WO2020071777A1 - 근접 단백질가수분해 반응에 기반한 표적 핵산 검출방법 - Google Patents
근접 단백질가수분해 반응에 기반한 표적 핵산 검출방법Info
- Publication number
- WO2020071777A1 WO2020071777A1 PCT/KR2019/012891 KR2019012891W WO2020071777A1 WO 2020071777 A1 WO2020071777 A1 WO 2020071777A1 KR 2019012891 W KR2019012891 W KR 2019012891W WO 2020071777 A1 WO2020071777 A1 WO 2020071777A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- ssdna
- target nucleic
- protease
- zymogen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6823—Release of bound markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
- G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
- G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/50—Other enzymatic activities
- C12Q2521/537—Protease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/101—Temperature
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/125—Specific component of sample, medium or buffer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/137—Concentration of a component of medium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/125—Nucleic acid detection characterized by the use of physical, structural and functional properties the label being enzymatic, i.e. proteins, and non proteins, such as nucleic acid with enzymatic activity
Definitions
- the present invention relates to a method for detecting a target nucleic acid based on a proximity proteolysis reaction, and more specifically, to a proteolytic reaction of a ssDNA-protease conjugate hybridized with a target nucleic acid and an ssDNA-zymogen conjugate. It relates to a method for detecting a target nucleic acid comprising the step of detecting a signal generated by.
- Nucleic acids provide a large amount of biological information, and various methods are used to use them.
- concentration of a specific nucleic acid molecule can be an important indicator of a specific disease state, and developing efficient and simple methods for determining the concentration of target DNA or RNA has been intensively studied for decades (M. Wang, et al., Biotechnology and Bioprocess Engineering 2017, 22, 95-99).
- various techniques for converting to detectable signals such as electrochemistry (L.
- the current fluorescence signal-based nucleic acid detection method mainly requires expensive equipment, analytical samples, and skilled technology, so it is only possible in specialized inspection institutions, and it takes a considerable amount of time and money from sample collection to notification of test results. It has the disadvantage of being.
- Current electrochemical signal-based nucleic acid detection methods occupy a large portion of signal generation methods using oxidizing / reducing enzymes (Patolsky, et al., Angew. Chem. Int. 2002, 41, 3398), and have many reaction steps. Therefore, there is a disadvantage in that the total analysis time is increased and the signal can be measured only while the enzymatic catalytic reaction is in progress, and the signal cannot be measured after the end of the enzymatic catalytic reaction.
- the nucleic acid detection method based on the absorbance signal has the advantage of being simple compared to other signals, such as simple detection instrumentation equipment, which is an important factor in developing a field diagnostic method.
- nucleic acid When nucleic acid is extracted from a biological sample such as blood for analysis of nucleic acids (DNA or RNA) in an organism, the extracted amount is very small to be used directly for various analyzes, so it is necessary to amplify the extracted nucleic acid to accurately analyze it.
- Nucleic acid amplification techniques of various methods have been developed to date, and PCR (Polymerase Chain Reaction), a typical method for amplifying DNA, is a high-efficiency amplifier that selectively amplifies a large amount of target genes. Widely used in.
- PCR requires a PCR device for fine temperature control of the reaction solution, which is expensive and difficult to use for on-site diagnosis.
- the reaction rate can be improved by placing the reactants close to each other, and this principle was used to detect target molecules.
- the most prominent example is a proximity ligation assay: two DNA molecules conjugated to different antibodies are in close proximity under antigen or protein-protein interactions and amplification process of rolling circle DNA synthesis Can participate in The same principle also applies to proteins (TE Schaus, et al., Nature communications 2017, 8, 696), antibodies (A. Porchetta, et al., Journal of the American Chemical Society 2018, 140, 947-953) and nucleic acids (WA Velema, ET Kool, Journal of the American Chemical Society 2017, 139, 5405-5411).
- the present inventors tried and developed a target nucleic acid detection method that is quick, simple, and easy to detect even at a low nucleic acid concentration.
- the ssDNA-protease conjugate with ssDNA and protease having a sequence complementary to the target nucleic acid When a target nucleic acid is detected using a proximity proteolysis reaction of an ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid and an zymogen conjugate are detected, nucleic acid is detected even at a concentration of about 100 pM.
- This is possible, consisting of two DNA-protein conjugates and a one-step addition of a colorimetric substrate to the sample, confirming that it takes less than an hour to detect the target nucleic acid, thereby completing the present invention.
- An object of the present invention is to provide a target nucleic acid detection method that is quick, simple, and easy to detect even at a low nucleic acid concentration.
- Another object of the present invention is to provide a nucleic acid detection solution used in the target nucleic acid detection method.
- the present invention (a) i) a ssDNA-protease conjugate with a ssDNA having a sequence complementary to the target nucleic acid and a protease (protease); ii) a ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid and an enzyme source (zymogen) are bound; And iii) mixing a sample containing a target nucleic acid in a nucleic acid detection solution containing a substrate specific for the enzyme source; And (b) detecting a signal generated by a proximity proteolysis reaction of the ssDNA-protease conjugate hybridized with the target nucleic acid and the ssDNA-zymogen conjugate.
- a method i) a ssDNA-protease conjugate with a ssDNA having a sequence complementary to the target nucleic acid and a protease (protease); ii) a ssDNA-zymogen
- the present invention also provides a nucleic acid detection solution used in the method for detecting the target nucleic acid.
- FIG. 1 is a schematic schematic diagram showing a method of detecting a target nucleic acid using a proximity proteolysis reaction according to the present invention.
- a) is a schematic schematic diagram showing the process of manufacturing the ssDNA-zymogen conjugate
- b) is a schematic schematic diagram showing the process of manufacturing the ssDNA-protease conjugate.
- 3 a) shows the one-step method and analysis results for DNA detection according to the present invention
- b) shows the optimum conditions of the proteolytic hydrolysis reaction according to the present invention for temperature and MgCl2 concentration.
- c) represents the optimal condition of the nucleotide space between the target nucleic acid binding site of the ssDNA-protease conjugate and the ssDNA-zymogen conjugate according to the present invention
- e) represents absorbance at 405 nm for various concentrations of target RNA (0-40 nM)
- f) mouse serum for proximity proteolysis reaction to detect DNA Red
- HEK 293F lysate yellow
- the effect of biological substrates g) mouse serum (proximal proteolysis reaction to detect RNA) and HEK 293F lysate (yellow) Influence of temperament Produce.
- NASBA nucleic acid sequence-based amplification
- ssDNA having a sequence complementary to the target nucleic acid and protease are coupled to ssDNA-protease conjugate and target nucleic acid.
- Proximity Proteolysis reaction of ssDNA-zymogen conjugates with ssDNA having an intact sequence and an enzyme source (zymogen) was used.
- zymogen enzyme source
- the present invention in one aspect (a) i) ssDNA having a sequence complementary to the target nucleic acid and a protease (protease) ssDNA-protease conjugate; ii) a ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid and an enzyme source (zymogen) are bound; And iii) mixing a sample containing a target nucleic acid in a nucleic acid detection solution containing a substrate specific for the enzyme source; And (b) detecting a signal generated by a proximity proteolysis reaction of the ssDNA-protease conjugate hybridized with the target nucleic acid and the ssDNA-zymogen conjugate. It's about how.
- protease refers to an enzyme that hydrolyzes protein and peptide bonds.
- zymogen in the present invention, also referred to as proenzyme, refers to an inactive enzyme precursor (precursor), and is composed of a form in which the enzyme and the activity inhibitor protein of the enzyme are cleaved by a protease through a peptide linker.
- the enzyme source has activity when biochemical changes such as the active site of an enzyme are revealed by being separated into an enzyme and an enzyme activity inhibitor protein by hydrolysis or configuration of the peptide linker by a protease. Become an enzyme.
- target nucleic acid in the present invention means a nucleic acid molecule to be detected by the method according to the present invention.
- the type of nucleic acid may be deoxyribonucleotide (DNA), ribonucleotide (RNA) and mixtures or combinations thereof.
- the bases constituting these are nucleotides present in nature, such as guanine (G), adenine (A), thymine (T), cytosine (C), uracil (U), , And other natural and artificial modified bases.
- modified base refers to a base in which five nucleotides, guanine, adenine, thymine, cytosine, and uracil, have been chemically modified.
- the target nucleic acid needs to be a single chain at the time of detection, but even a nucleic acid forming a double chain or a higher order structure can be used after being converted into a single chain by heat denaturation, alkali denaturation treatment or the like.
- the target nucleic acid of the present invention also includes an aspect to which such denaturation treatment is added.
- cDNA produced by a reverse transcription reaction using RNA as a template is also included.
- sample means a mixture thought to contain a target nucleic acid to be detected.
- the sample may be a living body containing humans (e.g. blood, saliva, body fluids, body tissues, etc.), environment (e.g., soil, sea water, environmental water (hot spring water, bath water, cooling tower water, etc.)), or artificial or natural products (e.g. For example, it is derived from processed foods such as bread, fermented foods such as yogurt, or cultivated plants such as rice or wheat, microorganisms, viruses), and those that have undergone a nucleic acid extraction operation can be used. You can add courses.
- oligonucleotide in the present invention, adenosine (adenosine), thymidine (thymidine), cytidine (cytidine), guanosine (guanosine), nucleotides containing nucleotides such as uridine or modified base
- adenosine adenosine
- thymidine thymidine
- cytidine cytidine
- guanosine guanosine
- nucleotides containing nucleotides such as uridine or modified base
- PNA peptide nucleic acid
- the term “complementarity” means that a polynucleotide or oligonucleotide chain is annealed with another chain to form a double chain structure, and each nucleotide of each chain forms a Watson-click type base-pairing. It means doing.
- Complementary nucleotides are generally A and T (or A and U), or C and G. It also means that a non-Watson-click type base match, such as a match of a modified nucleotide having a deoxyinosine (dI) or a 2-amino purine base, is also formed.
- hybridization in the present invention generally refers to a reaction in which a single chain of nucleic acids combines with a complementary chain to form a double chain.
- DNA is usually a double chain, and when heated to high temperature in solution, two single chains are separated as the complementary hydrogen bonds between the bases forming the double chain are broken, and this is called denaturation.
- the modified single-stranded DNA finds complementary base sequences again under appropriate conditions to form double chains, which are called reaturation.
- Hybrids can be formed between DNA-DNA, DNA-RNA or RNA-RNA. They can be formed between short chains and long chains containing regions complementary to the short chains. Incomplete hybrids may be formed, but the less stable they are, the less likely they are to form.
- proximity proteolysis reaction means that the distance between the proteolytic enzyme and the peptide bond is close to 1 to 5 nucleotide spaces, thereby breaking the peptide bond of the protein by hydrolysis to the amino acid or peptide. This refers to a reaction in which the rate of proteolysis to be produced increases.
- the present inventors report a ⁇ -lactamase zymogen constructed by linking a previously permutate ⁇ -lactamase enzyme and its inhibitor protein ⁇ -lactamase inhibitory protein (BLIP) through a linker cleavable by a protease. (H. Kim, et al., Chemical Communications 2014, 50, 10155-10157).
- a peptide linker containing a TEV protease cleavage site was inserted between ⁇ -lactamase and BLIP.
- the TEV protease cleavage site is cleavage site 1 of SEQ ID NO: 14 or cleavage site 2 of SEQ ID NO: 15 (R.B.Kapust, et al., Protein Engineering vol. 14 no.12, 993-1000, 2001).
- ⁇ -lactamase When the ssDNA-protease conjugate and the ssDNA-zymogen conjugate were hybridized to the target nucleic acid, ⁇ -lactamase could be activated by separating ⁇ -lactamase and BLIP through decomposition of the peptide linker by TEV protease. Activated ⁇ -lactamase hydrolyzed a substrate specific for ⁇ -lactamase to generate a signal.
- TEV cleavage site 1 SEQ ID NO: 14: ENLYFQ / G
- TEV cleavage site 2 SEQ ID NO: 15: ENLYFQ / S
- a yellow signal is displayed when the ssDNA-protease conjugate and the ssDNA-zymogen conjugate are not hybridized to the target nucleic acid, and a red signal when hybridized to the target nucleic acid.
- the substrate specific for ⁇ -lactamase is CCF2-AM
- the substrate specific for ⁇ -lactamase is CCF4-AM
- the inventors have previously reported engineered procaspase-3 that is activated by forming dimers through proteolytic degradation (D. K. Yang, et al., Anal. Methods, 2016, 8, 6270-6276).
- the enzyme activated by the protease hydrolyzed a substrate specific for caspase-3 to generate a signal.
- the ssDNA (single strand DNA) refers to single-stranded DNA, and may be characterized as having a linear structure or a hairpin structure, but is not limited thereto.
- the linear ssDNA in detecting the target nucleic acid than the hairpin ssDNA, the signal was generated faster, and it is expected that this is because the binding to the target nucleic acid is easy.
- the sequence of the ssDNA was adopted in a dual molecular beacon designed to target KRAS transcripts (PJ Santangelo, et al., Nucleic acids research 2004, 32, e57).
- TEV-ssDNA conjugates prepared using a similar method used for ⁇ -lactamase zymogen showed significantly lower activity compared to unconjugated TEV protease. It was predicted that the loss of activity was caused by the covalent binding or purification procedure of ssDNA, and another strategy of binding ssDNA with TEV protease was used (FIG. 2B).
- the SpyTag / Catcher system first reported by Howarth et al., Is based on an efficient isopeptide bond formation reaction between two proteins, SpyTag and SpyCatcher (M. Howarth, et al., Proceedings of the National Academy of Sciences of the United States of America 2012, 109, 690-697).
- the proteolytic reaction comprises (a) i) a ssDNA-protease conjugate having a ssDNA and a protease having a sequence complementary to a target nucleic acid; ii) a ssDNA-zymogen conjugate in which ssDNA and zymogen having a sequence complementary to the target nucleic acid are combined; And iii) mixing a sample containing a target nucleic acid in a nucleic acid detection solution comprising a substrate specific for the zymogen; (b) hybridizing the ssDNA-protease conjugate and the ssDNA-zymogen conjugate to a target nucleic acid; (c) hydrolysis of the enzyme source by the protease; And (d) an enzyme activated by the hydrolysis to bind to a chromogenic substrate to generate a signal (FIG. 1), but is not limited thereto.
- a ssDNA-protease conjugate having a ssDNA and a prote
- the proximity proteolysis reaction may be characterized in that it is carried out at a temperature of 20 ⁇ 40 °C, preferably 25 ⁇ 35 °C, more preferably 37 °C.
- the nucleic acid detection solution further includes 40 mM MgCl 2 and is most optimized when performing a proteolytic reaction at a temperature of 37 ° C. (FIG. 2 b). ).
- RNA is present in the serum of a patient in a range of femto molar concentrations.
- nucleic acid sequence-based amplification is performed on KRAS mRNA prepared by in vitro transcription. Applied.
- NASBA nucleic acid sequence-based amplification
- step (a) may be characterized in that it further comprises the step of amplifying the target nucleic acid.
- the present invention i) a ssDNA-protease conjugate with a ssDNA and a protease having a sequence complementary to a target nucleic acid; ii) a ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid and an enzyme source (zymogen) are bound; And iii) a nucleic acid detection solution comprising a chromogenic substrate specific to the enzyme source.
- the protease may be characterized as Tobacco Etch Virus (TEV) protease, Hepatitis C Virus (HCV) protease, Tobacco vein mottling virus (TVMV) protease or Human rhinovirus (HRV) 3c protease , but is not limited thereto.
- TEV Tobacco Etch Virus
- HCV Hepatitis C Virus
- TVMV Tobacco vein mottling virus
- HRV Human rhinovirus
- the enzyme source (zymogen) may be characterized by being ⁇ -lactamase zymogen or Pro-caspase-3, but is not limited thereto.
- the substrate may be characterized as a chromogenic or fluorescent substrate, but is not limited thereto.
- the chromogenic substrate may be characterized by being CENTA (CENTATM ⁇ -lactamase substrate) or Nitrocefin, which is a substrate specific for ⁇ -lactamase, but is not limited thereto.
- CENTA CENTATM ⁇ -lactamase substrate
- Nitrocefin which is a substrate specific for ⁇ -lactamase, but is not limited thereto.
- the chromogenic substrate may be characterized as being a substrate specific for caspase-3, Ac-DEVD-pNA, Ac-DMQD-pNA or Z-DEVD-pNA, but is not limited thereto.
- the fluorescent substrate may be characterized by CCF2-AM or CCF4-AM, which is a substrate specific for ⁇ -lactamase, but is not limited thereto.
- the fluorescent substrate may be characterized as being a substrate specific for caspase-3, Ac-DEVD-AFC, Ac-DMQD-AMC or Z-DEVD-AFC, but is not limited thereto.
- the nucleic acid detection solution may be characterized in that it further comprises MgCl2.
- the concentration of MgCl 2 may be characterized in that 10 mM to 90 mM, preferably 30 mM to 50 mM, more preferably 40 mM.
- TEV protease variants L56V, S135G
- the synthetic gene of the TEV protease variant was cloned into pET-21a using EcoRI and XhoI, and then the double chain oligonucleotides of Strep-Tag and SpyTag were cloned into a plasmid containing the TEV protease gene using NdeI and EcoRI; The cloned plasmid was named pSPEL515.
- the gene encoding the TEV protease variant is shown in SEQ ID NO: 1.
- the synthetic gene of SpyCatcher containing one TAG codon at the N-terminus of pSPEL515 was cloned into pET-21a using NdeI and XhoI to obtain pSPEL517.
- the gene encoding SpyCatcher is shown in SEQ ID NO: 2.
- PSPEL166 previously reported by the present inventors (H. Kim, et al., Chemical Communications 2014, 50, 10155-10157) to construct plasmids for expressing beta-lactamase zymogen was modified.
- the TAG codon was introduced by amplifying the ⁇ -lactamase zymogen gene using primer 1 of SEQ ID NO: 5 and primer 2 of SEQ ID NO: 6, and the PCR product was cloned into the same plasmid using NcoI and XhoI.
- the gene encoding ⁇ -lactamase zymogen is shown in SEQ ID NO: 3.
- the cleavage site of the TEV protease was then replaced with the original cleavage site of the MMP-2 protease using a double chain oligonucleotide to GGGSGGGSENLYFQ / GGGGSGGGS (/: peptide bond cleaved by /: TEV protease) via BamHI and HindIII.
- Primer 1 SEQ ID NO: 5
- E. coli BL21 (DE3) cells transformed with pSPEL515 were used for SpyTag-TEV protease expression.
- Recombinant E. coli strains were cultured at 2 ⁇ YT at 37 ° C. until the optical density, OD 600 , reached 0.5.
- Protein expression was induced with 0.4 mM ⁇ -D-1-thiogalactopyranoside (IPTG) at 25 ° C. for 8 hours. Cell pellets were obtained by centrifugation and then stored at -20 ° C until purification.
- the SpyTag-TEV protease with His6-tag at the N-terminus was purified using Ni-NTA resin (Clontech, USA) according to the manufacturer's instructions.
- the purified SpyTag-TEV protease was stored in a TEV protease storage buffer (50 mM Tris, 10 mM NaCl, 0.5 mM EDTA, 40% (v / v) glycerol, pH 8.0) at -20 ° C.
- TEV protease storage buffer 50 mM Tris, 10 mM NaCl, 0.5 mM EDTA, 40% (v / v) glycerol, pH 8.0
- pSEPL517 was transformed into E. coli BL21 (DE3) cells with two different plasmids: TAG codon (AzF-RS / tRNACUA)
- TAG codon AzF-RS / tRNACUA
- pSPEL150 and AzF expressing the aminoacyl-tRNA synthetase of Methanococcus jannaschii and the orthogonal pair of tRNA are inhibited from being mistaken for the protein's Pro position E. coli pSPEL168 overexpressing prolyl-tRNA synthetase (ProRS).
- the purified protein was stored in a storage buffer at -20 ° C (70 mM NaCl, 1.5 mM KCl, 5 mM Na 2 HPO 4 , 1 mM KH 2 PO 4 , 20% (V / V) glycerol, pH 7.4).
- E. coli BL21 (DE3) transformed with three plasmids (pSPEL427, pSEPL150 and pSPEL168) was used to express ⁇ -lactamase zymogen with AzF.
- Proteins were purified from the periplasmic fraction according to the method described above. Purified ⁇ -lactamase zymogen was stored in a storage buffer at -20 ° C.
- the purified protein concentration was determined by measuring the absorbance at 280 nm using the extinction coefficient calculated at the ProtParam site (http://web.expasy.org/protparam/).
- the ssDNA functionalized with a 5'-amine group (ssDNA-1 or ssDNA-2) or a 3'-amine group (ssDNA-3) was purchased from Bioneer Co. (Korea).
- the ssDNA was mixed with a 20-fold molar excess of NHS-PEG 4 -DBCO linker, and the reaction was mixed with a 25 ° C phosphate-buffered saline solution (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 , 2 mM KH 2 PO 4 , pH 7.4) for 2 hours under dark conditions.
- the modified ssDNA was precipitated with ethanol to remove excess linker, and the pellet was resuspended in PBS for storage at -20 ° C.
- ssDNA-1 SEQ ID NO: 11: [Amine] CCTACGCCACCAGCTCCGTAGG
- ssDNA-2 SEQ ID NO: 12: [Amine] CCTACGCCACCAGC
- ssDNA-3 SEQ ID NO: 13: AGTGCGCTGTATCGTCAAGGCACT [Amine]
- the SpyCatcher protein containing AzF was conjugated to ssDNA (ssDNA-3) modified with a 3'-terminus with an NHS-PEG4-DBCO linker.
- the protein was mixed with a 5-fold molar excess of modified ssDNA in PBS, and the mixture was incubated at 25 ° C. for 4 hours.
- Unconjugated SpyCatcher was removed through an anion-exchange chromatography step using a HiTrap Q column.
- the ssDNA-TEV protease conjugate was purified using Strep-Tactin resin (IBA Lifesciences, Germany) according to the manufacturer's instructions.
- the purified ssDNA-TEV protease in TEV protease storage buffer was stored at -20 ° C.
- the concentration of the conjugate was calculated by measuring absorbance at 260 and 280 nm using the following equation.
- the DNA extinction coefficient at 260 nm ( ⁇ 260, DNA ) was calculated by molbiotools (http://www.molbiotools.com/dnacalculator.html), and the extinction coefficient at 280 nm ( ⁇ 280, DNA ) was found to give a known concentration. It was determined by measuring the absorbance of the sample having.
- the protein extinction coefficient ( ⁇ 280, protein ) at 280 nm was calculated at the ProtParam site, and the protein extinction coefficient ( ⁇ 260, protein ) at 260 nm was determined by measuring the absorbance of samples with known concentrations.
- Proximity proteolysis reaction is reaction buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 , 2 mM KH 2 PO 4 , 40 mM MgCl 2 , 10 mM DTT, 0.5% (w / v) BSA, pH 7.4) by adding 40 nM ssDNA-TEV protease, 20 nM ssDNA- ⁇ -lactamase zymogen and 200 ⁇ M CENTA (CENTATM ⁇ -lactamase substrate, EMD Millipore, Billerica, MA, USA) to the sample solution containing the target nucleotide molecule. Started.
- reaction buffer 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 , 2 mM KH 2 PO 4 , 40 mM MgCl 2 , 10 mM DTT, 0.5% (w / v) BSA, pH 7.4
- the target nucleotide was established using a 46-nt DNA oligonucleotide (target DNA-4) sequence corresponding to a portion of the KRAS transcript.
- the reaction was performed at 37 ° C, and the incubation time was 45 minutes for ssDNA detection and 60 minutes for RNA detection.
- 10 U / 1 mL RNase inhibitor (Roche, Switzerland) was added.
- Hydrolysis of CENTA by ⁇ -lactamase was observed through absorbance at 405 nm measured using a platereader (Synergy HT Multi-Detection Reader; BioTek Instruments, USA).
- the limit of detection (LOD) was calculated using a standard curve as the target concentration of the absorbance value corresponding to the sum of the target's mean absorbance value and 3 times the standard deviation.
- LOD Limit of detection
- proteolytic reaction The difference in proteolytic reaction according to the spatial arrangement of the target nucleic acid binding site of TEV protease and ⁇ -lactamase zymogen was analyzed. Proximity proteolysis was performed with 1 to 5 nucleotide spaces (target DNA 1 to 5) at a distance between the binding sites of the template DNA to the two ssDNAs. As a result, the three nucleotide spaces showed a higher signal difference than the other cases (c in FIG. 3).
- Target DNA-1 TACGGAGCTGGTGGCGTAGGtAGTGCCTTGACGATACAGCGCA
- Target DNA-2 TACGGAGCTGGTGGCGTAGGtaAGTGCCTTGACGATACAGCGCA
- Target DNA-3 TACGGAGCTGGTGGCGTAGGtagAGTGCCTTGACGATACAGCGCA
- Target DNA-4 TACGGAGCTGGTGGCGTAGGtagaAGTGCCTTGACGATACAGCGCA
- Target DNA-5 TACGGAGCTGGTGGCGTAGGtagatAGTGCCTTGACGATACAGCGCA
- Target RNA UACGGAGCUGGUGGCGUAGGuagAGUGCCUUGACGAUACAGCGCA
- the proximity proteolysis reaction was applied to various concentrations of target DNA oligonucleotides.
- a difference in color development to yellow due to a change in absorbance at 405 nm was observed according to the DNA concentration immediately after addition of the protein-ssDNA conjugate and CENTA.
- the change in absorbance at 405 nm was 0.166
- the change in absorbance at 405 nm was 1.019.
- the highest signal difference was observed at 45 minutes, in which case the absorbance at 405 nm was shown compared to the target concentration.
- Hyperbolic curves were observed for all concentrations in the tested range, and a linear relationship was observed from 94 pM to 5 nM as the detection limit (LOD) (FIG. 3 d)).
- HEK293F cell lysate and mouse serum were used to evaluate interference by biological substrates in proximity proteolysis assays, the results of which are nucleotides of DNA and RNA present in biological samples as shown in f) and g) of Figure 3 It has been shown to be applicable to detecting.
- the method of proteolytic hydrolysis is not only simple to use, but takes less than an hour to detect a target nucleotide at a concentration lower than the nanomolar concentration.
- NASBA Nucleic acid sequence-based amplification
- KRAS The synthetic gene of KRAS was cloned into pET-21a (IDT, USA) using NdeI and XhoI (pSPEL570), and a PCR fragment for transcription was prepared using primer 3 of SEQ ID NO: 7 and primer 4 of SEQ ID NO: 8. .
- the gene encoding KRAS is shown in SEQ ID NO: 4.
- KRAS transcripts were produced by in vitro transcription using the EZ High Yield In Vitro Transcription Kit (Enzynomics, Korea) according to the manufacturer's instructions. RNA was purified using MEGAclear Kit (Ambion, USA) and stored at -20 ° C.
- KRAS mRNA was amplified through NASBA reaction using primer 5 of SEQ ID NO: 9 and primer 6 of SEQ ID NO: 10 and NASBA Liquid Kit Complete (Life Sciences Advanced Technologies, USA) according to the manufacturer's instructions, and RNA fragments were proximal protein singers. Used for digestion analysis.
- Primer 3 SEQ ID NO: 7: TCGATCCCGCGAAATTAATACGACTCACTATAGG
- Primer 4 SEQ ID NO: 8: CAAAAAACCCCTCAAGACCCGTTTA
- the method for detecting a target nucleic acid comprises a one-step method in which two DNA-protein conjugates and a colorimetric substrate are added to a sample using a proximity proteolysis reaction. Because it takes less than an hour to detect the target nucleic acid, it is quick, simple, and highly sensitive, so it will be useful in disease diagnosis, genetically modified organisms (GMO) testing, and forensic investigations that require target nucleic acid detection. .
- GMO genetically modified organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Optics & Photonics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 (a) i) ssDNA-protease 접합체; ii) ssDNA-zymogen 접합체; 및 iii) 효소원(zymogen)에 특이적인 기질을 포함하는 핵산검출용액에 표적 핵산을 함유하는 샘플을 혼합하는 단계; 및 (b) 상기 표적 핵산에 혼성화(hybridization)된 상기 ssDNA-protease 접합체와 상기 ssDNA-zymogen 접합체의 근접 단백질가수분해(Proximity Proteolysis) 반응에 의해 발생하는 신호를 검출하는 단계를 포함하는 표적 핵산의 검출방법에 관한 것이다.
Description
본 발명은 근접 단백질가수분해(Proximity Proteolysis) 반응에 기반한 표적 핵산 검출방법에 관한 것으로, 보다 구체적으로는 표적 핵산에 혼성화(hybridization)된 ssDNA-protease 접합체와 ssDNA-zymogen 접합체의 근접 단백질가수분해 반응에 의해 발생하는 신호를 검출하는 단계를 포함하는 표적 핵산의 검출방법에 관한 것이다.
핵산은 많은 양의 생물학적 정보를 제공하며, 이를 이용하기 위해 다양한 방법이 사용되고 있다. 특히, 특정 핵산 분자의 농도는 특정 질병 상태의 중요한 지표가 될 수 있으며, 표적 DNA 또는 RNA의 농도를 결정하기 위한 효율적이고 간단한 방법을 개발하는 것은 수십년 동안 집중적으로 연구되고 있다(M. Wang, et al., Biotechnology and Bioprocess Engineering 2017, 22, 95-99). 왓슨-크릭 염기쌍(Watson-Crick base pairing)을 기반으로 하는 표적 핵산에 특이적인 프로브(probe)를 제작하는 간단한 원리를 이용하여 혼성화(hybridization)를 흡광도(absorbance), 형광(fluorescence), 발광(luminescence) 및 전기화학(electrochemistry)과 같은 검출 가능한 신호로 변환하는 다양한 기술이 고안되었다(L. Yan, et al., Molecular bioSystems 2014, 10, 970-1003; Y. V.Gerasimova, D. M. Kolpashchikov, Chemical Society reviews 2014, 43, 6405-6438; X. Su, et al., Applied Spectroscopy 2012, 66,1249-1262). 높은 민감도(sensitivity) 때문에 대부분의 연구의 초점은 형광, 발광 및 전기화학 신호에 기반한 방법에 집중되어 있었다.
그러나 현재의 형광 신호 기반의 핵산 검출방법은 주로 고가의 장비와 분석 시료, 그리고 숙련된 기술을 필요로 하기 때문에 반드시 전문 검사 기관에서만 가능하고, 샘플의 수집부터 검사 결과 통보까지 시간과 비용이 상당히 소요된다는 단점이 있다. 현재의 전기화학 신호 기반의 핵산 검출방법은 산화/환원 효소를 이용한 신호 발생 방법이 많은 비중을 차지하고 있으며(Patolsky, et al., Angew. Chem. Int. 2002, 41, 3398), 많은 반응 단계로 인해 전체 분석 시간이 증가하고 효소적 촉매 반응이 진행되는 동안에만 신호 측정이 가능하고 효소적 촉매 반응이 종료된 시점 이후에는 신호 측정이 불가능하다는 단점이 있다. 흡광도 신호에 기반한 핵산 검출방법은 현장 진단 방법을 개발하는데 중요한 요소인 단순한 검출 계기 장비와 같은, 다른 신호에 비해 간편하다는 장점을 갖고 있다.
흡광도 신호의 낮은 민감도 한계를 극복하기 위해 신호 증폭에 대한 몇 가지 방법이 보고되고 있으나(Y. Guo, et al., Biosensors & Bioelectronics 2017, 94, 651-656), 다단계(multi-step) 또는 시간 소모적인 공정의 추가는 필연적으로 복잡성을 증가시켰다.
생물체 내의 핵산(DNA 또는 RNA) 분석을 위해 혈액 등의 생체 시료로부터 핵산을 추출하게 되면 일반적으로 추출되는 양은 다양한 분석에 바로 사용되기에는 매우 적기 때문에, 이를 정확히 분석하기 위해서는 추출된 핵산의 증폭이 필요하다. 현재까지 다양한 방법의 핵산 증폭 기술이 개발되었으며, 특히 DNA를 증폭하는 대표적인 방법인 PCR(Polymerase Chain Reaction, 중합효소연쇄반응)은 표적 유전자를 선택적으로 대량 증폭하여 주는 고효율의 증폭기술이기 때문에, 다양한 분야에서 광범위하게 사용되고 있다. 그러나 PCR은 반응 용액의 미세한 온도 조절을 해주는 PCR 기기를 필요로 하여 비용이 많이 들고 현장진단 등에 사용하기 어려운 단점이 있다.
반응물을 서로 가깝게 배치함으로써 반응 속도를 향상시킬 수 있으며, 이 원리는 표적 분자를 검출하는데 사용되었다. 가장 뛰어난 예는 근접 라이게이션 분석(proximity ligation assay)이다: 서로 다른 항체에 접합된 두 개의 DNA분자는 항원 또는 단백질-단백질 상호작용 하에서 밀접하게 근접하며 회전 환DNA(rolling circle DNA) 합성의 증폭 과정에 참여할 수 있다. 또한 같은 원리가 단백질(T. E. Schaus, et al., Nature communications 2017, 8, 696), 항체(A. Porchetta, et al., Journal of the American Chemical Society 2018, 140, 947-953) 및 핵산 (W. A. Velema, E. T. Kool, Journal of the American Chemical Society 2017, 139, 5405-5411)과 같은 다양한 분자의 검출에 적용되었다.
이에, 본 발명자들은 신속하고 간편하며 적은 핵산 농도에서도 검출이 용이한 표적 핵산 검출방법을 개발하고자 예의 노력한 결과, 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제(protease)가 결합된 ssDNA-protease 접합체와 표적 핵산에 상보적인 서열을 갖는 ssDNA와 효소원(zymogen)이 결합된 ssDNA-zymogen 접합체의 근접 단백질가수분해(Proximity Proteolysis) 반응을 이용하여 표적 핵산을 검출하는 경우에 약 100 pM의 농도에서도 핵산 검출이 가능하고 두 개의 DNA-단백질 접합체와 발색 기질(colorimetric substrate)을 샘플에 첨가하는 원스텝(one-step)으로 이루어지며 표적 핵산 검출에 1시간 미만이 걸리는 것을 확인하고, 본 발명을 완성하게 되었다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은, 신속하고 간편하며 적은 핵산 농도에서도 검출이 용이한 표적 핵산 검출방법을 제공하는 데 있다.
본 발명의 다른 목적은, 상기 표적 핵산 검출방법에 사용되는 핵산 검출용액을 제공하는 데 있다.
상기 목적을 달성하기 위하여, 본 발명은 (a) i) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제(protease)가 결합된 ssDNA-protease 접합체; ii) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 효소원(zymogen)이 결합된 ssDNA-zymogen 접합체; 및 iii) 상기 효소원에 특이적인 기질을 포함하는 핵산검출용액에 표적 핵산을 함유하는 샘플을 혼합하는 단계; 및 (b) 상기 표적 핵산에 혼성화(hybridization)된 상기 ssDNA-protease 접합체와 상기 ssDNA-zymogen 접합체의 근접 단백질가수분해(Proximity Proteolysis) 반응에 의해 발생하는 신호를 검출하는 단계를 포함하는 표적 핵산의 검출방법을 제공한다.
본 발명은 또한, 상기 표적 핵산의 검출방법에 사용되는 핵산검출용액을 제공한다.
도 1은 본 발명에 따른, 근접 단백질가수분해(Proximity Proteolysis) 반응을 이용하여 표적 핵산을 검출하는 방법을 나타내는 개략적인 모식도이다.
도 2의 a)는 ssDNA-zymogen 접합체를 제작하는 과정을 나타내는 개략적인 모식도이고, b)는 ssDNA-protease 접합체를 제작하는 과정을 나타내는 개략적인 모식도이다.
도 3의 a)는 본 발명에 따른 DNA 검출을 위한 원스텝(one-step) 방법 및 분석 결과를 나타내고, b)는 온도와 MgCl2 농도에 대한 본 발명에 따른 근접 단백질가수분해 반응의 최적 조건을 나타내며, c)는 본 발명에 따른 ssDNA-protease 접합체와 ssDNA-zymogen 접합체의 표적 핵산 결합 부위 사이의 뉴클레오타이드 공간의 최적 조건을 나타내고, d)는 표적 DNA-3의 다양한 농도(0 - 40 nM)에 대한 405 nm에서의 흡광도를 나타내며, e)는 표적 RNA의 다양한 농도(0 - 40 nM)에 대한 405 nm에서의 흡광도를 나타내고, f)는 DNA를 검출하기 위한 근접 단백질가수분해 반응에 대한 마우스 혈청(붉은색)과 HEK 293F 용해물(황색)인 생물학적 기질의 영향을 나타내며, g)는 RNA를 검출하기 위한 근접 단백질가수분해 반응에 대한 마우스 혈청(붉은색)과 HEK 293F 용해물(황색)인 생물학적 기질의 영향을 나타낸다.
도 4는 본 발명에 따른 근접 단백질가수분해 반응에 핵산 서열 기반 증폭(Nucleic acid sequence-based amplification, NASBA) 단계가 추가된 것으로, a)는 RNA 전사물을 증폭시키고 근접 단백질가수분해 반응으로 RNA를 검출하기 위한 NASBA의 사용을 나타내며, b)는 RNA 전사물의 다양한 농도(0.01 pM 내지 10 pM)에 대한 405 nm에서의 흡광도를 나타낸다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명에서는, 신속하고 간편하며 적은 핵산 농도에서도 검출이 용이한 표적 핵산 검출방법을 개발하고자, 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제(protease)가 결합된 ssDNA-protease 접합체와 표적 핵산에 상보적인 서열을 갖는 ssDNA와 효소원(zymogen)이 결합된 ssDNA-zymogen 접합체의 근접 단백질가수분해(Proximity Proteolysis) 반응을 이용하였다. 그 결과, 약 100 pM의 농도에서도 핵산 검출이 가능하고 두 개의 DNA-단백질 접합체와 발색 기질(colorimetric substrate)을 샘플에 첨가하는 1단계(one-step)로 이루어지며 표적 핵산 검출에 1시간 미만이 걸리는 것을 확인하였다.
따라서, 본 발명은 일 관점에서 (a) i) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제(protease)가 결합된 ssDNA-protease 접합체; ii) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 효소원(zymogen)이 결합된 ssDNA-zymogen 접합체; 및 iii) 상기 효소원에 특이적인 기질을 포함하는 핵산검출용액에 표적 핵산을 함유하는 샘플을 혼합하는 단계; 및 (b) 상기 표적 핵산에 혼성화(hybridization)된 상기 ssDNA-protease 접합체와 상기 ssDNA-zymogen 접합체의 근접 단백질가수분해(Proximity Proteolysis) 반응에 의해 발생하는 신호를 검출하는 단계를 포함하는 표적 핵산의 검출방법에 관한 것이다.
본 발명에서 용어 "프로테아제(protease)"는 단백질과 펩타이드 결합을 가수분해하는 효소를 의미한다.
본 발명에서 용어 "효소원(zymogen)"은 proenzyme이라고도 하며 불활성인 효소 전구체(precursor)를 의미하며, 효소와 효소의 활성 저해제 단백질이 프로테아제에 의해 절단 가능한 펩타이드 링커를 통해 연결된 형태로 구성되어 있다. 효소원은 프로테아제에 의한 펩타이드 링커의 가수분해 또는 배열(configuration)의 변화를 통해 효소와 효소의 활성 저해제 단백질로 분리됨으로써 효소의 활성 부위(active site)가 드러나는 등의 생화학적인 변화가 일어나면 활성을 가지는 효소가 된다.
본 발명에서 용어 "표적 핵산(target nucleic acid)"이란 본 발명에 따른 방법에 의해 검출해야할 핵산 분자를 의미한다. 핵산의 종류에는 데옥시리보뉴클레오타이드(deoxyribonucleotide, DNA), 리보뉴클레오타이드 (ribonucleotide, RNA) 및 이들 혼합물 또는 결합물일 수 있다. 이를 구성하는 염기는 천연에 존재하는 뉴클레오타이드, 예를 들어 구아닌(guanine, G), 아데닌(adenine, A), 티민(thymine, T), 사이토신(cytosine, C), 우라실(uracil, U) 이지만, 그 이외의 천연 및 인공의 수식 염기를 함유할 수 있다. 용어 "수식 염기"란, 구아닌, 아데닌, 티민, 사이토신, 우라실인 5개의 뉴클레오티타이드가 화학적 수식(modification)을 받은 염기를 의미한다. 본 발명에 있어서, 표적 핵산은, 검출할 때에는 단일 사슬일 필요가 있으나, 이중 사슬이나 고차 구조를 형성하고 있는 핵산이어도 열변성, 알칼리 변성 처리 등에 의해 단일 사슬으로 변환한 후에 사용할 수 있다. 본 발명의 표적 핵산에는 이러한 변성 처리를 부가한 양태도 포함된다. 또한, RNA를 주형으로 하여 역전사 반응에 의해 제조되는 cDNA도 포함된다.
본 발명에서 용어 "샘플(sample)"이란 검출 대상이 되는 표적 핵산을 포함하는 것으로 생각되는 혼합물을 의미한다. 샘플은 사람을 포함하는 생체 (예를 들어 혈액, 타액, 체액, 체조직 등), 환경 (예를 들어, 토양, 해수, 환경수 (온천수, 욕조수, 냉각탑수 등), 혹은 인공물 또는 자연물 (예를 들어, 빵 등의 가공 식품, 요구르트 등의 발효 식품, 혹은 쌀이나 밀 등의 재배 식물, 미생물, 바이러스)에서 유래하는 것으로, 통상은 핵산 추출 조작을 거친 것을 사용할 수 있다. 필요에 따라 핵산 정제 과정을 추가할 수 있다.
본 발명에서 용어 "올리고뉴클레오타이드(oligonucleotide)"란 아데노신(adenosine), 티미딘(thymidine), 시티딘(cytidine), 구아노신(guanosine), 우리딘(uridine) 등의 뉴클레오타이드 또는 수식 염기를 포함하는 뉴클레오타이드가 포스포디에스테르(phosphodiester) 결합에 의해 연결하여 이루어지는 직쇄상 올리고머(oligomer)를 의미하고, DNA, RNA, 이들의 결합물을 나타낸다. 경우에 따라서는 펩티드 핵산(PNA)일 수 있다.
본 발명에서 용어 "상보성"이란 폴리뉴클레오타이드 또는 올리고뉴클레오타이드 사슬이 다른 사슬과 어닐링(annealing)되어 이중 사슬 구조를 형성하고, 각 사슬의 각 뉴클레오타이드가 왓슨-클릭형의 염기 대합(base-pairing)을 형성하고 있는 것을 의미한다. 상보적 뉴클레오타이드는 일반적으로 A와 T(또는 A와 U), 또는 C와 G이다. 또한, 데옥시이노신(deoxyinosine, dI), 2-아미노 푸린(2-amino purine) 염기를 갖는 수식 뉴클레오타이드의 대합 등의 비왓슨-클릭형의 염기 대합을 형성하고 있는 것도 의미한다.
본 발명에서 용어 "혼성화(hybridization)"란 일반적으로 단일 사슬의 핵산이 상보적인 사슬과 결합하여 이중 사슬을 형성하는 반응을 의미한다. DNA는 보통 이중 사슬이며, 이를 용액 상에서 높은 온도로 가열하면 이중 사슬을 만들어주는 염기 사이의 상보적 수소결합이 끊어지면서 두 개의 단일 사슬이 분리되며, 이를 변성(denaturation)이라 한다. 이렇게 변성된 단일 사슬 DNA는 적절한 조건 하에서 다시 상보적인 염기서열을 찾아 이중 사슬을 형성하게 되는데, 이를 재결합(renaturation)이라 한다. 혼성체(hybrid)는 DNA-DNA, DNA-RNA 또는 RNA-RNA 간에 형성될 수 있다. 이들은 짧은 사슬과 짧은 사슬에 상보적인 영역을 포함하는 긴 사슬 간에 형성될 수 있다. 불완전한 혼성체가 형성될 수 있으나, 이들이 불완전할수록 덜 안정하므로 형성될 가능성도 낮다.
본 발명에서 용어 “근접 단백질가수분해(Proximity Proteolysis) 반응”이란 단백질가수분해 효소와 펩타이드 결합 사이의 거리가 1개 내지 5개의 뉴클레오타이드 공간으로 근접함으로써 단백질의 펩타이드 결합을 가수분해로 끊어 아미노산이나 펩타이드로 만드는 단백질가수분해 반응의 속도가 증가하는 반응을 의미한다. 본 발명자들은 이전에 순환 교환된(permutate) β-lactamase 효소와 그 저해제 단백질인 β-lactamase inhibitory protein(BLIP)을 프로테아제에 의해 절단 가능한 링커(linker)를 통해 연결하여 구축한 β-lactamase zymogen을 보고하였다(H. Kim, et al., Chemical Communications 2014, 50, 10155-10157). 본 발명에서는 β-lactamase와 BLIP 사이에 TEV 프로테아제 절단 부위를 포함하는 펩타이드 링커를 삽입하였다. 상기 TEV 프로테아제 절단 부위는 서열번호 14의 절단 부위 1 또는 서열번호 15의 절단 부위 2이다(R.B.Kapust, et al., Protein Engineering vol.14 no.12, 993-1000, 2001). ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화된 경우, TEV 프로테아제에 의한 펩타이드 링커의 분해를 통해 β-lactamase와 BLIP를 분리함으로써 β-lactamase를 활성화 시킬 수 있었다. 활성화된 β-lactamase는 β-lactamase에 특이적인 기질을 가수분해하여 신호를 생성하였다.
TEV 절단 부위 1: 서열번호 14: ENLYFQ/G
TEV 절단 부위 2: 서열번호 15: ENLYFQ/S
(/: TEV 프로테아제에 의해 절단된 펩타이드 결합)
상기 β-lactamase에 특이적인 기질이 CENTA (CENTATM β-lactamase substrate)일 때, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화된 경우, 405nm에서 흡광도의 변화량이 표적 핵산에 혼성화되지 않은 경우의 흡광도의 변화량보다 증가하였다(실시예 4).
상기 β-lactamase에 특이적인 기질이 Nitrocefin일 때, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화되지 않은 경우 노란색 신호를 나타내고, 표적 핵산에 혼성화된 경우 빨간색 신호를 나타낸다.
상기 β-lactamase에 특이적인 기질이 CCF2-AM일 때, 408nm의 파장을 갖는 광을 조사하면, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화되지 않은 경우 530nm의 파장을 갖는 광이 방출되고, 표적 핵산에 혼성화된 경우 460nm의 파장을 갖는 광이 방출된다.
상기 β-lactamase에 특이적인 기질이 CCF4-AM일 때, 409nm의 파장을 갖는 광을 조사하면, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화되지 않은 경우 520nm의 파장을 갖는 광이 방출되고, 표적 핵산에 혼성화된 경우 447nm의 파장을 갖는 광이 방출된다.
본 발명자들은 이전에 프로테아제에 의한 단백질 분해를 통해 dimer를 형성하여 활성화되는 조작된(engineered) procaspase-3를 보고하였다(D. K. Yang, et al., Anal. Methods, 2016, 8, 6270-6276). 프로테아제에 의해 활성화된 효소는 caspase-3에 특이적인 기질을 가수분해하여 신호를 생성하였다.
본 발명에 있어서, 상기 ssDNA(single strand DNA)는 단일 사슬의 DNA를 의미하며, 선형(linear) 구조 또는 헤어핀(hairpin) 구조인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다. 선형 ssDNA의 경우 헤어핀 ssDNA 보다 표적 핵산 검출에 있어서, 신호가 더 빨리 발생하였으며 이는 표적 핵산과의 결합이 용이하기 때문인 것으로 예상된다.
본 발명의 구체적인 실시예에 따르면, 상기 ssDNA의 서열은 KRAS 전사물을 표적으로 하기 위해 제작된 이중 분자 비콘(dual molecular beacon)에서 채택하였다(P. J. Santangelo, et al., Nucleic acids research 2004, 32, e57).
본 발명에 있어서, β-lactamase zymogen과 ssDNA 사이의 부위-특이적 접합(site-specific conjugation)은 아자이드(azide)와 사이클로옥틴(cyclooctyne)사이의 촉진된 클릭 반응(click reaction)을 통해 이루어졌다(도 2의a)).
본 발명에 있어서, β-lactamase zymogen에 대해 사용된 유사한 방법을 사용하여 제조된 TEV-ssDNA 접합체는 접합되지 않은 TEV 프로테아제에 비해 현저히 낮은 활성을 나타냈다. 활동의 손실이 ssDNA의 공유 결합이나 정제 절차에 의해 야기된 것으로 예측하고, TEV 프로테아제와 ssDNA를 결합시키는 다른 전략을 사용하였다(도 2의 b)). Howarth 등이 처음 보고한 SpyTag/Catcher 시스템은 SpyTag와 SpyCatcher의 두 단백질 간의 효율적인 이소펩타이드(isopeptide) 결합 형성 반응에 기반을 두고있다(M. Howarth, et al., Proceedings of the National Academy of Sciences of the United States of America 2012, 109, 690-697).
본 발명에 있어서, 근접 단백질가수분해 반응은 (a) i) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제가 결합된 ssDNA-protease 접합체; ii) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 zymogen이 결합된 ssDNA-zymogen 접합체; 및 iii) 상기 zymogen에 특이적인 기질을 포함하는 핵산검출용액에 표적 핵산을 함유하는 샘플을 혼합하는 단계; (b) 상기 ssDNA-protease 접합체 및 상기 ssDNA-zymogen 접합체가 표적 핵산에 혼성화(hybridization)하는 단계; (c) 상기 프로테아제에 의해 상기 효소원이 가수분해되는 단계; 및 (d) 상기 가수분해에 의해 활성화된 효소가 발색 기질에 결합하여 신호가 발생하는 단계로 이루어진 것을 특징으로 할 수 있으나(도 1), 이에 한정되는 것은 아니다.
본 발명에 있어서, 근접 단백질가수분해 반응은 20 ~ 40 ℃, 바람직하게는 25 ~ 35 ℃, 더욱 바람직하게는 37 ℃의 온도에서 수행되는 것을 특징으로 할 수 있다.
본 발명의 구체적인 실시예에 따르면, 핵산검출용액에 40 mM의 MgCl2를 추가로 포함하고 37 ℃의 온도에서 근접 단백질가수분해 반응을 수행하는 경우에 가장 최적화된 것을 확인할 수 있었다(도 2의 b)).
본 발명에 따른 표적 핵산 검출방법이 높은 민감도를 나타냈음에도 불구하고, 일부 표적 뉴클레오타이드는 생물학적 유체에서 훨씬 낮은 농도로 존재한다. 예를 들어 바이러스 RNA는 환자의 혈청 내에 펨토(femto) 몰 농도 범위로 존재한다. 본 발명의 구체적인 실시예에 따르면, 검출 한계를 더욱 향상시키기 위하여 등온 RNA 증폭(isothermal RNA amflication) 방법, 핵산 서열 기반 증폭(Nucleic acid sequence-based amplification, NASBA)이 시험관내 전사에 의해 준비된 KRAS mRNA에 적용되었다. 하지만, 이에 한정되는 것은 아니다.
따라서 본 발명에 있어서, 상기 (a)단계는 표적 핵산을 증폭하는 단계를 추가로 포함하는 것을 특징으로 할 수 있다.
본 발명은 다른 관점에서, i) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제(protease)가 결합된 ssDNA-protease 접합체; ii) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 효소원(zymogen)이 결합된 ssDNA-zymogen 접합체; 및 iii) 상기 효소원에 특이적인 발색 기질을 포함하는 핵산검출용액을 제공한다.
본 발명에 있어서, 상기 프로테아제(protease)는 Tobacco Etch Virus (TEV) protease, Hepatitis C Virus (HCV) protease, Tobacco vein mottling virus (TVMV) protease 또는 Human rhinovirus (HRV) 3c protease인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 효소원(zymogen)은 β-lactamase zymogen 또는 Pro-caspase-3인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 기질은 발색성 또는 형광성 기질인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 발색성 기질은 β-lactamase에 특이적인 기질인 CENTA (CENTATM β-lactamase substrate) 또는 Nitrocefin인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 발색성 기질은 caspase-3에 특이적인 기질인 Ac-DEVD-pNA, Ac-DMQD-pNA 또는 Z-DEVD-pNA인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 형광성 기질은 β-lactamase에 특이적인 기질인 CCF2-AM 또는 CCF4-AM인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 형광성 기질은 caspase-3에 특이적인 기질인 Ac-DEVD-AFC, Ac-DMQD-AMC 또는 Z-DEVD-AFC인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 핵산검출용액은 MgCl2를 추가로 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 MgCl2의 농도는 10 mM 내지 90 mM, 바람직하게는 30 mM 내지 50 mM, 더욱 바람직하게는 40 mM인 것을 특징으로 할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1
단백질 발현을 위한 플라스미드 구축
야생형(wild-type) 효소와 비교하여 향상된 용해도와 안정성을 나타내는 것으로 보고된(L. D. Cabrita, et al., Protein science : a publication of the Protein Society 2007, 16, 2360-2367) TEV(Tobacco Etch Virus) 프로테아제(protease) 변이체(L56V, S135G)를 사용하였다. TEV 프로테아제 변이체의 합성 유전자를 EcoRI 및 XhoI를 사용하여 pET-21a에 클로닝하고, 그리고 나서 Strep-Tag 및 SpyTag의 이중 사슬 올리고뉴클레오타이드를 NdeI 및 EcoRI를 사용하여 TEV 프로테아제 유전자를 함유하는 플라스미드에 클로닝하고; 클로닝된 플라스미드를 pSPEL515라고 명명하였다. TEV 프로테아제 변이체를 코딩하는 유전자는 서열번호 1로 나타냈다. pSPEL515의 N 말단에 하나의 TAG 코돈을 함유하는 SpyCatcher의 합성 유전자를 NdeI 및 XhoI를 사용하여 pET-21a에 클로닝하여, pSPEL517을 수득하였다. SpyCatcher를 코딩하는 유전자는 서열번호 2로 나타냈다.
베타 락타마제 효소원(β-lactamase zymogen)을 발현하기 위한 플라스미드를 구축하기 위해, 이전에 본 발명자들에 의해 보고된(H. Kim, et al., Chemical Communications 2014, 50, 10155-10157) pSPEL166을 변형하였다. TAG 코돈은 서열번호 5의 프라이머 1 및 서열번호 6의 프라이머 2를 사용하여 β-lactamase zymogen 유전자를 증폭시킴으로써 도입되었고, PCR 생성물은 NcoI 및 XhoI를 사용하여 동일한 플라스미드로 클로닝하였다. β-lactamase zymogen을 코딩하는 유전자는 서열번호 3으로 나타냈다. 그리고 나서, BamHI 및 HindIII를 통해 GGGSGGGSENLYFQ / GGGGSGGGS (/:TEV 프로테아제에 의해 절단된 펩티드 결합)에 대한 이중 사슬 올리고뉴클레오타이드를 사용하여 TEV 프로테아제의 절단 부위를 MMP-2 프로테아제의 원래 절단 부위로 대체하였다.
프라이머 1: 서열번호 5:
AACCTTCCATGGGCTAGGGCGGCAGCGGTGGTAGCGCGGGGGTGATGACCGGGGCG
프라이머 2: 서열번호 6:
AACCTTCTCGAGTGCCTGACTCCCCGTCGTGTAGATAACTACGATACG
실시예 2
단백질의 발현 및 정제
1. SpyTag-TEV 프로테아제
pSPEL515로 형질전환된 E. coli BL21(DE3) 세포를 SpyTag-TEV 프로테아제 발현에 사용하였다. 재조합 E. coli 균주를 광학 밀도, 즉 OD600이 0.5에 도달할 때까지 37 ℃의 2xYT에서 배양하였다. 단백질 발현은 0.4 mM β-D-1-thiogalactopyranoside (IPTG)로 25 ℃에서 8시간 동안 유도하였다. 원심 분리하여 세포 펠렛을 수득한 다음 정제할 때까지 -20 ℃에서 보관하였다. N-말단에 His6-tag를 갖는 SpyTag-TEV 프로테아제는 Ni-NTA 수지 (Clontech, USA)를 사용하여 제조사의 지시에 따라 정제하였다. 정제된 SpyTag-TEV 프로테아제는 -20 ℃의 TEV 프로테아제 저장 완충액(50 mM Tris, 10 mM NaCl, 0.5 mM EDTA, 40 % (v/v) 글리세롤, pH 8.0) 내에서 보관하였다.
2. SpyCatcher
SpyCatcher 단백질의 앰버 코돈 위치에 4-azido-Lphenylalanine(AzF)을 도입하기 위해, pSEPL517를 두 개의 다른 플라스미드를 갖는 E. coli BL21 (DE3) 세포로 형질전환하였다: TAG 코돈 (AzF-RS / tRNACUA)에 반응하여 AzF를 도입하기 위해 Methanococcus jannaschii의 아미노아실-tRNA 합성효소(aminoacyl-tRNA synthetase) 및 tRNA의 직교 쌍(orthogonal pair)을 발현시키는 pSPEL150 및 AzF가 단백질의 Pro 위치로 오인되는 것을 억제하기 위해 E. coli 프롤릴-tRNA 합성효소(prolyl-tRNA synthetase, ProRS)를 과발현하는 pSPEL168. 세포는 OD600이 0.5에 도달할 때까지 37 ℃의 2xYT에서 배양하고, 그리고 나서 0.2 % Larabinose와 50 nM anhydrous tetracycline(aTc)을 각각 첨가하여 직교 아미노아실-tRNA 합성효소와 ProRS의 발현을 유도 하였다. OD600이 1.0에 도달하였을 때, 1 mM AzF 존재 하에서 0.4 mM IPTG를 첨가하여 30 ℃에서 8시간 동안 SpyCatcher의 발현을 유도하였다. SpyCatcher의 정제 과정은 SpyTag-TEV의 정제 과정과 동일하다. 정제된 단백질은 -20 ℃의 저장 완충액(70 mM NaCl, 1.5 mM KCl, 5 mM Na2HPO4, 1 mM KH2PO4, 20 % (V/V) 글리세롤, pH 7.4) 내에서 보관하였다.
3. β-lactamase zymogen
3개의 플라스미드(pSPEL427, pSEPL150 및 pSPEL168)로 형질전환된 E. coli BL21(DE3)을 사용하여 AzF를 갖는 β-lactamase zymogen을 발현하였다. 0.26 % L-arabinose와 50 nM aTc로 OD600이 0.5에서, 각각 AzF-RS와 ProRS의 발현을 유도한 후에, 25 ℃에서 16시간 동안 1 mM AzF 존재 하에서 0.4 mM IPTG로 β-lactamase zymogen의 발현을 유도하였다. 단백질은 상기 기술된 방법에 따라 세포질 분획물(periplasmic fraction)로부터 정제하였다. 정제된 β-lactamase zymogen을 -20 ℃의 저장 완충액 내에서 보관하였다.
4. 정제된 단백질 농도의 결정
정제된 단백질 농도는 ProtParam 사이트 (http://web.expasy.org/protparam/)에서 계산된 흡광 계수(extinction coefficient)를 사용하여 280 nm에서 흡광도를 측정하여 결정하였다.
실시예 3
단일 사슬 DNA(ssDNA)와 단백질의 접합(conjugation)
1. N-hydroxysuccimide ester-(polyethyleneglycol)4-dibenzylcyclooctyne (NHS-PEG
4
-DBCO)에 의한 ssDNA의 유도체화
5'-아민기(ssDNA-1 또는 ssDNA-2) 또는 3'-아민기(ssDNA-3)로 기능화된 ssDNA는 Bioneer Co.(Korea)로부터 구입하였다. ssDNA를 20-배 몰 과량의 NHS-PEG4-DBCO 링커(linker)와 혼합하고, 반응을 25 ℃의 인산-완충 식염수 용액(phosphate-buffered saline solution, PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4) 내에서 2시간 동안 어두운 조건으로 수행하였다. 변형된 ssDNA를 에탄올로 침전시켜 과량의 링커를 제거하고, 펠렛을 -20 ℃에서 보관하기 위해 PBS 내에서 재현탁하였다.
ssDNA-1: 서열번호 11: [Amine]CCTACGCCACCAGCTCCGTAGG
ssDNA-2: 서열번호 12: [Amine]CCTACGCCACCAGC
ssDNA-3: 서열번호 13: AGTGCGCTGTATCGTCAAGGCACT[Amine]
2. ssDNA-β-lactamase zymogen 접합체(conjugate)
5'-말단이 변형된 ssDNA (ssDNA-1 또는 ssDNA-2)를 AzF를 함유하는 β-lactamase zymogen 단백질과 5:1의 몰비로 PBS 내에서 혼합 한 후, 혼합물을 4 ℃에서 16분 동안 배양하였다. 먼저, 접합되지 않은 단백질은 HiTrap Q 컬럼 (GE Healthcare Life Sciences, USA)을 사용하는 음이온-교환 크로마토그래피(anionexchange chromatography) 단계를 통하여 제거하였다. ssDNA-접합체 및 ssDNA의 혼합물을 0.2ㅡ1 M NaCl 구배로 용리하였다. 용리된 분획물을 Superdex-75 컬럼 (GE Healthcare Life Sciences, USA)을 사용하여 겔 여과 크로마토그래피(gel filtration chromatography)로 추가 정제하여 ssDNA를 제거하였다. 정제된 ssDNA-β-lactamase zymogen 접합체를 -20 ℃의 저장 완충액 내에서 보관하였다.
3. ssDNA-TEV 프로테아제 접합체
먼저, AzF를 함유하는 SpyCatcher 단백질을 NHS-PEG4-DBCO 링커로 3'-말단을 변형시킨 ssDNA (ssDNA-3)에 접합하였다. 단백질을 PBS 중 5-배 몰 과량의 변형된 ssDNA와 혼합하고, 혼합물을 25 ℃에서 4시간 동안 배양하였다. HiTrap Q 컬럼을 사용하는 음이온-교환 크로마토그래피 단계를 통하여 접합되지 않은 SpyCatcher를 제거하였다. 미반응의 ssDNA를 함유하는 부분적으로 정제된 ssDNA-SpyCatcher 접합체는 4 ℃에서 2시간 동안 PBS 중의 SpyTag-TEV 프로테아제와 반응하였다; 변형된 ssDNA가 SpyTag와 SpyCatcher 사이의 반응을 방해할 것으로 예상되지 않았기 때문에, 접합 반응은 미반응의 ssDNA 존재 하에서 수행하였다. ssDNA-TEV 프로테아제 접합체는 제조사의 지시에 따라 Strep-Tactin 수지 (IBA Lifesciences, Germany)를 사용하여 정제하였다. TEV 프로테아제 저장 완충액 중의 정제된 ssDNA-TEV 프로테아제를 -20 ℃에서 보관하였다.
4. ssDNA- 단백질 결합체에 대한 단백질 및 DNA 농도의 결정
접합체의 농도는 하기의 방정식을 사용하여 260 및 280 nm에서 흡광도를 측정하여 계산하였다. 260 nm에서의 DNA 흡광 계수 (ε260, DNA)는 molbiotools (http://www.molbiotools.com/dnacalculator.html)에서 계산하였으며, 280 nm (ε280, DNA)에서의 흡광 계수는 알려진 농도를 갖는 샘플의 흡광도를 측정하여 결정하였다. 280 nm에서의 단백질 흡광 계수 (ε280, protein)는 ProtParam 사이트에서 계산하였고, 260 nm에서의 단백질 흡광 계수 (ε260, protein)는 알려진 농도를 갖는 샘플의 흡광도를 측정하여 결정하였다.
A260 = A260, DNA + A260, protein =ε260, DNA Х b Х CDNA + ε260, protein Х b Х Cprotein
A280 = A280, DNA + A280, protein =ε280, DNA Х b Х CDNA + ε280, protein Х b Х Cprotein
ε: 흡광 계수 (extinction coefficient) (M-1cm-1)
b: 경로 길이 (path length) (cm)
C: 농도 (concentration) (M)
실시예 4
근접 단백질가수분해 반응(proximity proteolysis reaction)에 의한 핵산 검출
1. 실험 방법
근접 단백질 가수분해 반응은 반응 완충액 (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 40 mM MgCl2, 10 mM DTT, 0.5% (w/v) BSA, pH 7.4)에서 표적 뉴클레오타이드 분자를 함유하는 샘플 용액에 40 nM ssDNA-TEV 프로테아제, 20 nM ssDNA-β-lactamase zymogen 및 200 μM CENTA (CENTATM β-lactamase substrate, EMD Millipore, Billerica, MA, USA)를 첨가함으로써 시작하였다. 표적 뉴클레오타이드는 KRAS 전사물의 일부에 해당하는 46-nt DNA 올리고뉴클레오타이드 (표적 DNA-4) 서열을 사용하여 확립되었다. 반응은 37 ℃에서 수행하였으며, 배양 시간은 ssDNA 검출의 경우에는 45분, RNA 검출의 경우에는 60분이었다. RNA 샘플의 경우, 10 U/1 mL RNase 억제제 (Roche, Switzerland)를 첨가하였다. β-lactamase에 의한 CENTA의 가수분해는 플레이트 판독기(platereader) (Synergy HT Multi-Detection Reader; BioTek Instruments, USA)를 사용하여 측정한 405 nm에서의 흡광도를 통하여 관찰하였다. 검출 한계(limit of detection, LOD)는 표적의 평균 흡광도 값과 표준 편차의 3배의 합에 상응하는 흡광도 값의 표적 농도로서 표준 곡선을 사용하여 계산하였다. 근접 단백질가수분해 분석에 대한 생물학적 기질의 간섭은 두 생물학적 유체를 사용하여 실험하였다: HEK 293F 세포 용해물(lysate) 및 마우스 혈청 (Sigma, USA). HEK 293F 세포 용해물은 130 Watt 초음파 분산기 (Sonics & Materials, Inc., USA)를 사용하여 초음파 처리하여 제조하였으며, 1 x 106 세포의 용해물을 사용하여 200 μL 분석 샘플을 제조하였다. 마우스 혈청을 5 % (v/v) 농도로 샘플에 첨가하였다.
2. 근접 단백질 가수분해반응의 최적 조건 분석
근접 단백질 가수분해반응의 최적 조건을 설정하기 위하여, MgCl2의 농도와 온도 조건에 따른 신호 차이를 분석하였다. 초기에, 표적 뉴클레오타이드 (25 ℃에서 20 mM MgCl2)의 존재에 따라 비교적 작은 신호 차이가 관찰되었다. MgCl2의 농도와 온도의 두 가지 요소가 더욱 최적화되었고, 40 mM MgCl2와 37 ℃의 조건이 가장 높은 신호 차이를 나타냈다 (도 3의 b)).
TEV 프로테아제와 β-lactamase zymogen의 표적 핵산 결합 부위의 공간 배열에 따른 단백질 가수분해 반응의 차이를 분석하였다. 두 개의 ssDNA에 대한 주형 DNA의 결합 부위 사이의 거리를 1개 내지 5개의 뉴클레오타이드 공간을 두고(표적 DNA 1 내지 5) 근접 단백질 가수분해반응을 수행하였다. 그 결과, 3개의 뉴클레오타이드 공간은 다른 경우보다 더 높은 신호차이를 나타냈다 (도 3의 c)).
표적 DNA-1: TACGGAGCTGGTGGCGTAGGtAGTGCCTTGACGATACAGCGCA
표적 DNA-2: TACGGAGCTGGTGGCGTAGGtaAGTGCCTTGACGATACAGCGCA
표적 DNA-3: TACGGAGCTGGTGGCGTAGGtagAGTGCCTTGACGATACAGCGCA
표적 DNA-4: TACGGAGCTGGTGGCGTAGGtagaAGTGCCTTGACGATACAGCGCA
표적 DNA-5: TACGGAGCTGGTGGCGTAGGtagatAGTGCCTTGACGATACAGCGCA
표적 RNA: UACGGAGCUGGUGGCGUAGGuagAGUGCCUUGACGAUACAGCGCA
(밑줄 친 서열은 β-lactamase zymogen-ssDNA와 TEV-ssDNA의 두 결합 부위 사이의 뉴클레오타이드 공간을 나타낸다.)
3. 실험 결과
최적화된 조건을 사용하여, 근접 단백질가수분해 반응을 표적 DNA 올리고뉴클레오타이드의 다양한 농도에 적용하였다. 도 3의 d)에 나타난 바와 같이, 단백질-ssDNA 접합체 및 CENTA를 첨가한 직후의 DNA 농도에 따라 405nm에서 흡광도 변화로 인한 노란색으로의 발색량의 차이가 관찰되었다. 표적 핵산이 없는 경우 405nm에서 흡광도의 변화량은 0.166을 나타내었고, 표적 핵산이 있는 경우 405nm에서 흡광도의 변화량은 1.019를 나타내었다. 가장 높은 신호 차이가 45분에 관찰되었고, 이 경우에 405 nm에서의 흡광도를 목표 농도와 비교하여 나타내었다. 실험한 범위의 모든 농도에 대하여 쌍곡선(hyperbolic curve)이 나타났으며, 선형 관계가 검출 한계(LOD)로서 94 pM에서 5 nM까지 관찰되었다(도 3의 d)).
TEV 프로테아제 및 β-lactamase zymogen에 결합된 ssDNA는 원래 KRAS mRNA를 검출하기 위해 제작되었기 때문에, 상기에서 사용된 DNA 표적에 상응하는 합성된 RNA 뉴클레오타이드에 대해 근접 단백질 가수분해 분석을 적용하였다. DNA와 RNA 사이의 상호 작용이 약하기 때문에 발색은 DNA 표적 (45분)보다 오래 걸렸다. 쌍곡선이 표적 농도의 전체 범위에 대해 관찰되었고, 선형 관계가 93 pM의 검출 한계로 5 nM까지 관찰되었다 (도 3의 e)).
HEK293F 세포 용해물과 마우스 혈청을 사용하여 근접 단백질가수분해 분석법에서 생물학적 기질에 의한 간섭을 평가하였고, 그 결과는 도 3의 f) 및 g)에 나타난 바와 같이 생물학적 샘플에 존재하는 DNA와 RNA의 뉴클레오타이드를 검출하는 데 적용할 수 있는 것으로 나타났다.
특히, 근접 단백질 가수분해 방법은 사용이 간단할 뿐만 아니라 나노(nano) 몰 농도 보다 작은 농도에서 표적 뉴클레오타이드를 검출하는데 1시간 미만이 걸리는 것을 확인하였다.
실시예 5
핵산 서열 기반 증폭 (Nucleic acid sequence-based amplification, NASBA)
KRAS의 합성 유전자를 NdeI 및 XhoI를 사용하여 pET-21a (IDT, USA)에 클로닝하고(pSPEL570), 서열번호 7의 프라이머 3 및 서열번호 8의 프라이머 4를 사용하여 전사를 위한 PCR 단편을 제조하였다. KRAS를 코딩하는 유전자는 서열번호 4로 나타냈다. KRAS 전사물는 EZ High Yield In Vitro Transcription Kit (Enzynomics, Korea)를 제조사의 지시에 따라 사용하여 시험관내 전사에 의해 생산하였다. MEGAclear Kit (Ambion, USA)를 사용하여 RNA를 정제하고, -20 ℃에서 보관하였다. KRAS mRNA는 서열번호 9의 프라이머 5 및 서열번호 10의 프라이머 6과 NASBA Liquid Kit Complete (Life Sciences Advanced Technologies, USA)를 제조사의 지시에 따라 사용하여 NASBA 반응을 통해 증폭시키고, RNA 단편을 근접 단백질가수분해 분석에 사용하였다.
기준치와는 완전히 다른 신호가 10 fM 만큼 낮은 KRAS 전사물 농도를 포함하는 샘플에서 관찰되었으며, 증폭 단계가 없는 검출 한계 보다 10,000 배 더 낮은 것으로 나타났다(도 4의 b)).
프라이머 3: 서열번호 7: TCGATCCCGCGAAATTAATACGACTCACTATAGG
프라이머 4: 서열번호 8: CAAAAAACCCCTCAAGACCCGTTTA
프라이머 5: 서열번호 9:
AATTCTAATACGACTCACTATAGGGAGAAGGCTCGCTTGCGCGAATACGGAGCTGGTGGCG
프라이머 6: 서열번호 10:
GTCGTATCCAGTGCGTCATCTTTCGAGGTGACTTGCACTGGATACGACTGCGCT
본 발명에 따른 표적 핵산의 검출방법은 근접 단백질가수분해(Proximity Proteolysis) 반응을 이용하여, 두 개의 DNA-단백질 접합체와 발색 기질(colorimetric substrate)을 샘플에 첨가하는 원스텝(one-step)으로 이루어지며 표적 핵산 검출에 1시간 미만이 걸리므로 신속하고 간단하며, 높은 민감도를 나타내므로 표적 핵산 검출이 요구되는 질병 진단, 유전자 재조합 생물체 (GMO; genetically modified organisms) 검사, 법의학 수사 등에 있어서 유용하게 활용될 것이다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.
Claims (21)
- 다음 단계를 포함하는 표적 핵산의 검출방법:(a) i) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제(protease)가 결합된 ssDNA-protease 접합체;ii) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 효소원(zymogen)이 결합된 ssDNA-zymogen 접합체; 및iii) 상기 효소원에 특이적인 기질을 포함하는 핵산검출용액에 표적 핵산을 함유하는 샘플을 혼합하는 단계; 및(b) 상기 표적 핵산에 혼성화(hybridization)된 상기 ssDNA-protease 접합체와 상기 ssDNA-zymogen 접합체의 근접 단백질가수분해(Proximity Proteolysis) 반응에 의해 발생하는 신호를 검출하는 단계.
- 제1항에 있어서, 상기 효소원은 효소와 효소 활성 저해제인 단백질이 상기 프로테아제에 의해 절단 가능한 펩타이드 링커를 통해 연결된 것을 특징으로 하는 표적 핵산의 검출방법.
- 제1항에 있어서, 상기 (b)단계의 근접 단백질가수분해 반응은 ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화된 경우, 프로테아제에 의해 펩타이드 링커가 절단됨으로써 상기 효소원이 효소와 효소 활성 저해제인 단백질로 분리되어 효소가 활성화되는 단계; 및상기 활성화된 효소가 기질을 가수분해하여 신호를 생성하는 단계를 포함하는 것을 특징으로 하는 표적 핵산의 검출방법.
- 제1항에 있어서, 상기 프로테아제는 Tobacco Etch Virus (TEV) protease, Hepatitis C Virus (HCV) protease, Tobacco vein mottling virus (TVMV) protease 또는 Human rhinovirus (HRV) 3c protease인 것을 특징으로 하는 표적 핵산의 검출방법.
- 제1항에 있어서, 상기 효소원은 β-lactamase zymogen 또는 Pro-caspase-3인 것을 특징으로 하는 표적 핵산의 검출방법.
- 제1항에 있어서, 상기 기질은 발색성 또는 형광성 기질인 것을 특징으로 하는 표적 핵산의 검출방법.
- 제6항에 있어서, 상기 효소원은 β-lactamase zymogen이고, 상기 발색성 기질은 CENTA이며, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화된 경우, 405nm에서 흡광도의 변화량이 표적 핵산에 혼성화되지 않은 경우의 흡광도의 변화량보다 증가한 것을 특징으로 하는 표적 핵산의 검출방법.
- 제6항에 있어서, 상기 효소원은 β-lactamase zymogen이고, 상기 발색성 기질은 Nitrocefin이며, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화되지 않은 경우 노란색 신호를 나타내고, 표적 핵산에 혼성화된 경우 빨간색 신호를 나타내는 것을 특징으로 하는 표적 핵산의 검출방법.
- 제6항에 있어서, 상기 효소원은 β-lactamase zymogen이고, 상기 형광성 기질은 CCF2-AM이며, 408nm의 파장을 갖는 광을 조사하였을 때, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화되지 않은 경우 530nm의 파장을 갖는 광이 방출되고, 표적 핵산에 혼성화된 경우 460nm의 파장을 갖는 광이 방출되는 것을 특징으로 하는 표적 핵산의 검출방법.
- 제6항에 있어서, 상기 효소원은 β-lactamase zymogen이고, 상기 형광성 기질은 CCF4-AM이며, 409nm의 파장을 갖는 광을 조사하였을 때, ssDNA-protease 접합체와 ssDNA-zymogen 접합체가 표적 핵산에 혼성화되지 않은 경우 520nm의 파장을 갖는 광이 방출되고, 표적 핵산에 혼성화된 경우 447nm의 파장을 갖는 광이 방출되는 것을 특징으로 하는 표적 핵산의 검출방법.
- 제1항에 있어서, 상기 (a)단계의 핵산검출용액에 MgCl2를 추가로 포함하는 것을 특징으로 하는 표적 핵산의 검출방법.
- 제1항에 있어서, 상기 근접 단백질가수분해 반응은 20 ~ 40 ℃의 온도에서 수행되는 것을 특징으로 하는 표적 핵산의 검출방법.
- 제1항에 있어서, 상기 (a)단계는 표적 핵산을 증폭하는 단계를 추가로 포함하는 것을 특징으로 하는 표적 핵산의 검출방법.
- 제11항에 있어서, 상기 MgCl2의 농도는 10 mM ~ 90 mM인 것을 특징으로 하는 표적 핵산의 검출방법.
- i) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 프로테아제(protease)가 결합된 ssDNA-protease 접합체;ii) 표적 핵산에 상보적인 서열을 갖는 ssDNA와 효소원(zymogen)이 결합된 ssDNA-zymogen 접합체; 및iii) 상기 효소원에 특이적인 기질;을 포함하는 핵산검출용액.
- 제15항에 있어서, 상기 프로테아제는 Tobacco Etch Virus (TEV) protease, Hepatitis C Virus (HCV) protease, Tobacco vein mottling virus (TVMV) protease 또는 Human rhinovirus (HRV) 3c protease인 것을 특징으로 하는 핵산검출용액.
- 제15항에 있어서, 상기 효소원은 효소와 효소 활성 저해제인 단백질이 상기 프로테아제에 의해 절단 가능한 펩타이드 링커를 통해 연결된 것을 특징으로 하는 핵산검출용액.
- 제15항에 있어서, 상기 효소원은 β-lactamase zymogen 또는 Pro-caspase-3인 것을 특징으로 하는 핵산검출용액.
- 제15항에 있어서, 상기 기질은 발색성 또는 형광성 기질인 것을 특징으로 하는 핵산검출용액.
- 제15항에 있어서, 상기 핵산검출용액에 MgCl2를 추가로 포함하는 것을 특징으로 하는 핵산검출용액.
- 제20항에 있어서, 상기 MgCl2의 농도는 10 mM ~ 90 mM인 것을 특징으로 하는 핵산검출용액.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/282,650 US20210348219A1 (en) | 2018-10-05 | 2019-10-02 | Target nucleic acid detection method based on proximity proteolysis reaction |
| KR1020217010633A KR102525012B1 (ko) | 2018-10-05 | 2019-10-02 | 근접 단백질가수분해 반응에 기반한 표적 핵산 검출방법 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20180119010 | 2018-10-05 | ||
| KR10-2018-0119010 | 2018-10-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020071777A1 true WO2020071777A1 (ko) | 2020-04-09 |
Family
ID=70055062
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2019/012891 Ceased WO2020071777A1 (ko) | 2018-10-05 | 2019-10-02 | 근접 단백질가수분해 반응에 기반한 표적 핵산 검출방법 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20210348219A1 (ko) |
| KR (1) | KR102525012B1 (ko) |
| WO (1) | WO2020071777A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022191679A1 (ko) * | 2021-03-12 | 2022-09-15 | 아주대학교산학협력단 | 근접 단백질가수분해 반응에 기반한 표적물질 검출방법 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030198971A1 (en) * | 2002-04-18 | 2003-10-23 | Kalobios, Inc. | Reactivation-based molecular interaction sensors |
| KR101695684B1 (ko) * | 2014-10-01 | 2017-01-13 | 아주대학교산학협력단 | 신규한 자가저해 단백질 융합체 및 이의 용도 |
| US20170315114A1 (en) * | 2014-10-27 | 2017-11-02 | The University Of Queensland | Bimolecular autoinhibited biosensor |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101501221B1 (ko) * | 2013-04-08 | 2015-03-16 | 포항공과대학교 산학협력단 | mTOR 활성 조절제 및 이의 검출 방법 |
-
2019
- 2019-10-02 WO PCT/KR2019/012891 patent/WO2020071777A1/ko not_active Ceased
- 2019-10-02 US US17/282,650 patent/US20210348219A1/en active Pending
- 2019-10-02 KR KR1020217010633A patent/KR102525012B1/ko active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030198971A1 (en) * | 2002-04-18 | 2003-10-23 | Kalobios, Inc. | Reactivation-based molecular interaction sensors |
| KR101695684B1 (ko) * | 2014-10-01 | 2017-01-13 | 아주대학교산학협력단 | 신규한 자가저해 단백질 융합체 및 이의 용도 |
| US20170315114A1 (en) * | 2014-10-27 | 2017-11-02 | The University Of Queensland | Bimolecular autoinhibited biosensor |
Non-Patent Citations (4)
| Title |
|---|
| KIM, HAJIN ET AL.: "An engineering of p-lactamase zymogen to establish a protease assay method", KSBB CONFERENCE, April 2017 (2017-04-01), pages 233 * |
| KIM, HAJIN ET AL.: "Development, of a colorimetric protease assay method using an engineered beta-laclamase zymogen.", KSBB CONFERENCE, April 2016 (2016-04-01), pages 300 * |
| PARK, HYEON JI ET AL.: "Nucleic acid detection by a target-assisted proximity proteolysis reaction", ACS SENSORS, vol. 3, 8 October 2018 (2018-10-08), pages 2066 - 2070, XP055704545 * |
| YAN, LEI ET AL.: "Isothermal amplified detection of DNA and RNA", MOLECULAR BIOSYSTEMS, vol. 10, 2014, pages 970 - 1003, XP055324229 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022191679A1 (ko) * | 2021-03-12 | 2022-09-15 | 아주대학교산학협력단 | 근접 단백질가수분해 반응에 기반한 표적물질 검출방법 |
| KR20220128109A (ko) * | 2021-03-12 | 2022-09-20 | 아주대학교산학협력단 | 근접 단백질가수분해 반응에 기반한 표적물질 검출방법 |
| KR102572075B1 (ko) * | 2021-03-12 | 2023-08-29 | 아주대학교산학협력단 | 근접 단백질가수분해 반응에 기반한 표적물질 검출방법 |
| KR20230129956A (ko) * | 2021-03-12 | 2023-09-11 | 아주대학교산학협력단 | 근접 단백질가수분해 반응에 기반한 표적물질 검출방법 |
| KR102650014B1 (ko) * | 2021-03-12 | 2024-03-25 | 아주대학교산학협력단 | 근접 단백질가수분해 반응에 기반한 표적물질 검출방법 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20210047954A (ko) | 2021-04-30 |
| US20210348219A1 (en) | 2021-11-11 |
| KR102525012B1 (ko) | 2023-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Green et al. | Mutations at nucleotides G2251 and U2585 of 23 S rRNA perturb the peptidyl transferase center of the ribosome | |
| CN107760762B (zh) | 一种检测dna腺嘌呤甲基转移酶的荧光化学传感器及其检测方法 | |
| KR20210039989A (ko) | 고온 내성 Cas 단백질의 용도, 표적 핵산 분자의 검출 방법 및 시약 키트 | |
| CN109444105B (zh) | 一种检测dna糖基化酶udg的荧光生物传感器及其制备方法 | |
| WO2016072758A1 (ko) | 표적 물질에 의해 조절되는 핵산 중합효소 활성을 이용한 생체물질의 검출 및 정량 방법 | |
| JP2761159B2 (ja) | 相補的核酸配列の検出方法及びそのためのキット | |
| Liu et al. | G-triplex molecular beacon‒based fluorescence biosensor for sensitive detection of small molecule-protein interaction via exonuclease III‒assisted recycling amplification | |
| van der Heden van Noort | Chemical tools to study protein ADP-ribosylation | |
| Lu et al. | Rapid and highly specific detection of communicable pathogens using one-pot loop probe-mediated isothermal amplification (oLAMP) | |
| JP2019509766A (ja) | 海洋生物dnaポリメラーゼ | |
| US9222127B2 (en) | Compositions and methods for the protection of nucleophilic groups | |
| CN111304298B (zh) | 半胱天冬酶生物传感器及应用、半胱天冬酶活性的检测方法 | |
| WO2020071777A1 (ko) | 근접 단백질가수분해 반응에 기반한 표적 핵산 검출방법 | |
| Su et al. | Proximity ligation initiated DNAzyme-powered catalytic hairpin assembly for sensitive and accurate microRNA analysis | |
| Zhang et al. | A new method for sensitive detection of microphthalmia-associated transcription factor based on “OFF-state” and “ON-state” equilibrium of a well-designed probe and duplex-specific nuclease signal amplification | |
| Zhang et al. | An ultra-sensitive and specific UCBiosensor via CRISPR-Cas12a and UDG-mediated polymerase chain reaction | |
| WO2018062859A1 (ko) | 소형 rna 또는 소형 rna와 연관된 단백질을 탐지하는 방법 | |
| WO2020242226A1 (ko) | 핵산 검출용 다가 핵산 나노구조체 및 이를 이용한 고감도 핵산 탐침 | |
| Xu et al. | A universal DNAzyme-based bioluminescent sensor for label-free detection of biomolecules | |
| CN115725703B (zh) | 一种特异性酶切结合qPCR单碱基分辨定量检测DNA中尿嘧啶的方法 | |
| CN116179653B (zh) | 一种dna腺嘌呤甲基转移酶活性检测方法 | |
| CN115948508B (zh) | 一种检测尿嘧啶-DNA糖基化酶的熵驱动哑铃型DNAzyme组装回路系统及应用 | |
| Lai et al. | One-step sensitive detection of UDG activity based on nicking enzyme-assisted signal amplification coupled with APE1 and triggered reporter | |
| Zhou et al. | Sensitive osteosarcoma diagnosis through five-base telomerase product-triggered CRISPR-Cas12a enhanced rolling circle amplification | |
| WO2012070863A2 (ko) | 핵산효소-분자비콘을 이용한 핵산의 검출방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19868596 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20217010633 Country of ref document: KR Kind code of ref document: A |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19868596 Country of ref document: EP Kind code of ref document: A1 |
