WO2020111519A1 - Usp25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 약학 조성물 - Google Patents
Usp25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 약학 조성물 Download PDFInfo
- Publication number
- WO2020111519A1 WO2020111519A1 PCT/KR2019/014061 KR2019014061W WO2020111519A1 WO 2020111519 A1 WO2020111519 A1 WO 2020111519A1 KR 2019014061 W KR2019014061 W KR 2019014061W WO 2020111519 A1 WO2020111519 A1 WO 2020111519A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cartilage
- protein
- bone
- usp25
- pharmaceutical composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
- A61K38/4813—Exopeptidases (3.4.11. to 3.4.19)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
Definitions
- the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising a USP25 (Ubiquitin carboxyl-terminal hydrolase 25) protein or a polynucleotide encoding it as an active ingredient.
- USP25 Ubiquitin carboxyl-terminal hydrolase 25
- Cartilage an elastic tissue connects two bones to each other, and provides mobility to joints and relieves shock.
- articular cartilage is a connective tissue, and includes cartilage cells embedded in a matrix of proteoglycan and type collagen.
- the damage to cartilage tissue causes direct friction between the bone and the bone, stiffness of the joints, gradual deterioration of joint cartilage motion, and frequent pain in the cartilage area.
- the early etiology of osteoarthritis generally leads to cartilage destruction due to changes or imbalances of metabolic and catabolic mechanisms in the articular cartilage matrix.
- the method of surgically regenerating cartilage is 1 a method of inducing differentiation of stem cells into cartilage cells, 2 a method of implanting autologous or allogeneic cartilage tissue into a cartilage defect site, by osteochondral transplantation, 3 A method to plan to remove cartilage damaged by microfracture by scraping off the cartilage well, and when the subchondral cartilage is exposed, make a hole at regular intervals and regenerate the bone marrow cells flowing through it into the cartilage tissue, 4 chondrocyte transplantation ( Chondrocyte transplantation) is a method of inducing cartilage regeneration by implanting chondrocytes in a cartilage defect site.
- the micro-fracture is not a real bone required for an actual joint, but a fibrous cartilage (Fibro-cartilage) is mainly generated, so there is a disadvantage in that it does not have a satisfactory effect in terms of functionality, and the bone cartilage transplantation is There is a disadvantage that there is a gap between the implanted site and the existing tissue, and the chondrocyte transplantation has a disadvantage in that the patient suffers a lot of pain and economic burden due to multiple operations. According to these problems, it is still necessary to develop a technology capable of regenerating tissues such as cartilage very effectively.
- One object of the present invention is to provide a pharmaceutical composition
- a pharmaceutical composition comprising a USP25 (Ubiquitin carboxyl-terminal hydrolase 25) protein or a polynucleotide encoding the same.
- Another object of the present invention is to provide a pharmaceutical composition comprising the expression vector containing the polynucleotide as an active ingredient.
- Another object of the present invention is to provide a pharmaceutical composition
- a pharmaceutical composition comprising the transformant transformed with the expression vector containing the polynucleotide as an active ingredient.
- Another object of the present invention is to provide a method for preventing or treating bone or cartilage disease, comprising administering a USP25 protein or a polynucleotide encoding the same to a subject in a pharmaceutically effective amount.
- Another object of the present invention is an expression vector containing a polynucleotide encoding the USP25 protein; Or it is to provide a method for preventing or treating bone or cartilage disease comprising the step of administering a transformant transformed with the expression vector to a subject in a pharmaceutically effective amount.
- USP25 Ubiquitin carboxyl-terminal hydrolase 25 protein deubiquitinates Sox9 (SRY-Box 9) protein, so that the Sox9 protein is not degraded and bone marrow-derived mesenchymal stem cells are chondrocytes.
- Sox9 SRY-Box 9 protein
- In one embodiment of the present invention provides a pharmaceutical composition for tissue regeneration.
- the tissue regeneration pharmaceutical composition of the present invention includes USP25 (Ubiquitin carboxyl-terminal hydrolase 25) protein; Polynucleotides encoding them; An expression vector comprising the polynucleotide; Alternatively, a transformant transformed with the expression vector may be included as an active ingredient.
- USP25 Ubiquitin carboxyl-terminal hydrolase 25
- the USP25 protein of the present invention is a hydrolytic enzyme having a function of hydrolyzing a ubiquitin moiety, hydrolyzing a ubiquitin molecule bound to a substrate to reuse the ubiquitin molecule, or decomposing the substrate by proteasome It has the function of preventing. Due to this function, the USP25 protein of the present invention deproduces the transcription factor protein, which plays an important role in the differentiation of bone marrow-derived mesenchymal stem cells into chondrocytes, i.e., hydrolysis of the ubiquitin moiety, thereby profiling the transcription factor. Degradation by theasome can be suppressed.
- the transcription factor protein of the present invention may include all transcription factors that play a role in chondrocyte differentiation and skeletal formation, for example, Sox5 (SRY-Box 5) protein, Sox6 (SRY-Box 6) protein, or Sox9.
- Sox5 SRY-Box 5
- Sox6 SRY-Box 6
- Sox9. SRY-Box 9
- SRY-Box 9 may be a protein, preferably Sox9 (SRY-Box 9) protein, but is not limited thereto.
- the tissue of the present invention may be bone tissue or cartilage tissue, but is not limited thereto.
- the cartilage tissue of the present invention is a flexible connective tissue found in various parts of the body of an animal, including a human being, and is a concept including a junction between bones, rib cage, ears, nose, bronchi, and intervertebral discs. Unlike bones, they are not rigid and rigid, but they are less flexible and relatively stiff compared to muscles.
- the cartilage tissue is a chondrocyte that produces a large amount of extracellular matrix composed of collagen fiber, ground substance rich in proteoglycan, and elastic fiber. It consists of specialized cells called.
- the cartilage cells trapped in the cartilage tissue are provided with nutrients through diffusion by pumping action generated by compression of the articular cartilage or bending of the elastic cartilage. For this reason, growth and recovery may be very slow because the cartilage tissue does not include blood vessels unlike other connective tissue.
- the cartilage tissue of the present invention may be at least one selected from the group consisting of elastic cartilage, hyaline cartilage and fibrocartilage, which can be classified according to the relative content of the three main elements. However, it is not limited thereto.
- vitreous cartilage Hyaline cartilage; for example, vitreous cartilage located in the joint, nose, larynx or sternum
- elastic cartilage eg, elastic cartilage located in the ear
- fibrocartilage eg, intervertebral disc
- the bone tissue of the present invention refers to the tissue that forms the bone.
- the bone is made of dense bone, and both ends of the center or iliac bone are composed of spongy bone associated with a net.
- Bone tissue changes from cartilage in which connective tissue is differentiated, but some of it can be produced directly from connective tissue.
- the distal end of the bone tissue has an articular surface that is a part that joins the neighboring bone, and the surface is covered with a superficial cartilage, an vascular cartilage.
- Bone cells are arranged between the bone marrow plates, and are connected to other progenitor cells adjacent to the protoplasmic projections that go into an irregular star shape.
- a tough connective tissue periosteum is present on the surface of the bone, and can be protected as well as being supplied with nutrition by blood vessels and nerves distributed around the bone. When the periosteum is defective, it may be difficult to survive, start and regenerate bone.
- the bone tissue of the present invention may be a tissue that can be present in all bone parts of the body, for example, at least one selected from the group consisting of ribs, skull, iliac, humerus, vertebra, pelvis and shoulder blades It may be, but is not limited thereto.
- the regeneration of the present invention generally refers to a work in which an organism, when a part of the body or its function is lost, restores the tissue or organ of the part to its original state or restores its function.
- the regeneration means that the USP25 protein deubiquitinates the Sox9 protein, thereby inducing the bone marrow-derived mesenchymal stem cells to differentiate into cartilage tissue or bone tissue, thereby recovering the original state.
- the USP25 protein deubiquitinates the Sox9 protein, thereby inducing the bone marrow-derived mesenchymal stem cells to differentiate into cartilage tissue or bone tissue, thereby recovering the original state.
- it is not limited thereto.
- mesenchymal stem cells When the composition of the present invention is injected into damaged tissue, particularly bone or cartilage tissue, which needs to be regenerated together with mesenchymal stem cells, mesenchymal stem cells are highly effectively differentiated into bone tissue or cartilage tissue, thereby effectively regenerating bone or cartilage. Can be.
- the pharmaceutical composition may include USP25 protein as an active ingredient.
- the USP25 protein of the present invention may also include a peptide form if deubiquitination is maintained, but is preferably not limited to the amino acid sequence represented by SEQ ID NO:3.
- the protein of the present invention can be prepared by a known protein synthesis method or by culturing transformed host cells.
- a transformant is prepared by transducing a host vector with a production vector containing the polynucleotide encoding the USP25 protein of the present invention, and then transforming any of the known art.
- the transformant can be cultured by appropriately using the method described above. Proteins from the transformants thus cultured can be separated and purified by methods known in the art, such as centrifugation, chromatography, and electrophoresis.
- the recombinant vector of the present invention can be introduced into a cell and used as a means for expressing a protein.
- a known recombinant expression vector such as a plasmid vector, a cosmid vector, or a bacteriophage vector can be used, and the vector can be any known method using DNA recombination technology. Depending on the method can be easily prepared by those skilled in the art.
- amino acid sequence of the present invention can be easily modified by substitution, deletion, insertion, or a combination of one or more amino acids. Accordingly, proteins having high homology with SEQ ID NO: 3, for example, proteins having homology of 80% or higher, 85% or higher, 90% or higher, or 95% or higher, may also be included in the USP25 protein of the present invention.
- the homology of the present invention is intended to indicate a similar degree to the amino acid sequence of a wild type (Wild type) protein, and includes an amino acid sequence of the present invention and a sequence having a sequence equal to or greater than the above percentage. Such homology may be determined by visually comparing two sequences, but it may be determined by using a bioinformatic algorithm that analyzes the degree of homology by arranging the sequences to be compared side by side. Homology between the two amino acid sequences can be expressed as a percentage. Useful automated algorithms are available in the GAP, BESTFIT, FASTA and TFASTA computer software modules of the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, W, USA).
- the automated alignment algorithms in the module include Needleman & Wunsch, Pearson & Lipman and Smith & Waterman sequence alignment algorithms. Algorithms and homology determinations for other useful arrangements can be automated in software including FASTP, BLAST, BLAST2, PSIBLAST and CLUSTAL W.
- the pharmaceutical composition may include a polynucleotide encoding USP25 protein as an active ingredient.
- the polynucleotide of the present invention refers to a polymer of nucleotides in which a nucleotide (Nucleotide) unit is formed in a long chain by covalent bonding, and refers to a DNA or RNA strand of a certain length or more.
- the polynucleotide may be a polynucleotide encoding the USP25 protein, and preferably may be composed of a nucleotide sequence represented by SEQ ID NO: 4, but is not limited thereto.
- the coding region within a range that does not change the amino acid sequence of the protein expressed from the coding region in consideration of the codon preferred in the organism to express the protein, and the coding region Various modifications or modifications can be made within a range that does not affect the expression of the gene even in the part except.
- at least one nucleic acid base may be mutated by substitution, deletion, insertion, or a combination thereof. It can be included in the scope.
- the pharmaceutical composition may include an expression vector containing a polynucleotide encoding the USP25 protein as an active ingredient.
- the expression vector of the present invention is a recombinant vector capable of expressing the USP25 protein or peptide of the present invention in a desired host cell, and refers to a gene construct comprising essential regulatory elements operatively linked to express a gene insert.
- the expression vector includes elements that regulate the expression of an initiation codon, a termination codon, a promoter, an operator, etc., the initiation codon and the termination codon are generally considered to be part of the nucleotide sequence encoding the polypeptide, and the gene construct has to be administered.
- the promoter of the expression vector of the present invention may be constitutive or inducible.
- a promoter and a polynucleotide of the present invention may be operably linked.
- the ⁇ operably linked'' means a state in which a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein or RNA encoding the same are functionally linked to perform a general function.
- a promoter and a nucleic acid sequence encoding a protein or RNA can be operably linked to affect the expression of the coding sequence.
- Operational linkage with an expression vector can be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage can use enzymes and the like generally known in the art.
- the vector that can be used as a backbone of the expression vector of the present invention is not particularly limited as long as it can produce the USP25 protein of the present invention, for example, plasmid DNA, phage DNA, commercially developed plasmid ( pGEM ® T vector, pET22b, pUC18, pBAD, pIDTSAMRT-AMP, etc., E.
- coli-derived plasmids pYG601BR322, pGEX-4T-1, pET, pBR325, pUC118, pUC119, etc.
- Bacillus subtilis-derived plasmids pUB110, pTP5, etc.
- yeast-derived plasmids YEp13, YEp24, YCp50, etc.
- phage DNA Charon4A, Charon21A, EMBL3, EMBL4, ⁇ gt10, ⁇ gt11, ⁇ ZAP, etc.
- animal virus vectors Rostree, Adenovirus, Adeno-associated virus (Adeno-associated virus), vaccinia virus (Vaccinia virus), insect virus vector, can be a cuulovirus (Baculovirus), but is not limited thereto.
- the pharmaceutical composition may include a transformant transformed with an expression vector containing a polynucleotide encoding USP25 protein as an active ingredient.
- the transformation of the present invention may refer to that DNA is introduced into a host cell, and thus DNA can be replicated by being completed as a factor other than a chromosome or integrated with a chromosome.
- the host cell of the present invention can be included as long as it can produce a protein by the polynucleotide contained in the expression vector of the present invention, for example, E. coli such as BL21 or DH5 ⁇ ( E. coli ), Streptomyces , Bacterial cells such as Salmonella typhimurium, yeast cells such as Saccharomyces cerevisiae, Sukizocaromyces pombe, and fungal cells such as Pichia pastoris; Insect cells such as Drozophila and Spodoptera Sf9 cells, CHO cells, COS cells, NSO cells, 293 cells, Bow melanoma cells, animal cells such as stem cells, or plant cells can be used, preferably intermediate. It may be a mesenchymal stem cell, more preferably, it may be a bone marrow-derived mesenchymal stem cell, but is not limited thereto.
- In another embodiment of the present invention provides a pharmaceutical composition for the prevention or treatment of bone or cartilage disease.
- the pharmaceutical composition of the present invention is USP25 protein; Polynucleotides encoding them; An expression vector comprising the polynucleotide; Alternatively, the transformant transformed with the expression vector may be included as an active ingredient.
- the contents of USP25 protein, tissue regeneration, polynucleotide, expression vector, transformant, etc. are overlapped with those described in the pharmaceutical composition for tissue regeneration herein. In order to avoid excessive description, the description is omitted below.
- the bone or cartilage disease of the present invention is a disease that may occur due to damage to the bone or cartilage, for example, arthritis; osteoporosis; Osteochondrosis; Osteochondritis; Incomplete osteopenia; Osteomyelitis; Bone proliferation; Cartilage dysfunction; Chondritis; Chondroma; Chondrosarcoma; Intervertebral disc prolapse; Kiffel-Pile syndrome; Deformable osteoarthritis; Cystic fibritis; And it may be at least one selected from the group consisting of bone or cartilage disease due to accident, fracture, wound, joint damage, autoimmune disease, diabetes or cancer, but is not limited thereto.
- the prophylaxis of the present invention is without limitation if it is all actions to block or delay the symptoms of bone or cartilage disease that may occur due to bone or cartilage damage using the pharmaceutical composition of the present invention. Can be included.
- the treatment of the present invention may include, without limitation, any action to improve or improve the symptoms of bone or cartilage disease that may occur due to bone or cartilage damage using the pharmaceutical composition of the present invention.
- the pharmaceutical composition of the embodiment of the present invention may be characterized in that it is in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized for humans.
- the pharmaceutical composition of the present invention is not limited to these, but is formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions, respectively, according to a conventional method.
- the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
- Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, fragrances, etc. when administered orally, and in the case of injections, buffers, preservatives, painless Agents, solubilizers, isotonic agents, stabilizers, etc.
- the formulation of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
- a pharmaceutically acceptable carrier as described above.
- tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. may be prepared, and in the case of injections, they may be prepared in unit dosage ampoules or multiple dosage forms. have.
- Others can be formulated as solutions, suspensions, tablets, capsules, sustained-release preparations, and the like.
- examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used.
- fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
- the route of administration of the pharmaceutical composition of the present invention is not limited to these, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, This includes sublingual or rectal. Oral or parenteral administration is preferred.
- the parenteral of the present invention includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, synovial, intrasternal, epidural, intralesional and intracranial injection or infusion techniques.
- the pharmaceutical composition of the present invention depends on a number of factors, including the activity, age, weight, general health, sex, diet, administration time, route of administration, release rate, drug combination and severity of the particular disease to be prevented or treated, of the specific compound used. It may vary, and the dosage of the pharmaceutical composition varies depending on the patient's condition, body weight, disease severity, dosage form, administration route and duration, but can be appropriately selected by those skilled in the art, and 0.0001 to 50 mg/day It can be administered in kg or 0.001 to 50 mg/kg. The administration may be administered once a day, or may be divided into several times. The above dosage does not limit the scope of the present invention in any way.
- the pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions.
- a method for preventing or treating bone or cartilage disease comprising administering a USP25 protein or a polynucleotide encoding the same to a subject in a pharmaceutically effective amount.
- the "individual" of the present invention as an individual in need of prevention or treatment of bone or cartilage disease, primates such as humans, as well as mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, cats, etc. It may include all animals, but is not limited thereto.
- the "administration" of the present invention means a process of introducing the active ingredient of the present invention to an individual by any suitable method.
- the administration method is through various routes such as oral or parenteral. Can be administered.
- the contents related to the USP25 protein, polynucleotide, bone or cartilage disease, prevention, treatment, etc. are the same as described above, and are omitted to avoid excessive complexity of the specification.
- an expression vector containing a polynucleotide encoding the USP25 protein provides a method for preventing or treating bone or cartilage disease comprising the step of administering a transformant transformed with the expression vector to a subject in a pharmaceutically effective amount.
- the contents related to the USP25 protein, polynucleotide, bone or cartilage disease, prevention, treatment, individual, administration, etc. are the same as described above, and are omitted to avoid excessive complexity of the specification.
- the composition containing the USP25 protein of the present invention when using the composition containing the USP25 protein of the present invention as an active ingredient, it can be induced very effectively so that the bone marrow-derived mesenchymal stem cells can be differentiated into bone tissue cells, particularly cartilage cells, compared to other deubiquitinating enzymes.
- the bone marrow-derived mesenchymal stem cells can be differentiated into bone tissue cells, particularly cartilage cells, compared to other deubiquitinating enzymes.
- it by inducing such differentiation into chondrocytes, it can be very usefully applied to the prevention or treatment of various diseases that may occur due to damage to cartilage tissue.
- 1A and 1B show the results of confirming the effect of inhibiting cartilage differentiation ability using Alcian blue saining according to an embodiment of the present invention.
- Figure 2 shows the results confirming the effect of inhibiting cartilage differentiation ability using safranin O staining (Safranin O staining) and Alcian blue staining according to an embodiment of the present invention.
- Figure 3 shows the results confirming the effect of inhibiting cartilage differentiation capacity using immunohistochemistry (IHC) according to an embodiment of the present invention.
- Figure 4 shows the results confirming the effect of cartilage differentiation using safranin O stain and Alsian blue stain according to an embodiment of the present invention.
- Figure 5 shows the results confirming the effect of cartilage differentiation using immunohistochemistry according to an embodiment of the present invention.
- Figure 6 shows the results of comparing the effect of cartilage differentiation between de-ubiquitination enzymes using safranin o stain and alcian blue stain according to an embodiment of the present invention.
- Figure 7 shows the results of confirming the degree of ubiquitination of Sox9 (SRY-Box 9) protein according to an embodiment of the present invention using an immunoprecipitation method.
- tissue regeneration including USP25 (Ubiquitin carboxyl-terminal hydrolase 25) protein or a polynucleotide encoding the same as an active ingredient; And it provides a pharmaceutical composition for the prevention or treatment of bone or cartilage disease.
- USP25 Ubiquitin carboxyl-terminal hydrolase 25
- BM aspirates were obtained from the posterior iliac crest of 6 adult donors.
- Human bone marrow-derived mesenchymal stem cells (hBMSCs) were selected based on the ability to be adsorbed from the bone marrow puncture fluid to a plastic cell culture flask.
- the selected hBMSCs in culture medium (10% FBS (Gibco, Grand Island, NY, USA) and 1% antibiotic-antifungal solution (Gibco) containing DMEM-LG (low-glucose Dulbecco's modified Eagle's medium; Gibco)) Cultured.
- DMEM-LG low-glucose Dulbecco's modified Eagle's medium
- PLKO.1-puro-shUSP25 by inserting the nucleotide sequence of SEQ ID NOs: 1 and 2 complementary to a portion of the nucleotide sequence of USP25 at the TRC2 position of the lentiviral vector (pLKO.1-Puro Lentiviral Vector; Yonsei Genome Center, Korea) -1 (TRCN0000004366, Yonsei Genome Center, Korea) and pLKO.1-puro-shUSP25-2 (TRCN0000004367, Yonsei Genome Center, Korea) were produced.
- control vector shScramble, SHC016, pLKO.1-puro (Yonsei Genome Center) into which a non-target shRNA base sequence was inserted was used.
- the lentiviral vector was transformed into Lenti-X-293FT (Clontech, USA) cells using a viral packaging mix (Sigma-Aldrich, USA) and Lipofectamine LTX PLUS (Invitrogen, USA) according to the protocol provided by the manufacturer. Then, the transformed cells were cultured and virus was obtained from the culture medium of the cells. Then, the obtained virus was incubated in hBMSCs of the preparation example for 24 hours. Then, by removing the culture medium containing the virus, and culturing for more than 24 hours in a new culture medium containing 10 ⁇ g/ml of puromycine antibiotics, shUSP25 is selected by selecting only cells resistant to antibiotics.
- HBMSCs knocked down by -1 hereinafter referred to as'hBMSCs_shUSP25-1'
- hBMSCs knocked down by shUSP25-2 hereinafter referred to as'hBMSCs_shUSP25-2'
- control hBMSCs were prepared.
- hBMSCs_shUSP25-1, hBMSCs_shUSP25-2 and control cell pellets prepared in [1-1] above were carefully placed in 24-well plates, 37 It was allowed to adhere for 2 hours at °C.
- cartilage differentiation medium (1 ⁇ insulin-transferrin-selenium-A [Gibco], 1% antibiotic-antifungal solution, 50 ⁇ g/mL ascorbic acid and 10 ng/mL transformed growth factor- ⁇ 3 [TGF- ⁇ 3; R&D Systems] incubated in DMEM-HG (High-glucose Dulbecco's modified Eagle's medium; Gibco) for 21 days, and the micromes pellet of the cells was fixed in 10% formalin for 24 hours. Fixed specimens were embedded in paraffin The paraffin-embedded sections were deparaffinized, rehydrated and washed twice with PBS Then the sections were 4 ⁇ m.
- the optical density of the control group corresponds to 1.0, while the optical density of hBMSCs_shUSP25-1 (shUSP25-1) and hBMSCs_shUSP25-2 (shUSP25-2) to chondrocytes is about 0.1 and 0.3, respectively, which is remarkable compared to the control group. It was confirmed that it was reduced.
- USP25 can induce mesenchymal stem cells derived from bone marrow to be differentiated into cartilage.
- the differentiation into chondrocytes was analyzed using Alcian Blue staining and safranin-O staining, and the results are shown in FIG. 2.
- Alcian Blue was carried out in the same manner as in [1-2] except that the micromass was fixed in formaldehyde, paraffinized, and then deparaffinized using xylene and rehydrated with ethanol. .
- proteoglycan Proteoglycan
- hBMSCs_shUSP25-1 hBMSCs_shUSP25-2 was significantly reduced, and the mucopolysaccharide dyed in blue was significantly reduced was confirmed.
- the USP25 protein according to the present invention induces differentiation of bone marrow-derived mesenchymal stem cells into chondrocytes and forms a substrate.
- the USP25 protein according to the present invention can not only induce the bone marrow-derived mesenchymal stem cells to differentiate into chondrocytes, but also increase the expression of cartilage-specific matrix proteins. .
- a lentiviral vector (human CMV pLenti-GIII-CMV-GFP-2A-Puro-Lentiviral Vector; cat.No. LV353539, Abm, USA) containing the nucleotide sequence of SEQ ID NO: 3 encoding the USP25 protein was purchased.
- a vector without a nucleotide sequence encoding a USP25 protein (human CMV pLenti-CMV-GFP-2A-Puro-blank Lentiviral Vector; cat.No.LV590, Abm, USA) was purchased and used.
- the vector was transformed into hBMSCs in the same manner as in [1-1] to produce hBMSCs overexpressed with USP25 protein and control cells.
- HBMSCs and control cells overexpressed with the USP25 protein of [2-1] were cultured for 21 days using a micromass culture method, and safranin o and alsian blue staining were performed in the same manner as in [1-3] above. By performing, the results are shown in Figure 4.
- the USP25 protein according to the present invention can effectively induce differentiation of bone marrow-derived mesenchymal stem cells into cartilage.
- HBMSCs and control cells overexpressed with the USP25 protein of [2-1] were cultured for 21 days using a micromass culture method, and type 2 collagen and aggrecan in the same manner as in [1-4] above.
- the level of protein present was confirmed through immunohistochemical staining, and the results are shown in FIG. 5.
- the USP25 protein according to the present invention can not only induce the bone marrow-derived mesenchymal stem cells to differentiate into chondrocytes, but also increase the expression of cartilage-specific matrix proteins. .
- cartilage differentiation ability was specifically specific to the USP25 protein among enzymes having deubiquitination.
- the USP25 protein according to the present invention has a remarkable effect that allows bone marrow-derived mesenchymal stem cells to differentiate into cartilage compared to other deubiquitinating enzymes.
- HBMSCs overexpressed with USP25 in [2-1] and control cells were cultured for 21 days.
- MG132 a proteolytic inhibitor
- the cells were obtained and put into a lysis buffer to completely lyse the cells.
- an antibody specific to MYC was added to a 1 mg protein sample and reacted at 4°C for 12 hours. Thereafter, after adding the protein beads, after further reacting at 4° C. for 4 hours, the reaction was precipitated, washed three times with extraction buffer, and then the reaction was stopped by adding SDS buffer.
- the sample thus obtained was subjected to electrophoresis on SDS-PAGE, the protein contained in the gel was transferred to a PVDF membrane, and then Western blot analysis was performed using an antibody specific for Sox9 (SRY-Box 9) protein, and the results are shown in FIG. 7. It is shown in.
- ubiquitination occurs in the Sox9 protein in the control group (GFP-USP25-column), whereas when the USP25 protein is overexpressed (GFP-USP25 + column), the degree of ubiquitination of the Sox9 protein is significantly reduced. It was.
- USP25 inhibits sox9 protein, a transcription factor that plays a very important role in the differentiation of cartilage, from being decomposed by ubiquitination in cells, so that bone marrow-derived mesenchymal stem cells differentiate into cartilage. You can see that it is very effective to induce.
- the present invention relates to a pharmaceutical composition for tissue regeneration, specifically, to a pharmaceutical composition for tissue regeneration comprising USP25 (Ubiquitin carboxyl-terminal hydrolase 25) protein or a polynucleotide encoding the same as an active ingredient, using the composition
- USP25 Ubiquitin carboxyl-terminal hydrolase 25
- a pharmaceutical composition for tissue regeneration comprising USP25 (Ubiquitin carboxyl-terminal hydrolase 25) protein or a polynucleotide encoding the same as an active ingredient
- composition comprising the USP25 protein or a
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physical Education & Sports Medicine (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- General Chemical & Material Sciences (AREA)
- Rheumatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 조직 재생용 약학 조성물에 관한 것으로, 구체적으로 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 조직 재생용 약학 조성물에 관한 것으로, 상기 조성물을 사용하는 경우, 다른 탈 유비퀴틴화 효소에 비하여 골수 유래 중간엽 줄기 세포가 골 조직 세포, 특히 연골 세포로 분화될 수 있도록 매우 효과적으로 유도할 수 있다. 또한, 이렇게 연골 세포로 분화될 수 있도록 유도함으로써 연골 조직이 손상되어 발생될 수 있는 다양한 질환의 예방 또는 치료에 매우 유용하게 적용될 수 있다.
Description
본 발명은 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 약학 조성물에 관한 것이다.
탄력성을 갖는 조직인 연골은 두 개의 뼈를 서로 연결하며, 관절 부위에 운동성을 부여하고 충격을 완화하는 역할을 한다. 특히, 관절 연골은 결합조직으로서, 프로테오글리칸(Proteoglycan)과 타입 콜라겐의 매트릭스에 임베딩되어 있는 연골 세포가 포함된다. 연골 조직이 손상됨으로써, 뼈와 뼈의 직접적인 마찰, 관절의 뻣뻣함, 관절 연골 운동의 점진적 저하 및 연골 부위의 빈발성 통증이 유발된다. 아직 불명확하지만, 골관절염의 초기 병인은 일반적으로 관절 연골 매트릭스 내의 동화 및 이화 대사 기전의 변화나 불균형에 의하여 연골 파괴가 초래되는 것으로 알려져 있다.
일반적으로 척추동물의 관절을 이루는 연골 조직에는 혈관, 신경 및 임파조직이 부재하여, 상기 연골 조직이 한번 손상되게 되면 정상적으로 생체 내에서 재생될 수 없다. 이렇게 관절의 연골 조직이 손상될 경우 심한 통증으로 인해 일상 활동에 제한을 받게 되며, 연골 조직의 손상이 만성화되는 경우 치명적인 퇴행성 관절염을 유발하게 되어 정상적인 생활이나 직업적인 활동을 거의 할 수 없게 된다. 이에, 손상된 연골 조직을 재생하기 위한 다양한 의학적 방법이 시도되고 있으나, 아직 관절 연골인 초자연골(Hyaline cartilage)을 자연과 같은 상태로 회복하기에는 부족한 실정이다. 임상적으로 연골을 재생시키는 수술 방법으로는 ① 줄기세포의 연골 세포로의 분화를 유도하는 방법, ② 골 연골 이식술(Osteochondral transplantation)로 자가 혹은 동종의 연골조직을 연골 결손 부위에 이식하는 방법, ③ 미세 골절술(Microfracture)로 손상된 연골을 잘 긁어내어 제거하고 연골 하골이 노출되면 여기에 일정한 간격으로 구멍을 뚫고 이를 통해서 흘러나온 골수 세포가 연골 조직으로 재생되는 것을 도모하는 방법, ④ 연골세포 이식술(Chondrocyte transplantation)로 연골 결손부위에 연골세포를 이식함으로써 연골 재생을 유도하는 방법 등이 있다.
그러나 상기 미세 골절술은 실제 관절에 필요한 초자연골이 아니라 섬유연골(Fibro-cartilage)이 주로 생성되기 때문에, 기능적인 측면에서 볼 때는 만족할 만한 효과를 거두지 못한다는 단점이 존재하고, 상기 골 연골 이식술은 이식된 부위와 기존의 조직 사이에 틈이 남는 다는 단점이 있으며, 상기 연골세포 이식술의 경우 다수 회에 걸친 수술로 인한 환자의 고통과 경제적 부담이 크다는 단점이 존재한다. 이와 같은 문제점에 따라 연골과 같은 조직을 매우 효과적으로 재생할 수 있는 기술의 개발이 여전히 필요한 실정이다.
본 발명의 일 목적은 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 포함하는 약학 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 폴리뉴클레오티드가 포함된 발현 벡터를 유효성분으로 포함하는 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 폴리뉴클레오티드가 포함된 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함하는 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 약학적 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 약학적으로 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명자들은 탈 유비퀴틴화 효소 중에서 특히, USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질이 Sox9(SRY-Box 9) 단백질을 탈 유비퀴틴화 시킴으로써, Sox9 단백질이 분해되지 않고 골수 유래 중간엽 줄기세포를 연골 세포로 분화되도록 유도함을 발견하여 본 발명을 완성하게 되었다.
본 발명의 일 구현 예에서는 조직 재생용 약학 조성물을 제공한다.
본 발명의 상기 조직 재생용 약학 조성물은 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질; 이를 암호화하는 폴리뉴클레오티드; 상기 폴리뉴클레오티드를 포함하는 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함할 수 있다.
본 발명의 상기 USP25 단백질은 유비퀴틴 부분을 가수분해할 수 있는 기능을 갖는 가수분해 효소로서, 기질에 결합된 유비퀴틴 분자를 가수분해하여 유비퀴틴 분자를 재사용하거나, 기질의 프로테아솜(Proteasome)에 의한 분해를 방지하는 기능을 갖는다. 이와 같은 기능으로 인하여, 본 발명의 상기 USP25 단백질은 골수 유래 중간엽 줄기세포가 연골 세포로 분화되는데 중요한 역할을 하는 전사 인자 단백질을 탈 유비퀴틴화, 즉 유비퀴틴 부분을 가수분해함으로써, 상기 전사 인자의 프로테아솜에 의한 분해를 억제할 수 있다.
본 발명의 상기 전사 인자 단백질은 연골 세포의 분화와 골격 형성에 역할을 하는 전사 인자라면 모두 포함될 수 있고, 예를 들면, Sox5(SRY-Box 5) 단백질, Sox6(SRY-Box 6) 단백질 또는 Sox9(SRY-Box 9) 단백질 등일 수 있고, 바람직하게는 Sox9(SRY-Box 9) 단백질일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 조직은 골 조직 또는 연골 조직일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 연골 조직(Cartilage tissue)은 인간을 포함하는 동물의 체내 다양한 부분에서 발견되는 유연한 결합조직으로, 뼈, 흉곽, 귀, 코, 기관지 및 추간판 사이의 접합부를 포함하는 개념이다. 뼈와 달리, 단단하고 경직되어 있지 않으나, 근육과 비교하였을 때에는 덜 유연하고 비교적 뻣뻣하다는 특징을 갖고 있다. 상기 연골 조직은 콜라겐 섬유(Collagen fiber), 프로테오글리칸(Proteoglycan)이 풍부한 기반물질(Ground substance) 및 탄력소 섬유(Elastin fiber)로 구성된 다량의 세포외기질(Extracellular matrix)을 생산하는 연골세포 (Chondroblast)라 불리는 특화된 세포로 구성된다. 상기 연골 조직 내에 포획되어 있는 연골 세포에는 관절 연골의 압박 또는 탄성 연골의 굽힘에 의해 생성되는 펌핑 작용에 의한 확산을 통해 영양분이 제공된다. 이와 같은 이유에 의해 상기 연골 조직은 다른 결합조직과는 달리 혈관을 포함하지 않기 때문에 성장 및 회복이 매우 느릴 수 있다.
본 발명의 상기 연골 조직은 상기 세 가지 주요 요소의 상대적인 함유량에 따라 분류될 수 있는 탄성 연골(Elastic cartilage), 유리질 연골(Hyaline cartilage) 및 섬유 연골(Fibrocartilage)로 구성된 군으로부터 선택되는 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 연골 조직이 위치하는 부위는 유리질 연골(Hyaline cartilage; 예를 들어, 관절, 코, 후두 또는 흉골에 위치하는 유리질 연골), 탄성 연골(Elastic cartilage; 예를 들어 귀에 위치하는 탄성 연골) 및 섬유 연골(Fibrocartilage; 예를 들어, 추간판)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 골 조직(Osseous tissue)는 뼈를 형성하는 조직을 의미한다. 상기 뼈는 표면이 치밀골질로 이루어지고, 중심부나 장골의 양 끝은 그물 같이 연합된 해면골질로 이루어져 있다. 골 조직은 결합조직이 분화된 연골로부터 변화되나, 그 중 일부는 결합조직으로부터 바로 생성될 수 있다. 골 조직의 말단은 이웃된 뼈와 접합하는 부분인 관절면이 있으며, 그 표면은 초자 연골인 관전 연골로 뒤덮여 있다. 골 세포는 골충판 사이에 배열되어 있으며, 불규칙한 별모양으로 가는 원형질 돌기와 인접한 다른 골세포와 연결되어 있다. 뼈의 표면에는 질긴 결합조직성 골막이 존재하며, 뼈의 주변에 분포되어 있는 혈관과 신경에 의해 영양을 공급받을 뿐만 아니라, 보호받을 수 있다. 상기 골막이 결손되면 뼈의 생존, 신생 및 재생이 곤란해질 수 있다.
본 발명의 상기 골 조직은 체내의 모든 골 부위에 존재할 수 있는 조직일 수 있으며, 예를 들면, 늑골, 두개골, 장골, 상완골, 척추뼈, 골반뼈 및 어깨뼈로 구성된 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 재생은 일반적으로 생물체에는 몸의 일부 또는 그 기 능을 상실하였을 때, 그 부분의 조직이나 기관을 다시 원래의 상태로 복구시키거나 그 기능을 회복하려는 작을 일컫는다. 본 발명의 목적상 상기 재생은 USP25 단백질이 Sox9 단백질을 탈 유비퀴틴화 시켜, 골수 유래 중간엽 줄기세포가 연골 조직 또는 골 조직으로 분화될 수 있도록 유도함으로써, 원래의 상태로 복구될 수 있는 것을 의미할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 조성물을 중간엽 줄기세포와 함께 재생이 필요한 손상된 조직, 특히 골 조직 또는 연골 조직에 주입하는 경우, 중간엽 줄기세포가 골 조직 또는 연골 조직으로 매우 효과적으로 분화됨으로써 골 또는 연골을 효과적으로 재생할 수 있다.
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 유효성분으로 포함할 수 있다.
본 발명의 상기 USP25 단백질은 탈 유비퀴틴화 기능이 유지되는 경우라면 펩타이드 형태인 경우도 포함될 수 있고, 바람직하게는 서열번호 3으로 표시되는 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 아미노산 서열에 다른 아미노산, 펩타이드 등이 융합된 형태의 경우에도 USP25 단백질의 탈 유비퀴틴화 기능을 나타내는 한 모두 포함될 수 있다.
본 발명의 상기 단백질은 공지의 단백질 합성법 또는 형질전환된 숙주세포를 배양함으로써 제조될 수 있다. 상기 단백질을 형질전환된 숙주세포를 이용하는 경우, 본 발명의 상기 USP25 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 제조합 벡터를 숙주 세포에 형질도입하여 형질전환체를 제조한 뒤, 당업계에 공지된 임의의 방법을 적절하게 사용하여 상기 형질전환체를 배양할 수 있다. 이렇게 배양된 상기 형질전환체로부터 단백질은 당업계에서 공지된 원심분리, 크로마토그래피, 전기 영동 등의 방법에 의해 분리 및 정제될 수 있다.
본 발명의 상기 재조합 벡터는 세포 내에 도입되어 단백질을 발현시키기 위한 수단으로서, 플라스미드 벡터, 코즈미드 벡터, 박테리오파지 벡터 등 공지의 재조합 발현 벡터를 사용할 수 있으며, 벡터는 DNA 재조합 기술을 이용한 임의의 공지된 방법에 따라 당업자가에 의해 용이하게 제조될 수 있다.
본 발명의 상기 아미노산 서열은 하나 이상의 아미노산이 치환, 결실, 삽입 또는 이들 조합에 의해 용이하게 변형될 수 있다. 따라서, 서열번호 3과 높은 상동성을 갖는 단백질, 예를 들면 상동성이 80% 이상, 85% 이상, 90% 이상 또는 95% 이상인 경우의 단백질도 본 발명의 상기 USP25 단백질에 모두 포함될 수 있다.
본 발명의 상기 상동성이란, 야생형(Wild type) 단백질의 아미노산 서열과의 유사한 정도를 나타내기 위한 것으로서, 본 발명의 아미노산 서열과 상기와 같은 퍼센트 이상의 동일한 서열을 가지는 서열을 포함한다. 이러한 상동성은 두 서열을 육안으로 비교하여 결정할 수도 있으나, 비교대상이 되는 서열을 나란히 배열하여 상동성 정도를 분석해 주는 생물정보 알고리즘(Bioinformatic algorithm)을 사용하여 결정할 수 있다. 상기 두 개의 아미노산 서열 사이의 상동성은 백분율로 표시될 수 있다. 유용한 자동화된 알고리즘은 Wisconsin Genetics Software Package(Genetics Computer Group, Madison, W, USA)의 GAP, BESTFIT, FASTA와 TFASTA 컴퓨터 소프트웨어 모듈에서 이용가능하다. 상기 모듈에서 자동화된 배열 알고리즘은 Needleman & Wunsch와 Pearson & Lipman과 Smith & Waterman 서열 배열 알고리즘을 포함한다. 다른 유용한 배열에 대한 알고리즘과 상동성 결정은 FASTP, BLAST, BLAST2, PSIBLAST와 CLUSTAL W를 포함하는 소프트웨어에서 자동화될 수 있다.
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함할 수 있다.
본 발명의 상기 폴리뉴클레오티드는 뉴클레오티드(Nucleotide) 단위체가 공유결합에 의하여 길게 사슬모양으로 이루어진 뉴클레오티드의 중합체를 지칭하는 것으로, 일정 길이 이상의 DNA 또는 RNA 가닥을 지칭한다. 상기 폴리뉴클레오티드는 USP25 단백질을 암호화하는 폴리뉴클레오티드일 수 있으며, 바람직하게는 서열번호 4로 표시되는 염기서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 폴리뉴클레오티드는 상기 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있고, 코딩영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있다. 구체적으로, 상기 폴리뉴클레오티드는 본 발명의 상기 단백질과 동등한 활성을 갖는 단백질을 암호화하는 한, 적어도 하나의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함될 수 있다.
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 발현 벡터를 유효성분으로 포함할 수 있다.
본 발명의 상기 발현 벡터는 목적하는 숙주세포에서 본 발명의 상기 USP25 단백질 또는 펩타이드가 발현되도록 할 수 있는 재조합 벡터로서, 유전자 삽입물이 발현되도록 작동하게 연결된 필수적인 조절 요소를 포함하는 유전자 제작물을 의미한다. 상기 발현 벡터는 개시 코돈, 종결 코돈, 프로모터, 오퍼레이터 등의 발현을 조절하는 요소들을 포함하는데, 상기 개시 코돈 및 종결 코돈은 일반적으로 폴리펩타이드를 암호화하는 뉴클레오티드 서열의 일부로 간주되며, 유전자 제작물이 투여되었을 때 개체에서 반드시 작용을 나타내야 하며 암호화되는 서열과 함께 번역이 일어나는 서열인 인 프레임(In frame)에 위치하여야 한다. 본 발명의 상기 발현 벡터의 프로모터는 구성적 또는 유도성일 수 있다.
본 발명의 상기 발현 벡터는 프로모터와 본 발명의 폴리뉴클레오티드가 작동 가능하게 연결되어 있을 수 있다. 상기 '작동가능하게 연결(Operably linked)'이란, 일반적 기능을 수행하도록 핵산 발현 조절 서열과 목적하는 단백질 또는 이를 암호화하는 RNA를 코딩하는 핵산 서열이 기능적으로 연결(Functional linkage)되어 있는 상태를 의미다. 예를 들어 프로모터와 단백질 또는 RNA를 코딩하는 핵산 서열이 작동가능하게 연결되어 코딩 서열의 발현에 영향을 미칠 수 있다. 발현 벡터와의 작동적 연결은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용할 수 있다.
본 발명의 상기 발현 벡터의 백본(Backbone)으로 사용할 수 있는 벡터는 본 발명의 상기 USP25 단백질을 생산할 수 있는 한 특별히 제한되지는 않으나, 예를 들면, 플라스미드 DNA, 파아지 DNA, 상업적으로 개발된 플라스미드(pGEM® T 벡터, pET22b, pUC18, pBAD, pIDTSAMRT-AMP 등), 대장균 유래 플라스미드(pYG601BR322, pGEX-4T-1, pET, pBR325, pUC118, pUC119 등), 바실러스 서브틸리스 유래 플라스미드(pUB110, pTP5 등), 효모-유래 플라스미드(YEp13, YEp24, YCp50 등), 파아지 DNA(Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP 등), 동물 바이러스 벡터(레트로바이러스(Retrovirus), 아데노바이러스(Adenovirus), 아데노부속바이러스(Adeno-associated virus), 백시니아 바이러스(Vaccinia virus), 곤충 바이러스 벡터, 큘로바이러스(Baculovirus) 등 일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함할 수 있다.
본 발명의 상기 형질전환은 DNA를 숙주 세포로 도입하여 DNA가 염색체 외의 인자로서 또는 염색체와 통합하여 완성됨으로써 복제 가능하게 되는 것을 지칭하는 것일 수 있다.
본 발명의 상기 숙주 세포는 본 발명의 상기 발현 벡터에 포함된 폴리뉴클레오티드에 의해 단백질을 생산할 수 있는 것이라면 모두 포함될 수 있고, 예를 들면, BL21 또는 DH5α 등의 대장균(E.
coli), 스트렙토마이세스, 살모넬라 티피뮤리움 등의 박테리아 세포, 사카로마이세스 세레비지애, 스키조사카로마이세스 폼베 등의 효모 세포, 피치아 파스토리스 등의 균류 세포; 드로조필라, 스포도프테라 Sf9 세포 등의 곤충 세포, CHO 세포, COS 세포, NSO 세포, 293 세포, 보우 멜라노마 세포, 줄기 세포 등의 동물 세포, 또는 식물 세포를 이용할 수 있으며, 바람직하게는 중간엽 줄기 세포일 수 있고, 더욱 바람직하게는 골수 유래 중간엽 줄기 세포일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현 예에서는 골 또는 연골 질환의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 상기 약학 조성물은 USP25 단백질; 이를 암호화하는 폴리뉴클레오티드; 상기 폴리뉴클레오티드를 포함하는 발현 벡터; 또는 상기 발현 벡터에 의해 형질전환된 형질전환체를 유효성분으로 포함할 수 있다.
본 발명의 상기 골 또는 연골 질환의 예방 또는 치료용 약학 조성물에서, USP25 단백질, 조직 재생, 폴리뉴클레오티드, 발현 벡터, 형질전환체 등에 관한 내용은 본 명세서의 상기 조직 재생용 약학 조성물에 기재된 바와 중복되어 과도한 기재를 피하기 위하여, 이하에서는 그 기재를 생략한다.
본 발명의 상기 골 또는 연골 질환은 골 또는 연골의 손상으로 인해 발생될 수 있는 질환으로, 예를 들면, 관절염; 골다공증; 골연골증; 골연골염; 불완전 골형성증; 골수염; 골증식체; 연골형성부전증; 연골염; 연골종; 연골육종; 추간판 탈출증; 클리펠-파일 증후군; 변형성 골염; 낭성 섬유뼈염; 및 사고, 골절, 상처, 관절 손상, 자가면역질환, 당뇨병 또는 암으로 인한 골 또는 연골 질환으로 이루어진 군에서 선택되는 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 예방은 본 발명의 상기 약학 조성물을 이용하여 골 또는 연골손상으로 인해 발생될 수 있는 골 또는 연골 질환을 차단하거나, 이에 의해 발생될 수 있는 증상을 억제 또는 지연시키는 모든 행위라면 제한없이 포함될 수 있다.
본 발명의 상기 치료는 본 발명의 상기 약학 조성물을 이용하여 골 또는 연골손상으로 인해 발생될 수 있는 골 또는 연골 질환의 증상을 호전시키거나, 이롭게 되도록 유도하는 행위라면 제한없이 모두 포함될 수 있다.
본 발명의 상기 구현 예의 약학 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명의 상기 약학 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사 용액의 형태로 제형화되어 사용될 수 있다. 본 발명의 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등이 사용될 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등이 혼합되어 사용될 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등이 사용될 수 있다. 본 발명의 약학 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(Elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항 응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명의 상기 약학 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
본 발명의 상기 비경구는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다.
본 발명의 상기 약학 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50 mg/kg 또는 0.001 내지 50 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형화될 수 있다.
본 발명의 또 다른 구현 예에서는 USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 약학적 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공한다.
본 발명의 상기 "개체"란, 골 또는 연골질환의 예방 또는 치료가 필요한 개체로서, 영장류 예를 들면 인간뿐만 아니라, 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물을 모두 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 "투여"란, 임의의 적절한 방법으로 개체에게 본 발명의 유효성분을 도입하는 과정을 의미하는 것으로서, 본 발명의 상기 치료 방법에서 투여 방법은 경구 또는 비경구 등의 다양한 경로를 통해 투여될 수 있다.
본 발명의 상기 치료 방법에서, 상기 USP25 단백질, 폴리뉴클레오티드, 골 또는 연골 질환, 예방, 치료 등과 관련된 내용은 앞서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위하여 생략한다.
본 발명의 또 다른 구현 예에서는 USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 약학적으로 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공한다.
본 발명의 상기 치료 방법에서, 상기 USP25 단백질, 폴리뉴클레오티드, 골 또는 연골 질환, 예방, 치료, 개체, 투여 등과 관련된 내용은 앞서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위하여 생략한다.
본 발명의 USP25 단백질이 유효성분으로 포함된 조성물을 사용하는 경우, 다른 탈 유비퀴틴화 효소에 비하여 골수 유래 중간엽 줄기 세포가 골 조직 세포, 특히 연골 세포로 분화될 수 있도록 매우 효과적으로 유도할 수 있다. 또한, 이렇게 연골 세포로 분화될 수 있도록 유도함으로써 연골 조직이 손상되어 발생될 수 있는 다양한 질환의 예방 또는 치료에 매우 유용하게 적용될 수 있다.
도 1a 및 1b는 본 발명의 일 실시예에 따른 알시안 블루 염색(Alcian blue saining)을 이용한 연골 분화능 억제 효과를 확인한 결과를 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따른 사프라닌 오 염색(Safranin O staining) 및 알시안 블루 염색을 이용한 연골 분화능 억제 효과를 확인한 결과를 나타낸 것이다.
도 3은 본 발명의 일 실시예에 따른 면역조직화학(Immunohistochemistry; IHC)을 이용한 연골 분화능 억제 효과 확인한 결과를 나타낸 것이다.
도 4는 본 발명의 일 실시예에 따른 사프라닌 오 염색 및 알시안 블루 염색을 이용한 연골 분화 효과를 확인한 결과를 나타낸 것이다.
도 5는 본 발명의 일 실시예에 따른 면역조직화학을 이용한 연골 분화 효과 확인한 결과를 나타낸 것이다.
도 6은 본 발명의 일 실시예에 따른 사프라닌 오 염색 및 알시안 블루 염색을 이용한 탈 유비퀴틴화 효소간의 연골 분화 효과를 비교한 결과를 나타낸 것이다.
도 7은 본 발명의 일 실시예에 따른 Sox9(SRY-Box 9) 단백질의 유비퀴틴화 정도를 면역침전법을 이용하여 확인한 결과를 나타낸 것이다.
본 발명의 일 구현 예에서는 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 조직 재생용; 및 골 또는 연골 질환의 예방 또는 치료용 약학 조성물을 제공한다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예
[
준비예
1]
인간 골수 유래
중간엽
줄기 세포(hBMSCs)의
배양
아래의 실험은 모두 IRB(Institutional Review Board)의 승인(승인 번호: IRB no. 4-2017-0232) 하에 진행되었다. 6명의 성인 기증자의 후장골릉(posterior iliac crest)에서 골수 천자액(BM aspirates)을 수득하였다. 상기 골수 천자액으로부터 플라스틱 세포배양 플라스크에 흡착되는 능력을 기준으로 인간 골수 유래 중간엽 줄기세포(hBMSCs)를 선별하였다. 배양 배지(10% FBS(Gibco, Grand Island, NY, USA) 및 1% 항생제-항진균제 용액(Gibco)이 포함된 DMEM-LG(low-glucose Dulbecco's modified Eagle's medium; Gibco))에서 상기 선별된 hBMSCs를 배양하였다. 여기서, 통상의 방법에 따른 유세포 분석에 의해 CD90 및 CD105가 양성이면서, CD34 및 CD45가 음성인 것을 통해 hBMSCs의 특성이 확인된 세포만을 아래의 실험에서 사용하였다.
[
실시예
1]
USP25
(
Ubiquitin
carboxyl-terminal
hydrolase
25) 녹다운에 의한 연골 분화능 억제 효과 확인
[1-1] USP25가 녹다운된 hBMSCs 제작
렌티바이러스 벡터(pLKO.1-Puro Lentiviral Vector; Yonsei Genome Center, 한국)의 TRC2 위치에 USP25의 염기 서열의 일부에 상보적인 서열번호 1 및 2의 염기 서열을 삽입하여, pLKO.1-puro-shUSP25-1(TRCN0000004366, Yonsei Genome Center, 한국) 및 pLKO.1-puro-shUSP25-2 (TRCN0000004367, Yonsei Genome Center, 한국)를 제작하였다. 여기서, 대조군의 경우, 상기 서열번호 1 및 2 대신에, 비-타겟 shRNA 염기 서열이 삽입된 대조군 벡터(shScramble, SHC016, pLKO.1-puro (Yonsei Genome Center)를 사용하였다.
바이러스 패키징 믹스(Sigma-Aldrich, 미국) 및 리포펙타민 LTX PLUS (Invitrogen, 미국)을 이용하여 상기 렌티바이러스 벡터를 Lenti-X-293FT(Clontech, 미국) 세포에 제조사에서 제공된 프로토콜에 따라 형질전환한 뒤, 상기 형질전환된 세포를 배양하고 상기 세포의 배양액으로부터 바이러스를 수득하였다. 그런 다음, 상기 제조예의 hBMSCs에 상기 수득된 바이러스를 24시간 동안 배양하였다. 이후, 상기 바이러스가 포함된 배양 배지를 제거하고, 10 ㎍/㎖의 퓨로마이신(puromycine) 항생제가 포함된 새로운 배양 배지에서 24시간 이상 배양하는 과정을 통해, 항생제에 저항성이 있는 세포만을 선택함으로써 shUSP25-1에 의해 녹다운된 hBMSCs(이하, 'hBMSCs_shUSP25-1'이라 함.), shUSP25-2에 의해 녹다운된 hBMSCs(이하, 'hBMSCs_shUSP25-2'이라 함.)와, 대조군 hBMSCs를 제작하였다.
| 이름 | 번호 | 염기서열 |
| shUSP25-1 | 서열번호 1 | 5′- GCACTTCTCCTGTTGACGATA -3′ |
| shUSP25-2 | 서열번호 2 | 5′- GCTGTAGAAGATATGAGAAAT -3′ |
[1-2]
알시안
블루
염색을 이용한 연골
분화능
억제 효과 확인
마이크로메스(Micromass) 배양을 위하여, 상기 [1-1]에서 제작한 1 × 105 (10㎕)개의 hBMSCs_shUSP25-1, hBMSCs_shUSP25-2 및 대조군 세포 펠렛을 24-웰 플레이트에 조심스럽게 배치하고, 37℃에서 2시간 동안 부착될 수 있도록 하였다. 그런 다음, 연골 분화 배지(1× 인슐린-트랜스페린-셀레늄-A [Gibco], 1% 항생제-항진균제 용액, 50 ㎍/mL 아스코르브산 및 10 ng/mL 형질전환성장인자-β3 [TGF-β3; R&D Systems]이 포함된 DMEM-HG (High-glucose Dulbecco's modified Eagle's medium; Gibco)에서 21일 동안 배양하고, 상기 세포의 마이크로메스 펠렛을 24시간 동안 10% 포말린에 고정시켰다. 고정 후, 상기 포말린-고정 표본을 파라핀에 임베디드(embedded)시켰다. 상기 파라핀-임베디드 절편을 탈파라핀화(deparaffinized) 한 뒤, 재수화(rehydrated)하고 PBS를 이용하여 두 번 세척하였다. 그런 다음, 상기 절편을 4 ㎛의 두께로 슬라이스하고, 글리코사미노글리칸을 검출하기 위하여 사프라닌 오(Safranin O)/패스트 그린으로 염색을 실시하였다. 상기 염색한 샘플을 VS120 가상 현미경 (올림푸스, 일본)을 사용하여 염색 정도를 확인하고, 그 결과를 도 1에 나타내었다.
도 1에서 보는 바와 같이, 연골 특이적 기질 중 산성 점액다당류(Acid mucosubstance and acid mucin)가 파란색으로 염색되는 알시안블루의 염색 정도를 분석하였을 때, 대조군(shMock)의 염색 정도는 비교적 촘촘하게 되어 있는 반면, hBMSCs_shUSP25-1(shUSP25-1) 및 hBMSCs_shUSP25-2(shUSP25-2)에서는 파란색으로 염색된 부분이 엉성해진 것을 확인하였다. 또한, 대조군의 경우 광학 밀도가 1.0에 해당하는 반면, hBMSCs_shUSP25-1(shUSP25-1) 및 hBMSCs_shUSP25-2(shUSP25-2)의 연골 세포로의 광학 밀도는 각각 약 0.1 및 0.3으로, 대조군에 비하여 현저하게 감소된 것을 확인되었다.
상기 결과를 통해, 본 발명에 따른 USP25는 골수 유래 중간엽 줄기세포가 연골로 분화될 수 있도록 유도할 수 있음을 알 수 있다.
[1-3] 사프라닌 오 및
알시안
블루
염색을 이용한 연골
분화능
억제 효과 확인
상기 [1-1]의 세포를 연골로 분화시킬 때, 마이크로매스 배양법을 이용하였다. 트립신화된 hBMSC를 10% FBS가 함유된 DMEM-LG에서 1×108 cells/mL 농도로 재부유시키고, 이 중 10 μL 만을 24-웰 플레이트(1×106 cells/웰)의 각각의 웰에 찍어(dotting)주었다. 37℃에서 상기 세포들이 두 시간 동안 흡착될 수 있도록 한 뒤, 연골 분화 배지에서 21일 동안 배양하였다.
그런 다음, 알시안블루 염색과, 사프라닌-오 염색을 이용하여 연골 세포로의 분화 여부를 분석하여, 그 결과를 도 2에 나타내었다. 여기서, 상기 알시안 블루는 상기 마이크로매스를 포름알데히드에 고정시키고, 파라핀화 한 뒤 크실렌을 이용하여 탈 파라핀화하고 에탄올로 재수화하는 과정을 제외하고는 상기 [1-2]와 동일하게 수행하였다.
도 2에서 보는 바와 같이, 대조군에 비하여, hBMSCs_shUSP25-1, hBMSCs_shUSP25-2에서 붉은색으로 염색되는 연골 특이적 기질 중에서 프로테오글리칸(Proteoglycan)이 현저하게 감소되었고, 파란색으로 염색되는 점액다당류가 현저하게 감소되는 것을 확인하였다.
상기 결과를 통해 본 발명에 따른 USP25 단백질이 골수 유래 중간엽 줄기세포가 연골 세포로 분화를 유도하고, 기질을 형성하는 역할을 하는 것을 알 수 있다.
[1-4] 면역조직화학(
Immunohistochemistry
; IHC)을 이용한 연골
분화능
억제 효과 확인
상기 [1-3]에서와 같이 마이크로매스 배양법을 이용하여 배양된 hBMSCs_shUSP25-1 및 hBMSCs_shUSP25-2에서 2형 콜라겐 및 아그리칸(Aggrecan) 단백질이 존재하는 수준을 면역조직화학염색을 통해 확인하여, 그 결과를 도 3에 나타내었다.
도 3에서 보는 바와 같이, 대조군에서 기질 단백질에 해당하는 2형 콜라겐과, 아그리칸 단백질이 존재하는 수준과 비교하여, hBMSCs_shUSP25-1 및 hBMSCs_shUSP25-2에서 현저하게 감소된 것을 확인하였다.
상기 결과를 통해, 본 발명에 따른 USP25 단백질이 골수 유래 중간엽 줄기세포가 연골 세포로의 분화가 되도록 유도할 수 있을 뿐만 아니라, 연골 특이적인 기질 단백질의 발현이 증가될 수 있도록 하는 것을 알 수 있다.
[실시예 2]
USP25 과발현에 의한 연골 분화능 효과 확인
[2-1] USP25의 과발현 세포 제작
USP25 단백질을 암호화하는 서열번호 3의 염기 서열을 포함하고 있는 렌티바이러스 벡터(human CMV pLenti-GIII-CMV-GFP-2A-Puro-Lentiviral Vector; cat. No. LV353539, Abm, 미국)를 구입하였다. 여기서, 대조군의 경우, USP25 단백질을 암호화하는 염기 서열이 삽입되지 않은 벡터 (human CMV pLenti-CMV-GFP-2A-Puro- blank Lentiviral Vector; cat. No. LV590, Abm, 미국)를 구입하여 사용하였다. 그런 다음, 상기 벡터를 상기 [1-1]과 동일한 방법으로 hBMSCs에 형질전환하여 USP25 단백질이 과발현된 hBMSCs 및, 대조군 세포를 제작하였다.
[2-2] 사프라닌 오 및 알시안 블루 염색을 이용한 연골 분화능 효과 확인
상기 [2-1]의 USP25 단백질이 과발현된 hBMSCs 및 대조군 세포를 마이크로매스 배양법을 이용하여 21일 동안 배양하고, 상기 [1-3]에서와 동일한 방법으로 사프라닌 오 및 알시안 블루 염색을 수행하여, 그 결과를 도 4에 나타내었다.
도 4에서 보는 바와 같이, 대조군 세포에 비하여, USP25가 과발현된 hBMSCs에서 사프라닌 오 및 알시안 블루가 염색된 범위가 현저하게 증가됨을 통해 연골 특이적인 기질인 프로테오글리칸과 산성 점액다당류가 증가된 것을 확인하였다.
상기 결과를 통해, 본 발명에 따른 USP25 단백질은 골수 유래 중간엽 줄기세포가 연골로 분화되는 것을 매우 효과적으로 유도할 수 있음을 알 수 있다.
[2-3] 면역조직화학을 이용한 연골 분화능 효과 확인
상기 [2-1]의 USP25 단백질이 과발현된 hBMSCs 및 대조군 세포를 마이크로매스 배양법을 이용하여 21일 동안 배양하고, 상기 [1-4]에서와 동일한 방법으로 2형 콜라겐 및 아그리칸(Aggrecan) 단백질이 존재하는 수준을 면역조직화학염색을 통해 확인하여, 그 결과를 도 5에 나타내었다.
도 5에서 보는 바와 같이, 대조군에서 기질 단백질에 해당하는 2형 콜라겐과, 아그리칸 단백질이 존재하는 수준과 비교하여, USP25 단백질이 과발현된 hBMSCs에서 현저하게 증가된 것을 확인하였다.
상기 결과를 통해, 본 발명에 따른 USP25 단백질이 골수 유래 중간엽 줄기세포가 연골 세포로의 분화가 되도록 유도할 수 있을 뿐만 아니라, 연골 특이적인 기질 단백질의 발현이 증가될 수 있도록 하는 것을 알 수 있다.
[실시예 3]
USP25 단백질과 다른 탈 유비퀴틴화 효소의 연골 분화능 비교
연골 분화능이 탈 유비퀴틴화 기능을 갖는 효소 중에서 특히 USP25 단백질에 특이적인 것인지 확인하였다.
USP25 단백질을 제외의 다른 탈 유비퀴틴화 효소(USP 1, 2, 4, 5, 7, 8, 9X, 10, 14, 15, 16, 19, 20, 22, 24, 28, 47 및 48)의 기능을 억제하는 DUB 억제제인 10μL의 PR-619(cat no. A13190, AdooQ)를 hBMSCs에 처리하고, 6시간 동안 배양하였다. 그런 다음, 상기 PR-619가 처리된 hBMSCs와 상기 [1-1]에서 제작된 shUSP25-1에 의해 녹다운된 hBMSCs를 마이크로매스 배양법을 이용하여 21일 동안 배양하고, 상기 [1-3]에서와 동일한 방법으로 사프라닌 오 및 알시안 블루 염색을 수행하여, 그 결과를 도 6에 나타내었다. 여기서, 대조군(Cont)에는 shRNA가 삽입된 벡터가 형질전환되지 않고, PR-619가 처리되지 않도록 하였다.
도 6에서 보는 바와 같이, USP25 단백질이 아닌 다른 효소의 기능을 억제하는 PR-619가 처리된 경우에는 hBMSCs에서 사프라닌 오 및 알시안 블루가 염색된 범위가 감소되지 않은 반면, USP25 단백질이 억제된 경우에는 사프라닌 오 및 알시안 블루가 염색된 범위가 현저하게 감소된 것을 확인하였다.
상기 결과를 통해, 본 발명에 따른 USP25 단백질은 다른 탈 유비퀴틴화 효소에 비하여 골수 유래 중간엽 줄기세포가 연골로 분화될 수 있도록 하는 현저한 효과가 존재함을 알 수 있다.
[실시예 4]
USP25에 의한 연골 분화와 관련된 단백질의 탈 유비퀴틴화 확인
상기 [2-1]의 USP25가 과발현된 hBMSCs와, 대조군 세포를 21일 동안 배양하였다. 여기서, 세포를 수득하기 6시간 이전에 단백질 분해 억제제인 MG132를 처리하였다. 그런 다음, 상기 세포들을 수득하여 용해 완충액(Lysis buffer)에 넣어 세포를 완전히 용해시켰다. 그런 다음, 상기 세포 용해물에 존재하는 단백질을 정량화 한 뒤, 1 mg의 단백질 시료에 MYC에 특이적인 항체를 첨가하고 4℃에서 12시간 반응시켰다. 이후, 단백질 비드를 첨가한 후, 4℃에서 4시간 동안 추가로 반응시킨 뒤, 상기 반응물을 침전시키고, 추출 완충액으로 3회 세척한 후, SDS 완충액을 첨가하여 반응을 중단시켰다. 이렇게 얻은 샘플을 SDS-PAGE에 전기영동 시키고, 겔에 포함된 단백질을 PVDF 막에 옮긴 뒤에 Sox9(SRY-Box 9) 단백질에 특이적인 항체를 이용하여 웨스턴 블롯 분석을 수행하여, 그 결과를 도 7에 나타내었다.
도 7에서 보는 바와 같이, 대조군(GFP-USP25 - 컬럼)에서 Sox9 단백질에 유비퀴틴화가 일어나 있는 반면, USP25 단백질이 과발현 되어 있는 경우(GFP-USP25 + 컬럼)에는 Sox9 단백질의 유비퀴틴화 정도가 현저하게 감소되어 있었다.
상기 결과를 통해, 본 발명에 따른 USP25는 연골의 분화에 있어서 매우 중요한 기능을 하는 전사 인자인 Sox9 단백질을 세포 내에서 유비퀴틴화에 의해 분해되지 않도록 억제함으로써, 골수 유래 중간엽 줄기세포가 연골로 분화될 수 있도록 매우 효과적으로 유도하는 것을 알 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 조직 재생용 약학 조성물에 관한 것으로, 구체적으로 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 조직 재생용 약학 조성물에 관한 것으로, 상기 조성물을 사용하는 경우, 다른 탈 유비퀴틴화 효소에 비하여 골수 유래 중간엽 줄기 세포가 골 조직 세포, 특히 연골 세포로 분화될 수 있도록 매우 효과적으로 유도할 수 있다. 또한, 이렇게 연골 세포로 분화될 수 있도록 유도함으로써 연골 조직이 손상되어 발생될 수 있는 다양한 질환의 예방 또는 치료에 매우 유용하게 적용될 수 있다.
<110> Industry-Academic Cooperation Foundation, Yonsei University
<120> A Pharmaceutical composition comprising the USP25 protein or a
polynucleotide encoding the same as an active ingredient
<130> POPB194264PCT
<150> KR 10-2018-0152187
<151> 2018-11-30
<160> 4
<170> KoPatentIn 3.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> USP25 target shRNA artificial sequence
<400> 1
gcacttctcc tgttgacgat a 21
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> USP25 target shRNA artificial sequence
<400> 2
gctgtagaag atatgagaaa t 21
<210> 3
<211> 450
<212> PRT
<213> Homo sapiens
<400> 3
Met Thr Val Glu Gln Asn Val Leu Gln Gln Ser Ala Ala Gln Lys His
1 5 10 15
Gln Gln Thr Phe Leu Asn Gln Leu Arg Glu Ile Thr Gly Ile Asn Asp
20 25 30
Thr Gln Ile Leu Gln Gln Ala Leu Lys Asp Ser Asn Gly Asn Leu Glu
35 40 45
Leu Ala Val Ala Phe Leu Thr Ala Lys Asn Ala Lys Thr Pro Gln Gln
50 55 60
Glu Glu Thr Thr Tyr Tyr Gln Thr Ala Leu Pro Gly Asn Asp Arg Tyr
65 70 75 80
Ile Ser Val Gly Ser Gln Ala Asp Thr Asn Val Ile Asp Leu Thr Gly
85 90 95
Asp Asp Lys Asp Asp Leu Gln Arg Ala Ile Ala Leu Ser Leu Ala Glu
100 105 110
Ser Asn Arg Ala Phe Arg Glu Thr Gly Ile Thr Asp Glu Glu Gln Ala
115 120 125
Ile Ser Arg Val Leu Glu Ala Ser Ile Ala Glu Asn Lys Ala Cys Leu
130 135 140
Lys Arg Thr Pro Thr Glu Val Trp Arg Asp Ser Arg Asn Pro Tyr Asp
145 150 155 160
Arg Lys Arg Gln Asp Lys Ala Pro Val Gly Leu Lys Asn Val Gly Asn
165 170 175
Thr Cys Trp Phe Ser Ala Val Ile Gln Ser Leu Phe Asn Leu Leu Glu
180 185 190
Phe Arg Arg Leu Val Leu Asn Tyr Lys Pro Pro Ser Asn Ala Gln Asp
195 200 205
Leu Pro Arg Asn Gln Lys Glu His Arg Asn Leu Pro Phe Met Arg Glu
210 215 220
Leu Arg Tyr Leu Phe Ala Leu Leu Val Gly Thr Lys Arg Lys Tyr Val
225 230 235 240
Asp Pro Ser Arg Ala Val Glu Ile Leu Lys Asp Ala Phe Lys Ser Asn
245 250 255
Asp Ser Gln Gln Glu Trp His Gln Asp Tyr Arg Lys Phe Arg Glu Thr
260 265 270
Thr Met Tyr Leu Ile Ile Gly Leu Glu Asn Phe Gln Arg Glu Ser Tyr
275 280 285
Ile Asp Ser Leu Leu Phe Leu Ile Cys Ala Tyr Gln Asn Asn Lys Glu
290 295 300
Leu Leu Ser Lys Gly Leu Tyr Arg Gly His Asp Glu Glu Leu Ile Ser
305 310 315 320
His Tyr Arg Arg Glu Cys Leu Leu Lys Leu Asn Glu Gln Ala Ala Glu
325 330 335
Leu Phe Glu Ser Gly Glu Asp Arg Glu Val Asn Asn Gly Leu Ile Ile
340 345 350
Met Asn Glu Phe Ile Val Pro Phe Leu Pro Leu Leu Leu Val Asp Glu
355 360 365
Met Glu Glu Lys Asp Ile Leu Ala Val Glu Asp Met Arg Asn Arg Trp
370 375 380
Cys Ser Tyr Leu Gly Gln Glu Met Glu Pro His Leu Gln Glu Lys Leu
385 390 395 400
Thr Asp Phe Leu Pro Lys Leu Leu Asp Cys Ser Met Glu Ile Lys Ser
405 410 415
Phe His Glu Pro Pro Lys Leu Pro Ser Tyr Ser Thr His Glu Leu Cys
420 425 430
Glu Arg Phe Ala Arg Ile Met Leu Ser Leu Ser Arg Thr Pro Ala Asp
435 440 445
Gly Arg
450
<210> 4
<211> 3168
<212> DNA
<213> Homo sapiens
<400> 4
atgaccgtgg agcagaacgt gctgcagcag agcgcggcgc agaagcacca gcagacgttt 60
ttgaatcaac tgagagaaat tacggggatt aatgacaccc agatactaca gcaagccttg 120
aaggatagta atggaaactt ggaattagca gtggctttcc ttactgcgaa gaatgctaag 180
acccctcagc aggaggagac aacttactac caaacagcac ttcctggcaa tgatagatac 240
atcagtgtgg gaagccaagc agatacaaat gtgattgatc tcactggaga tgataaagat 300
gatcttcaga gagcaattgc cttgagtttg gccgaatcaa acagggcatt cagggagact 360
ggaataactg atgaggaaca agccattagc agagttcttg aagccagcat agcagagaat 420
aaagcatgtt tgaagaggac acctacagaa gtttggaggg attctcgaaa cccttatgat 480
agaaaaagac aggacaaagc tcccgttggg ctaaagaatg ttggcaatac ttgttggttt 540
agtgctgtta ttcagtcatt atttaatctt ttggaattta gaagattagt tctgaattac 600
aagcctccat caaatgctca agatttaccc cgaaaccaaa aggaacatcg gaatttgcct 660
tttatgcgtg agctgaggta tctatttgca cttcttgttg gtaccaaaag gaagtatgtt 720
gatccatcaa gagcagttga aattcttaag gatgctttca aatcaaatga ctcacagcag 780
caagatgtga gtgagtttac acacaaatta ttagattggt tagaagatgc cttccaaatg 840
aaagctgaag aggagacgga tgaagagaag ccaaagaacc ccatggtaga gttgttctat 900
ggcagattcc tggctgtggg agtacttgaa ggtaaaaaat ttgaaaacac tgaaatgttt 960
ggtcagtacc cacttcaggt caatgggttc aaagatctgc atgagtgcct agaagctgca 1020
atgattgaag gagaaattga gtctttacat tcagagaatt caggaaaatc aggccaagag 1080
cattggttta ctgaattacc acctgtgtta acatttgaat tgtcaagatt tgaatttaat 1140
caggcattgg gaagaccaga aaaaattcac aacaaattag aatttcccca agttttatat 1200
ttggacagat acatgcacag aaacagagaa ataacaagaa ttaagaggga agagatcaag 1260
agactgaaag attacctcac ggtattacaa caaaggctag aaagatattt aagctatggt 1320
tccggtccca aacgattccc cttggtagat gttcttcagt atgcattgga atttgcctca 1380
agtaaacctg tttgcacttc tcctgttgac gatattgacg ctagttcccc acctagtggt 1440
tccataccat cacagacatt accaagcaca acagaacaac agggagccct atcttcagaa 1500
ctgccaagca catcaccttc atcagttgct gccatttcat cgagatcagt aatacacaaa 1560
ccatttactc agtcccggat acctccagat ttgcccatgc atccggcacc aaggcacata 1620
acggaggaag aactttctgt gctggaaagt tgtttacatc gctggaggac agaaatagaa 1680
aatgacacca gagatttgca ggaaagcata tccagaatcc atcgaacaat tgaattaatg 1740
tactctgaca aatctatgat acaagttcct tatcgattac atgccgtttt agttcacgaa 1800
ggccaagcta atgctgggca ctactgggca tatatttttg atcatcgtga aagcagatgg 1860
atgaagtaca atgatattgc tgtgacaaaa tcatcatggg aagagctagt gagggactct 1920
tttggtggtt atagaaatgc cagtgcatac tgtttaatgt acataaatga taaggcacag 1980
ttcctaatac aagaggagtt taataaagaa actgggcagc cccttgttgg tatagaaaca 2040
ttaccaccgg atttgagaga ttttgttgag gaagacaacc aacgatttga aaaagaacta 2100
gaagaatggg atgcacaact tgcccagaaa gctttgcagg aaaagctttt agcgtctcag 2160
aaattgagag agtcagagac ttctgtgaca acagcacaag cagcaggaga cccagaatat 2220
ctagagcagc catcaagaag tgatttctca aagcacttga aagaagaaac tattcaaata 2280
attaccaagg catcacatga gcatgaagat aaaagtcctg aaacagtttt gcagtcggca 2340
attaagttgg aatatgcaag gttggttaag ttggcccaag aagacacccc accagaaacc 2400
gattatcgtt tacatcatgt agtggtctac tttatccaga accaggcacc aaagaaaatt 2460
attgagaaaa cattactaga acaatttgga gatagaaatt tgagttttga tgaaaggtgt 2520
cacaacataa tgaaagttgc tcaagccaaa ctggaaatga taaaacctga agaagtaaac 2580
ttggaggaat atgaggagtg gcatcaggat tataggaaat tcagggaaac aactatgtat 2640
ctcataattg ggctagaaaa ttttcaaaga gaaagttata tagattcctt gctgttcctc 2700
atctgtgctt atcagaataa caaagaactc ttgtctaaag gcttatacag aggacatgat 2760
gaagaattga tatcacatta tagaagagaa tgtttgctaa aattaaatga gcaagccgca 2820
gaactcttcg aatctggaga ggatcgagaa gtaaacaatg gtttgattat catgaatgag 2880
tttattgtcc catttttgcc attattactg gtggatgaaa tggaagaaaa ggatatacta 2940
gctgtagaag atatgagaaa tcgatggtgt tcctaccttg gtcaagaaat ggaaccacac 3000
ctccaagaaa agctgacaga ttttttgcca aaactgcttg attgttctat ggagattaaa 3060
agtttccatg agccaccgaa gttaccttca tattccacgc atgaactctg tgagcgattt 3120
gcccgaatca tgttgtccct cagtcgaact cctgctgatg gaagataa 3168
Claims (16)
- USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 조직 재생용 약학 조성물.
- 제 1항에 있어서,상기 USP25 단백질은 Sox5(SRY-Box 5), Sox6(SRY-Box 6) 및 Sox9(SRY-Box 9)으로 구성된 군으로부터 선택되는 적어도 하나의 단백질을 탈 유비퀴틴화 시키는 것인, 조직 재생용 약학 조성물.
- 제 1항에 있어서,상기 조직은 골 조직 또는 연골 조직인 것인, 조직 재생용 약학 조성물.
- 제 3항에 있어서,상기 연골 조직은 유리질 연골(Hyaline cartilage), 탄성 연골(Elastic cartilage) 및 섬유 연골(Fibrocartilage)로 구성된 군으로부터 선택되는 적어도 하나인 것인, 조직 재생용 약학 조성물.
- 제 3항에 있어서,상기 골 조직은 늑골, 두개골, 장골, 상완골, 척추뼈, 골반뼈 및 어깨뼈로 구성된 군으로부터 선택되는 적어도 하나인 것인, 조직 재생용 약학 조성물.
- USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터를 유효성분으로 포함하는, 조직 재생용 약학 조성물.
- USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함하는, 조직 재생용 약학 조성물.
- USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
- 제 8항에 있어서,상기 USP25 단백질은 Sox5, Sox6 및 Sox9으로 구성된 군으로부터 선택되는 적어도 하나의 단백질을 탈 유비퀴틴화 시키는 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
- 제 8항에 있어서,상기 연골은 유리질 연골, 탄성 연골 및 섬유 연골로 구성된 군으로부터 선택되는 적어도 하나인 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
- 제 8항에 있어서,상기 골은 늑골, 두개골, 장골, 상완골, 척추뼈, 골반뼈 및 어깨뼈로 구성된 군으로부터 선택되는 적어도 하나인 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
- 제 8항에 있어서,상기 골 또는 연골 질환은 관절염; 골다공증; 골연골증; 골연골염; 불완전 골형성증; 골수염; 골증식체; 연골형성부전증; 연골염; 연골종; 연골육종; 추간판 탈출증; 클리펠-파일 증후군; 변형성 골염; 낭성 섬유뼈염; 및 사고, 골절, 상처, 관절 손상, 자가면역질환, 당뇨병 또는 암으로 인한 골 또는 연골 질환으로 이루어진 군에서 선택되는 적어도 하나인 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
- USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터를 유효성분으로 포함하는, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
- USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함하는, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
- USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 약학적 유효량으로 개체에 투여하는 단계를 포함하는, 골 또는 연골 질환의 예방 또는 치료 방법.
- USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 약학적으로 유효량으로 개체에 투여하는 단계를 포함하는, 골 또는 연골 질환의 예방 또는 치료 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2018-0152187 | 2018-11-30 | ||
| KR1020180152187A KR102158644B1 (ko) | 2018-11-30 | 2018-11-30 | Usp25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 약학 조성물 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020111519A1 true WO2020111519A1 (ko) | 2020-06-04 |
Family
ID=70854058
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2019/014061 Ceased WO2020111519A1 (ko) | 2018-11-30 | 2019-10-24 | Usp25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 약학 조성물 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR102158644B1 (ko) |
| WO (1) | WO2020111519A1 (ko) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150307846A1 (en) * | 2012-06-19 | 2015-10-29 | Katholieke Universiteit Leuven | Growth factor cocktail to enhance osteogenic differentiation of mesenchymal cells |
-
2018
- 2018-11-30 KR KR1020180152187A patent/KR102158644B1/ko active Active
-
2019
- 2019-10-24 WO PCT/KR2019/014061 patent/WO2020111519A1/ko not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150307846A1 (en) * | 2012-06-19 | 2015-10-29 | Katholieke Universiteit Leuven | Growth factor cocktail to enhance osteogenic differentiation of mesenchymal cells |
Non-Patent Citations (6)
| Title |
|---|
| BAEK, DAUN: "Deubiquitinase USP 25 is essential for chondrogenic differentiation of human bone marrow derived mesenchymal stem cells", KOREAN SOCIETY OF , STEM CELL AND REGENERATIVE MEDICINE FOR LOCOMOTOR SYSTEM 1 1TH CONFERENCE, 19 May 2019 (2019-05-19), Gangnam Severance Hospital , Seoul * |
| GUO, Y.-C. ET AL.: "Deubiquitinating enzymes and bone remodeling", STEM CELLS INTERNATIONAL, vol. 2018, 8 July 2018 (2018-07-08), pages 3712083, XP055713299 * |
| KONDO, M. ET AL.: "IL -17 inhibits chondrogenic differentiation of human mesenchymal stem cells", PLOS ONE, vol. 8, no. 11, 15 November 2013 (2013-11-15), pages e79463, XP055713250 * |
| SURESH, B. ET AL.: "Regulation of pluripotency and differentiation by deubiquitinating enzymes", CELL DEATH & DIFFERENTIATION, vol. 23, no. 8, 10 June 2016 (2016-06-10), pages 1257 - 1264, XP055713302 * |
| WANG, Z. ET AL.: "IL -17A inhibits osteogenic differentiation of bone mesenchymal stem cells via Wnt signaling pathway", MEDICAL SCIENCE MONITOR, vol. 23, 24 August 2017 (2017-08-24), pages 4095 - 4101, XP055713298 * |
| ZHONG, B. ET AL.: "Negative regulation of IL -17-mediated signaling and inflammation by the ubiquitin-specific protease USP 25", NATURE IMMUNOLOGY, vol. 13, no. 11, November 2012 (2012-11-01), pages 1110 - 1117 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102158644B1 (ko) | 2020-09-22 |
| KR20200065586A (ko) | 2020-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021150079A1 (ko) | 안정성이 향상된 신규 히알루론산 가수분해 효소 변이체 및 이를 포함하는 약제학적 조성물 | |
| WO2020022791A1 (ko) | 신규 히알루론산 가수분해 효소 변이체 및 이를 포함하는 약제학적 조성물 | |
| WO2013169077A1 (ko) | 악액질 예방 또는 치료용 조성물 | |
| WO2017039267A1 (en) | Novel insulin analogs and use thereof | |
| WO2015076621A1 (ko) | 혈관 신생 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물 | |
| WO2015156649A1 (ko) | 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물 | |
| WO2019125059A1 (ko) | 신규한 구조를 갖는 치료학적 효소 융합단백질 및 이의 용도 | |
| WO2012050402A2 (ko) | 세포투과성 parkin 재조합 단백질 및 이를 함유하는 퇴행성 뇌질환 치료용 약학적 조성물 | |
| WO2013129801A1 (ko) | 트리펩타이드 및 이를 함유하는 노화방지, 주름개선, 미백 및 항염효능의 화장료 조성물 | |
| WO2019147036A1 (ko) | 뇌유래-신경영양인자를 발현하는 중간엽줄기세포 및 이의 용도 | |
| WO2010131917A2 (ko) | 줄기세포의 세포 활성과 연관된 tsp-1, tsp-2, il-17br 및 hb-egf 및 이들의 용도 | |
| WO2016204545A1 (ko) | 골 형성 촉진 또는 골 흡수 억제용 펩타이드 및 이의 용도 | |
| WO2021137674A1 (ko) | 조직 재생용 조성물 | |
| WO2022025455A1 (ko) | 염증성 질환의 예방 또는 치료용 조성물 및 이의 용도 | |
| WO2015088233A1 (ko) | 항산화 효과를 가지는 펩티드 및 이를 포함하는 조성물 | |
| WO2021145700A1 (ko) | 저산소 환경 하에서 높은 적응력을 가지는 세포 및 이의 용도 | |
| WO2022015106A1 (ko) | 종양괴사인자-자극된 유전자 6을 발현하는 중간엽 줄기세포를 포함하는 골관절염의 예방 또는 치료용 조성물 | |
| WO2020122498A1 (ko) | 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물 | |
| WO2020159191A1 (ko) | Mls-stat3를 포함하는 면역질환의 예방 또는 치료용 조성물 | |
| WO2016027990A1 (ko) | Dusp5를 유효성분으로 모두 포함하는 골대사성 질환의 예방 또는 치료용 약학적 조성물 | |
| WO2024029995A1 (ko) | 아밀로이드 베타 특이적 펩타이드 cbrv1-04369 및 이를 포함하는 알츠하이머병 치료용 조성물 | |
| WO2022103220A1 (ko) | 치료학적 효소 융합단백질의 파브리병에 기인하거나 동반되는 신경병증 예방 및 치료 용도 | |
| WO2009145573A9 (ko) | 아미노 말단의 메티오닌이 제거된 재조합 사람 변이 인터페론-베타 단백질을 생산하는 재조합 대장균 및 이의 제조방법 | |
| WO2025225980A1 (ko) | Nm3 돌연변이 adamts1 펩타이드 및 이를 포함하는 근육 질환 치료용 약제학적 조성물 | |
| WO2009136757A1 (en) | Gene encoding a protein having an anti-allergic and immune-modulatory activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19891019 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19891019 Country of ref document: EP Kind code of ref document: A1 |