WO2020061059A1 - Anti-lilrb2 antibodies and methods of use thereof - Google Patents
Anti-lilrb2 antibodies and methods of use thereof Download PDFInfo
- Publication number
- WO2020061059A1 WO2020061059A1 PCT/US2019/051529 US2019051529W WO2020061059A1 WO 2020061059 A1 WO2020061059 A1 WO 2020061059A1 US 2019051529 W US2019051529 W US 2019051529W WO 2020061059 A1 WO2020061059 A1 WO 2020061059A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- amino acid
- acid sequence
- set forth
- sequence set
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2818—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001102—Receptors, cell surface antigens or cell surface determinants
- A61K39/001111—Immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/421—Immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2827—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
- A61K2039/507—Comprising a combination of two or more separate antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5156—Animal cells expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5158—Antigen-pulsed cells, e.g. T-cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/48—Blood cells, e.g. leukemia or lymphoma
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/50—Colon
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/75—Agonist effect on antigen
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- This invention relates generally to antibodies or antigen-binding fragments thereof that bind to modulate leukocyte immunoglobulin (Ig)-like receptor (LILR) B2 (LILRB2) (“anti-LILRB2 antibodies”) and modulate LILRB2 signaling to induce acquisition of either the Ml or the M2 functional phenotype in myeloid cells, compositions comprising anti-LILRB2 antibodies, and uses thereof.
- Ig leukocyte immunoglobulin
- LILRB2 leukocyte immunoglobulin B2
- anti-LILRB2 antibodies modulate LILRB2 signaling to induce acquisition of either the Ml or the M2 functional phenotype in myeloid cells
- the invention also relates to related chimeric antigen receptors (CARs) and cells comprising same (e.g., T cells, natural killer cells, or macrophages), and uses of the CARs and cells in targeting tumors and killing them, asthma treatment, or in targeting and removing infected cells (e.g., to treat infections or infectious diseases), or in suppressing immune system cells, as involved in autoimmune disease or transplant rejection.
- CARs chimeric antigen receptors
- Leukocyte immunoglobulin (Ig)-like receptor also known as immunoglobulin like transcripts (ILTs)
- ILTs immunoglobulin like transcripts
- LILRBs inhibitory receptors
- Myeloid-derived suppressor cells are myeloid progenitors with immune suppressive functions that have included Grl+CDl lb+CDl l5+Ly6C+ monocytic (M)-cells and Grl+CDl lb+Ly6G+ granulocytic (G)-cells in mice (Gabrilovich et al, Cancer Res. 67:425, 2007; Huang et al, Cancer Res. 66: 1123- 1131, 2006).
- Human MDSCs are characterized as CD33+CD14+CD16+, CDl lb+CDl4LowCD33+ or Lin-HLA-DRLow-CD33+ myeloid cells (Chen et. al, Clin.
- MDSCs can be differentiated and polarized into Ml- and M2-linage cells (Ml-cells expressing iNOS, TNF-a, IFN-gR, MHC class I, and CCR7, and M2-cells expressing arginase, IL-10, CD36, CD206, CD 163, PD-L1, DC-SIGN and CCR2).
- M2-cells possess an enhanced ability to suppress Teff activation and proliferation compared to their Ml -like counterparts in co-cultures of T-cells and in vivo (Ma et al, Immunity 34:385-395, 2011).
- M2-cells also possess higher potency in Treg expansion than those with an Ml phenotype, both in vitro and in vivo (Ma et al., Immunity 34:385-395, 2011). As M2-cells suppress Teff activation and proliferation, and promote Treg expansion, M2-cells can be used to treat autoimmune diseases, where a decrease in pro-inflammatory immune response is desired.
- Ml-cells have increased direct tumor killing and promote the development of anti-tumoral immunity through the augmentation of free radicals, death ligand, HLA- DR and immunostimulating cytokines-TNFa, (see, e.g., Ma et al, Immunity 34:385- 395, 2011), and therefore, Ml-cells can be used to treat cancer or other disorders where an increase in pro-inflammatory immune response is desired.
- the present disclosure features antibodies and antigen-binding fragments thereof that bind to leukocyte immunoglobulin (Ig)-like receptor B2 (“LILRB2”), e.g., an anti-LILRB2 antibody or antigen-binding fragments thereof.
- LILRB2 leukocyte immunoglobulin-like receptor B2
- These antibodies can be grouped into three classes: one class (Class I) includes LILRB2 antagonist antibodies and antigen-binding fragments thereof for use in the treatment of cancer; and second class (Class II) including LILRB2 agonist antibodies cross-binding to LILRA1 and antigen-binding fragments thereof for use in the treatment in immune suppression.
- an antibody or antigen-binding fragment thereof that binds to LILRB2, comprising: (a) a heavy chain variable region (VH) comprising a heavy chain complementarity determining region 1 (HCDR1) comprising the amino acid sequence set forth in SEQ ID NO:225, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:230, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:244; and a light chain variable region (VL) comprising: a light chain CDR 1 (LCDR1) comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:202, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l6; (b) a VH comprising a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 89, a HCDR2 comprising the amino acid sequence set forth in
- the antibody or antigen-binding fragment thereof comprises: (a) a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:225, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:230, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:244; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:202, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l6; (b) a VH comprising a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:89, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising:
- the antibody or antigen-binding fragment thereof comprises: a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:225, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:230, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:244; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:202, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l6.
- the antibody or antigen-binding fragment thereof is an antagonist of LILRB2 activity.
- an antibody or antigen-binding fragment thereof that binds to LILRB2, comprising: (a) a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 172; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID
- a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 63;
- a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 175; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:67; (c) a VH comprising a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 134,
- the antibody or antigen-binding fragment comprises: (a) a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 172; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 63; (b) a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 175; and a VL comprising: a
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 172; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:63.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 175; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:67.
- the antibody or antigen-binding fragment thereof is an agonist of LILRB2 activity.
- the foregoing antibody or antigen-binding fragment thereof is an antigen-binding fragment of the antibody.
- the foregoing antibody or antigen-binding fragment thereof is an antibody.
- the antibody comprises an IgGl heavy chain constant region.
- the antibody comprises an IgG2 heavy chain constant region.
- the antibody comprises a kappa light chain constant region.
- nucleic acid molecule encoding any one of the foregoing antibodies or antigen-binding fragments thereof.
- a vector comprising a nucleic acid molecule encoding any one of the foregoing antibodies or antigen-binding fragments thereof.
- a vector comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule encodes the VH of any one of the foregoing antibodies or antigen-binding fragments thereof, and wherein the second nucleic acid molecule encodes the VL of the antibody or antigen-binding fragment thereof.
- a host cell comprising one or more nucleic acid molecules encoding any one of the foregoing antibodies or antigen binding fragments thereof.
- the host cell is a prokaryotic or eukaryotic cell.
- a host cell comprising any one of the foregoing vectors.
- the host cell is a prokaryotic or eukaryotic cell.
- a method for producing any one of the foregoing antibodies or antigen-binding fragments thereof comprising: (a) culturing any one of the foregoing host cells under conditions suitable for expression of the antibody or antigen-binding fragment thereof by the host cell; and (b) recovering the antibody or antigen-binding fragment thereof.
- a pharmaceutical composition comprising any one of the foregoing antibodies or antigen-binding fragments thereof and a suitable pharmaceutical carrier.
- the pharmaceutical composition further comprises a chemotherapeutic agent or an analgesic.
- the pharmaceutical composition further comprises one or more additional agents selected from the group consisting of: a myeloid-derived suppressor cell, a mobilizing agent, a c-jun N-terminal kinase inhibitor, an anti-inflammatory agent, and an immunosuppressive agent.
- the pharmaceutical composition is formulated for intravenous, intramuscular, oral, subcutaneous, intraperitoneal, intrathecal, intratumoral or intramuscular administration to a subject.
- a method of treating cancer in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of any one of the foregoing antibodies or antigen-binding fragments thereof or the foregoing pharmaceutical composition.
- the method further comprises administering to the mammal a chemotherapeutic agent or an analgesic.
- the method further comprises administering to the mammal an immune checkpoint inhibitor.
- the cancer is a lymphoma, a leukemia, or a breast cancer.
- the antibody is an antagonist of LILRB2.
- a method of treating cancer in a mammal in need thereof comprising administering to the mammal any one of the foregoing antibodies or antigen-binding fragments thereof or the pharmaceutical composition and a PD-l or PD-L1 inhibitor.
- the cancer is a lymphoma, a leukemia, or a breast cancer.
- the antibody is an antagonist of LILRB2.
- a method of treating an infection in a mammal in need thereof comprising administering to the mammal any one of the foregoing antibodies or antigen-binding fragments thereof or the pharmaceutical composition.
- the infection is a bacterial infection.
- the antibody is an antagonist of LILRB2.
- a method of decreasing a pro- inflammatory immune response in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of any one of the foregoing antibodies or antigen-binding fragments thereof or the pharmaceutical.
- the mammal has been diagnosed as having inflammation, an autoimmune disease, or transplant rejection.
- the mammal is selected for organ or tissue transplantation.
- a method of treating inflammation, an autoimmune disease, or transplant rejection in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of any one of the foregoing antibodies or antigen-binding fragments thereof or the pharmaceutical composition.
- the mammal has been diagnosed as having inflammation, an autoimmune disease, or transplant rejection.
- the mammal is selected for organ or tissue transplantation.
- the method further comprises administering to the mammal one or more additional agents selected from the group consisting of: a myeloid-derived suppressor cell, a mobilizing agent, a c-jun N- terminal kinase inhibitor, an anti-inflammatory agent, and an immunosuppressive agent.
- additional agents selected from the group consisting of: a myeloid-derived suppressor cell, a mobilizing agent, a c-jun N- terminal kinase inhibitor, an anti-inflammatory agent, and an immunosuppressive agent.
- the mammal is a human.
- a chimeric antigen receptor comprising the VH and VL of an antibody described herein.
- the VH comprises a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:92, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161;
- the VL comprises a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:37, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:53.
- the VH comprises a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:225, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:230, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:244; and the VL comprises a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:202, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l6.
- provided herein is a polynucleotide encoding any one of the foregoing CARs.
- a vector comprising a polynucleotide encoding any one of the foregoing CARs.
- a cell comprising any one of the foregoing CARs. In another aspect, provided herein is a cell comprising a polynucleotide encoding any one of the foregoing CARs. In another aspect, provided herein is a cell comprising a vector comprising a polynucleotide encoding any one of the foregoing CARs. In one embodiment, the cell is a T cell. In one embodiment, the cell is a natural killer cell. In one embodiment, the cell is a macrophage.
- a pharmaceutical composition comprising any one of the foregoing CARs and a suitable pharmaceutical carrier.
- a pharmaceutical composition comprising a cell comprising any one of the foregoing CARs and a suitable pharmaceutical carrier.
- a pharmaceutical composition comprising a cell comprising a polynucleotide encoding any one of the foregoing CARs and a suitable pharmaceutical carrier.
- a pharmaceutical composition comprising a cell comprising a vector comprising a polynucleotide encoding any one of the foregoing CARs and a suitable pharmaceutical carrier.
- a method of producing a CAR comprising (a) culturing one of the foregoing cells (e.g., a cell comprising a polynucleotide encoding any one of the foregoing CARs or a cell comprising a vector comprising a polynucleotide encoding any one of the foregoing CARs) and (b) isolating the CAR.
- the foregoing cells e.g., a cell comprising a polynucleotide encoding any one of the foregoing CARs or a cell comprising a vector comprising a polynucleotide encoding any one of the foregoing CARs
- a method of treating cancer in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of any one of the foregoing CARs, any one of the foregoing cells, or any one of the foregoing pharmaceutical compositions.
- the cancer is a lymphoma, a leukemia, a colon cancer, or a breast cancer.
- the mammal is a human.
- a method of treating asthma in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of any one of the foregoing CARs, any one of the foregoing cells, or any one of the foregoing pharmaceutical compositions.
- the mammal is a human.
- a method of treating an infection in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of any one of the foregoing CARs, any one of the foregoing cells, or any one of the foregoing pharmaceutical compositions.
- the mammal is a human.
- a method of treating inflammation, an autoimmune disease, or transplant rejection in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of any one of the foregoing CARs, any one of the foregoing cells, or any one of the foregoing pharmaceutical compositions.
- the mammal is a human.
- the disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to LILRB2, wherein the antibody or antigen-binding fragment comprises a heavy chain complementarity determining region (CDR) 1 comprising an amino acid sequence as set forth in one of SEQ ID NOs: 111, 265, 267, 269, 274, 277, 279, 282, 284, 285, 112, 267, 292, and 295, or the amino acid sequence as set forth in one of SEQ ID NOs: 111, 265, 267, 269, 274, 277, 279, 282, 284, 285, 112, 267, 292, and 295 with a substitution at two or fewer amino acid positions, a heavy chain CDR 2 comprising an amino acid sequence as set forth in one of SEQ ID NOs: 147, 157, 270, 272, 275, 280, 283, 286, 288, 290, 293, and 296, or the amino acid sequence as set forth in one of SEQ ID NOs: 147, 157, 270, 275,
- the disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to LILRB2, wherein the antibody or antigen-binding fragment comprises a light chain CDR 1 comprising an amino acid sequence as set forth in one of SEQ ID NOs: 298, 300, 302, 305, 26, 308, 7, 197, 312, 314, 316, 317, 318, 320, 322, 325, and 31, or the amino acid sequence as set forth in one of SEQ ID NOs: 298, 300, 302, 305, 26, 308, 7, 197, 312, 314, 316, 317, 318, 320, 322, 325, and 31 with a substitution at two or fewer amino acid positions, a light chain CDR 2 comprising an amino acid sequence as set forth in one of SEQ ID NOs: 38, 41, 44, 49, 42, 45, 39, 323, and 326, or the amino acid sequence as set forth in one of SEQ ID NOs: 38, 41, 44, 49, 42, 45, 39, 323, and 326 with
- the disclosure provides an antibody or antigen-binding fragment thereof specifically binds to LILRB2, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising complementarity determining region (CDR)l, CDR2, and CDR3, consisting of the amino acid sequences: (i) GYTFTTYG (SEQ ID NO: 111), MNTYSGVP (SEQ ID NO: 147), and CARMGRGSLY GMDYW (SEQ ID NO: 261, respectively; (ii) GYTFTTYG (SEQ ID NO: 111), INTYSGVP (SEQ ID NO: 157) and
- CGPSDYWYFDVW SEQ ID NO: 276
- GFTFSDYG SEQ ID NO: 277
- ISSGSSTI SEQ ID NO: 275
- C ARDYFY GNNY GFPYW SEQ ID NO: 278
- GYTFINYY SEQ ID NO: 279
- IYPGNINS SEQ ID NO: 280
- CAMTNSSAMDYW SEQ ID NO: 281
- GYTFISYY SEQ ID NO: 282
- IYPGNVNT SEQ ID NO: 283
- CAMTNSSAMDYW (SEQ ID NO: 281), respectively;
- the disclosure provides an antibody or antigen-binding fragment thereof specifically binds to LILRB2, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising complementarity determining region (CDR)l, CDR2, and CDR3, consisting of the amino acid sequences: consisting of the amino acid sequences: (i) GYTFTTYG (SEQ ID NO: 111), MNTYSGVP (SEQ ID NO: 147), and CARMGRGSLYGMDYW (SEQ ID NO: 261, respectively; (ii) GYTFTTYG (SEQ ID NO: 111), INTYSGVP (SEQ ID NO: 157) and CARS GHS Y SLYVMGYW (SEQ ID NO: 262), respectively; (iii)
- GYTFTTYG (SEQ ID NO: 111), INTYSGVP (SEQ ID NO: 157) and
- CAMTNSSAMDYW (SEQ ID NO: 281), respectively;
- GFSLTNYD (SEQ ID NO: 285), IWTGGNT (SEQ ID NO: 286) and CVREGFRQGYY AMDYW (SEQ ID NO: 287), respectively;
- GYTFTDYY (SEQ ID NO: 112), IDTKNGGT (SEQ ID NO: 288) and CASGGRGYW (SEQ ID NO: 289), respectively;
- (xviii) GYTFTNYG (SEQ ID NO: 267), INTYTGEP (SEQ ID NO: 290) and
- CTRN YYRP YYY AMDYW (SEQ ID NO: 291), respectively; (xix) GYSFTGYT (SEQ ID NO: 292), INPYNDNT (SEQ ID NO: 293) and CAREGNYY GASPWFAYW (SEQ ID NO: 294), respectively; and (xx) GYTFTHYG (SEQ ID NO: 295), INTSTGET (SEQ ID NO: 296) and
- the isolated antibody or antigen-binding fragment is an antagonist of LILRB2 activity.
- the disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to LILRB2, wherein the antibody or antigen-binding fragment comprises a heavy chain complementarity determining region (CDR) 1 comprising an amino acid sequence as set forth in one of SEQ ID NOs: 279, 284, 94, 112, 328, 331, 334, 102, 342, and 344, or the amino acid sequence as set forth in one of SEQ ID NOs: 279, 284, 94, 112, 328, 331, 334, 102, 342, and 344 with a substitution at two or fewer amino acid positions, a heavy chain CDR 2 comprising an amino acid sequence as set forth in one of SEQ ID NOs: 283, 329, 332, 335, 337, 339, 340, 232, 345, and 347, or the amino acid sequence as set forth in one of SEQ ID NOs: 283, 329, 332, 335, 337, 339, 340, 232, 345, and 347 with
- the disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to LILRB2, wherein the antibody or antigen-binding fragment comprises light chain CDR 1 comprising an amino acid sequence as set forth in one of SEQ ID NOs: 298, 300, 302, 305, 26, 308, 7, 197, 312, 314, 316, 317, 318, 320, 322, 325, and 31, or the amino acid sequence as set forth in one of SEQ ID NOs: 314, 316, 87, 23, 353, 355, 91, 357, 12, and 27, or the amino acid sequence as set forth in one of SEQ ID NOs: 314, 316, 87, 23, 353, 355, 91, 357, 12, and 27 with a substitution at two or fewer amino acid positions
- a light chain CDR 2 comprises an amino acid sequence as set forth in one of SEQ ID NOs: 41, 42, 45, 349, 351, 97, 40, and 48, or the amino acid sequence as set forth in one of SEQ ID NOs: 41, 42, 45
- the disclosure provides an antibody or antigen-binding fragment thereof specifically binds to LILRB2, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising complementarity determining region (CDR)l, CDR2, and CDR3, consisting of the amino acid sequences: (xl) GFTFTGYW (SEQ ID NO: 328), ILPVSGIT (SEQ ID NO: 329) and CARRGSPYFDYW (SEQ ID NO: 330), respectively; (xli) GFSLNTFDMG (SEQ ID NO: 331), IWWDDDK (SEQ ID NO: 332) and CGRKPGGY GNYVL (SEQ ID NO: 333), respectively; (xlii) GFSLTRYG (SEQ ID NO: 334), IWSGGST (SEQ ID NO: 335) and C ARDGRVY AMDYW (SEQ ID NO: 336), respectively; (xliii) GYTFTDYY (SEQ ID NO: 11
- the disclosure provides an antibody or antigen-binding fragment thereof specifically binds to LILRB2, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising complementarity determining region (CDR)l, CDR2, and CDR3, consisting of the amino acid sequences: consisting of the amino acid sequences: (xl) GFTFTGYW (SEQ ID NO: 328), ILPVSGIT (SEQ ID NO: 329) and CARRGSPYFDYW (SEQ ID NO: 330), respectively; (xli) GFSLNTFDMG (SEQ ID NO: 331), IWWDDDK (SEQ ID NO: 332) and CGRKPGGY GNYVL (SEQ ID NO: 333), respectively; (xlii) GFSLTRYG (SEQ ID NO: 334), IWSGGST (SEQ ID NO: 335) and C ARDGRVY AMDYW (SEQ ID NO: 336), respectively; (xliii) GYTFTD
- the isolated antibody or antigen-binding fragment is an agonist of LILRB2 activity.
- the disclosure provides an isolated nucleic acid molecule encoding the anti-LILRB2 antibody or antigen-binding fragment thereof as disclosed herein.
- the disclosure also provides a vector comprising a nucleic acid molecule encoding the anti-LILRB2 antibody or antigen-binding fragment thereof as disclosed herein.
- Host cells including prokaryotic or eukaryotic cells, comprising a vector comprising a nucleic acid molecule encoding the anti-LILRB2 antibody or antigen binding fragment thereof as disclosed herein are also provided herein.
- the disclosure provides methods for producing an anti- LILRB2 antibody or antigen-binding fragment thereof comprising the steps of (a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the anti-LILRB2 antibody or antigen-binding fragment thereof under conditions suitable for expression of the LILRB2 antibody or antigen-binding fragment thereof by the host cell; and (b) recovering the LILRB2 antibody or antigen-binding fragment thereof.
- compositions comprising the anti-LILRB2 antibody or antigen-binding fragment thereof and a suitable pharmaceutical carrier are disclosed herein.
- the compositions further comprise a chemotherapeutic agent or an analgesic.
- the compositions further comprise a one or more additional agents selected from the group consisting of: a myeloid-derived suppressor cell, a mobilizing agent, a c-jun N-terminal kinase inhibitor, an anti-inflammatory agent, and an immunosuppressive agent.
- compositions of the present disclosure can be formulated, for example, for intravenous, intramuscular, oral, subcutaneous, intraperitoneal, intrathecal, intratumoral or intramuscular administration.
- the disclosure provides methods for treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof that specifically binds to LILRB2 as described herein. In some aspects, the methods further comprise administering to the mammal a chemotherapeutic agent or an analgesic.
- this disclosure provides a pharmaceutical composition
- a pharmaceutical composition comprising the anti-LILRB2 antibody or antigen-binding fragment thereof (e.g., Fab or scFv) described herein and a pharmaceutically acceptable carrier.
- the antibody or antigen-binding fragment thereof has an apparent monovalent affinity of about 150rM to about lOOnM.
- the antibody or the antigen-binding fragment thereof is an Fab, an Fab', an F(ab')2, an Facb, an Fv, an Fd, a diabody, an scFv, or an sc(Fv)2.
- the antibody or the antigen-binding fragment thereof is an Fab.
- the term“one or more” includes at least one, more suitably, one, two, three, four, five, ten, twenty, fifty, one-hundred, five-hundred, etc., of the item to which“one or more” refers.
- FIGs. 1A - 1C The effect of anti LILRB2 on TNF alpha production from human PBMC.
- FIGs. 1A - 1C are graphs showing the production of TNF-a from human peripheral blood mononuclear cells (PBMC) obtained from healthy donors after incubation with anti-LILRB2 purified antibodies (5 pg/ml), or isotype control overnight for 16 hours following stimulation with LPS (50 ng/ml) for 24 hours.
- Anti- LILRB2 monoclonal antibodies (mAbs) were ranked in order of clones that suppress TNF alpha release to those that enhance TNF alpha secretion. The levels of TNF-a were determined by ELISA.
- FIG. 1A The secretion of TNF alpha is shown in FIG. 1A (fold change with Ig control).
- the overall difference in TNF alpha levels from FIG. IB is presented in FIG. 1C (by subtraction of Ig control).
- FIGs. 2A - 2C The effect of anti LILRB2 on IL-10 production from human PBMC.
- FIGs. 2A - 2C are graphs showing the production of IL-10 from PBMCs obtained from healthy donors after treatment with purified LILRB2 antibodies (5 pg/ml), or isotype control overnight for 16 hours following stimulation with LPS (50 ng/ml) for 24 hours.
- FIG. 2D The effect of anti LILRB2 on M1/M2 differentiation/TAM markers from monocyte-derived macrophages (Antagonist).
- FIG. 2D is the flow cytometric analysis on the effect of LILRB2 antibodies on the M1/M2 markers of tumor- associated macrophages from multiple lung cancer patients. Tumor infiltrated lymphocytes were isolated and treated with LILRB2 antagonistic antibody (P 5G5) for 2 days in the presence of IFNgamma. The test cells were harvested for cytometric analysis in upper panel and the statistic analysis on multiple patients is shown in lower panel.
- LILRB2 antagonistic antibody P 5G5
- FIG. 2E The effect of anti LILRB2 on M1/M2 differentiation/TAM markers from monocyte-derived macrophages (Agonist).
- FIG. 2E is the flow cytometric analysis on the effect of LILRB2 antibodies on the M1/M2 markers in multiple healthy donors.
- Ml-type macrophages were differentiated from CD33+ myeloid cells sorted from healthy donor in the presence of GM-CSF lOOng/ml and agonistic anti- LILRB2 Ab (12H6, 5 pg/ml) for 6 days and IFNgamma (25ng/ml) and LPS (25ng/ml) for the last 24 hours.
- the test cells were harvested for cytometric analysis in upper panel and the statistic analysis on multiple healthy donors is shown in lower panel.
- FIG. 2F Mass cytometry analysis of anti-LILRB2 treated PBMCs stimulated with anti-CD3.
- FIG. 2F is mass cytometry analysis of antagonistic and agonistic LILRB2 antibodies on OKT3 -stimulated PBMCs from multiple healthy donors.
- PBMCs were obtained from healthy donors and treated with purified LILRB2 antagonistic (C_lH3) and agonistic (C_8B5) antibodies (5 pg/ml), or isotype control overnight for 16 hours following stimulation with OKT3 (0.01 pg/ml) for 3 days.
- the test cells were harvested for cytometric analysis (heat map, Left panel and Disney figure, Right panel).
- Left panel represents the heatmaps showing the expression of the indicated markers in the immune cells subsets (PBMC, CD4 and CD8 T cells).
- Right panel represents t-SNE map displaying data on subsets of 1 x 10 6 PBMCs, CD4 and CD8 T cells analyzed with our 38-antibody panel and colored by marker expression normalized based on IgG control.
- FIG. 3A The effect of anti LILRB2 on the T proliferation of human PBMC stimulated with low dose of antiOKT3 (Antagonist).
- FIG. 3A is a graph showing OKT3 -mediated T cell proliferation (CPM) following stimulation of PBMC from healthy donors. PBMC were cultured with LILRB2 antagonistic antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) of anti-CD3 (OKT3) for 3 days. After 3 days of treatment, [ 3 H] -thymidine was added for the last 8 hours of culture followed by measurement on a scintillation counter. Clone ranking based on TNF alpha from Figure 1A is presented. The relative fold change in T-cell proliferation (CPM) is shown in FIG. 3A (based on fold change with Ig control).
- FIG. 3B The effect of anti LILRB2 on interferon gamma production of human PBMC stimulated with low dose of antiOKT3 (Antagonist).
- FIG. 3B is a graph showing IFN-g production from OKT3-mediated T cell proliferation of PBMC from healthy donors. PBMC were cultured with LILRB2 antagonistic antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) of anti-CD3 (OKT3) for 3 days. Supernatants were collected from FIG. 3A and IFN-g concentrations were measured by ELISA (based on fold change with Ig control).
- FIG. 3C The effect of anti LILRB2 on T cells proliferation from human PBMC stimulated with low dose of OKT3 (agonist).
- FIG. 3C is a set of flow cytometric data from OKT3 -stimulated human PBMC labeled with CFSE.
- CFSE- labeled PBMCs were cultured with LILRB2 agonistic antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) of anti-CD3 (OKT3) for 3 days. After 3 days of culture, viable CD4 T cells (left panel) and CD8 T cells (middle panel) were analyzed by flow cytometry.
- the representative flow plots were showed as CFSE dilution of CD4 and CD8 T cells (left and middle panels) and proliferation index (right middle for CD4 cells and right lower panel for CD8 cells). Supernatants were harvested for IFNgamma detection shown in right upper panel.
- FIG. 3D The effect of anti LILRB2 on T cell proliferation in MLR.
- FIG. 3D is a set of flow cytometric data from cultured human PBMC (responders) labeled with CFSE, and stimulated with irradiated (30 Gy) unrelated donor PBMCs (stimulators) in presence of IgG isotype control or the indicated LILRB2 antibodies (5 pg/ml). The ratio of responder/stimulator was 1/2. After 5 days of co-culture, viable CD4 T cells (left panel) and CD 8 T cells (right panel) were analyzed by flow cytometry. The representative flow plots are shown as CFSE dilution.
- FIG. 4A The effect of anti LILRB2 on human myeloid leukemia cell, THP- RB2, proliferation.
- FIG. 4A is a graph showing the proliferation of LILRB2- tranduced human myeloid leukemia cells (THP1) following treatment with anti- LILRB2 antibody (5 pg/ml), or isotype control for 42 hours.
- LILRB2+ THP-l cell proliferation was assessed by [ 3 H] -thymidine incorporation. Cells were pulsed with [ 3 H] -thymidine for the last 8 hours of culture.
- FIG. 4B The effect of anti LILRB2 on human solid cancer, MCF7 proliferation.
- FIG. 4B is a graph showing the proliferation of LILRB2-tranduced human breast cancer cells (MCF7) following treatment with anti-LILRB2 antibody (5 pg/ml), or isotype control for 4 days.
- LILRB2+ MCF7 cell proliferation was assessed by [3 ⁇ 4] -thymidine incorporation. Cells were pulsed with [3 ⁇ 4] -thymidine for the last 8 hours of culture.
- FIGs. 5A - 5B AntiLILRB3 decreases the migration of RB3+ breast cancer cells.
- FIGs. 5A - 5B are graphs showing migration/invasive activity of LILRB2 + MDAMB231 breast cancer cells.
- FIG. 5A shows the scratch assay performing to evaluate the migration activity of LILRB2 + MDAMB231. Scratched the cell monolayer in a straight line and treated with anti-LILRB2 mAbs or control Ig (5 pg/ml) in serum-free medium. After 24 hours, the migratory ability of LILRB2 + MDAMB231 cells was determined by scratch closure on the basis of the area that are measured by Image J.
- FIG. 5A shows the scratch assay performing to evaluate the migration activity of LILRB2 + MDAMB231. Scratched the cell monolayer in a straight line and treated with anti-LILRB2 mAbs or control Ig (5 pg/ml) in serum-free medium. After 24 hours, the migratory ability of
- FIG. 5B shows the transwell assay performed to evaluate the invasive activity of LILRB2 + MDAMB231.
- lxlO 5 cells were seeded in the upper chamber in the presence of LILRB2 antagonistic antibody (C 5C12) or control Ig (5 pg/ml). After 24 hours, the transwell membrane was stained with Crystal Violet and cells per field were counted. Photos are shown to indicate the migrated cells at the upper panel.
- Statistical analysis of upper panels in FIGs. 5A - 5B are shown in lower panels.
- FIG. 6A Antagonistic anti-LILRB2 enhance Vaccine adjuvant effect (CpG) and bacterial opsonization/phagocytosis.
- FIG. 6A are graphs showing the effect of LILRB2 antagonistic antibody (P 5G5) on enhancement of adjuvant effect (left panel) and phagocytic activities of human monocytes on GFP-expressing Escherichia coli (middle and right panels).
- LILRB2 antagonistic antibody P 5G5
- MISTRG mice were intravenously injected with IgG control or LILRB2 antagonistic antibody (P 5G5) ( 150pg/mouse) for two days, and then intraperitoneally challenged with 5 nmol. After 2 hours, the serums were collected from test mice and subjected to ELISA analysis for TNFa levels.
- humanized MISTRG mice were intraperitoneally injected with LILRB2 antagonistic antibody (P 5G5) or control Ig ( 150pg/mouse) for 48 hours.
- Peripheral blood cells were isolated and incubated with E. coli expressing GFP at the ratio of 2x10 8 A. Coli per l x lO 7 peripheral blood cells for 4h at 37°C. The cells were harvested and washed with PBS and analyzed by gating on viable CD45 + CD33 + population.
- FIG. 6B The tumor growth of mouse and human lung cancer cells were inhibited by antagonistic antiLILRB2 in tumor models.
- FIG. 6B is a graph showing tumor growth of LLC cells were suppressed by LILRB2 antagonistic clone (P 5G5) in BAC LILRB2/3 transgenic mice in conjunction with anti-PDLl. Test mice were subcutaneously (sc) implanted with 4x10 5 LLC cells. When the tumor size reached 2- 3 mm diameter, LILRB2 antagonistic clone, clone P 5G5 (open circle) or control IgG (open diamond) ( 150pg/mouse. every three days) were infused through I.V. injection. Anti-PDL-l ( 150pg/mouse. every three days) was started from second time injection of LILRB2 antibody, clone P 5G5 (open square) or control IgG (open triangle). The tumor volume was determined every 2 ⁇ 3 days; shown in FIG. 6B.
- FIG. 6C The tumor growth of mouse and human lung cancer cells were inhibited by antagonistic antiLILRB2 in tumor models.
- FIG. 6C is a graph showing the anti-tumor effect of LILRB2 antagonistic antibodies (P 5G5) on tumor growth of Luciferase-expressed-A549 in HLA-A2 matching humanized NCG mice model.
- Test mice were intravenously (iv) injected with 2x10 6 A549 cells.
- LILRB2 antagonistic clone, clone P 5G5 or control IgG were infused through I.V. injection on day 3 (200pg/mouse, every three days).
- HLA-A2 matched PBMC from same donors were infused on day 3 and day 13.
- FIG. 7A The synergistic effect of antiLILRB2 with co-stimulatory molecules.
- FIG. 7A is a schematic of the experiment.
- 7B - C depicts graphs showing the co-stimulatory effect of anti-LILRB2 on human PBMC proliferation and interferon gamma secretion.
- 1 x 10 5 total PBMC from healthy donors were cultured with stimulated with anti-LILRB2 Abs (5 pg/ml) in the presence of 1 pg/ml of a-PD- 1, 1 pg/ml of 4-1BBL, 100 ng/ml of OX40L or 1 pg/ml of GITRL overnight (16 hours) a low dose of anti-CD3 (OKT3, 0.01 pg/ml) plus for 3 days. After 3 days of treatment, T cells proliferation was assessed by [ 3 H]-thymidine incorporation.
- Thymidine was added for the last 8 hours of culture followed by measurement on a scintillation counter.
- the effect of on T cell proliferation (CPM) is shown in FIG. 7B.
- Supernatants were harvested for detection of interferon gamma production shown in FIG. 7C.
- FIGs. 8A - FIG. 8E Anti-LILRB2 antibodies enhance LPS response in primary human monocytes.
- FIG. 8A Fold change of TNFa and CD86 MFI levels relative to IgG-treated samples. PBMC were cultured for 48 hours with LILRB2 reactive hybridoma supernatant followed by 6 hours of LPS stimulation (50 ng/ml) in the presence of brefeldin A. MFI values represent cells gated on CD33 + monocytes.
- FIG. 8B Raw CD86 and TNFa data of highlighted clones (red line) from FIG. 8A. Data are overlaid Ig control-treated PBMC (black line).
- FIG. 8C LILRB and LILRA1 receptor recognition of highlighted clones in FIG. 8A.
- FIG. 8D Expression of LILRB2 on THP1 parental cells and LILRB2 retroviral transduced cells.
- FIGs. 9A - FIG. 91 LILRB2 antagonism generates inflammatory macrophages in the presence of MCSF.
- FIG. 9A Representative brightfield microscopy images of MCSF M(-) macrophages matured in the presence of mIgG2a or anti-LILRB2 (aLILRB2, 1 pg/ml).
- FIG. 9B Representative levels of CD14 and CD 163 expression by M(-) in the presence of mIgG2a (blue line) or anti-LILRB2 (red line).
- FIG. 9A Representative brightfield microscopy images of MCSF M(-) macrophages matured in the presence of mIgG2a or anti-LILRB2 (aLILRB2, 1 pg/ml).
- FIG. 9B Representative levels of CD14 and CD 163 expression by M(-) in
- FIG. 9D Secreted TNFa and IL10 from macrophages in FIG. 9C following 16 hour LPS (50 ng/mL) stimulation and detection by ELISA.
- FIG. 9E Fold changes in IRF3, 4, 5 and 7 mRNA expression relative to mean value in IgG-treated immature macrophages cultured in the presence of MCSF (50 ng/ml) for 2 days p-value was calculated by using 2-tailed, Student t- test.
- FIG. 9F Representative PD-L1 expression in M(LPS) and M(IL4) matured in the presence of mIgG2a (black) and anti-LILRB2 (red).
- FIG. 9G Pooled paired MFI data from FIG.
- FIG. 9H Representative DC-SIGN expression of M(LPS) and M(IL4) matured in the context of mIgG2a (black) and anti-LILRB2 (red).
- FIGs. 10A - FIG. 101 LILRB2 antagonism favors NFKB/STAT1 inflammatory pathways.
- FIG. 10A - FIG. 10C THP1 LILRB2 + cells were cultured with IgG or anti-LILRB2 (aLILRB2, 1 pg/ml) for 24 hours followed by acute stimulation with LPS (FIG. 10A), IFNy (FIG. 10B), or IL4 (FIG. 10C) for 5, 10, and 30 min.
- FIG. 10A Immunoblot of phosphorylated NFKB, ERK1/2 and p38 in response to LPS (50 ng/mL) stimulation.
- FIG. 10A Immunoblot of phosphorylated NFKB, ERK1/2 and p38 in response to LPS (50 ng/mL) stimulation.
- FIG. 10A Immunoblot of phosphorylated NFKB, ERK1/2 and p38 in response to LPS (50 ng/mL) stimulation.
- FIG. 10B Immunoblot of phosphorylated NFKB, ERK1/2, p38, and STAT1 in response to IFNy (20 ng/mL) stimulation.
- FIG. 10C Immunoblot of phosphorylated STAT6 in response to IL4 (20 ng/mL) stimulation.
- FIG. 10D Immunoblot of SOCS1 and SOCS3 in response to IL4 (20 ng/mL) stimulation.
- FIG. 10E Immunoblot of phosphorylated AKT from primary MCSF macrophages matured in the presence of IgG or anti-LILRB2. Representative data from 3 independent PBMC donors.
- FIG. 10E Immunoblot of phosphorylated AKT from primary MCSF macrophages matured in the presence of IgG or anti-LILRB2. Representative data from 3 independent PBMC donors.
- FIG. 10F LILRB2, pSHPl, and total SHP1 immunoblotting from IgG and anti-LILRB2 treated macrophages. Results from anti-LILRB2 (42D1) immunoprecipitate (top) and total input lysate (bohom).
- FIG. 10G LILRB2 antagonism inhibits monocyte/macrophage-mediated suppression of Teff responses. Total CD4 and CD8 T cell counts determined by flow cytometry of 72 hour MLRs containing mature DCs, sorted allogeneic T cells, and titrated ratios of MCSF macrophages matured in the presence of IgG (black line) or anti-LILRB2 (red line).
- FIG. 10H Supernatants from MLRs in FIG.
- FIG. 101 Total PBMC were incubated with anti-LILRB2 (5 pg/ml) or IgG overnight followed by anti -PD- 1 treatment (1 pg/ml) in the presence of OKT3 stimulation (0.01 pg/ml) for three days. Supernatants were harvested for IFNy detection by ELISA. Data are from a representative experiment of three independent experiments and presented as mean ⁇ SEM, and p values were calculated by one way ANOVA, Tukey’s multiple comparison test.
- FIGs. 11A - FIG. 11D LILRB2 blockade alters the macrophage transcriptome distinct from conventional Ml versus M2 phenotypes.
- FIG. 11A Volcano plots of normalized gene enrichment scores and enrichment p-values of anti- LILRB2 (aLILRB2) treatment versus IgG treatment in monocyte-derived macrophage conditions M(LPS) (left) and M(IL4) (right). Statistically significant DEGs above the enrichment cutoff (DEGs with FC>l.5 and p-value ⁇ 0.0l with FDR) are shown in red.
- FIG. 11B Overlapping and unique DEGs from M(LPS) and M(IL4) conditions in response to anti-LILRB2 treatment.
- FIG. 11C 2D principal component analysis of Illumina BeadArray datasets.
- FIG. 11D Heatmap visualization of normalized DEGs associated with immune function changes as a result of LILRB2 antagonism in M(IL4) by comparing M(IL4)+ anti-LILRB2 versus M(IL4)+ IgG conditions. DEGs are ranked top to bottom by fold change: red (increased), green (decreased), black (unchanged). Data is normalized by row z-score.
- FIGs. 12A - FIG. 12G LILRB2 blockade reprograms lung tumor-associated macrophage maturation in vitro and in vivo.
- FIG. 12A FACS gating analysis of primary human CD33+ monocytes (lxl 0 5 cells/well) with 5 days co-culture of A549 cells (lxlO 3 cells/well).
- FIG. 12B CD14, CD16, CD163, and DC-SIGN expression among live CD33 + CDl4 + myeloid cells from FIG. 12A. IgG treated cells (black line) are overlaid by anti-LILRB2 treated cells (aLILRB2, red line).
- FIG. 12A FACS gating analysis of primary human CD33+ monocytes (lxl 0 5 cells/well) with 5 days co-culture of A549 cells (lxlO 3 cells/well).
- FIG. 12B CD14, CD16, CD163, and DC-SIGN expression among live CD33 + CDl4 + myeloid cells from FIG
- FIG. 12C FACS gating strategy for identifying human CD45 + CD33 + macrophages from NSG-SGM3 immuno-deficient mice subcutaneously inoculated with A549 tumor and CD33 + monocytes 12 days earlier.
- FIG. 12D One representative data from one donor was shown. Data were averaged from 4 tumor samples/group, 2 mice/group. Data were compared using two-tailed Student's t-test. Individual data from five donors were presented in FIG. 20B. Combined data from all five donors for CD14, HLADR and CD 16 is presented in FIG. 20D. Data were averaged from 4-8 tumor samples/group/donor, 2-4 mice/group/donor, three independent experiments, paired t- test. FIG.
- HLA-A2 matched humanized NCG mice were used to assess in vivo anti -tumor responses by LILRB2 blockade (aLILRB2) together with anti-PD-l (aPDl) treatment in a LUC-A549 (HLA-A2 + ) xenograft mouse model.
- LILRB2 blockade aLILRB2 blockade
- aPDl anti-PD-l
- FIGs. 13A - FIG. 13G Anti-tumor effect of LILRB2 blockade in LILRB2 transgenic mice in LLC tumor model.
- FIG. 13A LILRB2 and LILRB3 expression in CD1 lb-gated viable peripheral blood cells.
- FIG. 13B Total peripheral blood cells were harvested for flow cytometric analysis after LPS stimulation in the presence of IgG or anti-LILRB2 (aLILRB2) and supernatants were collected for ELISA assay. Representative dot plots of the CD86 + MHCII + population in CD1 lb-gated cells.
- FIG. 13F Tumor infiltrating lymphocytes were purified for flow cytometric analysis of Ly6G + Ly6C mt granulocytic MDSC and Ly6G Ly6C hl monocytic MDSC in the CD1 lb + cell population.
- Upper panels representative flow cytometric analysis on MDSC from tumor of test mice treated with Ig control or anti-LILRB2+ anti-PDLl.
- FIG. 13G Splenocytes and tumor infiltrating lymphocytes were isolated for flow cytometric analysis of CD25 + FoxP3 + Treg in CD4 + cell population.
- FIGs. 14A - FIG. 14F Lung cancer patient-derived tumor-infiltrating myeloid cells respond to LILRB2 blockade.
- FIG. 14A Characterization of myeloid cell populations isolated from NSCLC excised tumor. Cells were gated on DAPI- CD45 + live leukocyte cells. PMN-MDSC, M-MDSC, DC, and TAM populations were identified.
- FIG. 14B Representative LILRB1-4 staining among CD33 + gate from FIG. 14A.
- FIG. 14F Proposed mechanisms for LILRB2 antagonism on the M1/M2 polarization.
- FIGs. 15A - 15B LILRB and LILRA1 detection on transduced cell lines
- FIGs. 16A - 16B LILRB2 antagonism reduces macrophage-dependent inhibition on T cell proliferation.
- FIGs. 17A - 17B Differentially expressed genes of M(LPS) vs. M(IL4) macrophages.
- FIGs. 18A - 18E Differentially expressed genes from monocyte-derived macrophages in the context of LILRB2 antagonism.
- FIG. 19 LILRB2 blockade reprograms breast tumor-associated macrophage maturation.
- FIGs. 20A - 20D A549 lung cancer xenograft models and the generation humanized MISTRG mice.
- FIG. 21 Lung cancer patient-derived tumor infiltrating myeloid cells respond to LILRB2 blockade.
- FIGs. 22A - 22B LILRB2 expression on CD45+CD33+HLADRhiCDl4- dendritic cells in tumor infiltrated lymphocytes and CD 14+ monocyte-differentiated dendritic cells.
- FIGs. 23A - 23C are graphs showing OKT3 -mediated T cell proliferation (CPM) following stimulation of PBMC from healthy donors.
- PBMC were cultured with LILRB2 antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) anti-CD3 (OKT3) for 3 days.
- [3 ⁇ 4] -thymidine was added for the last 8 hours of culture followed by measurement on a scintillation counter.
- Clone ranking based on TNF alpha from FIG. 1A is presented.
- the relative fold change in T-cell proliferation (CPM) is presented in FIG. 23A.
- T-cell proliferation is shown in FIG. 23B.
- the overall difference in T-cell proliferation from FIG. 23B is presented in FIG. 23C.
- FIGs. 23D - 23F are graphs showing the IFN-g production from PBMCs obtained from healthy donors.
- PBMCs were cultured with LILRB2 antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) anti-CD3 (OKT3) for 3 days.
- Supernatants were collected and IFN-g production was measured by ELISA.
- Clone ranking based on TNF alpha from FIG. 1A is presented.
- the relative fold change in IFN-g production release is presented in FIG. 23D.
- the secretion of IL-10 is shown in FIG. 23E.
- the overall difference in IL-10 concentrations from FIG. 23E is presented in FIG. 23F.
- FIG. 23G shows the cross-reactivity of the anti-LILRB2 agonist antibodies to the LILRA family.
- FIG. 23H shows the suppression of T cell IFN-g production upon treatment with anti-LILRB2 agonist antibodies.
- FIG. 231 shows suppression of the MLR reaction by the anti-LILRB2 agonist antibodies.
- FIG. 24 Anti-LILRB2 CAR-T cells demonstrate specific activation and cytokine release when stimulated by LILRB2+ leukemia cells, e.g., THP-l.
- LILRB2+ leukemia cells e.g., THP-l.
- Anti-LILRB2-CAR-T short form vector (upper panel): Anti-LILRB2 CAR-T cells displayed activation specificity to target LILRB2 proteins.
- the anti-LILRB2 CAR-T cells were co-cultured with LILRB2-expressing THP1 cells or parental THP1 cells for 24 hours at target: effector ranging from 1 : 1 to 1 : 10.
- CAR-T cell activation was determined by detection of 41BB expression using flow cytometry. T cells without transduction were used as control.
- Anti-LILRB2 CAR-T cells displayed cytokine release specificity to target LILRB2 proteins. Supernatant was collected after 24-hour co-culture of anti-LILRB2 CAR-T cells with LILRB2-expressing THP1 cells or parental THP1 cells at target: effector ranging from 1: 1 to 1 : 10. Cytokine release was assayed for interferon g (IKNg) by ELISA. T cells without transduction were used as control.
- IKNg interferon g
- FIG. 25 Anti-LILRB2 CAR-T cells demonstrate specific activation and cytokine release when stimulated by LILRB2+ leukemia cells.
- Anti-LILRB2-CAR-T long form vector (upper panel): Anti-LILRB2 CAR-T cells displayed activation specificity to target LILRB2 proteins. The anti-LILRB2 CAR-T cells were co cultured with LILRB2-expressing THP1 cells or parental THP1 cells for 24 hours at target: effector ranging from 1 : 1 to 1: 10. CAR-T cell activation was determined by detection of 41BB expression using flow cytometry. T cells without transduction were used as control.
- Anti-LILRB2 CAR-T cells displayed cytokine release specificity to target LILRB2 proteins. Supernatant was collected after 24-hour co culture of anti-LILRB2 CAR-T cells with LILRB2-expressing THP1 cells or parental THP1 cells at target: effector ranging from 1 : 1 to 1 : 10. Cytokine release was assayed for interferon g (IKNg) by ELISA. T cells without transduction were used as control.
- IKNg interferon g
- FIG. 26 Anti-LILRB2 CAR-T cells demonstrate binding specificity to target LILRB2.
- Anti-LILRB2 CAR-T cells both short (upper panel) and long (lower panel) form, were co-cultured with LILRB2-expressing THP1 cells, LILRB3-expressinh THP1 cells or parental THP1 cells for 24 hours.
- CAR-T cell activation was determined by detection of 41BB expression using flow cytometry. T cells without transduction were used as control.
- FIG. 27 Anti-LILRB2 CAR-T cells demonstrate binding specificity to target LILRB2 protein in HT29 colon cancer cells.
- Anti-LILRB2 CAR-T cells were co cultured with LILRB2-, LILRB3-expressing HT29 cells or HT29 control cells for 24 hours.
- CAR-T cell activation was determined by detection of activation markers on 41BB expression using flow cytometry.
- CAR-T cells stimulated with OKT3 were used as positive control for CAR-T cell activation. T cells without transduction were used as control.
- FIG. 28 Anti-LILRB2 CAR-T cells display efficient cytotoxicity against LILRB2- expressing leukemia cells in vitro.
- LILRB2-expressing leukemia cells B2- THP1
- B2- THP1 LILRB2-expressing leukemia cells
- Supernatant was collected after 7 hours co-culture and cytotoxicity was determined by detection of LDH release.
- FIG. 29 Experimental design for demonstration the efficacy of the anti- LILRB2 CAR-T cells in the THP1-LILRB2 xenograft mouse model.
- NSG-SGM3 mice were injected with LILRB2-expressing THP1 cells on day 0, and treated with untransduced T cells (control) or anti-LILRB2 CAR-T cells on day 8, 15, 22 and 30. Bioluminescent images were taken weekly.
- FIGs. 30-33 Anti-LILRB2 CAR-T cells reduced leukemia burden in the THP1-LILRB2 xenograft mouse model.
- NSG-SGM3 mice were injected with LILRB2-expressing THP1 cells on day 0, and treated with untransduced T cells (control) or anti-LILRB2 CAR-T cells on day 8, 15, 22 and 30.
- Bioluminescent images (BLI) were taken weekly.
- FIG. 30 Weekly BLI of mice treated with untransduced T cells (left) or anti- LILRB2- CAR-T cells (right) were taken from the back of mice.
- FIG. 31 Weekly BLI of mice treated with untransduced T cells (left) or anti- LILRB2- CAR-T cells (right) were taken from the abdomen were showed.
- FIG. 32 Each shape represents an individual mouse in the treatment group. Plot of total flux (p/s) as a function of time demonstrated that anti-LILRB2 CAR-T cells (right) decrease leukemia burden as compared to the control T cell-treated (left) mice.
- FIG. 33 The quantification results of leukemia burden were showed in total flux (left panel) and average radiance (right panel). Mice treated with anti-LILRB2 CAR-T cells showed decrease of the tumor burden compared to the untransduced T cell-treated mice.
- FIG. 34 Anti-LILRB4 CAR-T cells demonstrated cytotoxicity against LILRB4 protein expressing human AML cells.
- FIGs. 35A - 35B Antagonistic anti-LILRB2 abrogates MDSC-mediated inhibition of CAR-T T cell proliferation.
- FIG. 35A Anti-LILRB2 overcame MDSC- mediated inhibition of AML killing by LILRB4 CAR-T.
- LILRB4 CAR-T cells were co-cultured with MDSC and AML cells, THP-l, which express LILRB4, in the presence of an anti-LILRB2 antibody or control immunoglobulin for three days. The residual THP-l and MDSC cells were identified by staining of CD33 and CD 14 markers.
- Anti-LILRB2 enhanced the LILRB4 CAR-T mediated THP-l killing as compared with control immunoglobulin.
- FIG. 35A Anti-LILRB2 overcame MDSC- mediated inhibition of AML killing by LILRB4 CAR-T.
- LILRB4 CAR-T cells were co-cultured with MDSC and AML cells, THP-l, which express LIL
- 35B Anti-LILRB2 overcame MDSC- mediated suppression of CAR-T proliferation.
- CFSE-labeled Her2 CAR-T cells were stimulated with Her2+ SCC-47 tumor cells for 3 days in the presence of MDSCs and anti-LILRB2.
- the proliferation of CD4 and CD8 T cells were assessed using CFSE dilution by flow cytometry.
- the ratio of CAR-T cells, tumor cells, and MDSCs was 10: 1 :5.
- This disclosure features antibodies and antigen-binding fragments that specifically bind LILRB2.
- the disclosure also provides polynucleotides encoding the antibodies and antigen-binding fragments thereof described herein.
- this disclosure relates to methods of using the anti-LILRB2 antibodies and antigen-binding fragments thereof in the treatment of cancer or stimulating a pro-inflammatory immune response.
- the disclosure also relates to related chimeric antigen receptors (CARs) and cells comprising same (e.g., T cells, natural killer cells, or macrophages), and uses of the CARs and cells in targeting tumors and killing them, asthma treatment, or in targeting and removing infected cells (e.g., to treat infections or infectious diseases), or in suppressing immune system cells, as involved in autoimmune disease or transplant rejection.
- CARs chimeric antigen receptors
- antibody means an immunoglobulin molecule that recognizes and specifically binds to a target, such as a protein (e.g., the LILRB2, a subunit thereof, or the receptor complex), polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule.
- a typical antibody comprises at least two heavy (HC) chains and two light (LC) chains interconnected by disulfide bonds. Each heavy chain is comprised of a“heavy chain variable region” or“heavy chain variable domain” (abbreviated herein as VH) and a heavy chain constant region.
- the heavy chain constant region is comprised of three domains, CH1, CH2, and CH3.
- Each light chain is comprised of a“light chain variable region” or“light chain variable domain” (abbreviated herein as VL) and a light chain constant region.
- the light chain constant region is comprised of one domain, Cl.
- the VH and VL regions can be further subdivided into regions of hypervariablity, termed Complementarity Determining Regions (CDR), interspersed with regions that are more conserved, termed framework regions (FRs).
- CDR Complementarity Determining Regions
- FRs framework regions
- Each VH and VL region is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the term “antibody” encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, Fd, Facb, and Fv fragments), single chain Fv (scFv), minibodies (e.g., sc(Fv)2, diabody), multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as the antibodies exhibit the desired biological activity.
- the term “antibody” includes whole antibodies and any antigen-binding fragment or single chains thereof. Antibodies can be naked or conjugated to other molecules such as toxins, radioisotopes, small molecule drugs, polypeptides, etc.
- isolated antibody refers to an antibody that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
- the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and including more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
- Bispecific antibodies are described, e.g., in US Patent No. 5,932,448, incorporated by reference, disclosing making of bispecific antibodies with Fab’ portions joined by a leucine zipper; US Patent No. 7,538,196, incorporated by reference, disclosing making of bispecific antibodies where portions are joined with a linker; and US Patent No. 8,148,496, incorporated by reference, disclosing a multivalent a multi-valent Fv antibody construct having at least four variable domains which are linked with each other via peptide linkers.
- humanized immunoglobulin refers to an immunoglobulin comprising a human framework region and one or more CDR's from a non-human (usually a mouse or rat) immunoglobulin.
- the non-human immunoglobulin providing the CDR's is called the “donor” and the human immunoglobulin providing the framework is called the“acceptor”.
- Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e., at least about 85-90%, preferably about 95% or more identical.
- all parts of a humanized immunoglobulin, except possibly the CDR's are substantially identical to corresponding parts of natural human immunoglobulin sequences.
- A“humanized antibody” is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin.
- a humanized antibody would not encompass a typical chimeric antibody as defined above, e.g., because the entire variable region of a chimeric antibody is non-human. See, e.g., US Pat Nos. 5585089; 5225539 (incorporated by reference).
- antibody fragment refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. It is known in the art that the antigen binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antigen-binding antibody fragments include, but are not limited to Fab, Fab', F(ab')2, Facb, Fd, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments. In some instances, antibody fragments may be prepared by proteolytic digestion of intact or whole antibodies. For example, antibody fragments can be obtained by treating the whole antibody with an enzyme such as papain, pepsin, or plasmin. Papain digestion of whole antibodies produces F(ab)2 or Fab fragments; pepsin digestion of whole antibodies yields F(ab')2 or Fab'; and plasmin digestion of whole antibodies yields Facb fragments.
- Fab refers to an antibody fragment that is essentially equivalent to that obtained by digestion of immunoglobulin (typically IgG) with the enzyme papain.
- the heavy chain segment of the Fab fragment is the Fd piece.
- Such fragments can be enzymatically or chemically produced by fragmentation of an intact antibody, recombinantly produced from a gene encoding the partial antibody sequence, or it can be wholly or partially synthetically produced.
- F(ab')2 refers to an antibody fragment that is essentially equivalent to a fragment obtained by digestion of an immunoglobulin (typically IgG) with the enzyme pepsin at pH 4.0-4.5.
- fragments can be enzymatically or chemically produced by fragmentation of an intact antibody, recombinantly produced from a gene encoding the partial antibody sequence, or it can be wholly or partially synthetically produced.
- Fv refers to an antibody fragment that consists of one NH and one N domain held together by noncovalent interactions.
- scFv or “scFv molecule” includes binding molecules which consist of one light chain variable domain (VL) or a portion thereof, and one heavy chain variable domain (VH) or a portion thereof, wherein each variable domain (or a portion thereof) is derived from the same or different antibodies.
- Single chain Fv molecules preferably comprise an scFv linker interposed between the VH domain and the VL domain.
- Exemplary scFv molecules are known in the art and are described, for example, in US Patent No.
- scFv linker refers to a moiety interposed between the VL and VH domains of the scFv.
- the scFv linkers preferably maintain the scFv molecule in an antigen-binding conformation.
- a scFv linker comprises or consists of an scFv linker peptide.
- an scFv linker peptide comprises or consists of a Gly-Ser peptide linker.
- an scFv linker comprises a disulfide bond.
- LILRB2 antibody refers to an antibody that is capable of specifically binding to the LILRB2 with sufficient affinity such that the antibody is useful as a therapeutic agent or diagnostic reagent in targeting LILRB2.
- an anti-LILRB2 antibody disclosed herein to an unrelated, non-LILRB2 protein is less than about 10% of the binding of the antibody to LILRB2 as measured, e.g., by a radioimmunoassay (RIA), BIACORETM (using recombinant LILRB2 as the analyte and antibody as the ligand, or vice versa), or other binding assays known in the art.
- an antibody that binds to LILRB2 has a dissociation constant (KD) of ⁇ 1 mM, ⁇ 100 nM, ⁇ 50 nM, ⁇ 10 nM, or ⁇ 1 nM.
- % identical between two polypeptide (or polynucleotide) sequences refers to the number of identical matched positions shared by the sequences over a comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences.
- a matched position is any position where an identical nucleotide or amino acid is presented in both the target and reference sequence. Gaps presented in the target sequence are not counted since gaps are not nucleotides or amino acids. Likewise, gaps presented in the reference sequence are not counted since target sequence nucleotides or amino acids are counted, not nucleotides or amino acids from the reference sequence.
- the percentage of sequence identity is calculated by determining the number of positions at which the identical amino acid residue or nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
- the comparison of sequences and determination of percent sequence identity between two sequences can be accomplished using readily available software both for online use and for download. Suitable software programs are available from various sources, and for alignment of both protein and nucleotide sequences.
- One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S.
- Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
- BLASTN is used to compare nucleic acid sequences
- BLASTP is used to compare amino acid sequences.
- Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk/Tools/psa.
- the percentage identity“X” of a first amino acid sequence to a second sequence amino acid is calculated as 100 x (Y/Z), where Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.
- Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program)
- Z is the total number of residues in the second sequence.
- ClustalW2 One suitable program to generate multiple sequence alignments is ClustalW2, available from www.clustal.org (ClustalX is a version of the ClustalW2 program ported to the Windows environment).
- Another suitable program is MUSCLE, available from www.drive5.com/muscle.
- ClustalW2 and MUSCLE are alternatively available, e.g., from the EBI.
- therapeutic agent refers to any biological or chemical agent used in the treatment of a disease or disorder.
- Therapeutic agents include any suitable biologically active chemical compounds, biologically derived components such as cells, peptides, antibodies, CARs (and cells comprising CARs), and polynucleotides, and radiochemical therapeutic agents such as radioisotopes.
- the therapeutic agent comprises a chemotherapeutic agent or an analgesic.
- the prevention may be complete, e.g., the total absence of tissue damage in a subject.
- the prevention may also be partial, such that the occurrence of tissue damage in a subject is less than that which would have occurred without the therapeutic agent.
- prevention shall refer to a decrease in the occurrence of a disease or decrease in the risk of acquiring a disease or its associated symptoms in a subject.
- the prevention may be complete, e.g., the total absence of disease or pathological cells in a subject.
- the prevention may also be partial, such that the occurrence of the disease or pathological cells in a subject is less than that which would have occurred without the present invention.
- LILRB2 leukocyte immunoglobulin (Ig)-like receptor B2
- a mammalian (e.g., human) LILRB2 protein or mRNA or a LILRB2 protein or mRNA derived from a mammalian (e.g., human) LILRB2 protein or mRNA.
- LILRB2 proteins and mRNA are described herein. Additional examples of LILRB2 proteins and mRNA are known in the art.
- amino acid sequence of a human LILRB2 are provided below: (NP_00l265333.2)
- LILRB2 agonist an agent that specifically binds to LILRB2 protein and activates LILRB2 signaling pathways in a mammalian cell.
- Non-limiting examples of LILRB2 agonists are described herein.
- Examples of LILRB2 signaling pathways are described in the WO2013/181438 and US. Publication No. US 2050174203, each of which is incorporated herein in its entirety.
- LILRB2 antagonist an agent that specifically binds to LILRB2 protein and decreases the activity, activation or function of the LILRB2 signaling pathways in a mammalian cell.
- Non-limiting examples of LILRB2 antagonist are described herein.
- the antibodies of this disclosure can comprise CDRs according to any CDR definition (e.g., Kabat, Chothia, enhanced Chothia, contact, IMGT, AbM).
- the CDRs of an antibody according to the different CDR definitions can be determined, e.g., by using the AbYsis database (ABySS: a parallel assembler for short read sequence data. Simpson JT et al. Genome Res. (2009)).
- these antibodies or antigen-binding fragments thereof have at least one, at least two, at least three, at least four, at least five, or all six of the CDRs of as disclosed in Tables 1 and 2 (wherein the CDRs can be according to any CDR definition).
- the antibody or antigen-binding fragment thereof comprises a VH comprising a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:225, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:230, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:244; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:202, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l6.
- the antibody or antigen-binding fragment thereof comprises a VH comprising a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 89, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising SEQ ID NO:50.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:90, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 121, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 159; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:2, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:5l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:9l, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 122, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 160; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:92, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:37, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:53.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:92, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 124, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:53.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:93, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 125, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 162; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:93, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 122, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 160; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:95, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 127, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 164; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:96, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 128, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 165; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:6, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:40, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:55.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 122, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 166; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:56.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:97, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:57.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:90, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 121, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 167; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:97, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:57.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:98, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 8, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:58.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:99, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 129, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:50.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 100, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:258, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 168; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:9, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:42, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:59.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:97, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:57.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 131, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 169; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 10, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:43, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:60.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:97, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:57.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:77, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 170; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 11, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:44, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:6l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 101, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 132, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: l7l; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 12, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:49, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:62.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 101, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 132, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 171; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 15, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:49, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:65.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 104, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 136, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:50.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 105, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 137, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 177; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 16, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:45, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:68.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 107, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 138, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 178; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 18, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:69.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 139, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 179; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:20, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:39, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:7l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 175; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:67.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 108, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 140, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 180; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:2l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:45, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:72.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 141, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 181; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:22, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:73.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 142, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 182; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:23, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:46, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:74.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 109, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 143, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 183; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:42, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:75.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 110, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 144, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 173; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:25, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:259.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 145, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 185; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:23, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:47, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:76.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 111, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 111, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 186; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:26, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:l30.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 175; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:42, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:78.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 111, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 147, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 187; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:27, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:48, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:79.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:95, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 127, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 164; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:28, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:45, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:8l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 89, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:50.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 106, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:50.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:99, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:50.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:99, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:50.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 111, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 147, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 187; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 12, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:49, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:82.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 113, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 148, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 189; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:29, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:42, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:59.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 114, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 149, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 190; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:6, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:40, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:55.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 115, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 150, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 191; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:6, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:40, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:55.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 108, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 151, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 180; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:30, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:45, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:83.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 116, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 152, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 192; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:39, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:7l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:93, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 125, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 160; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:32, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:84.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:77, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 170; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 117, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 153, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 167; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:33, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:97, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:57.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:92, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:57.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:97, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 154, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:38, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:57.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 89, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 158; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:25, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:85.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 118, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 155, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 193; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:25, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:85.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:93, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:77, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 194; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:44, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:86.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 156, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 195; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:34, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:39, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:87.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 111, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 157, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 196; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:23, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:260, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:88.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 109, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 143, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:245; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:42, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:203.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:224, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 120, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:246; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:35, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:204.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 139, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:247; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:7, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:205.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:2l7, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 157, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:233; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:25, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:206.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:2l8, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:23l, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:234; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:207.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:2l9, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:232, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:235; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 197, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:39, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:208.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:220, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 122, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:236; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 87, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:20l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:209.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:226, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:237; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:6, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:40, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2lO.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:22l, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:227, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:238; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:28, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:45, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:77, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:239; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 11, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:44, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l2.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 103, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 135, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:24l; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:7, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l4.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 101, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 132, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:242; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 199, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:206.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:223, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:229, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:243; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID N0:200, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l5.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:252, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:254, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:257; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 12, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:249, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:25l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:256, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 169; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:248, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:39, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:7l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 111, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 131, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 169; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3l, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:39, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:7l.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 172; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:63.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 133, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 175; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:67.
- the antibody or antigen-binding fragment thereof comprises a VH comprising a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 134, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 173; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:202, and a LCDR3 comprising SEQ ID NO:64.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 102, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 134, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 173; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 14, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:64.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 126, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 163; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:5, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:39, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:54.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 103, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 135, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 174; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:7, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:66.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:94, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 142, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 184; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:23, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:46, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:74.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:222, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:228, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:240; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 13, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l3.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 114, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:255, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 146; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:27, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:48, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:250.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 112, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:258, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 188; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 12, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:49, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:80.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:377, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 125, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:378; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:3, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:36, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:52.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:363, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:364, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:365; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 176, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:253, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:362.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 101, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 132, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: l7l; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:374, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:375, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:376.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:267, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 138, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 174; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:7, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:l l9.
- the antibody or antigen-binding fragment thereof comprises a VH comprising: a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 18, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:4l, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:69; and a VL comprising: a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 107, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 138, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: l78.
- the VH and or VL region of the anti-LILRB2 antibodies or antigen-binding fragments thereof described herein can be linked to a constant region (e.g., a wild- type human Fc region or an Fc region that includes one or more alterations).
- the antibody has a light chain constant region derived from a human kappa sequence.
- the antibody has a light chain constant region derived from a human lambda sequence.
- the light chain constant region comprises a human subgroup kappa 1 sequence.
- the antibody has an isotype selected from the group consisting of IgGl, IgG2, IgG3, and IgG4 (e.g., a human IgGl, human IgG2, human IgG3, or human IgG4 isotype).
- the antibody has a human IgGl isotype.
- the antibody has a human IgGl isotype and a human kappa light chain constant region.
- the antibody has a human IgG2 isotype.
- the antibody has a human IgG2 isotype and a human kappa light chain constant region.
- the heavy chain constant region can be a wild- type human Fc region, or a human Fc region that includes one or more amino acid substitutions.
- the antibodies can have mutations that stabilize the disulfide bond between the two heavy chains of an immunoglobulin, such as mutations in the hinge region of IgG4, as disclosed in the art (e.g., Angal et al, Mol. Immunol, 30: 105-08 (1993)). See also, e.g., U.S. 2005/0037000.
- the heavy chain constant region can also have substitutions that modify the properties of the antibody (e.g., decrease one or more of: Fc receptor binding, antibody glycosylation, deamidation, binding to complement, or methionine oxidation).
- the antibodies may have mutations such as those described in U.S. Patent Nos. 5,624,821 and 5,648,260.
- the antibody is modified to reduce or eliminate effector function.
- the heavy chain constant region has one or more of the following mutations: S228P; N297Q; and T299A (numbering according to Kabat).
- the heavy chain constant region can be chimeric, e.g., the Fc region can comprise the CHI and CH2 domains of an IgG antibody of the IgG4 isotype, and the CH3 domain from an IgG antibody of the IgGl isotype (see, e.g., U.S. Patent Appl. No.
- the humanized anti-LILRB2 antibodies described herein have a chimeric constant region comprising the CHI and CH2 domains of an IgG antibody of the IgG4 isotype, and the CH3 domain from an IgG antibody of the IgGl isotype and further contain the S228P and N297Q mutations (numbering according to Kabat).
- the anti-LILRB2 antibody or antigen-binding molecule thereof comprises or consists of (i) a single chain Fv (“scFv”); (h) a diabody; (iii) an sc(Fv)2; (iv) a polypeptide chain of an antibody; (v) F(ab')2; or (vi) F(ab).
- the antigen-binding fragment is an Fab molecule.
- the fragment antigen-binding (Fab fragment) is a region on an antibody that binds to antigens. It is composed of one constant and one variable domain of each of the heavy and the light chain.
- the antigen binding site shape the paratope, i.e., the antigen binding site.
- the enzyme papain can be used to cleave an immunoglobulin monomer into two Fab fragments and an Fc fragment. Recombinant methods can also be used to make an Fab molecule.
- the antigen-binding fragment is a single-chain fragment variable (scFv).
- An scFv is comprised of the variable regions of the heavy and light chains of an antibody. It is only half the size of the Fab fragment and yet retains the original specificity of the parent immunoglobulin. Methods of making an ScFv are well known in the art (see, e.g., Ahmad et al, Clinical and Developmental Immunology, vol. 2012, Article ID 980250, 15 pages, 2012. doi: 10.1 155/2012/980250).
- the anti-LILRB2antibody or antigen-binding molecule thereof can be a targeting moiety.
- targeting moieties are useful in ferrying an agent of interest (e.g., a therapeutic agent, a small molecule drug) to a cell.
- the present disclosure also provides“chimeric molecules” comprising, for example, at least one of the LILRB2 antibodies or antigen-binding fragments thereof disclosed herein that is linked and/or conjugated and/or otherwise associated with at least one heterologous moiety.
- the heterologous moiety is an agent that to be ferried or delivered to a cell or its local environment.
- an agent can be e.g., a therapeutic agent such as a chemotherapeutic agent.
- a chimeric molecule disclosed herein encompasses any molecule comprising (i) a LILRB2 antibody or antigen-binding molecule thereof disclosed herein (e.g., an Fab or scFv), and (ii) at least one (e.g., one two, three, four) heterologous moiety (e.g., a therapeutic moiety, a chemotherapeutic agent, a half-life extending moiety) and optionally including one or more linkers.
- a chimeric molecule is a chimeric protein, i.e., a chimeric molecule in which all its components (heterologous moieties and/or linkers) are polypeptides.
- chimeric molecules can comprise non-polypeptide heterologous moieties (e.g., PEG, lipids, carbohydrates, nucleic acids, small molecule therapeutic agents, radionuclides, fluorescent probes, etc.) and/or non-polypeptide linkers.
- non-polypeptide heterologous moieties e.g., PEG, lipids, carbohydrates, nucleic acids, small molecule therapeutic agents, radionuclides, fluorescent probes, etc.
- a chimeric molecule comprises a first amino acid sequence derived from a first source, bonded, covalently or non-covalently, to a second amino acid sequence derived from a second source, wherein the first and second source are not the same.
- a first source and a second source that are not the same can include two different biological entities, or two different proteins from the same biological entity, or a biological entity and a non-biological entity.
- a chimeric molecule can include for example, a protein derived from at least two different biological sources.
- a biological source can include any non-synthetically produced nucleic acid or amino acid sequence (e.g., a genomic or cDNA sequence, a plasmid or viral vector, a native virion or a mutant or analog, as further described herein, of any of the above).
- a synthetic source can include a protein or nucleic acid sequence produced chemically and not by a biological system (e.g., solid phase synthesis of amino acid sequences).
- a chimeric molecule can also include a protein derived from at least 2 different synthetic sources or a protein derived from at least one biological source and at least one synthetic source.
- a chimeric molecule can also comprise a first amino acid sequence derived from a first source, covalently or non-covalently linked to a nucleic acid, derived from any source or a small organic or inorganic molecule derived from any source.
- the chimeric molecule can also comprise a linker molecule between the first and second amino acid sequence or between the first amino acid sequence and the nucleic acid, or between the first amino acid sequence and the small organic or inorganic molecule.
- heterologous moiety or moieties of the chimeric molecules disclosed herein can comprise, consist of, or consist essentially of, for example, prophylactic and/or therapeutic agents (e.g., chemotherapeutic agent or analgesic), molecules capable of improving a pharmacokinetic (PK) property (e.g., plasma half-life extending moieties), and detectable moieties (e.g., fluorescent molecules or radionuclides).
- the heterologous moiety comprises a clotting factor (e.g., a Factor VII).
- a heterologous moiety comprises a molecule that can modify a physicochemical property of a chimeric molecule lacking such heterologous moiety.
- the incorporation of a heterologous moiety into a chimeric molecule can improve one or more pharmacokinetic properties without significantly affecting its biological activity or function.
- a heterologous moiety increases stability of the chimeric molecule of the invention or a fragment thereof.
- the heterologous moiety is a polypeptide comprising, consisting essentially of, or consisting of at least about 10, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, or 4000 amino acids.
- the heterologous moiety is a polypeptide comprising, consisting essentially of, or consisting of about 100 to about 200 amino acids, about 200 to about 300 amino acids, about 300 to about 400 amino acids, about 400 to about 500 amino acids, about 500 to about 600 amino acids, about 600 to about 700 amino acids, about 700 to about 800 amino acids, about 800 to about 900 amino acids, or about 900 to about 1000 amino acids.
- the chimeric molecule comprises at least one heterologous moiety that is a “half-life extending moiety.”
- Half-life extending moieties can comprise, for example, (i) XTEN polypeptides; (ii) Fc; (iii) albumin, (iv) albumin binding polypeptide or fatty acid, (v) the C-terminal peptide (CTP) of the b subunit of human chorionic gonadotropin, (vi) PAS; (vii) HAP; (viii) transferrin; (ix) polyethylene glycol (PEG); (x) hydroxyethyl starch (HES), (xi) polysiabc acids (PSAs); (xii) a clearance receptor or fragment thereof which blocks binding of the chimeric molecule to a clearance receptor; (xiii) low complexity peptides; (xiv) vWF; or (xv) any combinations thereof.
- the half-life extending moiety comprises an Fc region. In other embodiments, the half-life extending moiety comprises two Fc regions fused by a linker.
- Exemplary heterologous moieties also include, e.g., FcRn binding moieties (e.g., complete Fc regions or portions thereof which bind to FcRn), single chain Fc regions (scFc regions, e.g., as described in U.S. Publ. No. 2008-0260738, and Intl. Publ. Nos. WO 2008-012543 and WO 2008- 1439545), or processable scFc regions.
- a heterologous moiety can include an atachment site for a non-polypeptide moiety such as polyethylene glycol (PEG), hydroxyethyl starch (HES), polysiabc acid, or any derivatives, variants, or combinations of these moieties.
- PEG polyethylene glycol
- HES hydroxyethyl starch
- polysiabc acid polysiabc acid
- a chimeric molecule of the disclosure comprises at least one (e.g., one, two, three, or four) half-like extending moiety which increases the in vivo half-life of the chimeric molecule compared with the in vivo half-life of the corresponding chimeric molecule lacking such heterologous moiety.
- In vivo half-life of a chimeric molecule can be determined by any method known to those of skill in the art, e.g., activity assays (chromogenic assay or one stage cloting aPTT assay), ELISA, etc.
- the presence of one or more half-life extending moiety results in the half-life of the chimeric molecule to be increased compared to the half-life of the corresponding chimeric molecule lacking such one or more half- life extending moieties.
- the half-life of the chimeric molecule comprising a half-life extending moiety is at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 1 1 times, or at least about 12 times longer than the in vivo half-life of the corresponding chimeric molecule lacking such half-life extending moiety.
- the half-life of the chimeric molecule comprising a half- life extending moiety is about 1.5 -fold to about 20-fold, about 1.5 fold to about 15 fold, or about 1.5 fold to about 10 fold longer than the in vivo half-life of the corresponding chimeric molecule lacking such half-life extending moiety.
- the half-life of chimeric molecule comprising a half-life extending moiety is extended about 2-fold to about 10-fold, about 2-fold to about 9-fold, about 2 -fold to about 8-fold, about 2-fold to about 7-fold, about 2-fold to about 6-fold, about 2 -fold to about 5-fold, about 2-fold to about 4-fold, about 2-fold to about 3-fold, about 2.5-fold to about lO-fold, about 2.5-fold to about 9-fold, about 2.5-fold to about 8- fold, about 2.5-fold to about 7-fold, about 2.5-fold to about 6-fold, about 2.5-fold to about 5-fold, about 2.5-fold to about 4-fold, about 2.5-fold to about 3-fold, about 3 - fold to about lO-fold, about 3 -fold to about 9-fold, about 3 -fold to about 8-fold, about 3 -fold to about 7-fold, about 3 -fold to about 6-fold, about 3 -fold to about 5 -fold, about 3-fold to about 4-fold, about 4-fold, about 4-
- the LILRB2 binding properties of the antibodies described herein may be measured by any standard method, e.g., one or more of the following methods: OCTET®, Surface Plasmon Resonance (SPR), BIACORETM analysis, Enzyme Linked Immunosorbent Assay (ELISA), EIA (enzyme immunoassay), RIA (radioimmunoassay), and Fluorescence Resonance Energy Transfer (FRET).
- OCTET® Surface Plasmon Resonance
- SPR Surface Plasmon Resonance
- BIACORETM analysis Enzyme Linked Immunosorbent Assay
- EIA Enzyme immunoassay
- RIA radioimmunoassay
- FRET Fluorescence Resonance Energy Transfer
- the binding interaction of a protein of interest can be analyzed using the OCTET® systems.
- OCTET® QKe and QK are used to determine protein interactions, binding specificity, and epitope mapping.
- the OCTET® systems provide an easy way to monitor real-time binding by measuring the changes in polarized light that travels down a custom tip and then back to a sensor.
- SPR Surface Plasmon Resonance
- BIA Biomolecular Interaction Analysis
- Epitopes can also be directly mapped by assessing the ability of different anti- LILRB2 antibody or functional fragment thereof to compete with each other for binding to human LILRB2 using BIACORE chromatographic techniques (Pharmacia BIAtechnology Handbook,“Epitope Mapping”, Section 6.3.2, (May 1994); see also Johne et al. (1993) J. Immunol. Methods, 160: 191-198).
- an enzyme immunoassay When employing an enzyme immunoassay, a sample containing an antibody, for example, a culture supernatant of antibody-producing cells or a purified antibody is added to an antigen-coated plate. A secondary antibody labeled with an enzyme such as alkaline phosphatase is added, the plate is incubated, and after washing, an enzyme substrate such as p-nitrophenylphosphate is added, and the absorbance is measured to evaluate the antigen binding activity.
- an enzyme substrate such as p-nitrophenylphosphate
- the inventors performed the LPS-stimulated PBMC (top priority, majorly targeting to myeloid cells) and OKT3 -stimulated PBMC (majorly targeting to T cells) as pilot screening strategies.
- the antagonistic Abs can increase TNFa along with decreased/unchanged IL-10 secretion, meanwhile, increased/unchanged T cell proliferation (TNFa > 1.5 fold, IL-10 ⁇ 1.1 fold).
- agonistic Abs can increase IL-10 secretion together with decreased/unchanged TNFa secretion, meanwhile, decreased T cell proliferation (IL-10 > 1.2 fold, TNFa ⁇ 1.1 fold and T cell proliferation ⁇ 0.8 fold).
- the antagonists can decrease the M2 differentiation (downregulated CD 163, CD206, PD- Ll), increase HLA-DR and decrease human MDSC CD33+CD14+CD16+, in contrast, the agonists can counter-regulate or maintain above parameters. These assay provided very important parameters to decide the activity or compare the efficiency/potency of Ab candidates.
- chimeric antigen receptor comprising the VH and VL of an antibody described herein.
- the VH comprises a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:92, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 123, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 161;
- the VL comprises a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:37, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:53.
- the VH comprises a HCDR1 comprising the amino acid sequence set forth in SEQ ID NO:225, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NO:230, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NO:244; and the VL comprises a LCDR1 comprising the amino acid sequence set forth in SEQ ID NO:24, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NO:202, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NO:2l6.
- polynucleotide(s) encoding a CAR described herein are also provided herein.
- Also provided herein is a vector comprising a polynucleotide encoding a CAR described herein.
- a cell comprising a CAR described herein. Also provided herein is a cell comprising a polynucleotide encoding a CAR described herein. Also provided herein is a cell comprising a vector comprising a polynucleotide encoding a CAR described herein. In one embodiment, the cell is a T cell. In one embodiment, the cell is a natural killer cell. In one embodiment, the cell is a macrophage.
- a pharmaceutical composition comprising a CAR described herein and a suitable pharmaceutical carrier.
- a pharmaceutical composition comprising a cell comprising a CAR described herein and a suitable pharmaceutical carrier.
- a pharmaceutical composition comprising a cell comprising a polynucleotide encoding CAR described herein and a suitable pharmaceutical carrier.
- a pharmaceutical composition comprising a cell comprising a vector comprising a polynucleotide encoding a CAR described herein and a suitable pharmaceutical carrier.
- Also provided herein is a method of producing a CAR described herein, comprising (a) culturing a cell described hereis (e.g., a cell comprising a polynucleotide encoding a CAR described herein or a cell comprising a vector comprising a polynucleotide encoding a CAR) and (b) isolating the CAR.
- a cell described hereis e.g., a cell comprising a polynucleotide encoding a CAR described herein or a cell comprising a vector comprising a polynucleotide encoding a CAR
- MDSCs have recently been recognized as one of the central regulators of the immune system.
- MDSCs represent a heterogeneous population of cells of myeloid origin that include myeloid progenitors, immature macrophages, immature granulocytes, and immature dendritic cells.
- MDSCs differentiate and polarize into Grl + CDl lb + CDl l5 + Ly6C + monocytic (M)-cells and Grl + CDl lb + Ly6G + granulocytic (G)-cells in mice (Gabrilovich et al, Cancer Res. 67:425, 2007; Huang et al, Cancer Res.
- Human MDSCs are characterized as CDl lb + CDl4 Low CD33 + or Lin HLA DR Lo " CD33 1 myeloid cells (Ostrand-Rosenberg et al, J. Immunol. 182:4499-4506, 2009; Raychaudhuri et al, Neurol. Oncol. 13:591 -599. 2011).
- MDSCs can be differentiated and polarized into Ml- and M2-cells (Ml-cells expressing iNOS, TNF-a, IFN-gR, MHC class I, and CCR7, and M2-cells expressing arginase, IL-10, CD36, CD206, and CCR2).
- Ml-cells expressing iNOS, TNF-a, IFN-gR, MHC class I, and CCR7
- Tumor- associated MDSCs exhibit predominantly M2-like phenotypes with pro-tumoral and immunosuppressive activities.
- M2-cells are phenotypically characterized by a number of enhanced signature markers such as IL-10, arginase, IL-10, Tie-2, CD36, CD206, IL-4R and CCR2 (Ma et al., Immunity 34:385-395, 2011).
- Ml-cells have an elevation in the expression of iNOS, NO, TNF-a, IFN-yR, MHC I, and CCR7 (Ma et al, Immunity 34:385-395, 2011).
- M2-cells up-regulate the expression of arginase, CCL2, CCL5 and MMP-9. In contrast, Ml-cells show elevated expression levels of TNF-a, Fas, and ICAM-l.
- MDSCs exert immune suppression through cross-communication with T-cells, NK cells, dendritic cells, macrophages, and other immune cells via multiple mechanisms.
- the details of how MDSC cross-talk with other immune cells are described in Bunt et al. (J Leukoc. Biol. 85:996-1004, 2009), Ostrand-Rosenberg et al. (Nat. Rev. Immunol. 12:253-268, 2012), and Sinha et al. (J. Immunol. 179:977-983, 2007).
- T-cells can induce effector T-cell (Teff) inactivation and apoptosis (see, e.g., Apolloni et al, J.
- T-cell suppression and Treg expansion by MDSC is cell contact-, MHC class II-, NO- and/or arginase-dependent.
- M2-cells possess an enhanced ability to suppress Teff activation and proliferation compared to their Ml-like counterparts in co-cultures of T-cells (Ma et al, Immunity 34:385-395, 2011).
- M2-cells accelerate tumor growth mainly by enhanced immune suppression involving an increase in arginase and immunosuppressive cytokines (see, e.g., Ma et al, Immunity 34:385-395, 2011).
- Ml- cells have increased direct tumor killing and promote the development of anti-tumoral immunity through the augmentation of free radicals, death ligand, and immunostimulating cytokines (see, e.g., Ma et al, Immunity 34:385-395, 2011).
- the balance of M1/M2 polarization may have a significant influence on disease and health.
- MDSCs can be isolated using fluorescence-assisted cell sorting using antibodies that recognize any of the specific protein markers of the different MDSC subsets described herein.
- Exemplary methods for preparing and isolating MDSCs are described in U.S. Patent Application Publication No. 2008/0305079 and WO 11/087795 (each of which is herein incorporated by reference).
- compositions further contain one or more mobilizing agents or are used in combination with one or more mobilizing agents.
- Mobilizing agents stimulate the release of MDSCs from the bone marrow of a mammal.
- mobilizing agents include, for example, granulocyte colony stimulating factor (G-CSF), cyclophosphamide, AMD3100, Fms- like tyrosine kinase 3 ligand (Flt3-L), GM-CSF, M-CSF, IL-34, TSLP-l, SCF, FK560, S100 A8, and S 100 A9.
- the disclosure provides a composition containing a mobilizing agent and at least one LILRB1, LILRB2, LILRB2, LILRB4, and/or LILRB5 agonist.
- a composition contains a mobilizing agent, at least one LILRB1, LILRB2, LILRB2, LILRB4, and/or LILRB5 agonist, and at least one JNK inhibitor.
- the disclosure provides a composition further containing a mobilizing agent and does not include MDSCs.
- compositions further contain at least one JNK inhibitor or are used in combination with at least one JNK inhibitor.
- JNK inhibitors include, for example, BI-78D3, SP600125, AEG 3482, JIP-1, SU 3327, TCS JNK 5a, and TCS JNK 6o.
- JNK inhibitors are described in WO 00/35906, WO 00/35909, WO 00/35921, WO 00/64872, WO 01/12609, WO 01/12621, WO 01/23378, WO 01/23379, WO 01/23382, WO 01/47920, WO 01/91749, WO 02/046170, WO 02/062792, WO 02/081475, WO 02/083648, and WO 03/024967, each of which are herein incorporated by reference.
- the composition can also contain one or more anti inflammatory agents or are used in combination with one or more anti-inflammatory agents.
- Anti-inflammatory agents include, for example, corticosteroids, non-steroidal anti-inflammatory drugs (NSAIDs, e.g., cyclooxygenase I (COX I) inhibitors and cyclooxygenase II (COX-II) inhibitors), immune selective anti-inflammatory derivatives (ImSAIDs), and biologies. Any of the exemplary anti-inflammatory agents described herein or known in the art can be included in the compositions described herein.
- Non-limiting examples of NSAIDs are salicylates (e.g., aspirin, diflusinal, and salsalate), propionic acid derivatives (e.g., ibuprofen, dexiboprofen, naproxen, fenoprofen, ketoprofen, dexketoprofen, flurbiprofen, oxaprozin, and loxoprofen), acetic acid derivatives (e.g., indomethacin, sulindac, etodolac, ketorolac, diclofenac, and nabumetone), enolic acid derivatives (e.g., piroxicam, meloxicam, tanoxicam, droxicam, lomoxicam, and isoxicam), fenamic acid derivatives (e.g., mefamic acid, meclofenamic acid, flufenamic acid, and tolfenamic acid), sulphonanil
- an NSAID is a COX-I inhibitor or a COX-II inhibitor.
- COX-I inhibitors include aspirin, ibuprofen, and naproxen.
- Non-limiting examples of COX-II inhibitors include celecoxib, valdecoxib, and rofecoxib.
- Non-limiting examples of ImSAIDs include FEG (Phe-Glu-Gly), its D-isomer feG, and SGP-T peptide.
- Non-limiting examples of corticosteroids include hydrocortisone, cortisone acetate, tixocortol pivalate, prednisolone, methylprednisolone, prednisone, triamcinolone acetonide, triamcinolone alcohol, mometasone, amcinonide, budesonide, desonide, fluocinolone, halcinonide, betamethasone, dexamethasone, and fluocortolone.
- Non-limiting examples of biologies include tocilizumab, certolizumab, etanercept, adalimumab, anakinra, abatacept, efalizumab, infliximab, rituximab, and golimumab.
- Immunosuppressive Agents include tocilizumab, certolizumab, etanercept, adalimumab, anakinra, abatacept, efalizumab, infliximab, rituximab, and golimumab.
- compositions described herein can also contain one or more immunosuppressive agents or can be used in combination with one or more immunosuppressive agents.
- immunosuppressive agents include mycophenolate, ciclosporin, cyclosporine, tacrolimus, sirolimus, and pimecrolimus. Additional immunosuppressive agents are known in the art.
- compositions further contain one or more chemotherapeutic agents or are used in combination with one or more chemotherapeutic agents.
- chemotherapeutic agents include alkylating agents (e.g., cyclophosphamide, mechlorethamine, chlorambucil, and melphalan), anthracy dines (e.g., daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, and valrubicin), taxanes (e.g., paxlitaxel and docetaxel), epothilones, histone deacetylase inhibitors (e.g., vorinostat and romidepsin), topoisomerase II inhibitors (e.g., etoposide, teniposide, and tafluposide), kinase inhibitors (e.g., bortezomib, erlotini
- alkylating agents
- the composition can further contain one or more analgesics or are used in combination with one or more analgesics.
- analgesics include opioid drugs (e.g., morphine, opium, codeine, oxycodone, hydrocodone, diamorphine, dihydromorphine, pethidine, buprenorphine, fentanyl, methadone, meperidine, pentazocine, dipipanone, and tramadol), acetaminophen, venlafaxine, flupirtine, nefopam, gabapentin, pregababn, orphenadrine, cyclobenzaprine, trazodone, clonidine, duloxetine and amitriptyline.
- opioid drugs e.g., morphine, opium, codeine, oxycodone, hydrocodone, diamorphine, dihydromorphine, pethidine, buprenorphine, fentanyl
- the composition can further contain one or more immune checkpoint inhibitor or are used in combination with one or more immune checkpoint inhibitor.
- immune checkpoint inhibitors include antagonists (e.g., antagonistic antibodies antibodies) of programmed cell death protein 1 (PD1), cytotoxic T-lymphocyte- associated antigen 4 (CTLA-4), B and T-lymphocyte attenuator (BTLA), killer cell immunoglobulin-like receptor (KIR), lymphocyte activation gene 3 (LAG3), T-cell membrane protein 3 (TIM3), CD 160, or adenosine A2a receptor (A2aR) and agonists (e.g., agonistic antibodies) of glucocorticoid-induced tumor necrosis factor receptor (GITR), Inducible T-cell costimulator (ICOS or CD278), 0X40 (CD 134), CD27, CD28, 4-1BB (
- GITR glucocorticoid-induced tumor necrosis factor receptor
- ICOS or CD278 Inducible T-cell cost
- the immune-checkpoint inhibitor is an antagonist of PD-l (e.g., an antagonistic antibody of PD-l). In specific embodiments, the immune-checkpoint inhibitor is an antagonist of PD-L1 (e.g., an antagonistic antibody of PD-L1).
- the anti-LILRB2 antibodies (or antigen binding domain of an antibody or functional fragment thereof) of this disclosure may be produced in bacterial or eukaryotic cells.
- a polynucleotide encoding the polypeptide is constructed, introduced into an expression vector, and then expressed in suitable host cells. Standard molecular biology techniques are used to prepare the recombinant expression vector, transfect the host cells, select for transformants, culture the host cells and recover the antibody.
- the expression vector should have characteristics that permit amplification of the vector in the bacterial cells. Additionally, when E. coli such as JM109, DH5a, HB101, or XL 1 -Blue is used as a host, the vector must have a promoter, for example, a lacZ promoter (Ward et al, 341 :544-546 (1989), araB promoter (Better et al, Science, 240: 1041-1043 (1988)), or T7 promoter that can allow efficient expression in E. coli.
- a promoter for example, a lacZ promoter (Ward et al, 341 :544-546 (1989), araB promoter (Better et al, Science, 240: 1041-1043 (1988)
- T7 promoter that can allow efficient expression in E. coli.
- Such vectors include, for example, Ml 3-series vectors, pUC-series vectors, pBR322, pBluescript, pCR-Script, pGEX-5X-l (Pharmacia),“QIAexpress system” (QIAGEN), pEGFP, and pET (when this expression vector is used, the host is preferably BL21 expressing T7 RNA polymerase).
- the expression vector may contain a signal sequence for antibody secretion.
- the pelB signal sequence Lei et al, J. Bacteriol, 169:4379 (1987)
- calcium chloride methods or electroporation methods may be used to introduce the expression vector into the bacterial cell.
- the expression vector includes a promoter necessary for expression in these cells, for example, an SV40 promoter (Mulligan et al, Nature, 277: 108 (1979)), MMLV-LTR promoter, EFla promoter (Mizushima et al, Nucleic Acids Res., 18:5322 (1990)), or CMV promoter.
- SV40 promoter Mulligan et al, Nature, 277: 108 (1979)
- MMLV-LTR promoter MMLV-LTR promoter
- EFla promoter EFla promoter
- CMV promoter CMV promoter
- the recombinant expression vectors may carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes.
- the selectable marker gene facilitates selection of host cells into which the vector has been introduced (see e.g., U.S. Pat. Nos. 4,399,216, 4,634,665 and 5,179,017).
- typically the selectable marker gene confers resistance to drugs, such as G418, hygromycin, or methotrexate, on a host cell into which the vector has been introduced.
- examples of vectors with selectable markers include pMAM, pDR2, pBK-RSV, pBK-CMV, pOPRSV, and rOR13.
- the antibodies are produced in mammalian cells.
- mammalian host cells for expressing a polypeptide include Chinese Hamster Ovary (CHO cells) (including dhfr- CHO cells, described in Urlaub and Chasin (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220, used with a DHFR selectable marker, e.g., as described in Kaufman and Sharp (1982) Mol. Biol.
- human embryonic kidney 293 cells e.g., 293, 293E, 293T
- COS cells e.g., NIH3T3 cells
- lymphocytic cell lines e.g., NS0 myeloma cells and SP2 cells
- a cell from a transgenic animal e.g., a transgenic mammal.
- the cell is a mammary epithelial cell.
- the antibodies of the present disclosure can be isolated from inside or outside (such as medium) of the host cell and purified as substantially pure and homogenous antibodies. Methods for isolation and purification commonly used for polypeptides may be used for the isolation and purification of antibodies described herein, and are not limited to any particular method. Antibodies may be isolated and purified by appropriately selecting and combining, for example, column chromatography, filtration, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectric focusing, dialysis, and recrystallization.
- Chromatography includes, for example, affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse-phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al, Cold Spring Harbor Laboratory Press, 1996). Chromatography can be carried out using liquid phase chromatography such as HPLC and FPLC. Columns used for affinity chromatography include protein A column and protein G column. Examples of columns using protein A column include Hyper D, POROS, and Sepharose FF (GE Healthcare Biosciences). The present disclosure also includes antibodies that are highly purified using these purification methods.
- the present disclosure also provides a nucleic acid molecule or a set of nucleic acid molecules encoding an anti-LILRB2 antibody or antigen binding molecule thereof disclosed herein.
- the invention includes a nucleic acid molecule encoding a polypeptide chain, which comprises a light chain of an anti- LILR3 antibody or antigen-binding molecule thereof as described herein.
- the invention includes a nucleic acid molecule encoding a polypeptide chain, which comprises a heavy chain of an anti-LILR3 antibody or antigen-binding molecule thereof as described herein.
- the instant disclosure also provides a method for producing a LILRB2 or antigen-binding molecule thereof or chimeric molecule disclosed herein, such method comprising culturing the host cell disclosed herein and recovering the antibody, antigen-binding molecule thereof, or the chimeric molecule from the culture medium.
- a variety of methods are available for recombinantly producing a LILRB2 antibody or antigen-binding molecule thereof disclosed herein, or a chimeric molecule disclosed herein. It will be understood that because of the degeneracy of the code, a variety of nucleic acid sequences will encode the amino acid sequence of the polypeptide.
- the desired polynucleotide can be produced by de novo solid-phase DNA synthesis or by PCR mutagenesis of an earlier prepared polynucleotide.
- a polynucleotide sequence encoding a polypeptide is inserted into an appropriate expression vehicle, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an RNA viral vector, the necessary elements for replication and translation.
- an appropriate expression vehicle i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an RNA viral vector, the necessary elements for replication and translation.
- the nucleic acid encoding the polypeptide (e.g., a LILRB2 antibody or antigen-binding molecule thereof disclosed herein, or any of the chimeric molecules disclosed herein) is inserted into the vector in proper reading frame.
- the expression vector is then transfected into a suitable target cell which will express the polypeptide. Transfection techniques known in the art include, but are not limited to, calcium phosphate precipitation (Wigler et al. 1978, Cell 14:725) and electroporation (Neumann et al. 1982, EMBO J. 1 :84l).
- eukaryotic cells can be utilized to express the polypeptides described herein (e.g., a LILRB2 antibody or antigen-binding molecule thereof disclosed herein, or any of the chimeric molecules disclosed herein) in eukaryotic cells.
- the eukaryotic cell is an animal cell, including mammalian cells (e.g., 293 cells, PerC6, CHO, BHK, Cos, HeLa cells).
- the DNA encoding the polypeptide can also code for a signal sequence that will permit the polypeptide to be secreted.
- a signal sequence that will permit the polypeptide to be secreted.
- the signal sequence is cleaved by the cell to form the mature chimeric molecule.
- Various signal sequences are known in the art and familiar to the skilled practitioner.
- the polypeptide e.g., a LILRB2 antibody or antigen binding molecule thereof disclosed herein, or any of the chimeric molecules disclosed herein
- the polypeptide can be recovered by lysing the cells.
- compositions comprising one or more of: (i) a LILRB2 antibody or antigen-binding molecule thereof disclosed herein;
- an anti-LILRB2 antibodies or fragments thereof described herein can be formulated as a pharmaceutical composition for administration to a subject, e.g., to treat a disorder described herein.
- a pharmaceutical composition includes a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
- the composition can include a pharmaceutically acceptable salt, e.g., an acid addition salt or a base addition salt (see e.g., Berge, S.M., et al. (1977) J. Pharm. Sci. 66: 1-19).
- compositions may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories.
- liquid solutions e.g., injectable and infusible solutions
- dispersions or suspensions tablets, pills, powders, liposomes and suppositories.
- the preferred form can depend on the intended mode of administration and therapeutic application.
- compositions for the agents described herein are in the form of injectable or infusible solutions.
- an antibody described herein is formulated with excipient materials, such as sodium citrate, sodium dibasic phosphate heptahydrate, sodium monobasic phosphate, Tween®-80, and a stabilizer. It can be provided, for example, in a buffered solution at a suitable concentration and can be stored at 2-8°C.
- the pH of the composition is between about 5.5 and 7.5 (e.g., 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4,
- the pharmaceutical compositions can also include agents that reduce aggregation of the antibody when formulated.
- aggregation reducing agents include one or more amino acids selected from the group consisting of methionine, arginine, lysine, aspartic acid, glycine, and glutamic acid. These amino acids may be added to the formulation to a concentration of about 0.5 mM to about 145 mM (e.g., 0.5 mM, 1 mM, 2 mM, 5 mM, 10 mM, 25 mM, 50 mM, 100 mM).
- the pharmaceutical compositions can also include a sugar (e.g., sucrose, trehalose, mannitol, sorbitol, or xylitol) and/or a tonicity modifier (e.g., sodium chloride, mannitol, or sorbitol) and/or a surfactant (e.g., polysorbate-20 or polysorbate-80).
- a sugar e.g., sucrose, trehalose, mannitol, sorbitol, or xylitol
- a tonicity modifier e.g., sodium chloride, mannitol, or sorbitol
- a surfactant e.g., polysorbate-20 or polysorbate-80.
- the composition can be formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable for stable storage at high concentration.
- Sterile injectable solutions can be prepared by incorporating an agent described herein in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating an agent described herein into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze drying that yield a powder of an agent described herein plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- the proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
- the antibodies may be prepared with a carrier that will protect the compound against rapid release, such as a controlled release formulation, including implants, and microencapsulated delivery systems.
- a controlled release formulation including implants, and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known. See, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York (1978).
- the pharmaceutical formulation comprises an antibody at a concentration of about 0.005 mg/mL to 500 mg/mL (e.g., 0.005mg/ml, O.Olmg/ml, 0.05mg/ml, O.lmg/ml, 0.5 mg/mL, 1 mg/mL, 5 mg/mL, 10 mg/mL, 25 mg/mL, 30 mg/mL, 35 mg/mL, 40 mg/mL, 45 mg/mL, 50 mg/mL, 55 mg/ mL, 60 mg/mL, 65 mg/mL, 70 mg/mL, 75 mg/mL, 80 mg/mL, 85 mg/mL, 90 mg/mL, 95 mg/mL, 100 mg/mL, 125 mg/mL, 150 mg/mL, 175 mg/mL, 200 mg/mL, 250 mg/mL, 300 mg/mL, 350 mg/mL, 400 mg/mL, 450 mg/mL, 500 mg/mL
- the antibody is formulated in sterile distilled water or phosphate buffered saline.
- the pH of the pharmaceutical formulation may be between 5.5 and 7.5 (e.g., 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2 6.3, 6.4 6.5, 6.6 6.7, 6.8, 6.9 7.0, 7.1, 7.3, 7.4, 7.5).
- a pharmaceutical composition may include a “therapeutically effective amount” of an agent described herein. Such effective amounts can be determined based on the effect of the administered agent, or the combinatorial effect of agents if more than one agent is used.
- a therapeutically effective amount of an agent may also vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the compound to elicit a desired response in the individual, e.g., amelioration of at least one disorder parameter or amelioration of at least one symptom of the disorder.
- a therapeutically effective amount is also one in which any toxic or detrimental effects of the composition are outweighed by the therapeutically beneficial effects.
- the antibodies or antigen-binding fragment thereof, or nucleic acids encoding same can be administered to a subject, e.g., a subject in need thereof, for example, a human or animal subject, by a variety of methods.
- the route of administration is one of: intravenous injection or parenteral, infusion (IV), subcutaneous injection (SC), intraperitoneally (IP), or intramuscular injection, intratumor (IT).
- IV infusion
- SC subcutaneous injection
- IP intraperitoneally
- IT intramuscular injection
- Other modes of parenteral administration can also be used.
- the route of administration of the antibodies of the invention is parenteral.
- parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration.
- the intravenous form of parenteral administration is preferred. While all these forms of administration are clearly contemplated as being within the scope of the invention, a form for administration would be a solution for injection, in particular for intravenous or intraarterial injection or drip.
- a suitable pharmaceutical composition for injection can comprise a buffer (e.g., acetate, phosphate or citrate buffer), a surfactant (e.g. polysorbate), optionally a stabilizer agent (e.g., human albumin), etc.
- a buffer e.g., acetate, phosphate or citrate buffer
- a surfactant e.g. polysorbate
- a stabilizer agent e.g., human albumin
- Preparations for parenteral administration include sterile aqueous or non- aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Pharmaceutically acceptable carriers include, but are not limited to, 0.01-0.1M and preferably 0.05M phosphate buffer or 0.8% saline.
- Intravenous vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose, and the like.
- Preservatives and other additives can also be present such as for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.
- compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and will preferably be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like.
- isotonic agents for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition.
- Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
- sterile injectable solutions can be prepared by incorporating an active compound (e.g., a polypeptide by itself or in combination with other active agents) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated herein, as required, followed by filtered sterilization.
- an active compound e.g., a polypeptide by itself or in combination with other active agents
- dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying, which yields a powder of an active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- the preparations for injections are processed, filled into containers such as ampoules, bags, bottles, syringes or vials, and sealed under aseptic conditions according to methods known in the art. Further, the preparations can be packaged and sold in the form of a kit. Such articles of manufacture will preferably have labels or package inserts indicating that the associated compositions are useful for treating a subject suffering from, or predisposed to clotting disorders.
- Effective doses of the compositions of the present disclosure, for the treatment of conditions vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic.
- the patient is a human but non-human mammals including transgenic mammals can also be treated.
- Treatment dosages can be titrated using routine methods known to those of skill in the art to optimize safety and efficacy.
- the route and/or mode of administration of the anti-LILRB2 antibody or fragment thereof can also be tailored for the individual case, e.g., by monitoring the subject.
- the antibody or fragment thereof can be administered as a fixed dose, or in a mg/kg dose.
- the dose can also be chosen to reduce or avoid production of antibodies against the anti-LILRB2 antibody or fragment thereof.
- Dosage regimens are adjusted to provide the desired response, e.g., a therapeutic response or a combinatorial therapeutic effect.
- doses of the antibody or fragment thereof (and optionally a second agent) can be used in order to provide a subject with the agent in bioavailable quantities.
- doses in the range of 0.1-100 mg/kg, 0.5-100 mg/kg, 1 mg/kg -100 mg/kg, 0.5-20 mg/kg, 0.1-10 mg/kg, or 1-10 mg/kg can be administered.
- Other doses can also be used.
- a subject in need of treatment with an antibody or fragment thereof is administered the antibody or fragment thereof at a dose of between about 1 mg/kg to about 30 mg/kg.
- a subject in need of treatment with anti-LILRB2 antibody or fragment thereof is administered the antibody or fragment thereof at a dose of 1 mg/kg, 2 mg/kg, 4 mg/kg, 5 mg/kg, 7 mg/kg 10 mg/kg, 12 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 28 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, or 50 mg/kg.
- the antibody or fragment thereof is administered subcutaneously at a dose of 1 mg/kg to 3 mg/kg.
- the antibody or fragment thereof is administered intravenously at a dose of between 4 mg/kg and 30 mg/kg.
- a composition may comprise about 1 mg/mL to 100 mg/ml or about 10 mg/mL to 100 mg/ml or about 50 to 250 mg/mL or about 100 to 150 mg/ml or about 100 to 250 mg/ml of the antibody or fragment thereof.
- Dosage unit form or“fixed dose” as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of antibody or fragment thereof calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier and optionally in association with the other agent. Single or multiple dosages may be given. Alternatively, or in addition, the antibody or fragment thereof may be administered via continuous infusion.
- An antibody or fragment thereof dose can be administered, e.g., at a periodic interval over a period of time (a course of treatment) sufficient to encompass at least 2 doses, 3 doses, 5 doses, 10 doses, or more, e.g., once or twice daily, or about one to four times per week, or preferably weekly, biweekly (every two weeks), every three weeks, monthly, e.g., for between about 1 to 12 weeks, preferably between 2 to 8 weeks, more preferably between about 3 to 7 weeks, and even more preferably for about 4, 5, or 6 weeks.
- Factors that may influence the dosage and timing required to effectively treat a subject include, e.g., the stage or severity of the disease or disorder, formulation, route of delivery, previous treatments, the general health and/or age of the subject, and other diseases present.
- treatment of a subject with a therapeutically effective amount of a compound can include a single treatment or, preferably, can include a series of treatments.
- the antibody or fragment thereof can be administered before the full onset of the disorder, e.g., as a preventative measure.
- the duration of such preventative treatment can be a single dosage of the antibody or fragment thereof or the treatment may continue (e.g., multiple dosages).
- a subject at risk for the disorder or who has a predisposition for the disorder may be treated with the antibody or fragment thereof for days, weeks, months, or even years so as to prevent the disorder from occurring or fulminating.
- the antibody or fragment thereof is administered subcutaneously at a concentration of about 1 mg/mL to about 500 mg/mL (e.g., 1 mg/mL, 2 mg/mL, 3 mg/mL , 4 mg/mL, 5 mg/mL , 10 mg/mL, 15 mg/mL, 20 mg/mL, 25 mg/mL, 30 mg/mL, 35 mg/mL, 40 mg/mL, 45 mg/mL, 50 mg/mL, 55 mg/mL, 60 mg/mL, 65 mg/mL, 70 mg/mL, 75 mg/mL, 80 mg/mL, 85 mg/mL, 90 mg/mL, 95 mg/mL, 100 mg/mL, 125 mg/mL, 150 mg/mL, 175 mg/mL, 200 mg/mL, 225 mg/mL, 250 mg/mL, 275 mg/mL, 300 mg/mL, 325 mg/mL, 350 mg/mL, 400 mg/mL
- the anti-LILRB2 antibody or fragment thereof is administered subcutaneously at a concentration of 50 mg/mL. In another embodiment, the antibody or fragment thereof is administered intravenously at a concentration of about 1 mg/mL to about 500 mg/mL. In one embodiment, the antibody or fragment thereof is administered intravenously at a concentration of 50 mg/mL.
- the anti-LILRB2 antibody or fragment thereof can be administered to a patient in need thereof alone or in combination with (i.e., by co-administration or sequential administration) other therapeutic agents useful for treating a cancer or immunological disorder as described herein may be desirable.
- therapeutic agents can be chemical or biologic in nature.
- the term“biologic” or“biologic agent” refers to any pharmaceutically active agent made from living organisms and/or their products which is intended for use as a therapeutic.
- the additional therapeutic proteins are included in the pharmaceutical composition of the present invention.
- Doses intermediate in the above ranges are also intended to be within the scope of the invention.
- Subjects can be administered such doses daily, on alternative days, weekly or according to any other schedule determined by empirical analysis.
- An exemplary treatment entails administration in multiple dosages over a prolonged period, for example, of at least six months.
- two or more polypeptides can be administered simultaneously, in which case the dosage of each polypeptide administered falls within the ranges indicated.
- Polypeptides of the invention can be administered on multiple occasions. Intervals between single dosages can be daily, weekly, monthly or yearly. Intervals can also be irregular as indicated by measuring blood levels of modified polypeptide or antigen in the patient. Alternatively, polypeptides can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the polypeptide in the patient.
- compositions containing the polypeptides of the invention or a cocktail thereof are administered to a patient not already in the disease state to enhance the patient's resistance or minimize effects of disease. Such an amount is defined to be a “prophylactic effective dose.”
- a relatively low dosage is administered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives.
- the antibodies, or antigen-binding fragments thereof of the disclosure can be useful in methods of treating a subject (e.g., a human) with a disease or condition.
- the disease or condition can include, but is not limited to, cancer or stimulating a pro- inflammatory immune response for antiviral immune response or inhibition of chronic infections.
- the present invention includes the use of anti-LILRB2, including antagonists or agonists having anti-LILRB2 activity.
- the invention includes administering to a subject (e.g., a mammal, e.g., a human) the anti-LILRB2 antibodies or a fragment thereof and contemplates both human and veterinary therapeutic uses.
- Illustrative veterinary subjects include mammalian subjects, such as farm animals and domestic animals.
- kits for stimulating a pro-inflammatory immune response in a mammal that include administering to a mammal a therapeutically effective amount of an anti-LILRB2 antibody or fragment thereof as described herein.
- an increase in pro-inflammatory immune response in a mammal can be detected as an increase in the levels of one or more pro-inflammatory proteins in the mammal (e.g., an increase in one or more of C-reactive protein, IL-la, IL-l , TNF-a, IL-6, IL-8, IL-23, IL-17, and matrix metalloproteases) or an increase in the number of effector T-cells (Teff) in the mammal (e.g., as compared to the levels of the one or more pro-inflammatory proteins in the mammal and/or the levels of effector T-cells in the mammal prior to treatment or compared to the levels of the one or more pro-inflammatory proteins and/or the levels of effector T-cells present in a control, healthy mammal).
- pro-inflammatory proteins in the mammal e.g., an increase in one or more of C-reactive protein, IL-la, IL-l , TNF-a, IL-6,
- a mammal e.g., human
- methods of treating in a mammal that include administering to a mammal a therapeutically effective amount of an anti- LILRB2 antibody or antigen-binding fragment thereof as described herein (or a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof).
- the mammal e.g., human
- a cancer e.g., any of the different types of cancer described herein.
- cancer include: bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, kidney cancer, lung cancer, melanoma, pancreatic cancer, prostate cancer, thyroid cancer, bile duct cancer, bone cancer, brain cancer, cervical cancer, cardiac tumors, esophageal cancer, eye cancer, gallbladder cancer, gastric cancer, head and neck cancer, heart cancer, liver cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, lymphoma, melanoma, mesothelioma, mouth cancer, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, non-Hodgkin lymphoma, ovarian cancer, penile cancer, pituitary tumor, retinoblastoma, sarcoma, skin cancer, testi
- the cancer is a lymphoma, a leukemia, or a breast cancer.
- a mammal having cancer can present with one or more of the following symptoms: fatigue, lump or thickening that can be felt under the skin, weight changes, skin changes (e.g., yellowing, darkening or redness of the skin, sores that won’t heal, or changes in existing moles), changes in bowel or bladder habits, persistent cough, difficulty swallowing, hoarseness, persistent indigestion or discomfort after eating, persistent, unexplained muscle or joint pain, and unexplained and persistent fevers or night sweats.
- the particular symptoms experienced by a mammal will depend on the particular type of cancer.
- a mammal can be diagnosed as having a cancer based on the observation of one or more symptoms of cancer in the mammal (e.g., any of the symptoms of cancer described herein or known in the art).
- a mammal can also be diagnosed as having a cancer based on imaging (e.g., magnetic resonance imaging, computed tomography, and/or X-ray) and/or tissue biopsy results.
- imaging e.g., magnetic resonance imaging, computed tomography, and/or X-ray
- tissue biopsy results e.g., tissue biopsy results.
- a mammal can also be diagnosed as having a cancer based using molecular diagnostic tests (e.g., based on the detection of prostate specific antigen, or mutations in breast cancer susceptibility 2 protein, breast cancer susceptibility 1 protein, or a tumor suppressor protein (e.g., p53)).
- molecular diagnostic tests e.g., based on the detection of prostate specific antigen, or mutations in breast cancer susceptibility 2 protein
- Efficacy of treatment of a cancer can be detected by a decrease the number of symptoms of a cancer in a mammal (e.g., any of the symptoms of cancer described herein or known in the art) and/or a decrease in the frequency and/or severity of one or more symptoms of cancer in a mammal (e.g., any of the symptoms described herein or known in the art).
- An effective treatment of cancer in a mammal can also be assessed by a decrease in the rate of growth of a tumor in a mammal (e.g., compared to the rate of tumor growth in the mammal prior to administration of treatment or compared to a control mammal having the same type of cancer not administered a treatment or administered a different treatment).
- An effective treatment of cancer in a mammal can also be observed by an increase in the length of remission of cancer in the mammal (e.g., compared to a control mammal having the same type of cancer not administered a treatment or administered a different treatment).
- the mammal may be female or male, and may be an adult or juvenile (e.g., an infant).
- the mammal may have been previously treated with a chemotherapeutic agent and/or analgesic and/or responded poorly to the chemotherapeutic agent and/or analgesic.
- the mammal may have non-metastatic cancer.
- the mammal can have metastatic cancer.
- the mammal may be, e.g., between 18 to 20 years old or at least or about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or at least or about 100 years old.
- Also provided are methods of treating cancer in a mammal that include administering to the mammal a therapeutically effective amount of an anti- LILRB2 antibody or antigen-binding fragment thereof as described herein (or a pharmaceutical composition comprising the antibody or fragment thereof).
- the methods of treating cancer described herein further comprise administering to the mammal a chemotherapeutic agent or an analgesic. In some embodiments, the methods of treating cancer described herein further comprise administering to the mammal an immune checkpoint inhibitor. In some embodiments, the methods of treating cancer described herein further comprise administering to the mammal one or more additional agents selected from the group consisting of: a myeloid-derived suppressor cell, a mobilizing agent, a c-jun N- terminal kinase inhibitor, an anti-inflammatory agent, and an immunosuppressive agent.
- the infection is a bacterial infection.
- a mammal e.g., human
- the mammal has been diagnosed as having inflammation, an autoimmune disease, or transplant rejection.
- the mammal is selected for organ or tissue transplantation.
- the mammal has been diagnosed as having inflammation, an autoimmune disease, or transplant rejection.
- the mammal is selected for organ or tissue transplantation.
- Also provided herein is a method of treating cancer in a mammal in need thereof, the method comprising administering to the mammal a therapeutically effective amount of a CAR described herein (or cells comprising or encoding a CAR described herein or a pharmaceutical composition comprising same) or a pharmaceutical composition comprising same.
- the cancer is a lymphoma, a leukemia, a colon cancer, or a breast cancer.
- the mammal is a human.
- a method of treating asthma in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of a CAR described herein (or cells comprising or encoding a CAR described herein or a pharmaceutical composition comprising same) or a pharmaceutical composition comprising same.
- the mammal is a human.
- a method of treating an infection in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of a CAR described herein (or cells comprising or encoding a CAR described herein or a pharmaceutical composition comprising same) or a pharmaceutical composition comprising same.
- the mammal is a human.
- a method of treating inflammation, an autoimmune disease, or transplant rejection in a mammal in need thereof comprising administering to the mammal a therapeutically effective amount of a CAR described herein (or cells comprising or encoding a CAR described herein or a pharmaceutical composition comprising same) or a pharmaceutical composition comprising same.
- the mammal is a human.
- compositions that include the anti-LILRB2 antibody or fragment thereof described herein can be administered with a medical device.
- the device can be designed with features such as portability, room temperature storage, and ease of use so that it can be used in emergency situations, e.g., by an untrained subject or by emergency personnel in the field, removed from medical facilities and other medical equipment.
- the device can include, e.g., one or more housings for storing pharmaceutical preparations that include an anti-LILRB2 antibody or fragment thereof, and can be configured to deliver one or more unit doses of the antibody or fragment thereof.
- the device can be further configured to administer a second agent, e.g., a chemotherapeutic agent, either as a single pharmaceutical composition that also includes the anti-LILRB2 antibody or fragment thereof or as two separate pharmaceutical compositions.
- kits An anti-LILRB2 antibody or fragment thereof can be provided in a kit.
- the kit includes (a) a container that contains a composition that includes an anti-LILRB2 antibody or fragment thereof as described herein, and optionally (b) informational material.
- the informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein and/or the use of the agents for therapeutic benefit.
- the kit also includes a second agent for treating a disorder described herein.
- the kit includes a first container that contains a composition that includes the anti-LILRB2 antibody or fragment thereof, and a second container that includes the second agent.
- the informational material of the kits is not limited in its form.
- the informational material can include information about production of the compound, molecular weight of the compound, concentration, date of expiration, batch or production site information, and so forth.
- the informational material relates to methods of administering the anti-LILRB2 antibody or fragment thereof, e.g., in a suitable dose, dosage form, or mode of administration (e.g., a dose, dosage form, or mode of administration described herein), to treat a subject who has had or who is at risk for a disease as described herein.
- the information can be provided in a variety of formats, include printed text, computer readable material, video recording, or audio recording, or information that provides a link or address to substantive material, e.g., on the internet.
- the composition in the kit can include other ingredients, such as a solvent or buffer, a stabilizer, or a preservative.
- the anti-LILRB2 antibody or fragment thereof can be provided in any form, e.g., liquid, dried or lyophilized form, preferably substantially pure and/or sterile.
- the liquid solution preferably is an aqueous solution.
- the anti-LILRB2 antibody or fragment thereof in the liquid solution is at a concentration of about 25 mg/mL to about 250 mg/mL (e.g., 40 mg/mL, 50 mg/mL, 60 mg/mL, 75 mg/mL, 85 mg/mL, 100 mg/mL, 125 mg/mL, 150 mg/mL, and 200 mg/mL).
- the anti-LILRB2 antibody or fragment thereof is provided as a lyophilized product, the anti-LILRB2 antibody or fragment thereof is at about 75 mg/vial to about 200 mg/vial (e.g., 100 mg/vial, 108.5 mg/vial, 125 mg/ vial, 150 mg/vial).
- the lyophilized powder is generally reconstituted by the addition of a suitable solvent.
- the solvent e.g., sterile water or buffer (e.g., PBS), can optionally be provided in the kit.
- the kit can include one or more containers for the composition or compositions containing the agents.
- the kit contains separate containers, dividers or compartments for the composition and informational material.
- the composition can be contained in a bottle, vial, or syringe, and the informational material can be contained in a plastic sleeve or packet.
- the separate elements of the kit are contained within a single, undivided container.
- the composition is contained in a bottle, vial or syringe that has attached thereto the informational material in the form of a label.
- the kit includes a plurality (e.g., a pack) of individual containers, each containing one or more unit dosage forms (e.g., a dosage form described herein) of the agents.
- the containers can include a combination unit dosage, e.g., a unit that includes both the anti-LILRB2 antibody or fragment thereof and the second agent, e.g., in a desired ratio.
- the kit includes a plurality of syringes, ampules, foil packets, blister packs, or medical devices, e.g., each containing a single combination unit dose.
- the containers of the kits can be air right, waterproof (e.g., impermeable to changes in moisture or evaporation), and/or light-tight.
- the kit optionally includes a device suitable for administration of the composition, e.g., a syringe or other suitable delivery device. The device can be provided pre-loaded with one or both of the agents or can be empty, but suitable for loading.
- Monoclonal antibodies that specifically bind LILRB2 were generated (Examples 1 and 9) and characterized (Examples 2-9) as described below.
- the anti- LILRB2 antibodies exhibited pro- or anti-inflammatory responses as well as regulated T cell-mediated immunities through modulation of LILRB2 signaling. Additionally, anti-LILRB2 antibodies described below mediated anti-tumor responses on LILRB2- expressed tumor cells.
- Monoclonal antibodies that specifically bind LILRB2 were generated as described below.
- the anti-LILRB2 antibodies can exhibit pro- or anti-inflammatory responses as well as regulate T cell-mediated immunities through modulation of LILRB2 signaling. Additionally, LILRB2 antibodies can mediate anti-tumor responses on the LILRB2-expressed tumor cells.
- Monoclonal antibodies generated from clonal hybridoma cells were cultured in ClonaCell-HY Medium A (StemCell Technologies) followed by adaptation to serum-free conditions using Hybridoma-SFM (ThermoFisher Scientific). Hybridoma cells were expanded in 50mL of Hybridoma SFM for 2 weeks or until medium was exhausted. Antibody-containing supernatant was harvested by centrifugation followed by sterile 0.22 micron filtration. Antibodies were concentrated using Ami con Ultra- 15 centrifugal filter concentrator with nominal molecular weight limit of 100 kDa (Milbpore). Concentrated antibodies were then purified using Nab Protein A/G Spin Kit (Thermo Fisher Scientific) according to manufacturer’s instructions. Purified antibodies were desalted using Zeba Spin Columns (Thermo Fisher Scientific).
- RNA from hybridoma clones was extracted using Trizol extraction.
- cDNA was synthesized from purified RNA using OneStep RT-PCR Kit (Qiagen) according to manufacturer’s instructions.
- PCR of Ig heavy and light chains was performed using degenerate primers.
- Amplified PCR products were subsequently sequenced (GeneWiz) and validated using IMGT/V-QUEST from The International Immunogenetics Information System.
- CDRs complementarity determining regions
- Anti-LILRB2 antagonists promote TNF alpha secretion whereas Anti-LILRB2 agonist promotes IL-10 secretion from total peripheral blood mononuclear cells (PBMC) in the presence of low-dose LPS stimulation.
- the inventors screened several monoclonal antibodies (mAbs) for biological function with total PBMC under the inflammatory condition.
- the mAbs with antagonistic functional characteristics can further promote the TNF alpha production from total PBMC under the low dose of LPS stimulation, but do not affect the IL-10 secretion, meaning they are effective in treating cancer or infectious diseases.
- the agonistic clones can increase the IL-10 production (FIG. 1), for treating autoimmune diseases, inflammation or transplant rejection.
- Antagonistic anti-LILRB-l antibodies are described in Table 1.
- Agonistic anti-LILRB-l antibodies are described in Table 2.
- 5G5 and P 5G5 are used interchangeably and refer to antibodies having the same sequences as each other.
- 5G5 and P 5G5 may be used interchangeably to refer to an antibody having HCDR1-3 of SEQ ID NOs: 225, 230, and 244, respectively, and LCDR1-3 of SEQ ID NOs: 24, 202, and 216, respectively.
- Anti-LILRB2 antibodies modulate TNF alpha secretion in vitro.
- PBMC peripheral blood mononuclear cells
- Anti-LILRB2 purified antibodies 5 pg/ml
- isotype control overnight for 16 hours following stimulation with LPS (50 ng/ml) for 24 hours.
- Supernatants were collected and TNF alpha concentrations were measured by ELISA (FIG. 1).
- Isotype treatment was used as a control.
- Anti-LILRB mAbs were ranked in order of clones that suppress TNF alpha release to those that enhance TNF alpha secretion by the relative fold change in TNF alpha release (FIG. 1A).
- the raw data of TNF alpha release is presented in FIG. IB.
- the overall difference in TNF alpha levels from Figure 1B is presented in FIG. 1C.
- Anti-LILRB2 antibodies modulate IL-10 production in vitro.
- PBMC peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- LPS lipopoly saccharide
- Supernatants were collected and IL-10 concentrations were measured by ELISA ( Figure 2). Isotype treatment was used as a control.
- Anti-LILRB mAbs were ranked in order of clones that suppress IL-10 release to those that enhance IL-10 secretion by the relative fold change in IL-10 release (Figure 2A).
- the raw data of IL-10 release is presented in Figure 2B.
- the overall difference in IL-10 levels from Figure 1B is presented in Figure 2C.
- Raw data for Example 3 is provided in Table 3 and Table 4.
- FIG. 2D presents the flow cytometric analysis on the effect of LILRB2 antibodies on the M1/M2 markers of tumor-associated macrophages from multiple lung cancer patients.
- Tumor infiltrated lymphocytes were isolated and treated with LILRB2 antagonistic antibody (P 5G5) for 2 days in the presence of IFNgamma.
- the test cells were harvested for cytometric analysis (FIG. 2D, upper panel); the statistical analysis on multiple patients is shown in FIG. 2D, lower panel.
- FIG. 2E shows the flow cytometric analysis on the effect of LILRB2 antibodies on the M1/M2 markers in multiple healthy donors.
- Ml -type macrophages were differentiated from CD33 + myeloid cells sorted from healthy donor in the presence of GM-CSF lOOng/ml and agonistic anti-LILRB2 Ab (12H6, 5 pg/ml) for 6 days and IFNgamma (25ng/ml) and LPS (25ng/ml) for the last 24 hours.
- the test cells were harvested for cytometric analysis (FIG. 2E, upper panel); the statistical analysis on multiple healthy donors is shown in FIG. 2E, lower panel.
- FIG. 2F shows the mass cytometry analysis of antagonistic and agonistic LILRB2 antibodies on OKT3 -stimulated PBMCs from multiple healthy donors.
- PBMCs were obtained from healthy donors and treated with purified LILRB2 antagonistic (C_lH3) and agonistic (C_8B5) antibodies (5 pg/ml) or isotype control overnight for 16 hours following stimulation with OKT3 (0.01 pg/ml) for 3 days.
- the test cells were harvested for cytometric analysis (see heat map in FIG. 2F, left panel and Disney figure, Right panel).
- FIG. 2F, left panel represents the heatmaps showing the expression of the indicated markers in the immune cells subsets (PBMC, CD4 and CD8 T cells).
- FIG. 2F, right panel represents t-SNE map displaying data on subsets of 1 x 10 6 PBMCs, CD4 and CD8 T cells analyzed with our 38-antibody panel and colored by marker expression normalized based on IgG control.
- Anti-LILRB2 antibodies modulate T cell proliferation and IFN gamma secretion in vitro.
- PBMCs were cultured with LILRB2 antagonistic antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) of anti-CD3 (OKT3) for 3 days. After 3 days of treatment, [3 ⁇ 4] -thymidine was added for the last 8 hours of culture followed by measurement on a scintillation counter. T-cell proliferation (CPM) is shown in FIG. 3A. Supernatants were collected from the samples of FIG. 3A and IFN-g concentrations were measured by ELISA (FIG. 3B). Isotype treatment was used as a control. FIGs.
- 3C-3D present the flow cytometric data from cultured human PBMCs (responders) labeled with CFSE, and stimulated with irradiated (30 Gy) unrelated donor PBMCs (stimulators) in the presence of IgG isotype control or the indicated LILRB2 antibodies (5 pg/ml). The ratio of responder/stimulator was 1/2. After 5 days of co-culture, viable CD4 T cells (left panel) and CD8 T cells (right panel) were analyzed by flow cytometry. The representative flow plots were shown as CFSE dilution and percent divided cells.
- Anti-LILRB2 antibodies modulate IFN gamma release in vitro.
- PBMC peripheral blood mononuclear cells
- LILRB2 antagonistic antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) anti-CD3 (OKT3) for 3 days.
- Supernatants were collected from the samples of FIG. 3A and IFN-g concentrations were measured by ELISA (FIG. 3B). Isotype treatment was used as a control.
- Anti-LILRB2 antibodies inhibited allogeneic T cell proliferation in vitro.
- CFSE-labeled PBMCs were cultured with LILRB2 agonistic antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) anti-CD3 (OKT3) for 3 days (FIG. 3C). After 3 days of culture, viable CD4 T cells (FIG. 3C, left panel) and CD8 T cells (FIG. 3C, middle panel) were analyzed by flow cytometry. The representative flow plots are shown as CFSE dilution of CD4 and CD8 T cells (FIG. 3C, left and middle panels) and proliferation index (FIG. 3C, right middle for CD4 cells and right lower panel for CD8 cells). Supernatants were harvested for IFNgamma detection shown in FIG. 3C, right upper panel.
- OKT3-mediated T cell proliferation and IFN gamma secretion was strongly suppressed by agonistic clones, whereas antagonistic clones enhanced IFNgamma production and proliferation or exerted no effect on different healthy donors (FIGs. 3A - 3B).
- antagonistic clones enhanced IFNgamma production and proliferation or exerted no effect on different healthy donors (FIGs. 3A - 3B).
- LILRB2 agonistic antibodies mediated suppression of mixed lymphocyte reactions (MLR) (FIG. 3D).
- AntiLILRB2 can inhibit the proliferation of cancer cells of multiple cancer types.
- the inventors further tested the effect of LILRB2 mAbs on myeloid leukemia cell proliferation.
- the proliferative activity of U937 and HL60 cells was inhibited by antagonist clones.
- LILRB2-transduced U937 leukemia cells were treated with control Ig or anti- LILRB2 mAbs (5 microgram) for 42 days.
- U937 cell proliferation was assessed by [ 3 H] -thymidine incorporation.
- Cells were pulsed with [ 3 H] -thymidine for the last 8 hours of culture.
- the proliferation of LILRB2+ THP-l cells (CPM) is shown in FIG. 4A.
- LILRB2-tranduced human breast cancer cells were treated with anti- LILRB2 antibody (5 pg/ml), or isotype control for 4 days.
- LILRB2+ MCF7 cell proliferation was assessed by [ 3 H] -thymidine incorporation. Cells were pulsed with [ 3 H] -thymidine for the last 8 hours of culture.
- the proliferation of LILRB2+ MCF7 cells is shown in FIG. 4B.
- LILRB2 antagonists inhibit the migratory ability of LILRB2 + MDAMB231 breast cancer cells.
- the migratory ability of LILRB2 + MDAMB231 breast cancer cells was substantially inhibited by antagonistic clone C_5Cl2 at 5 microgram/ml concentrations by scratch assay (FIG. 5A) and transwell assay (FIG. 5B).
- Antagonistic anti-LILRB2 antibody enhances Vaccine adjuvant effect (CpG) and bacterial opsonization/phagocytosis
- MISTRG mice were intravenously injected with IgG control or LILRB2 antagonistic antibody (P_5G5) (150 pg/mouse) for two days, and then intraperitoneally challenged with 5 nmol. After 2 hours, the sera were collected from test mice and subjected to ELISA analysis for TNFa levels (FIG. 6A, left panel).
- IgG control or LILRB2 antagonistic antibody P_5G5
- LILRB2 antagonistic antibody P 5G5
- control Ig 150 pg/mouse
- Peripheral blood cells were isolated and incubated with E. coli expressing GFP at the ratio of 2*l0 8 E. Coli per 1 * 10 7 peripheral blood cells for 4 hours at 37°C.
- the cells were harvested and washed with PBS and analyzed by gating on viable CD45 + CD33 + population.
- antagonistic LILRB2 antibody P 5G5 strongly enhanced systemic response to CpG challenge and enhanced phagocytic activities of macrophages (FIG. 6A, right panel).
- the LILRB2 antagonist inhibits the growth of cancer cells in vivo.
- the inventors further evaluated the anti-tumor effect of anti-LILRB2 mAh on LILRB2 transduced THP-l leukemia cells in xenograft mouse models.
- the anti -tumor effect of LILRB2 antagonistic antibodies (P 5G5) inhibited the tumor growth of Luciferase- expressed-A549 in HLA-A2 matching humanized NCG mice model when combined with anti-PD-l (FIG. 6C).
- FIG. 7C is a diagrammatic representation of FIG. 7C.
- Example 9 Blocking Immunoinhibitory Receptor Lilrb2 Reprograms Tumor- Associated Myeloid Cells And Promotes Antitumor Immunity
- Macrophages not only mediate inflammation during infection but also suppress immunity during inflammation resolution (1) and promote immune escape within tumor microenvironments (2).
- the functional plasticity of macrophage phenotypes is largely influenced by the surrounding milieu. Viruses and bacteria activate toll-like receptor signaling to drive NFKB and favor macrophage release of iNOS, TNFa, and IL12 to support Thl immunity while Thl -associated IFNy activates STAT1 to support effector T cell responses.
- humoral cytokines IL4/IL13 and IL10 secreted from tumor cells stimulate macrophages to release IL10, TGFp. and Arginase 1.
- STAT6, STAT3, and matrix proteases further support tissue remodeling and Th2 immunity (3). Whether, and how, to target maturation pathways to control the plasticity of myeloid cell differentiation and macrophage phenotypes remain a challenging task for current cancer immunotherapies .
- paired-immunoglobulin-like receptor B (PIR- B) is the sole mouse receptor ortholog of human leukocyte immunoglobulin-like receptor B (LILRB) family (also known as ILT, LIR, and CD85) (4, 5).
- LILRB human leukocyte immunoglobulin-like receptor B
- Pirb deficiency results in increased BCR signaling and hyperactivity (6).
- Pirb- deficient macrophages similarly have increased proinflammatory cytokine release and exacerbated autoimmune diseases (7).
- PIR-B homeostatically suppresses immune activation by binding MHC I in cis and trans (8, 9).
- PIR-B is a key regulator for maintaining the M2 -like phenotype of tumor-infiltrating myeloid- derived suppressor cells (MDSC) (12). TLR and IFNy signaling were magnified in P/rZi-deficient MDSCs while IL4/IL13 and IL10 were suppressed. Mice with Pirb deficiency had reduced tumor burdens, enhanced anti-tumor responses, decreased Treg activation, and an infiltrating macrophage profile that resembled Ml -like classical activation (12).
- Human LILRBs similar to mouse PIR-B, bear immunoreceptor tyrosine-based inhibitory motifs (ITIM) that can attenuate signaling cascades generated from the crosslink-dependent activation of immunoreceptor tyrosine-based activating motifs (ITAM)-bearing receptors (13).
- ITIM immunoreceptor tyrosine-based inhibitory motifs
- ITAM immunoreceptor tyrosine-based activating motifs
- LILRB3 and LILRB4 are orphan receptors (17, 18) and LILRB5 reportedly binds 2m-free heavy chains of HLA-B27 (19).
- LILRB 1 and LILRB2 may compete with CD8 for HLA-I binding to potentially modulate CD8 + T cell responses (22).
- LILRB2 Activation of LILRB2 by viral expression of an HLA-B variant can promote myeloid cell tolerance and downregulate maturation and costimulatory molecule expression of dendritic cells (DC) (23).
- DC dendritic cells
- HLA-G-LILRB1/2 engagement increases IL4 and IL13, suppresses proinflammatory cytokine release, and promotes secretion of IL10 and TGF regulatory cytokines (24).
- Lower levels of LILRBs expression on DCs are correlated with enhanced antigen-presenting cell function (25).
- LILRB2 agonism has been shown to block DC Ca 2+ -flux (17) and plays a crucial role in the tolerization of DC (26).
- LILRB2 by antagonizing cell surface receptor-mediated activation may potentially alter the function of myeloid cells with immunosuppressive activities, i.e. MDSC or tumor- associated macrophages (TAM), toward a classically activated inflammatory macrophage phenotype.
- immunosuppressive activities i.e. MDSC or tumor- associated macrophages (TAM)
- LILRB2 is a valid and sufficient target for modulating myeloid cell functions.
- LILRB2 antagonism also rendered macrophages resistant to humoral cytokine-dependent STAT6 activation by IL4, relieved the suppressive effect of macrophages on T cell proliferation, and reprogrammed human macrophages from A549 lung tumor models and primary human non-small cell lung carcinoma (NSCLC).
- NSCLC primary human non-small cell lung carcinoma
- LILRB2 is a critical homeostatic surface regulator for myeloid cell maturation with a great therapeutic value as a promising myeloid immune checkpoint target specifically aimed at myeloid cell functional determination.
- Blockade of LILRB2 can be used to reprogram TAM to improve the therapeutic outcome of cancer immune therapies through modulation of the tumor microenvironment.
- LILRB2 antibodies enhance activation of human monocytes
- FIG. 16A Because members of the LILRB family share a high degree of homology, we tested for potential cross-reactivity by generating cell lines stably transduced with each receptor’s extracellular domain (FIG. 16A). Cross reactivity to LILRA1 was included since this receptor shares about 80% homology with the LILRB2 extracellular domain. FACS staining demonstrated that LILRB2 antibodies did not cross-react with related family members (FIG. 9C). Staining of PBMC was also restricted to the CD33 + myeloid subset, specifically staining CDl4 + CDl6 hi and CDl4 + CDl6 l0 monocyte populations (FIG. 16B). We identified LILRB2-specific antibodies that enhanced monocyte inflammatory potential in response to a low dose of LPS stimulus.
- LILRB2 antagonism alters MCSF-dependent maturation of macrophages
- LILRB2 antagonists amplified monocyte activation in response to LPS
- LILRB2 blockade affects macrophage maturation.
- Studies in human monocyte-derived macrophages (MDM) have demonstrated different maturation phenotypes resulting from inflammatory cues (27, 28).
- MDM human monocyte-derived macrophages
- We generated immature macrophages M(-) by treating CD33 + monocytes from PBMCs of healthy donors with M-CSF for 5-7 days. While macrophages cultured in the presence of control Ig appeared elongated and loosely adherent, monocytes cultured in the presence of anti-LILRB2 appeared rounder and tightly adherent (FIG. 10A).
- CD163 was also enhanced in the presence of M-CSF, IL6, IL10, and in response to glucocorticoids (33).
- M-CSF M-CSF
- IL6 IL10
- glucocorticoids 33
- TNFa and IL10 cytokine levels TNFa and IL10 cytokine levels
- IRF5 is induced by type I interferon and promotes inflammatory macrophage polarization (34), which is inhibited by IRF4.
- IRF4 is associated with alternative macrophage maturation, is induced by IL4, and negatively regulates TLR signaling and proinflammatory cytokines (35, 36).
- IRF3 is activated by TLR signaling and induces type I interferon-STATl signaling cascades (37) whereas IRF7 is reported to participate in the inflammatory microglial polarization switch (38).
- anti-LILRB2 upregulated IRF3, 5 and 7 but downregulated IRF4 during differentiation of immature macrophages (FIG. 10E), indicating that anti-LILRB2 potentially favors classical and inflammatory macrophage polarization.
- endotoxin levels to be less than 0.005 EU per pg in all antibody batches.
- M(LPS) had markedly increased expression of PD-L1, consistent with literature reporting PD-L1 upregulation in response to TLR agonists (39).
- anti-LILRB2 treated M(LPS) significantly inhibited the induced expression of PD-L1 (FIG. 10F, FIG. 10G). PD-L1 expression on M(IL4) was negligible.
- M(IL4) matured in the presence of anti-LILRB2 and showed significantly less induction of DC-SIGN expression and basal expression of DC-SIGN was found in M(LPS) (FIG. 10H, FIG. 101).
- LILRB2 antagonism favors activation of NFKB/STATI and inhibition of
- LILRB receptors have been shown to constitutively recruit and activate SHP1 in macrophage populations (16).
- Co-immunoprecipitation experiments demonstrated that LILRB2-associated SHP1 phosphorylation was diminished in anti-LILRB2 treated macrophages (FIG. 11F).
- disruption of SHP1 activation downstream of LILRB2 may explain the increased sensitization of signaling cascades.
- LILRB2 antagonism inhibits myeloid-dependent suppression on effector
- FIG. 17A, FIG. 17B Total numbers of CD4 and CD8 T cells were determined by FACS.
- the macrophages generated in the presence of anti-LILRB2 showed restored CD4/CD8 T cell numbers (FIG. 11G) and IFNy secretion (FIG. 11H) indicating anti- LILRB2 diminished suppressive capacity as compared to IgG-treated macrophages.
- PBMC cultures stimulated with a low dose of OKT3, anti-LILRB2 significantly synergized with PD-l blockade to enhance effector T cell secretion of IFNy (FIG. 111).
- LILRB2 antagonism induced a macrophage phenotype that enhances adaptive Thl effector T cell responses.
- LILRB2 blockade alters M(IL4) immune, migratory, and vesicle trafficking pathways
- Transcriptome studies can provide additional insight into the maturation and phenotypic changes of macrophages.
- Early microarray studies comparing M(LPS) and M(IL4) populations have defined markers and pathway networks associated with Ml vs. M2-like functional phenotypes (27).
- Illumina microarray analysis was used to determine how LILRB2 blockade may affect transcriptional networks in M(LPS) and M(IL4).
- Comparison of M(LPS) and M(IL4) IgG-treated transcriptomes identified 3,926 differentially expressed genes (DEGs) (FIG. 18A, FIG. 18B) with significant overlap between the top 100 and those originally described by Mantovani (27).
- LILRB2 blockade upregulated LILRA3 transcript, a secreted LILR family member that may further compete with other LILR family members.
- Anti-LILRB2 increased Ccl22, FGR, and Trem2 transcription as well as Ml -associated Sphkl transcription but decreased Siglecl, PLC decoy messenger Plcl2, and complement protein C2 transcription as well as M2-associated Klf2 transcripts.
- Principle component analysis of M(LPS) and M(IL4) in response to IgG or anti-LILRB2 suggests that LILRB2 blockade generates unique macrophage phenotypes that are dissimilar from each other (FIG. 12C).
- LILRB2 blockade has a more significant impact on M(IL4) versus M(LPS) global transcription suggests that LILRB2 may be more important for maintaining immune homeostasis in the steady state or M2 -like macrophages versus Ml-like macrophages.
- M(LPS) DEGs were associated with G-coupled protein receptor signaling, transport, and other cellular processes.
- LILRB2 blockade significantly altered genes associated with immune function, as well as cell migration/motility, lipid metabolism, apoptosis/proliferation, and increased enzymatic remodeling/activity (FIG.
- Sphingosine kinase 1 ⁇ Sphkl is associated with obese adipose tissue macrophages from high-fat diet and ob/ob mice (48). Compared to Ml -associated genes, more M2-associated genes were downregulated by anti- LILRB2 including III 3ral .
- LILRB2 blockade suppressed MAF in M(IL4), an important regulator of the macrophage enhancer landscape and M2- associated gene expression (49).
- M2-associated genes were also downregulated, including Klf2/Klf4, Tgfbr2, Ms4a6a, Aloxl5 etc. (FIG. 19E).
- the biological role of these molecules in M1/M2 differentiation remains to be elucidated.
- M(IL4) treated with anti-LILRB2 showed significant inhibition of Lilrb5 and AngptU transcript.
- Chemokine transcript levels were also strongly inhibited, e.g. Ccl8, Ccl26, Cell 3, Cell 4, Cell 5, and Ccl23.
- LILRB2 blockade suppressed LPS-induced dual-specific PTPs (DSPs), DusplO (MKP-5, JNK and p38 pathway-associated phosphatase) (50) and Dusp22 (JSP-l, JNK pathway-associated phosphatase) (51), which mediates negative feedback control of the inflammatory response.
- DSPs LPS-induced dual-specific PTPs
- DusplO MKP-5, JNK and p38 pathway-associated phosphatase
- JSP-l JNK pathway-associated phosphatase
- LILRB2 blockade results in phenotypic changes in macrophage maturation that include immune, as well as metabolic, sorting, and cytoskeletal changes. LILRB2 blockade can alter tumor cell-induced macrophage maturation and promote antitumor immunity
- LILRB2 blockade could alter the macrophage phenotype in the presence of tumor-derived factors and the tumor microenvironment. Some tumor cells are sufficient to promote the autocrine production of M-CSF by monocytes in a process dependent on tumor cell-derived IL6 (52). We hypothesized that co-culture of tumor cells with human monocytes would be sufficient to generate macrophages. Gating on CD33 + CDl4 + cells, we reproduced the finding that A549 NSCLC cells were sufficient to generate macrophages whose profile resembled macrophages derived from M-CSF cultures (FIG. 13A).
- A549-derived macrophages cultured in the presence of LILRB2 antagonist had decreased levels of CD14, CD163, CD16 and DC-SIGN (FIG. 13B), consistent with our observations on MCSF primary macrophage cultures (FIG. 10). Similar to A549 NSCLC cells, LILRB2 antagonist exerted a similar impact on Hs578T breast cancer cell-derived macrophages (FIG. 20A, FIG. 20B). We next assessed if A549 cells could generate primary human macrophages when co-injected subcutaneously in immunodeficient NSG-SGM3 mice and whether LILRB2 blockade could similarly reprogram macrophages in vivo (FIG. 21).
- FIG. 13C FACS gating on human CD45 + CD33 + cells identified human myeloid cells from tumor single-cell suspensions.
- FACS analysis of immune markers showed that specific reductions in CD 163 were reproducibly detected in four out of total five donors (FIG. 2 IB). Furthermore, changes in other markers, including CD 14, CD 16 and PD-L1 were variable across donors in response to aLILRB2.
- FIG. 13D showed the representative data from one donor, while combined data from all five donors for CD 14, HLADR and CD 16 is presented in FIG. 2 ID. CD 14 and CD 16 were significantly down-regulated while HLA-DR was upregulated following anti-LILRB2 treatment across multiple mice and multiple human monocyte donors by using paired comparative analysis (FIG.
- HLA-A2 matched humanized NCG mice were used for in vivo experiments in order to trace long-term anti-tumor responses by LILRB2 blockade together with anti-PD-l treatment, using an A549 (HLA-A2 + ) xenograft model with luciferase-expressing A549 (LUC-A549) cells.
- the results showed that the anti-LILRB2 and anti-PD-l combination substantially decreased LUC-A549 tumor burden (FIG. 13E).
- MISTRG mice support xenogenic human hematopoietic development due to humanized knock-in alleles (M-CSF h , IL3/GM-CSF h and TPO h ) important for innate immune cell development that enable the full recapitulation of human myeloid development and function in the mouse. Similar human CD33 + cell engraftment rates were observed between experimental groups (FIG. 21C).
- mice were treated with CpG and TNFa concentration in serum was measured. Interestingly, approximately two-fold higher human TNFa levels were found in mice treated with anti-LILRB2 vs. control Ig (FIG. 13F).
- the effect of LILRB2 on phagocytosis in this humanized mouse model was tested using GFP expressing Escherichia coli. Anti- LILRB2 significantly increased the phagocytic activity of C D 14 1 C D 16 monocytes on GFP-expressing Escherichia coli when compared with the control Ig treated group (FIG. 13G).
- anti-LILRB2 can reprogram human macrophages in vivo to enhance anti-tumor responses in a xenograft human lung cancer model, a systemic response to CpG challenge and phagocytic activities of macrophages in humanized MISTRG mice.
- antagonistic LILRB2 antibody can modulate macrophage function to an Ml- associated phenotype and further enhance pro-inflammatory responses in vivo.
- LILRB2 blockade can enhance antitumor responses and decrease MDSC and Treg populations in syngeneic Lewis lung carcinoma (LLC)-bearing mice.
- LILRB2 Since LILRB2 is only expressed on human, not mouse cells, and exhibits very low homology to the mouse Pirb gene, our antibody did not crossreact in the mouse system. Therefore, we employed BAC DNA injection to develop LILRB2 transgenic mice. These mice highly expressed LILRB2/3 on CDl lb + cells in the peripheral blood (FIG. 14A), and anti-LILRB2 treatment increased the CD86 + MHCII + population (FIG. 14B, FIG. 14C) as well as TNFa secretion in response to LPS stimulation in vitro (FIG. 14D). We evaluated whether LILRB2 blockade alone or in combination with anti-PD-Ll treatment could inhibit tumor progression and modulate the tumor microenvironment in a Lewis lung carcinoma model.
- PD-L1 blockade had no effect on tumor growth while LILRB2 blockade showed moderate anti-tumor effect.
- Blockade of both PD-L1 and LILRB2 led to significantly reduced tumor size and weight in LLC-tumor bearing mice (FIG. 14E).
- the combination of anti-LILRB2 and anti-PD-Ll significantly decreased the granulocytic Ly6G+Ly6Cint MDSC population but increased monocytic Ly6G-Ly6Chi MDSC in tumor tissues (FIG. 14F).
- anti-LILRB2 was combined with anti-PD-Ll treatment, the CD4 + CD25 + Foxp3 + Treg populations in spleen and tumor-infiltrated lymphocytes were both substantially decreased (FIG. 14G).
- LILRB2 blockade significantly decreased MDSC and Treg populations and enhanced the therapeutic efficacy of anti-PD-Ll treatment in vivo.
- LILRB2 blockade could reprogram isolated primary tumor-associated macrophages ex vivo. Single cell suspensions of collagenase- digested tumor tissues were used to isolate tumor-infiltrating leukocytes. By gating on DAPI-negative live cells and human CD45, we could identify infiltrating tumor associated macrophages (TAM) and MDSC based on CD33, CD14, and HLA-DR gating (FIG. 15A). Staining for LILRB family members revealed variable, but a ubiquitous expression of LILRB 1, LILRB2, LILRB3, and LILRB4 among MDSC and TAM populations (FIG. 15B, FIG.
- LILRB2 blockade itself augmented NFKB and ERK1/2 phosphorylation and decreased AKT phosphorylation, implying that LILRB2 antagonism alone is sufficient to moderately drive MCSF monocyte-derived macrophages toward an Ml lineage. Nevertheless, LILRB2 antagonism suppressed an M2-associated and IL4-driven gene cluster while promoting those associated with an Ml phenotype.
- LILRB2 mediated signal regulation model FIG.
- LILRB2 blockade can suppress SHP1/2 phosphorylation and lead to an Ml program through restored activation of ERK (53) and p38 by suppression of SHPl/DUSPs-mediated direct or indirect dephosphorylation (ERK at Y204 and p38 at Y182), leading to further activation of NFKB.
- ERK ERK at Y204 and p38 at Y182
- downregulation of SHP1/SHP2 recruitment/activation led to removal of a suppressor of JAK-STAT1 signaling and thus enhanced the IFN-induced signaling cascade (55).
- LILRB2 antagonism inhibited STAT6 phosphorylation by increasing SOCS3, which has been reported to suppress IL4/STAT6 signaling (56).
- SOCS3 The induction of SOCS3 could result from the anti-LILRB2-mediated release of proinflammatory cytokines (IL6 and IL12) through activation of MAPK/NFKB cascades (57, 58). Phosphorylation of AKT was significantly inhibited by LILRB2 blockade, which could be due to potential inhibition of: 1) SOCS3 (59, 60) or, 2) PI3- kinase g or SHIP-l - two molecules that have been identified as key regulators for the macrophage switch between immune stimulation and suppression (61, 62).
- TAM and M2 -like macrophages appear to share functional similarities (66).
- Immunotherapies that reprogram TAM to support adaptive anti tumor immunity offer an alternative strategy that avoids the potential pitfalls associated with TAM depletion (67).
- LILRB2 blockade appeared to alter the tumor- dependent maturation of macrophages similar to what was observed with MDM cultures.
- Patient biopsies from NSCLC showed significant infiltration of MDSC and TAM populations.
- LILRB2 appeared to be a critical negative regulator in both primary monocyte-derived macrophages as well as TAM populations harvested from patients.
- anti-LILRB2 significantly decreased Ly6G + Ly6C mt granulocytic MDSC in both spleen and tumor tissues in an immune competent syngeneic LILRB transgenic mouse model.
- LILRB2 antagonism substantially enhanced the efficacy of an immune checkpoint inhibitor, anti-PD-l, in a PBMC humanized NCG mouse model bearing human lung cancer cells, A549 (FIG. 13E).
- an immune checkpoint inhibitor anti-PD-l
- FIG. 14E We further confirmed the effect of LILRB2 blockade in an immunocompetent syngeneic Lilrb2/3 BAC transgenic mouse model (FIG. 14E).
- anti-PD-Ll treatment alone showed a limited antitumor effect in LLC-tumor bearing immune-competent mice (68, 69).
- LILRB2 antagonism suppressed LPS-induced CD274 (PD-L1) expression in activated monocytes from healthy donors (FIG.
- LILRB2 may have broader impacts on reversing immunosuppressive function of tumor-associated macrophages to enhance the efficacy of immune checkpoint inhibitors.
- Our data provided strong evidence that LILRB2 antagonism could be a promising approach for reprogramming TAM in the tumor microenvironment, thereby enhancing adaptive anti-tumor immunity.
- NSG-SGM3 (Stock No. 013062) and MISTRG mice (Stock No. 017712) were purchased from Jackson Laboratory (Bar Harbor, ME).
- NCG mice (Stock No. 572) were purchased from Charles River Laboratories (Wilmington, MA). All animal experiments were conducted in accordance with the animal guidelines of the Icahn School of Medicine at Mount Sinai and the Houston Cincinnati Research Institute.
- Lilrbl-4 and Lilral expressing 2B4 reporter cells were generated by transfection with plasmids carrying corresponding Lilr-Fc fusion genes followed by selection by GS/MAS systems and maintained in Dulbecco’s modified Eagle’s medium (DMEM, Coming Cellgro, Manassas, VA) containing 10% fetal bovine serum (FBS, Atlantic Biologicals, Atlantic, GA) + 100 nM penicillin/streptomycin (Life Technologies).
- DMEM Dulbecco’s modified Eagle’s medium
- FBS Atlantic Biologicals, Atlantic, GA
- penicillin/streptomycin Life Technologies
- THP-l cells a pro-monocytic cell line
- RPMI 1640 Coming Cellgro, Manassas, VA
- FBS 0.1 mM non- essential amino acids
- Gibco non- essential amino acids
- THP-l and human alveolar adenocarcinoma A549 cell lines were purchased from the American Type Culture Collection (Manassas, VA).
- LILRB2 + THP-l cells were generated by retroviral transfection with full-length LILRB2 plasmid.
- Anti-LILRB2 antibodies clone 42D1 and clone 287219 were purchased from Biolegend (San Diego, CA) and eBioscience (San Diego, CA), respectively.
- Anti-LILRBl clone GHI/75
- anti-LILRB3 clone MKT5.1
- anti- LILRB4 clone ZM4.1
- Anti-LILRAl clone 586326 antibody was from Novus Biologicals (Littleton, CO).
- Human anti-CD4- FITC (Clone RPA-T4), anti-CD8-PE (Clone HIT8a), anti-CD 16-FITC (Clone CB16), anti-DC-SIGN-PE (Clone eB-h209), anti-CD 163 -APC (Clone GHI/61), anti-PD-Ll- PerCP-Cy5.5 (Clone MIH1), anti-CD33-PE-Cy7 (clone WM-53), anti-CD 14- APC- Cy7 (Clone 61D3), anti-CD45-PE (clone 2D1) and anti-HLA-DR-FITC (clone LN3) were purchased from eBioscience or Biolegend.
- Mouse anti-CD l lb-PerCP (clone Ml/70), anti-CD8a-eFluor 780 (clone 53-6.7), anti-CD4-FOXP3 (clone FJK-16S), anti-CD4-FITC (clone GK1.5), anti-CD25-PE-Cy7 (clone PC61.5), anti-MHCII-PE- Cy7 (clone M5/114.15.2), anti-Ly6G-APC-Cy7 (clone 1A8) and anti-CD25-PE-Cy7 (clone PC61.5) were purchased from eBioscience or Biolegend.
- Anti-Ly6C-FITC (clone AL-21) and anti-mouse arginase l-APC (clone IC5868F) were purchased from BD Biosciences (Franklin Lakes, NJ) and R&D Systems (Minneapolis, MN), respectively.
- PBMC peripheral blood mononuclear cells
- LPS 50 ng/ml, Sigma- Aldrich, St. Louis, MO
- GolgiPlug GolgiPlug (BD Biosciences) were added at last 4 hours of cell culture.
- the cells were harvested for surface CD86 (anti-CD86-Alexa Fluor 488, clone IT2.2, Biolegend) and intracellular TNFa (anti-TNFa-PE-Cy7, clone MAB11, Biolegend) per the manufacturer’s instructions (GolgiPlug Kit, BD Biosciences).
- DAPI Sigma- Aldrich
- Binding kinetics were calculated using the Octet Red software package, which determined the best fit for the observed binding curves and calculated the association rate constants.
- LILRB2-His was dissociated by incubating the sensors in PBS with 0.1% Tween-20 and 10% DMSO. Best fit dissociation curves were determined, and the dissociation rate constants were calculated. Binding affinities (kD) were calculated as the kinetic dissociation rate constant divided by the kinetic association rate constant.
- Hybridoma cells were cultured in ClonaCell-HY Medium A (StemCell Technologies) followed by adaptation to serum-free conditions using Hybridoma- SFM (ThermoFisher Scientific). Hybridoma cells were expanded in 50 mL of Hybridoma SFM for 2 weeks or until medium was exhausted. Antibody-containing supernatant was harvested by centrifugation (800 g, 10 mins) and concentrated using Ami con Ultra- 15 centrifugal filter concentrators with a nominal molecular weight limit of 100 kDa. Concentrated supernatants were then purified using Nab Protein A/G Spin Kit (Thermo Fisher Scientific, Waltham, MA) according to manufacturer’s instructions.
- Purified antibody was desalted using ZebaTM Spin Desalting Columns, 7K MWCO (Thermo Fisher Scientific). Purified antibodies were further concentrated by centrifugal filter (Thermo Fisher Scientific), if needed. Endotoxin levels in purified antibodies were determined by PierceTM LAL Chromogenic Endotoxin Quantitation Kit (Thermo Fisher Scientific) according to manufacturer’s protocol.
- Buffy coats from healthy donors were purchased from the New York Blood Center.
- PBMC peripheral blood mononuclear cells
- CD33 + monocytes were purified from healthy PBMC donors using CD33 + magnetic beads (Miltenyi Biotech, Cat. No. 130-045-501) and treated with IgG or anti-LILRB2 (1 pg/mL) in the presence of M-CSF (50 ng/ml) (PeproTech: 300-25) for 5 days. After 5-day culture, immature macrophages were obtained for flow analysis or further stimulated with LPS (50 ng/ml) or IL4 (25 ng/ml) for 16-24 hours. The supernatants were collected and TNFa and IL10 production was determined by ELISA (eBioscience).
- A549 xenograft model in NSG-SGM3 immuno-deficient mice 3 X 10 6 A549 cells and CD33 + myeloid cells from healthy donors were suspended in 50% Matrigel (Coming, Cat: 356231) and subcutaneously co-inoculated into NSG-SGM3 mice (Jackson Laboratories, No: 013062). Each mouse received two subcutaneous A549/CD33 + implants in the right and left flank (Day 0). Anti-RB2 antibody and corresponding Ig controls were injected intravenously on day 6 and day 9 (150 pg/mice). The tumors were measured and dissected for analysis on day 12. Tumor- infiltrating lymphocytes were purified as previously described for flow cytometric analysis of M1/M2 differentiation.
- Luciferase-expressing A549 (LUC-A549) xenograft model in HLA-
- Human luciferase-A549 cancer cells (LUC-A549, from GenTarget, Inc.) (2 x 10 6 cells) were intravenously injected into NCG immuno-deficient mice on day 0.
- Human HLA-A2 + PBMC (1 x 10 7 cells) were purified and intravenously injected into test mice together with anti-LILRB2 on day 3 and day 13.
- Anti-LILRB2 and IgG (200 pg/mice) were given once every three days for a total of 8 injections.
- Anti-PD-l (Nivolumab) was given once per week (200 pg/mice) for a total of 3 injections.
- the LUC-A549 tumor-bearing mice were monitored for bioluminescent imaging of luciferase activity using the IVIS Spectrum In Vivo Imaging System and Living Image software (Perkin Elmer, Inc.).
- 250 pl luciferin at 15 mg/ml; PerkinElmer, Waltham, MA
- was administered intraperitoneally prior to imaging, 250 pl luciferin (at 15 mg/ml; PerkinElmer, Waltham, MA) was administered intraperitoneally.
- the mice were anesthetized by isoflurane inhalation and imaged. Tumor progression was quantified by bioluminescence signals (Avg Radiance [p/s/cm 2 /sr]) from the lungs 25 days after tumor inoculation.
- BAC bacterial artificial chromosome
- BAC clones for both the human Lilrb2 and Lilrb3 genes were isolated from a human BAC library (BACPAK Resources Center). BAC DNA was purified by NucleoBond Xtra Midi EF Kit. The identity of BAC DNA was confirmed via PCR for our gene of interest ( Lilrb2 ), then microinjected into embryonic stem (ES) cells. Germline transmission of the targeted allele was confirmed by PCR and flow cytometry.
- LLC Lewis lung carcinoma
- Lewis lung carcinoma (LLC) tumor cells (4 x 10 5 cells) were subcutaneously injected into LILRB2 B6 transgenic mice. Antibody treatments were started when tumors reached 2 mm x 2 mm. Anti-LILRB2 (200 pg/mouse) treatment was started on day 4 after tumor inoculation for a total of 6 injections. Anti-PD-Ll (200 pg/mouse) treatment was started with the second injection of Anti-LILRB2 for a total of 5 injections. The tumors were dissected for analysis on day 21. Splenocytes and tumor-infiltrating lymphocytes were purified for flow cytometric analysis on MDSC and Treg populations.
- LLC Lewis lung carcinoma
- Humanized MISTRG mice were screened by assessing human CD33 + cell engraftment and equally distributed between human IgG control and anti-LILRB2 groups.
- the test mice were intraperitoneally injected with anti-LILRB2 Ab (150 pg/mouse) for 48 hours.
- Peripheral blood cells were isolated and incubated with E. coli expressing GFP at the ratio of 2* l0 8 E. Coli per 1 * 10 7 peripheral blood cells for 4 h at 37°C. Duplicates per mouse were performed. After the incubation, the cells were washed with PBS and analyzed by gating on viable CD45+CD33+CD14+ population.
- MISTRG newborns received a low-dose of radiation 150 rad
- 5 X 10 4 CD34 + human stem cells from cord blood (StemCell Technologies, Cat. 70008) as previously described (73).
- LILRB2-transduced THP-l cells were treated with 1 pg/ml IgG or anti- LILRB2 for 24 h followed by acute stimulation with 50 ng/ml LPS, 20 ng/ml IFNy, or 20 ng/ml IL4 for 5, 10, 30 minutes.
- the cells were lysed using cell lysis reagent (Sigma-Aldrich). Protein samples were separated on 8% sodium dodecyl sulfate (SDS)-polyacrylamide gels and transferred to PVDF membranes. The membranes were blocked in 4% skim milk solution, incubated with an appropriate antibody, and subsequently incubated with a secondary antibody conjugated to horseradish peroxidase.
- SDS sodium dodecyl sulfate
- the antibodies for p-STATl, p-ERKl/2, p-p38, p-NF-KBp65, p-STAT6, SOCS1, SOCS3, p-Akt, SHP-l and p-SHP-l were purchased from Cell Signaling Technology (Beverly, MA), and the antibody for actin was purchased from Santa Cruz Biotechnology (Dallas, TX).
- the immunoreactive bands were visualized with the ECL system (Thermo Scientific).
- LILRB2 + THP-l cells were treated with IgG or anti-LILRB2 for 24 h and 0.1 mM Na3V04 (Sigma-Aldrich) for the last hour.
- the cells were lysed using cell lysis buffer including 1 mM Na3V04 and 25 mM alpha-glycerophosphate.
- Dynabeads protein G (Life Technologies, Carlsbad, CA) was used for pull-down.
- the pull-down samples were subjected to immunoblot assay and probed by anti-LILRB2, anti-SHP-l, and anti-p-SHP-l.
- Mature dendritic cells for use as stimulator cells were generated by culturing sorted CDl4 + monocytes in the presence of human GM-CSF (50 ng/ml) (PeproTech, Rocky Hill, NJ) for 5 days followed by LPS stimulation. IgG or anti-LILRB2-treated mature macrophages were generated as previously described. Allogeneic T cells as responder cells were purified from unrelated healthy donors and co-cultured with mature dendritic cells and titrated ratios of macrophages for 72 hours (FIG. 17A). No antibody was present in the culture for the duration of the MLR. Cells and supernatants from MLRs were analyzed for CD4 and CD8 T cell number by FACS and IFNy secretion by ELISA.
- Differential gene expression analysis was performed using the limma R package, and significantly differentially expressed genes were identified based on a fold change of >1.5 and a p-value of ⁇ 0.05 with Benjamini & Hochberg false-discovery rate correction.
- Heatmaps of differentially expressed genes were created using the plots R package, and unsupervised hierarchical clustering was performed based on Euclidean distance. Expression values were z-score normalized, and high and low expression are shown as red and green, respectively, with intermediate expression as white.
- Principal component analysis was performed using the prcomp function in R.
- the accession number for the microarray data is GSE117340.
- RT-PCR Reverse transcriptase-polymerase chain reaction
- RT-PCR was performed on total RNA prepared by the Tri Reagent Method. Two pg of RNA was used for cDNA synthesis using M-MLV reverse transcriptase (Promega, Madison, WI) and oligo (dT) 18 (Thermo Scientific). Indicated below are the sequences of 5’ and 3’ primers used for each of the tested genes, respectively.
- GCCTTCGGTGTATTTCCCTG (SEQ ID NO:37l); IRF7, Forward: 5’CCCAGCAGGTAGCATTCCC (SEQ ID NO:372); Reverse: 5’GCAGCAGTTCCTCCGTGTAG (SEQ ID NO:373).
- TIL mesothelioma-derived infiltrating lymphocytes
- PIR-B immunoglobulin-like receptor B
- IRF5 promotes inflammatory macrophage polarization and TH1-TH17 responses. Nat Immunol. 2011 ; l2(3):231-8.
- Tanoue T, Moriguchi T, and Nishida E Molecular cloning and characterization of a novel dual specificity phosphatase, MKP-5. J Biol Chem. 1999;274(28): 19949-56. 51. Li JP, Yang CY, Chuang HC, Lan JL, Chen DY, Chen YM, et al. The phosphatase JKAP/DUSP22 inhibits T-cell receptor signalling and autoimmunity by inactivating Lck. Nat Commun. 20l4;5:36l8.
- IL-6 switches the differentiation of monocytes from dendritic cells to macrophages. Nature immunology. 2000;l(6):5l0-4.
- SOCS-l and SOCS-3 inhibit IL-4 and IL-13 induced activation of Eotaxin- 3/CCL26 gene expression in HEK293 cells. Mol Immunol. 2005;42(3):295- 303.
- SOCS3 is a modulator of human macrophage phagocytosis. J Leukoc Biol.
- the Tumor Microenvironment Regulates Sensitivity of Murine Lung Tumors to PD-1/PD-L1 Antibody Blockade. Cancer Immunol Res. 20l7;5(9):767-77.
- Kang S Nakanishi Y, Kioi Y, Okuzaki D, Kimura T, Takamatsu H, et al.
- Semaphorin 6D reverse signaling controls macrophage lipid metabolism and anti-inflammatory polarization. Nat Immunol. 20l8;l9(6):56l-70.
- Anti-LILRB2 antibodies modulate IFN gamma release in vitro and inhibited allogeneic T cell proliferation in vitro.
- FIGs. 23A - 23C are graphs showing OKT3 -mediated T cell proliferation (CPM) following stimulation of PBMC from healthy donors.
- PBMC were cultured with LILRB2 antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) anti-CD3 (OKT3) for 3 days.
- [3H] -thymidine was added for the last 8 hours of culture followed by measurement on a scintillation counter.
- Clone ranking based on TNF alpha from FIG. 1A is presented.
- the relative fold change in T-cell proliferation (CPM) is presented in FIG. 23A.
- T-cell proliferation is shown in FIG. 23B.
- the overall difference in T-cell proliferation from FIG. 23B is presented in FIG. 23C.
- FIGs. 23D - 23F are graphs showing the IFN-g production from PBMCs obtained from healthy donors.
- PBMCs were cultured with LILRB2 antibodies overnight (16 hours) and stimulated with a low dose (0.01 pg/ml) anti-CD3 (OKT3) for 3 days.
- Supernatants were collected and IFN-g production was measured by ELISA.
- Clone ranking based on TNF alpha from FIG. 1A is presented.
- the relative fold change in IFN-g production release is presented in FIG. 23D.
- the secretion of IL-10 is shown in FIG. 23E.
- the overall difference in IL-10 concentrations from FIG. 23E is presented in FIG. 23F.
- FIG. 23G shows the suppression of T cell IFN-g production upon treatment with anti-LILRB2 agonist antibodies.
- FIG. 231 shows suppression of the MLR reaction by the anti-LILRB2 agonist antibodies.
- Example 11 Anti-LILRB2 CAR T-cells
- LILRB2 CARs were generated using the 1H3 Fab region.
- FIG. 24 shows that anti-LILRB2 CAR-T cells demonstrated specific activation and cytokine release when stimulated by LILRB2+ leukemia cells, e.g., THP-l.
- LILRB2+ leukemia cells e.g., THP-l.
- anti-LILRB2-CAR-T short form vector FIG. 24, upper panel
- anti- LILRB2 CAR-T cells displayed activation specificity to target LILRB2 proteins.
- the anti-LILRB2 CAR-T cells were co-cultured with LILRB2-expressing THP1 cells or parental THP1 cells for 24 hours at a target: effector (T:E) ratio ranging from 1: 1 to 1 : 10.
- T:E effector
- Anti-LILRB2 CAR-T cells displayed cytokine release specificity to target LILRB2 proteins. Supernatant was collected after a 24-hour co-culture of anti- LILRB2 CAR-T cells with LILRB2-expressing THP1 cells or parental THP1 cells at a target: effector (T:E) ranging from 1: 1 to 1 : 10. Cytokine release was assayed for interferon g (IFNy) by ELISA. T cells without transduction were used as control.
- IFNy interferon g
- FIG. 25 shows that anti-LILRB2 CAR-T cells demonstrated specific activation and cytokine release when stimulated by LILRB2+ leukemia cells.
- anti-LILRB2-CAR-T long form vector FIG. 25, upper panel
- anti-LILRB2 CAR-T cells displayed activation specificity to target LILRB2 proteins.
- the anti-LILRB2 CAR-T cells were co-cultured with LILRB2-expressing THP1 cells or parental THP1 cells for 24 hours at a target: effector ratio ranging from 1: 1 to 1 : 10.
- CAR-T cell activation was determined by detection of 41BB expression using flow cytometry. T cells without transduction were used as control.
- FIG. 25 shows that anti-LILRB2 CAR-T cells demonstrated specific activation and cytokine release when stimulated by LILRB2+ leukemia cells.
- anti-LILRB2-CAR-T long form vector FIG. 25, upper panel
- anti-LILRB2 CAR-T cells displayed activation
- Anti- LILRB2 CAR-T cells displayed cytokine release specificity to target LILRB2 proteins.
- Supernatant was collected after a 24-hour co-culture of anti-LILRB2 CAR-T cells with LILRB2-expressing THP1 cells or parental THP1 cells at target: effector ratio ranging from 1 : 1 to 1 : 10.
- Cytokine release was assayed for interferon g (IFNy) by ELISA. T cells without transduction were used as control.
- FIG. 26 shows that anti-LILRB2 CAR-T cells demonstrated binding specificity to target LILRB2.
- Anti-LILRB2 CAR-T cells both short (FIG. 26, upper panel) and long (FIG. 26, lower panel) form, were co-cultured with LILRB2- expressing THP1 cells, LILRB3 -expressing THP1 cells, or parental THP1 cells for 24 hours.
- CAR-T cell activation was determined by detection of 41BB expression using flow cytometry. T cells without transduction were used as control.
- FIG. 27 shows that anti-LILRB2 CAR-T cells demonstrated binding specificity to target LILRB2 protein in HT29 colon cancer cells.
- Anti-LILRB2 CAR- T cells were co-cultured with LILRB2-, LILRB3-expressing HT29 cells, or HT29 control cells for 24 hours.
- CAR-T cell activation was determined by detection of activation markers on 41BB expression using flow cytometry.
- CAR-T cells stimulated with OKT3 were used as positive control for CAR-T cell activation. T cells without transduction were used as control.
- FIG. 28 shows that Anti-LILRB2 CAR-T cells displayed efficient cytotoxicity against LILRB2-expressing leukemia cells in vitro.
- LILRB2-expressing leukemia cells B2-THP1
- B2-THP1 LILRB2-expressing leukemia cells
- anti-LILRB2 CAR-T left bars
- untransduced T cells riht bars
- FIG. 29 shows the experimental design for demonstration the efficacy of the anti-LILRB2 CAR-T cells in the THP1-LILRB2 xenograft mouse model.
- NSG- SGM3 mice were injected with LILRB2-expressing THP1 cells on day 0, and treated with untransduced T cells (control) or anti-LILRB2 CAR-T cells on day 8, 15, 22 and 30. Bioluminescent images were taken weekly.
- FIGs. 30-33 show that anti-LILRB2 CAR-T cells reduced leukemia burden in the THP1-LILRB2 xenograft mouse model.
- NSG-SGM3 mice were injected with LILRB2-expressing THP1 cells on day 0, and treated with untransduced T cells (control) or anti-LILRB2 CAR-T cells on day 8, 15, 22 and 30.
- Bioluminescent images (BLI) were taken weekly.
- FIG. 30 shows weekly BLI of mice treated with untransduced T cells (left) or anti-LILRB2- CAR-T cells (right); images were taken from the back of mice.
- FIG. 31 shows weekly BLI of mice treated with untransduced T cells (left) or anti-LILRB2- CAR-T cells (right); images were taken from the abdomen.
- FIG. 32 shows plots of total flux (p/s) as a function of time; each shape represents an individual mouse in the treatment group.
- FIG. 32 demonstrates that anti-LILRB2 CAR-T cells (right) decreased leukemia burden as compared to the control T cell-treated (left) mice.
- FIG. 33 shows the quantification results of leukemia burden in total flux (left panel) and average radiance (right panel). Mice treated with anti-LILRB2 CAR-T cells (squares) showed decrease of the tumor burden compared to the untransduced T cell-treated mice (circles).
- FIG. 34 shows that anti-LILRB4 CAR-T cells demonstrated cytotoxicity against LILRB4 protein expressing human AML cells.
- Example 13 Anti-LILRB2 Ab abrogates MDSCs-mediated suppression of CAR- T cells. Given the strong functional activities of Anti-LILRB2 on macrophages maturation, we investigated whether anti-LILRB2 (antibody 20D3 with human IgG4) could abolish MDSCs-mediated suppression of CAR-T cells proliferation. We generated in vitro-cultured monocyte-derived MDSCs and co-cultured with CAR-T cells in presence of target tumor cells. MDCSs significantly suppressed CAR-T cell proliferation induced by target tumor cells, i.e., AML (THP-l) (FIG. 35A) or Her-2 positive head and neck solid cancer (SCC-47) (FIG. 35B).
- AML AML
- SCC-47 Her-2 positive head and neck solid cancer
- anti-LILRB2 antibody abrogated MDSCs-mediated suppression, reinvigorated both CD4 and CD8 T cells proliferation (FIG. 35B) and enhanced the CAR-T mediated killing effect on tumor cells as well as MDSC that are LILRB2 positive (Fig. 35A).
- anti-LILRB2 can overcome MDSCs-mediated suppression and enhance CAR-T cell proliferation.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Cell Biology (AREA)
- Transplantation (AREA)
- Communicable Diseases (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3111862A CA3111862A1 (en) | 2018-09-17 | 2019-09-17 | Anti-lilrb2 antibodies and methods of use thereof |
| KR1020217011459A KR20210108940A (ko) | 2018-09-17 | 2019-09-17 | 항-lilrb2 항체 및 이의 이용 방법 |
| CN201980075255.5A CN113543804A (zh) | 2018-09-17 | 2019-09-17 | 抗lilrb2抗体及其使用方法 |
| AU2019343131A AU2019343131A1 (en) | 2018-09-17 | 2019-09-17 | Anti-LILRB2 antibodies and methods of use thereof |
| JP2021539483A JP2022501428A (ja) | 2018-09-17 | 2019-09-17 | 抗lilrb2抗体およびその使用の方法 |
| EP19863793.6A EP3852805A4 (en) | 2018-09-17 | 2019-09-17 | ANTI-LILRB2 ANTIBODIES AND METHODS OF USE THEREOF |
| US17/276,324 US12157768B2 (en) | 2018-09-17 | 2019-09-17 | Anti-LILRB2 antibodies and methods of use thereof |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862732299P | 2018-09-17 | 2018-09-17 | |
| US201862732334P | 2018-09-17 | 2018-09-17 | |
| US62/732,299 | 2018-09-17 | ||
| US62/732,334 | 2018-09-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020061059A1 true WO2020061059A1 (en) | 2020-03-26 |
Family
ID=69888746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/051529 Ceased WO2020061059A1 (en) | 2018-09-17 | 2019-09-17 | Anti-lilrb2 antibodies and methods of use thereof |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US12157768B2 (https=) |
| EP (1) | EP3852805A4 (https=) |
| JP (1) | JP2022501428A (https=) |
| KR (1) | KR20210108940A (https=) |
| CN (1) | CN113543804A (https=) |
| AU (1) | AU2019343131A1 (https=) |
| CA (1) | CA3111862A1 (https=) |
| WO (1) | WO2020061059A1 (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021225954A1 (en) * | 2020-05-04 | 2021-11-11 | The Regents Of The University Of California | Inhibiting anti-enpp1 antibodies |
| EP3981789A1 (en) | 2020-10-12 | 2022-04-13 | Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives | Anti-lilrb antibodies and uses thereof |
| US11401328B2 (en) | 2018-07-09 | 2022-08-02 | Five Prime Therapeutics, Inc. | Antibodies binding to ILT4 |
| WO2022187968A1 (en) * | 2021-03-11 | 2022-09-15 | University Health Network | Lilrb1 and lilrb2-binding molecules and uses therefor |
| WO2023279107A1 (en) * | 2021-07-01 | 2023-01-05 | Albert Einstein College Of Medicine | Compositions and methods for inhibiting the expression of tmigd2 |
| US20230050449A1 (en) * | 2019-12-20 | 2023-02-16 | Merck Sharp & Dohme Llc | Methods for treating cancer using a combination of a pd-1 antagonist, an ilt4 antagonist, and chemotherapeutic agents |
| WO2023192850A1 (en) * | 2022-03-29 | 2023-10-05 | Ngm Biopharmaceuticals, Inc. | Ilt3 and cd3 binding agents and methods of use thereof |
| WO2024041315A1 (en) * | 2022-08-22 | 2024-02-29 | Antengene (Hangzhou) Biologics Co., Ltd. | Novel anti-lilrb2 antibodies and uses thereof |
| EP4232087A4 (en) * | 2020-10-21 | 2024-10-09 | Immune-ONC Therapeutics, Inc. | NOVEL ANTI-LILRB2 ANTIBODIES AND DERIVED PRODUCTS |
| WO2024155891A3 (en) * | 2023-01-20 | 2024-10-24 | Washington University | Lilrb4/ilt3 antagonist compositions and methods of use thereof |
| EP4213879A4 (en) * | 2020-09-17 | 2024-10-30 | Merck Sharp & Dohme LLC | DOSAGE REGIMEN OF AN ANTI-ILT4 ANTIBODY OR ITS COMBINATION WITH AN ANTI-PD-1 ANTIBODY FOR TREATING CANCER |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023235706A1 (en) * | 2022-05-31 | 2023-12-07 | Ngm Biopharmaceuticals, Inc. | Combination therapies using ilt-binding agents and pd-1 inhibitors |
| CN116333128B (zh) * | 2022-06-28 | 2026-03-24 | 北京科诺信诚科技有限公司 | 靶向人lilrb2的纳米抗体及其应用 |
| CN116082504A (zh) * | 2022-06-28 | 2023-05-09 | 北京科诺信诚科技有限公司 | 靶向人lilrb2的纳米抗体及其应用 |
| CN119604531A (zh) * | 2022-07-29 | 2025-03-11 | 盛禾(中国)生物制药有限公司 | 一种抗ilt4的单域抗体及其应用 |
| JP2025532504A (ja) * | 2022-09-08 | 2025-10-01 | 江蘇恒瑞医薬股▲ふん▼有限公司 | 抗ilt4抗体及びその医薬的使用 |
| KR20250090398A (ko) * | 2022-09-28 | 2025-06-19 | 스팍스 바이오사이언스 리미티드 | 백혈구 면역글로불린 유사 수용체 하위 패밀리 b 구성원 2(lilrb2)에 결합하는 항체 및 그 용도 |
| CN120548326A (zh) * | 2022-12-23 | 2025-08-26 | 艾奥麦克斯治疗公司 | 靶向白细胞免疫球蛋白样受体亚家族b1(lilrb1)和lilrb2的交叉特异性抗原结合蛋白(abp)、其组合和用途 |
| EP4491230A1 (en) * | 2023-07-14 | 2025-01-15 | iOmx Therapeutics AG | Cross-specific antigen binding proteins (abp) targeting leukocyte immunoglobulin-like receptor subfamily b1 (lilrb1) and lilrb2, combinations and uses thereof |
| CN116789826A (zh) * | 2023-05-12 | 2023-09-22 | 南京师范大学 | 抗人lilrb2全人源单域抗体及其应用 |
| CN119176874A (zh) * | 2023-06-21 | 2024-12-24 | 康源博创生物科技(北京)有限公司 | 一种能够结合lilrb2的抗体或其抗原结合片段 |
| WO2025128822A1 (en) * | 2023-12-12 | 2025-06-19 | The Methodist Hospital | Lilrb3 modulators and methods of use thereof |
| GB202319149D0 (en) * | 2023-12-14 | 2024-01-31 | Kbio Holdings Ltd | Antibody |
| CN121299117B (zh) * | 2025-12-05 | 2026-03-27 | 中国农业科学院都市农业研究所 | 检测猪轮状病毒的试剂和纳米酶免疫层析试纸条及其应用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150284460A1 (en) * | 2012-10-26 | 2015-10-08 | Deutsches Rheuma-Forschungszentrum Berlin | Bi-specific affinity reagents for cell-lineage-specific tnf-alpha neutralisation |
| US20160011217A1 (en) * | 2013-02-28 | 2016-01-14 | National Cancer Center | Antibody against insoluble fibrin |
| US20180086829A1 (en) * | 2015-03-06 | 2018-03-29 | The Board Of Regents Of The University Of Texas System | Anti-lilrb antibodies and their use in detecting and treating cancer |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10138286B2 (en) | 2013-03-12 | 2018-11-27 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for inhibiting the effects of amyloid beta oligomers |
| KR20170007449A (ko) * | 2014-05-22 | 2017-01-18 | 프레드 헛친슨 켄서 리서치 센터 | 조혈 전구체 세포의 lilrb2 및 노치 매개 증식 |
| US20160200815A1 (en) * | 2015-01-05 | 2016-07-14 | Jounce Therapeutics, Inc. | Antibodies that inhibit tim-3:lilrb2 interactions and uses thereof |
| TWI780083B (zh) | 2016-11-18 | 2022-10-11 | 丹麥商賽門弗鎮公司 | 抗pd-1抗體及組成物 |
| TWI796329B (zh) * | 2017-04-07 | 2023-03-21 | 美商默沙東有限責任公司 | 抗-ilt4抗體及抗原結合片段 |
-
2019
- 2019-09-17 KR KR1020217011459A patent/KR20210108940A/ko not_active Withdrawn
- 2019-09-17 AU AU2019343131A patent/AU2019343131A1/en not_active Abandoned
- 2019-09-17 EP EP19863793.6A patent/EP3852805A4/en not_active Withdrawn
- 2019-09-17 WO PCT/US2019/051529 patent/WO2020061059A1/en not_active Ceased
- 2019-09-17 JP JP2021539483A patent/JP2022501428A/ja active Pending
- 2019-09-17 CA CA3111862A patent/CA3111862A1/en active Pending
- 2019-09-17 CN CN201980075255.5A patent/CN113543804A/zh active Pending
- 2019-09-17 US US17/276,324 patent/US12157768B2/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150284460A1 (en) * | 2012-10-26 | 2015-10-08 | Deutsches Rheuma-Forschungszentrum Berlin | Bi-specific affinity reagents for cell-lineage-specific tnf-alpha neutralisation |
| US20160011217A1 (en) * | 2013-02-28 | 2016-01-14 | National Cancer Center | Antibody against insoluble fibrin |
| US20180086829A1 (en) * | 2015-03-06 | 2018-03-29 | The Board Of Regents Of The University Of Texas System | Anti-lilrb antibodies and their use in detecting and treating cancer |
Non-Patent Citations (3)
| Title |
|---|
| AN, H ET AL.: "Soluble LILRA3 promotes neurite outgrowth and synapses formation through a high-affinity interaction with Nogo 66", JOURNAL OF CELL SCIENCE, vol. 129, no. 6, 29 January 2016 (2016-01-29), pages 1198 - 1209, XP055694887, ISSN: 0021-9533, DOI: 10.1242/jcs.182006 * |
| See also references of EP3852805A4 * |
| ZHANG, J ET AL.: "Leukocyte immunoglobulin-like receptors in human diseases: an overview of their distribution, function, and potential application for immunotherapies", JOURNAL OF LEUKOCYTE BIOLOGY, vol. 102, no. 2, 28 March 2017 (2017-03-28), pages 351 - 360, XP055694885, ISSN: 0741-5400, DOI: 10.1189/jlb.5MR1216-534R * |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11401328B2 (en) | 2018-07-09 | 2022-08-02 | Five Prime Therapeutics, Inc. | Antibodies binding to ILT4 |
| US12435136B2 (en) | 2018-07-09 | 2025-10-07 | Five Prime Therapeutics, Inc. | Antibodies binding to ILT4 |
| US20230050449A1 (en) * | 2019-12-20 | 2023-02-16 | Merck Sharp & Dohme Llc | Methods for treating cancer using a combination of a pd-1 antagonist, an ilt4 antagonist, and chemotherapeutic agents |
| EP4146706A4 (en) * | 2020-05-04 | 2024-05-29 | The Regents of the University of California | INHIBITION OF ANTI-ENPP1 ANTIBODIES |
| US12473372B2 (en) | 2020-05-04 | 2025-11-18 | The Regents Of The University Of California | Inhibiting anti-ENPP1 antibodies |
| US11834512B2 (en) | 2020-05-04 | 2023-12-05 | The Regents Of The University Of California | Inhibiting anti-ENPP1 antibodies |
| WO2021225954A1 (en) * | 2020-05-04 | 2021-11-11 | The Regents Of The University Of California | Inhibiting anti-enpp1 antibodies |
| EP4213879A4 (en) * | 2020-09-17 | 2024-10-30 | Merck Sharp & Dohme LLC | DOSAGE REGIMEN OF AN ANTI-ILT4 ANTIBODY OR ITS COMBINATION WITH AN ANTI-PD-1 ANTIBODY FOR TREATING CANCER |
| EP3981789A1 (en) | 2020-10-12 | 2022-04-13 | Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives | Anti-lilrb antibodies and uses thereof |
| WO2022079045A1 (en) | 2020-10-12 | 2022-04-21 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | Anti-lilrb antibodies and uses thereof |
| EP4232087A4 (en) * | 2020-10-21 | 2024-10-09 | Immune-ONC Therapeutics, Inc. | NOVEL ANTI-LILRB2 ANTIBODIES AND DERIVED PRODUCTS |
| CN117321083A (zh) * | 2021-03-11 | 2023-12-29 | 大学保健网 | Lilrb1和lilrb2结合分子及其用途 |
| WO2022187968A1 (en) * | 2021-03-11 | 2022-09-15 | University Health Network | Lilrb1 and lilrb2-binding molecules and uses therefor |
| WO2023279107A1 (en) * | 2021-07-01 | 2023-01-05 | Albert Einstein College Of Medicine | Compositions and methods for inhibiting the expression of tmigd2 |
| WO2023192850A1 (en) * | 2022-03-29 | 2023-10-05 | Ngm Biopharmaceuticals, Inc. | Ilt3 and cd3 binding agents and methods of use thereof |
| WO2024041315A1 (en) * | 2022-08-22 | 2024-02-29 | Antengene (Hangzhou) Biologics Co., Ltd. | Novel anti-lilrb2 antibodies and uses thereof |
| WO2024155891A3 (en) * | 2023-01-20 | 2024-10-24 | Washington University | Lilrb4/ilt3 antagonist compositions and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220056128A1 (en) | 2022-02-24 |
| AU2019343131A1 (en) | 2021-04-29 |
| EP3852805A1 (en) | 2021-07-28 |
| CN113543804A (zh) | 2021-10-22 |
| EP3852805A4 (en) | 2022-06-15 |
| KR20210108940A (ko) | 2021-09-03 |
| JP2022501428A (ja) | 2022-01-06 |
| CA3111862A1 (en) | 2020-03-26 |
| US12157768B2 (en) | 2024-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12157768B2 (en) | Anti-LILRB2 antibodies and methods of use thereof | |
| US20240158538A1 (en) | Vista antigen-binding molecules | |
| US11787858B2 (en) | Anti-LILRB3 antibodies and methods of use thereof | |
| US11873346B2 (en) | VISTA antigen-binding molecules | |
| JP2022518925A (ja) | 受容体チロシンキナーゼ様オーファン受容体1(ror1)に特異的な抗体およびキメラ抗原受容体 | |
| ES2961666T3 (es) | Métodos para determinar la dosificación de células CAR-T | |
| JP2022513778A (ja) | キメラ抗原受容体及びt細胞受容体並びに使用方法 | |
| JP2021501605A (ja) | B細胞成熟抗原に特異的な抗体およびキメラ抗原受容体 | |
| WO2020212710A1 (en) | Antagonists anti-cd7 antibodies | |
| JP2022512917A (ja) | B細胞成熟抗原に特異的なキメラ抗原受容体を使用する処置方法 | |
| TW201833135A (zh) | 抗-TGF-β抗體及其用途 | |
| TW202128131A (zh) | 重組抗程式性細胞死亡受體1和抗分化抗原簇137雙特異性抗體製劑及其用途 | |
| US20260098093A1 (en) | Treatment and prevention of cancer using vista antigen-binding molecules | |
| WO2024035342A1 (en) | B7-h3 antigen-binding molecules | |
| US20250313631A1 (en) | Treatment and prevention of cancer using vista antigen-binding molecules | |
| US10626183B2 (en) | IFN-γ-inducible regulatory T cell convertible anti-cancer (IRTCA) antibody and uses thereof | |
| WO2025072871A2 (en) | ANTI-SIRPα ANTIBODY COMPOSITIONS AND USES THEREOF | |
| HK40026638B (en) | Vista antigen-binding molecules | |
| HK40026638A (en) | Vista antigen-binding molecules | |
| HK40015176A (zh) | 抗lilrb3抗体及其使用方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19863793 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3111862 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021539483 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20217011459 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019343131 Country of ref document: AU Date of ref document: 20190917 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019863793 Country of ref document: EP Effective date: 20210419 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 774120 Country of ref document: NZ |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2019863793 Country of ref document: EP |