production. To this end, as described above, the hasA gene and the tuaD gene are produced in the form of an operon to induce overexpression of the tuaD gene together with the hasA gene. In order to construct an operon, a highly active RBS sequence exists at the 5'end of the tuaD gene, and thus the translation of the tuaD gene must be controlled. Since the activity of RBS is sequence context-dependent to the surrounding sequence, it may vary according to the sequence of the gene to be regulated (Mutalik, 2013, Nature Methods, 10:347-353). For this reason, it is advantageous for the translation of the actual tuaD, and as a result, an RBS selection process suitable for hyaluronic acid production was performed.

Specifically, in the RBS screening, 6 synthetic RBSs (BBa_B0030, BBa_B0031, BBa_B0032, BBa_B0033, BBa_B0034, BBa_B0035), native RBS (tuaD RBS) from the BioBrick Registry of standard biological parts, and plasmids commonly used as pET RBS (RBS) was compared. Table 8 shows the 8 RBS sequences tested. In order to secure the tuaD gene in which each RBS sequence was included at the 5'end, PCR was performed using the DNA of Bacillus subtilis 168 strain (Bacillus Genetic Stock Center) as a template using the primers shown in Table 4 and SEQ ID NO: 38. .

The tuaD gene containing each amplified RBS was digested with XbaI, and then cut with XbaI and SmaI to connect pSigx-hasA-RBS34-tuaD plasmid with RBS34-tuaD removed using T4 DNA ligase (NEB). This was introduced into E. coli DH5alpha (Enzynomics), and each plasmid was isolated from the ampicillin-resistant transformant obtained by plating on a plate medium containing ampicillin. Through sequencing, it was confirmed that the tuaD gene containing RBS corresponding to each plasmid isolated was cloned.

denomination order
number Base sequence (5'->3') BBa_B0030-RBS 65 attaaagaggagaaatactag BBa_B0031-RBS 66 tcacacaggaaacctactag BBa_B0032-RBS 67 tcacacaggaaagtactag BBa_B0033-RBS 68 tcacacaggactactag BBa_B0034-RBS 69 aaagaggagaaatactag BBa_B0035-RBS 70 attaaagaggagaatactag tuaD RBS 71 gacactgcgaccattataaattggaagatcattttacaggagagggttgagcgct pET RBS 72 aataattttgtttaactttaagaaggagatatacat BBa_B0030-PCR 55 aatctagaattaaagaggagaaatactagatgaaaaaaatagctgtc 38 gggttataaattgacgcttcccaagtctttagccaatt BBa_B0031-PCR 56 aatctagatcacacaggaaacctactagatgaaaaaaatagctgtc 38 gggttataaattgacgcttcccaagtctttagccaatt BBa_B0032-PCR 57 aatctagatcacacaggaaagtactagatgaaaaaaatagctgtc 38 gggttataaattgacgcttcccaagtctttagccaatt BBa_B0033-PCR 58 aatctagatcacacaggactactagatgaaaaaaatagctgtc 38 gggttataaattgacgcttcccaagtctttagccaatt BBa_B0034-PCR 37 aatctagaaaagaggagaaatactagatgaaaaaaatagctgtcattgg 38 gggttataaattgacgcttcccaagtctttagccaatt BBa_B0035-PCR 59 aatctagaattaaagaggagaatactagatgaaaaaaatagctgtc 38 gggttataaattgacgcttcccaagtctttagccaatt tuaD-RBS-PCR 60 aatctagagacactgcgaccattataaattgg 38 gggttataaattgacgcttcccaagtctttagccaatt pET-RBS-PCR 61 aatctagaaataattttgtttaactttaagaaggagatatacatatgaaaaaaatagctgtc 38 gggttataaattgacgcttcccaagtctttagccaatt

Plasmids having different RBSs obtained above were introduced into Bacillus subtilis 2217 strain by electroporation, and transformed strains having chloroamphenicol resistance were prepared.

Next, in the same manner as in Example 2, each transformed strain was cultured and the culture solution was taken to measure the hyaluronic acid content, and the content of hyaluronic acid produced by the transformed strain using RBS of the pET plasmid ( g/L) to 100, and the hyaluronic acid content produced by the transformed strain containing the test RBS sequence is relatively displayed, and the results are shown in Table 7 and FIG. 5.

RBS type Relative hyaluronic acid production (%) BBa_B0030-RBS 83.6 ± 8.9 BBa_B0031-RBS 4.2 ± 1.4 BBa_B0032-RBS 4.7 ± 0.5 BBa_B0033-RBS 5.7 ± 0.9 BBa_B0034-RBS 123.3 ± 1.8 BBa_B0035-RBS 80.5 ± 1.0 tuaD RBS 75.7 ± 9.5 pET RBS 100.0 ± 6.4

According to the comparison result of BioBrick Registry of standard biological parts (http://parts.igem.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Community_Collection), BBa_B0035 has more expression efficiency compared to BBa_B0034 (corresponding to RBS of Example 1-2). It is known to be excellent. However, according to the experimental results of this example, unlike the characteristics of RBS itself, the expression system according to the present invention confirmed the highest yield of hyaluronic acid production when using the BBa_B0034 RBS sequence.

Example 5: Molecular weight measurement of the produced hyaluronic acid

The hyaluronic acid produced in the same manner as the method described in Example 2 was purified through ultrafiltration, and then the molecular weight was measured. First, the process of purifying the produced hyaluronic acid is as follows. The culture solution was centrifuged at 10,000 rpm for 10 minutes and then passed through a 0.45 μm filter to remove the strain. The culture solution from which the strain was removed was filtered through an ultrafiltration membrane having a cut-off value of 100 kDa to obtain a product. Cetyl trimethyl ammonium bromide was added to a concentration of 1% (v/v) in the obtained total product, followed by stirring and centrifuging for 1 hour (7,000 rpm, 30 minutes) to obtain a precipitate. The precipitate was dissolved in a 0.25M sodium iodide solution for 10 minutes and dissolved to allow cetyl trimethyl ammonium bromide to react with iodine and sodium. The reaction solution was centrifuged (7,000 rpm, 30 minutes) and the supernatant was taken to remove the reactant of cetyl trimethyl ammonium bromide and sodium iodide. Purified samples were obtained by adding 2% activated carbon to the supernatant and stirring for 1 hour to adsorb impurities and passing through a 0.22 μm filter.

The purified sample was confirmed to be consistent with the hyaluronic acid standard (sigma) through an infrared spectrum, and the spectrum analysis results are shown in FIG. 6.

Next, the molecular weight of the purified sample was measured using a multi-angle laser light scattering (MALLS). Measurement conditions are shown in Table 8 below, and the analysis results are shown in FIG. 7.

As a result of measuring the multi-angle laser light scattering shown in FIG. 7, the molecular weight of the purified hyaluronic acid showed a peak in the range of 1,000 to 7,000 kDa belonging to the ultra-high molecular range, and the main peak was measured at 5,455 kDa. The polymer hyaluronic acid has excellent properties such as moisturizing effect, viscosity increase, joint lubrication, water absorption ability, elasticity, etc., compared to low molecular hyaluronic acid. Particularly, in the case of ultra-high molecular weight hyaluronic acid of 3000 kDa or more, such as hyaluronic acid produced by using the expression system of the present invention, the decomposition rate in the body is slow and may be used as an anti-adhesion agent.

MALLS meter Wyatt Technology, DAWN HELEOS column Ultrahydrogel analytical column 120, 120 7.8 x 300 mm (Waters, WAT011520)
Ultrahydrogel analytical column 250, 250 7.8 x 300 mm (Waters, WAT011525)
Ultrahydrogel analytical column 1000, 1000 7.8 x 300 mm (Waters, WAT011535) Column temperature 30℃ Eluent 100mM sodium phosphate buffer pH7.2 Flow rate 0.5 mL/min Injection volume 100 μL Laser wavelength 662.0 nm Line filter 0.22 μm Multi-angle fitting method Zimm

<110> Dae Hwa Pharma. Co., Ltd. RedoxBio <120> Expression system for production of hyaluronic acid by using non-pathogenic bacteria and method of preparing hyaluronic acid using the same <130> DPP20190383KR <150> KR 10-2018-0158627 <151> 2018-12-10 <160> 77 <170> KopatentIn 2.0 <210> 1 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_forward1) <400> 1 cgggatccat gagaacatta aaaaacctca taactgttgt ggcctttagt 50 <210> 2 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_forward2) <400> 2 gttgtggcct ttagtatttt ttgggtactg ttgatttacg tcaatgttta 50 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_forward3) <400> 3 ttacgtcaat gtttatctct ttggtgctaa aggaagcttg tcaatttatg 50 <210> 4 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_forward4) <400> 4 gcttgtcaat ttatggcttt ttgctgatag cttacctatt agtcaaaatg 50 <210> 5 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_forward5) <400> 5 ctattagtca aaatgtcctt atcctttttt tacaagccat ttaagggaag 50 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_forward6) <400> 6 gccatttaag ggaagggctg ggcaatataa ggttgcagcc attattccct 50 <210> 7 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_reverse1) <400> 7 ggtctctagc aatgactcag catcttcgtt ataagaggga ataatggctg 50 <210> 8 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_reverse2) <400> 8 gctaggggat aggtttgctg ctgaacactt tttaaggtct ctagcaatga 50 <210> 9 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_reverse3) <400> 9 catcagcact tccatcgtca acaacataaa tttctgctag gggataggtt 50 <210> 10 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_reverse4) <400> 10 acgcacatag tcttcaatgc gcttaatacc tgtctcatca gcacttccat 50 <210> 11 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_reverse5) <400> 11 tgaacaatga cattgcttga taggtcacca gtgtcacgca catagtcttc 50 <210> 12 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag1_reverse6) <400> 12 gtgcatgacg ctttccttga tttttctctg accgatgaac aatgacattg 50 <210> 13 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_forward1) <400> 13 gaaagcgtca tgcacaggcc tgggcctttg aaagatcaga cgctgatgtc 50 <210> 14 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_forward2) <400> 14 tcagacgctg atgtcttttt gaccgttgac tcagatactt atatctaccc 50 <210> 15 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_forward3) <400> 15 tacttatatc taccctgatg ctttagagga gttgttaaaa acctttaatg 50 <210> 16 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_forward4) <400> 16 taaaaacctt taatgaccca actgtttttg ctgcgacggg tcaccttaat 50 <210> 17 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_forward5) <400> 17 acgggtcacc ttaatgtcag aaatagacaa accaatctct taacacgctt 50 <210> 18 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_forward6) <400> 18 tctcttaaca cgcttgacag atattcgcta tgataatgct tttggcgttg 50 <210> 19 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_reverse1) <400> 19 aaggatatta cctgtaacgg attgggcagc tcgttcaacg ccaaaagcat 50 <210> 20 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_reverse2) <400> 20 tcgcgtctgt aaacgctaag cggacctgag caaacaagga tattacctgt 50 <210> 21 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_reverse3) <400> 21 ggttgatgta tctatctatg ttaggaacaa ccacctcgcg tctgtaaacg 50 <210> 22 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_reverse4) <400> 22 atcaccaata cttacaggaa tacccaggaa ggtctggttg atgtatctat 50 <210> 23 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_reverse5) <400> 23 cctaaatcag ttgcatagtt ggtcaagcac ctgtcatcac caatacttac 50 <210> 24 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag2_reverse6) <400> 24 taatacattt agcagtggat tgataaacag tctttcctaa atcagttgca 50 <210> 25 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_forward1) <400> 25 ctgctaaatg tattacagat gttcctgaca agatgtctac ttacttgaag 50 <210> 26 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_forward2) <400> 26 tctacttact tgaagcagca aaaccgctgg aacaagtcct tctttagaga 50 <210> 27 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_forward3) <400> 27 gtccttcttt agagagtcca ttatttctgt taagaaaatc atgaacaatc 50 <210> 28 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_forward4) <400> 28 aaatcatgaa caatcctttt gtagccctat ggaccatact tgaggtgtct 50 <210> 29 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_forward5) <400> 29 atacttgagg tgtctatgtt tatgatgctt gtttattctg tggtggattt 50 <210> 30 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_forward6) <400> 30 ttctgtggtg gatttctttg taggcaatgt cagagaattt gattggctca 50 <210> 31 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_reverse1) <400> 31 aacaatgaag ataatcacca gaaaggctaa aaccctgagc caatcaaatt 50 <210> 32 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_reverse2) <400> 32 tgcttaagca tgtaatgaat gttccgacac agggcaacaa tgaagataat 50 <210> 33 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_reverse3) <400> 33 ccccataaaa cggagataac aagaaggaca gcgggtgctt aagcatgtaa 50 <210> 34 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_reverse4) <400> 34 taatttcaag ggctgtagga caaacaaatg cagcacccca taaaacggag 50 <210> 35 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_reverse5) <400> 35 ccccagtcag catttctaat agtaaaaaga gaatataatt tcaagggctg 50 <210> 36 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_frag3_reverse6) <400> 36 gctctagatt ataataattt tttacgtgtt ccccagtcag cattt 45 <210> 37 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0034-RBS-tuaD_forward) <400> 37 aatctagaaa agaggagaaa tactagatga aaaaaatagc tgtcattgg 49 <210> 38 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0034-RBS-tuaD_reverse) <400> 38 gggttataaa ttgacgcttc ccaagtcttt agccaatt 38 <210> 39 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (P43_forward primer) <400> 39 gatcgctagc tgataggtgg tatgttttcg 30 <210> 40 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (P43_reverse primer) <400> 40 gatcggatcc gtgtacattc ctctcttacc tataa 35 <210> 41 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pmsm_forward primer) <400> 41 gatcgctagc agtgtctgcg aaaacattac 30 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pmsm_reverse primer) <400> 42 gatcggatcc ctaacatccc cctttgttat 30 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Ppbp_forward primer) <400> 43 gatcgctagc agatggcaag ttagttacgc 30 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Ppbp_reverse primer) <400> 44 gatcggatcc tcctccacct cccatatctc 30 <210> 45 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pylb_forward primer) <400> 45 gatcgctagc catcgtcgaa cgcgctccat 30 <210> 46 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pylb_reverse primer) <400> 46 gatcggatcc acgttctacc tttgtcaaac aa 32 <210> 47 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyob_forward primer) <400> 47 gatcgctagc attcggcgtt ttggttttag gc 32 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyob_reverse primer) <400> 48 gatcggatcc ttaagcttct ccccttctct 30 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyqe_forward primer) <400> 49 gatcgctagc cttcttgagc gtctcaacca 30 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyqe_reverse primer) <400> 50 gatcggatcc tcctttgatt tgaagcaagg 30 <210> 51 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyvl_forward primer) <400> 51 gatcgctagc ttcaaaacaa aaaaggcaag at 32 <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyvl_reverse primer) <400> 52 gatcggatcc ttcattccac actcctattg 30 <210> 53 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psigx_forward primer) <400> 53 gatcgctagc aggttataaa tttgaggtcg gcg 33 <210> 54 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psigx_reverse primer) <400> 54 gatcggatcc ttgaaacccc tccgttcact tt 32 <210> 55 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0030-RBS-tuaD_forward primer) <400> 55 aatctagaat taaagaggag aaatactaga tgaaaaaaat agctgtc 47 <210> 56 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0031-RBS-tuaD_forward primer) <400> 56 aatctagatc acacaggaaa cctactagat gaaaaaaata gctgtc 46 <210> 57 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0032-RBS-tuaD_forward primer) <400> 57 aatctagatc acacaggaaa gtactagatg aaaaaaatag ctgtc 45 <210> 58 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0033-RBS-tuaD_forward primer) <400> 58 aatctagatc acacaggact actagatgaa aaaaatagct gtc 43 <210> 59 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0035-RBS-tuaD_forward primer) <400> 59 aatctagaat taaagaggag aatactagat gaaaaaaata gctgtc 46 <210> 60 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (tuaD-RBS-tuaD_forward primer) <400> 60 aatctagaga cactgcgacc attataaatt gg 32 <210> 61 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (pET-RBS-tuaD_forward primer) <400> 61 aatctagaaa taattttgtt taactttaag aaggagatat acatatgaaa aaaatagctg 60 tc 62 <210> 62 <211> 2000 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Psigx_promoter) <400> 62 aggttataaa tttgaggtcg gcgctgaatg aaattttgga aaagcgtagt aggcaagctg 60 tggtttacga tcctttcact cgtcttgatc gtattgttca ttttaacggt tcttttgctg 120 gagtttattg aaaactacca tgtggaagaa gctgagaatg atttaacaca gcttgcgaat 180 aaagttgctg tcatcctaga aaatcacgag gaccaggcac tggcaaggtc aatcacttgg 240 gaactcgctg ataacttaac aagcattgcc atcatccagg atgagaagaa ccactggtat 300 tctccgaatg ataaaaatcg cctgtcgtct attacggttg agcaaataca gcatgacaaa 360 gacttaaata aagctctcaa agaccataaa aaagtaagca aacggacggg actgagcgat 420 acagacacgg ataatgaacg cctgattgta ggtgtcccgt atgaaaaaga cggaaagaaa 480 ggcatggtct ttttatccca gtctttgctt gccgttaaag atacaacaaa acatacgacc 540 cgctatattt ttcttgccgc tggaattgcg attgtgctga ccacattttt cgcattcttt 600 ttatcaagca gggtcacgta ccctctccga aaaatgagag aaggcgcgca ggatttggcg 660 aagggcaagt tcgatacaaa aatcccgatt ttaactcagg atgaaatcgg tgaactggcg 720 accgctttta atcaaatggg ccggcagctt aactttcata tcaatgcgct caatcaagaa 780 aaagagcagc tttctaacat tttgagcagt atggctgacg gggttattac cattaatatt 840 gacggtacga ttcttgtgac caacccgccg gctgaacgtt ttcttcaggc ttggtattat 900 gaacagaaca tgaatatcaa agaaggcgac aatcttccgc ctgaagcaaa agagctgttt 960 caaaacgctg tcagcactga aaaagaacaa atgattgaga tgacgcttca aggcagatca 1020 tgggtgcttt tgatgtcgcc gctttatgcg gaatcgcacg tcagaggagc ggttgccgta 1080 ctgcgtgaca tgacagaaga acgccgcctt gataagctgc gggaggactt tatcgcaaat 1140 gtcagtcatg agctgagaac accgatctcc atgcttcagg gatacagtga agcaattgtc 1200 gatgacattg caagctctga agaagaccgg aaagaaattg cccaaatcat ttatgacgaa 1260 tcgctccgaa tgggccgttt agttaatgat ttgcttgatt tagcccgaat ggaatcaggc 1320 catacaggct tacattatga aaaaatcaat gtgaatgagt ttttagaaaa gatcattcgg 1380 aagttttccg gtgttgcgaa agaaaaaaat attgctttag atcatgacat ttctctcaca 1440 gaagaggaat ttatgtttga tgaagacaag atggagcagg tatttaccaa tttgattgat 1500 aacgcgctgc ggcatacttc agccggcggc agtgtctcca tttcagtcca ttctgtgaag 1560 gatggattga aaattgatat caaagactcc gggtctggca taccggaaga agatctgcca 1620 tttatctttg agcggtttta taaggcagat aaagcgcgga caaggggcag agcaggaacc 1680 gggttagggc tggctatcgt taaaaatatc gtggaagccc acaacggatc aattactgtg 1740 cacagccgaa tagataaagg aacaacattt tctttttata ttccgacaaa acggtaaaat 1800 cgagtctgaa tttgccgaag aatcttgttc cataagaaac acccgctgac tgagcgggtg 1860 tttttttaat agccaacatt aataaaattt aaggatatgt taatataaat tcccttccaa 1920 attccagtta ctcgtaatat agttgtaatg taacttttca agctattcat acgacaaaaa 1980 agtgaacgga ggggtttcaa 2000 <210> 63 <211> 494 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyob_promoter) <400> 63 attcggcgtt ttggttttag gctacaactt tgatcatgca tcagttgtaa atagaactaa 60 tgaatataaa gaacactatg gccttactga tggacttgtg gttattgaag atgttgatta 120 ctttgcttac tgtctagata caaataaaat gaaagacgga gaatgccctg tagttgaatg 180 ggatagggta attggttatc aagatactgt tgcagacagc tttattgaat ttttttataa 240 taagattcag gaagcgaaag atgactggga tgaggatgaa gactgggacg attaagcaaa 300 agtattgcta tagcgcaata gaaggcttga gttgcacatc ctcaatctaa ataaaataag 360 ctctcgcaat gagagcttat tttattggat taaataatta aagtgacaga agttttctag 420 tcccgtttta tatgaaacct tttttatttt agcccgtatt aaaagtaaat tcagagagaa 480 ggggagaagc ttaa 494 <210> 64 <211> 589 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Pyqe_promoter) <400> 64 cttcttgagc gtctcaacca ggatatgaag ctgtatatga aaaaccgtga gaaagacaaa 60 ctgactgtcg ttcgaatggt taaggcttca cttcaaaatg aagcaattaa gcttaagaaa 120 gacagtttga ccgaggatga ggaactcact gtcctttctc gtgaacttaa gcaacgtaaa 180 gactccctcc aggaattttc aaacgctaat cgtttagatt tagtagataa agttcaaaaa 240 gagctggaca ttttagaagt ttatttacct gagcagctgt cagaagaaga gctgcgtaca 300 atcgtaaatg aaaccatcgc ggaggtcggt gcgagctcaa aagcggacat gggcaaagtg 360 atgggggcaa ttatgcctaa agtaaaaggt aaagctgacg gaagtttaat taataagctt 420 gtgagcagtc aactgtctta aatggcaaag aaaaggacat ctttctaaga gagatgtctt 480 tttttataca taaaaaaatg aaacctttga tacatttgtt acgtatgaag agaaggcact 540 tattataaaa ggaaggaggg atacaccgcc cttgcttcaa atcaaagga 589 <210> 65 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0030-RBS) <400> 65 attaaagagg agaaatacta g 21 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0031-RBS) <400> 66 tcacacagga aacctactag 20 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0032-RBS) <400> 67 tcacacagga aagtactag 19 <210> 68 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0033-RBS) <400> 68 tcacacagga ctactag 17 <210> 69 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0034-RBS) <400> 69 aaagaggaga aatactag 18 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (BBa_B0035-RBS) <400> 70 attaaagagg agaatactag 20 <210> 71 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (RBS_tuaD) <400> 71 gacactgcga ccattataaa ttggaagatc attttacagg agagggttga gcgct 55 <210> 72 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (RBS_pET) <400> 72 aataattttg tttaacttta agaaggagat atacat 36 <210> 73 <211> 1386 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (tuaD_gene) <400> 73 gtgaaaaaaa tagctgtcat tggaacaggt tatgtaggac tcgtatcagg cacttgcttt 60 gcggagatcg gcaataaagt tgtttgctgt gatatcgatg aatcaaaaat cagaagcctg 120 aaaaatgggg taatcccaat ctatgaacca gggcttgcag acttagttga aaaaaatgtg 180 ctggatcagc gcctgacctt tacgaacgat atcccgtctg ccattcgggc ctcagatatt 240 atttatattg cagtcggaac gcctatgtcc aaaacaggtg aagctgattt aacgtacgtc 300 aaagcggcgg cgaaaacaat cggtgagcat cttaacggct acaaagtgat cgtaaataaa 360 agcacagtcc cggttggaac agggaaactg gtgcaatcta tcgttcaaaa agcctcaaag 420 gggagatact catttgatgt tgtatctaac cctgaattcc ttcgggaagg gtcagcgatt 480 catgacacga tgaatatgga gcgtgccgtg attggttcaa caagtcataa agccgctgcc 540 atcattgagg aacttcatca gccattccat gctcctgtca ttaaaacaaa cctagaaagt 600 gcagaaatga ttaaatacgc cgcgaatgca tttctggcga caaagatttc ctttatcaac 660 gatatcgcaa acatttgtga gcgagtcggc gcagacgttt caaaagttgc tgatggtgtt 720 ggtcttgaca gccgtatcgg cagaaagttc cttaaagctg gtattggatt cggcggttca 780 tgttttccaa aggatacaac cgcgctgctt caaatcgcaa aatcggcagg ctatccattc 840 aagctcatcg aagctgtcat tgaaacgaac gaaaagcagc gtgttcatat tgtagataaa 900 cttttgactg ttatgggaag cgtcaaaggg agaaccattt cagtcctggg attagccttc 960 aaaccgaata cgaacgatgt gagatccgct ccagcgcttg atattatccc aatgctgcag 1020 cagctgggcg cccatgtaaa agcatacgat ccgattgcta ttcctgaagc ttcagcgatc 1080 cttggcgaac aggtcgagta ttacacagat gtgtatgctg cgatggaaga cactgatgca 1140 tgcctgattt taacggattg gccggaagtg aaagaaatgg agcttgtaaa agtgaaaacc 1200 ctcttaaaac agccagtcat cattgacggc agaaatttat tttcacttga agagatgcag 1260 gcagccggat acatttatca ctctatcggc cgtcccgctg ttcggggaac ggaaccctct 1320 gacaagtatt ttccgggctt gccgcttgaa gaattggcta aagacttggg aagcgtcaat 1380 ttataa 1386 <210> 74 <211> 417 <212> PRT <213> Streptococcus zooepidemicus <400> 74 Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe 1 5 10 15 Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly 20 25 30 Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys 35 40 45 Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln 50 55 60 Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser 65 70 75 80 Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala 85 90 95 Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys 100 105 110 Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val 115 120 125 Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala 130 135 140 Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser 145 150 155 160 Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe 165 170 175 Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn 180 185 190 Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn 195 200 205 Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu 210 215 220 Val Cys Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro 225 230 235 240 Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser 245 250 255 Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys 260 265 270 Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys 275 280 285 Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe 290 295 300 Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val 305 310 315 320 Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr 325 330 335 Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu 340 345 350 Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg 355 360 365 Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro 370 375 380 Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr 385 390 395 400 Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu 405 410 415 Leu <210> 75 <211> 1254 <212> DNA <213> Streptococcus zooepidemicus <400> 75 atgagaacat taaaaaacct cataactgtt gtggccttta gtattttttg ggtactgttg 60 atttacgtca atgtttatct ctttggtgct aaaggaagct tgtcaattta tggctttttg 120 ctgatagctt acctattagt caaaatgtcc ttatcctttt tttacaagcc atttaaggga 180 agggctgggc aatataaggt tgcagccatt attccctctt ataacgaaga tgctgagtca 240 ttgctagaga ccttaaaaag tgttcagcag caaacctatc ccctagcaga aatttatgtt 300 gttgacgatg gaagtgctga tgagacaggt attaagcgca ttgaagacta tgtgcgtgac 360 actggtgacc tatcaagcaa tgtcattgtt catcggtcag agaaaaatca aggaaagcgt 420 catgcacagg cctgggcctt tgaaagatca gacgctgatg tctttttgac cgttgactca 480 gatacttata tctaccctga tgctttagag gagttgttaa aaacctttaa tgacccaact 540 gtttttgctg cgacgggtca ccttaatgtc agaaatagac aaaccaatct cttaacacgc 600 ttgacagata ttcgctatga taatgctttt ggcgttgaac gagctgccca atccgttaca 660 ggtaatatcc ttgtttgctc aggtccgctt agcgtttaca gacgcgaggt ggttgttcct 720 aacatagata gatacatcaa ccagaccttc ctgggtattc ctgtaagtat tggtgatgac 780 aggtgcttga ccaactatgc aactgattta ggaaagactg tttatcaatc cactgctaaa 840 tgtattacag atgttcctga caagatgtct acttacttga agcagcaaaa ccgctggaac 900 aagtccttct ttagagagtc cattatttct gttaagaaaa tcatgaacaa tccttttgta 960 gccctatgga ccatacttga ggtgtctatg tttatgatgc ttgtttattc tgtggtggat 1020 ttctttgtag gcaatgtcag agaatttgat tggctcaggg ttttagcctt tctggtgatt 1080 atcttcattg ttgccctgtg tcggaacatt cattacatgc ttaagcaccc gctgtccttc 1140 ttgttatctc cgttttatgg ggtgctgcat ttgtttgtcc tacagccctt gaaattatat 1200 tctcttttta ctattagaaa tgctgactgg ggaacacgta aaaaattatt ataa 1254 <210> 76 <211> 417 <212> PRT <213> Artificial Sequence <220> <223> Synthetic (hasA_MT_prt) <400> 76 Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe 1 5 10 15 Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly 20 25 30 Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys 35 40 45 Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln 50 55 60 Tyr Arg Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser 65 70 75 80 Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala 85 90 95 Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys 100 105 110 Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val 115 120 125 Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala 130 135 140 Trp Ala Phe Gly Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser 145 150 155 160 Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe 165 170 175 Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn 180 185 190 Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn 195 200 205 Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu 210 215 220 Val Cys Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro 225 230 235 240 Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser 245 250 255 Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys 260 265 270 Thr Val Tyr Gln Ser Thr Ala Arg Cys Ile Thr Asp Val Pro Asp Lys 275 280 285 Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe 290 295 300 Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val 305 310 315 320 Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr 325 330 335 Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu 340 345 350 Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg 355 360 365 Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro 370 375 380 Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr 385 390 395 400 Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu 405 410 415 Leu <210> 77 <211> 1254 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (hasA_MT_dna) <400> 77 atgagaacat taaaaaacct cataactgtt gtggccttta gtattttttg ggtactgttg 60 atttacgtca atgtttatct ctttggtgct aaaggaagct tgtcaattta tggctttttg 120 ctgatagctt acctattagt caaaatgtcc ttatcctttt tttacaagcc atttaaggga 180 agggctgggc aatatagggt tgcagccatt attccctctt ataacgaaga tgctgagtca 240 ttgctagaga ccttaaaaag tgttcagcag caaacctatc ccctagcaga aatttatgtt 300 gttgacgatg gaagtgctga tgagacaggt attaagcgca ttgaagacta tgtgcgtgac 360 actggtgacc tatcaagcaa tgtcattgtt catcggtcag agaaaaatca aggaaagcgt 420 catgcacagg cctgggcctt tggaagatca gacgctgatg tctttttgac cgttgactca 480 gatacttata tctaccctga tgctttagag gagttgttaa aaacctttaa tgacccaact 540 gtttttgctg cgacgggtca ccttaatgtc agaaatagac agaccaatct cttaacacgc 600 ttgacagata ttcgctatga taatgctttt ggcgttgaac gagctgccca atccgttaca 660 ggtaatatcc ttgtttgctc aggtccgctt agcgtttaca gacgcgaggt ggttgttcct 720 aacatagata gatacatcaa ccagaccttc ctgggtattc ctgtaagtat tggtgatgac 780 aggtgcttga ccaactatgc aactgattta ggaaagactg tttatcaatc cactgctaga 840 tgtattacag atgttcctga caagatgtct acttacttga agcagcaaaa ccgctggaac 900 aagtccttct ttagagagtc cattatttct gttaagaaaa tcatgaacaa tccttttgta 960 gccctatgga ccatacttga ggtgtctatg tttatgatgc ttgtttattc tgtggtggat 1020 ttctttgtag gcaatgtcag agaatttgat tggctcaggg ttttagcctt tctggtgatt 1080 atcttcattg ttgccctgtg tcggaacatt cattacatgc ttaagcaccc gctgtccttc 1140 ttgttatctc cgttttatgg ggtgctgcat ttgtttgtcc tacagccctt gaaattatat 1200 tctcttttta ctattagaaa tgctgactgg ggaacacgta aaaaattatt ataa 1254

Claims (16)

Bacillus, comprising a transcriptional promoter, a hyaluronic acid synthase gene, a ribosome binding site for expression of the UDP-glucose 6-dehydrogenase gene, and a UDP-glucose 6-dehydrogenase gene, operably linked Expression system for producing hyaluronic acid in a strain. The expression system of claim 1, wherein the expression system produces hyaluronic acid synthase that is always expressed without an expression inducer. The expression system of claim 1, wherein the expression system produces hyaluronic acid in Bacillus subtilis or Bacillus licheniformis. The expression system of claim 1, wherein the transcription promoter is a promoter having a hyaluronic acid production amount of 1.1 to 10 times compared to a transformed strain having an expression system including a P43 promoter. The expression system of claim 1, wherein the transcription promoter is a constitutive expression promoter in a Bacillus strain. The expression system of claim 1, wherein the transcription promoter is a Psigx promoter, a Pyob promoter, or a Pyqe promoter. According to claim 1, wherein the ribosome binding site is BBa_B0030 (SEQ ID NO: 65), BBa_B0031 (SEQ ID NO: 66), BBa_B0032 (SEQ ID NO: 67), BBa_B0033 (SEQ ID NO: 68), BBa_B0034 (SEQ ID NO: 69), or BBa_B0035 (SEQ ID NO: No. 70), the expression system. The expression system of claim 1, wherein the ribosome binding site (RBS) exhibits a hyaluronic acid yield of 1.1 to 3 times that of tuaD's own RBS. The expression system of claim 8, wherein the ribosome binding site is BBa_B0034 consisting of the nucleotide sequence of SEQ ID NO: 69. The expression system of claim 1, wherein the UDP-glucose 6-dehydrogenase gene is a tuaD gene derived from Bacillus subtilis. The expression system of claim 1, wherein the hyaluronic acid synthase gene is hasA derived from a strain of the genus Streptococcus. A recombinant strain for producing hyaluronic acid comprising the expression system for producing hyaluronic acid according to any one of claims 1 to 11. The recombinant strain for synthesizing hyaluronic acid according to claim 11, wherein the strain is Bacillus subtilis or Bacillus licheniformis. A method of obtaining a culture by culturing a recombinant strain for producing hyaluronic acid comprising the expression system for producing hyaluronic acid according to any one of claims 1 to 11, and obtaining hyaluronic acid from the culture, Method for producing hyaluronic acid using a recombinant strain. The method of claim 14, wherein the strain is Bacillus subtilis or Bacillus licheniformis. The production method according to claim 14, wherein the hyaluronic acid has a molecular weight in the range of 100 kDa to 10,000 kDa.

Images