WO2020052603A1 - Gene chip and kit for noninvasive prenatal testing of bilateral cupped ear deformity, and application method of gene chip - Google Patents

Abstract

Disclosed are a gene chip and kit for noninvasive prenatal testing of bilateral cupped ear deformity, and an application method of a gene chip. The gene chip comprises a substrate; a probe group for testing the gene related to bilateral cupped ear deformity is provided on the substrate to form a microarray gene chip; the probe group comprises ten probes. The kit comprises the gene chip. The gene chip features high sensitivity, accuracy, and high speed, can quickly screen variations of the gene related to the bilateral cupped ear deformity, and improves the diagnosis of the bilateral cupped ear deformity to a genetic level.

Description

Gene chip, kit and gene chip application method for non-invasive prenatal detection of bilateral goblet ear deformities Technical field

The invention relates to the technical field of biology and medicine, in particular to a gene chip, a kit and a method for applying the gene chip for noninvasive prenatal detection of bilateral goblet ear malformations.

Background technique

Congenital ear deformity is a common birth defect that affects the position and shape of the ear, and abnormal cartilage development in the ear often affects the shape and normal function of the ear. Epidemiological investigations show that about 5% of the samples in the population have congenital ear developmental deformities of varying degrees, which mainly include stroke ears, goblet ear deformities, and congenital microtia (or auricular) deformities.

Goblet ear deformity is one of the congenital ear deformities. It is a congenital malformation between Zhaofeng ear and microtia. The main clinical phenotype is: tightening of the upper part of the ear, the ear and the ear. The cartilage is curled and sticky, the caster foot is shifted downward, the caster and its hind foot are flattened or even disappeared, the caster is widened, the flange of the caster is bent toward the ear boat, the cup is shaped like a cup, and in severe cases the cup is curled into a tube. Goblet ear deformities account for about 10% of various congenital ear deformities. Unlike other common ear deformities, goblet ear deformities occur on both sides and have a significant genetic tendency.

Although goblet ear malformations are generally not accompanied by severe middle ear, inner ear deformities, or other organ deformities, appearance defects and obvious genetic tendencies caused by different degrees of severity often cause huge psychological pressure and burden on patients. Therefore, the identification of susceptible genes based on pediatric ear deformities has important scientific value and social significance.

From the perspective of developmental biology, human facial formation is mainly affected by head neural crest cells. Neural crest cells originate from the outer edge of the preset neural plate and are located at the closed position when the neural tube is closed. Part migration. The outer ear and middle ear are derived from the migration of the first and second gill arches and neural crest cells. At the 6th week of the embryo, the mesenchyme proliferates around the first gill groove, forming 6 nodular ear mounds surrounding the mouth of the external ear canal, which gradually evolves into auricles; while the middle ear is mainly differentiated by the mesenchymal tissue of the neural crest Come. The occurrence of outer ear and middle ear is the result of neural crest cell migration and cartilage differentiation, various cell interactions, and is affected by a variety of structural and regulatory proteins and signaling pathways.

Gene chip technology refers to immobilizing a specific oligonucleotide fragment as a probe on a support, the target DNA fragment incorporating the label is amplified by PCR, hybridized according to the principle of base pairing, and the chip is then detected by a signal detection system. Scan and compare and detect the signal on each probe with relevant analysis software. This technology has been widely used in the field of disease detection.

The traditional method for the diagnosis of bilateral cup ear deformities does not have a special prenatal detection method. It can only wait for surgery after birth, which brings double mental and physical pain to the patient. Therefore, it is necessary to find a high-sensitivity non-invasive prenatal diagnosis of bilateral goblet ear deformity genetic disease.

Based on the results of previous studies, we collected pregnant women's peripheral blood, extracted fetal free DNA (cf-fDNA) from pregnant women's peripheral blood, used specific primers or probe pairs for amplification detection, and performed fertility risk assessment of bilateral goblet ear deformities. Provide more choices and warnings for children and parents, and provide powerful tools for eugenics.

Summary of the Invention

The purpose of the present invention is to provide a gene chip, a kit and a gene chip application method for non-invasive prenatal detection of bilateral goblet ear deformities, so as to overcome the deficiencies mentioned in the prior art. The object of the present invention is achieved by the following technical solutions:

One aspect of the present invention is to provide a gene chip for non-invasive prenatal detection of bilateral goblet ear deformities. The gene chip includes a base, and the base is provided with genes for detecting bilateral goblet ear deformities. The probe set forms a microarray gene chip.

The probe set includes 10 probes, and the sequence of each probe is as follows:

(1) Probe P1: its nucleotide sequence is GTGGGTTATTGGGGGGAAGAAC;

(2) Probe P2: its nucleotide sequence is TAAATATTGCAGTTGACTTTATT;

(3) Probe P3: its nucleotide sequence is CAGGTTCGAGACACGGATCGCAT;

(4) Probe P4: its nucleotide sequence is CTGTCAACAGAGGAGAAAGCCTG;

(5) Probe P5: its nucleotide sequence is ATGGTGTCTGCAGCAGGAGGC;

(6) Probe P6: its nucleotide sequence is TTATCTCTTGTATGTAACTTGA;

(7) Probe P7: its nucleotide sequence is GTGGCAACTAAGAACCAACATT;

(8) Probe P8: its nucleotide sequence is GGCCTGTGAGTCCCTCTGCCAGGTG;

(9) Probe P9: its nucleotide sequence is CCCACAGCCGGCTCCTGGCCTGG;

(10) Probe P10: its nucleotide sequence is TCCCTTCCCTAACGCCCCCTGAG;

In the probes P1 to P10, the 5 'end of each probe is labeled with a fluorescent group, and the 3' end thereof is labeled with a quenching group.

Further, the film base includes a glass slide, a silicon wafer, or a film as a carrier.

Further, on the gene chip, each of the probes is provided with 3, and then the gene chip contains 30 of the probes.

Further, a positive quality control probe, a negative quality control probe, and a blank control probe are also fixed on the gene chip; preferably, each of the positive quality control probe, the negative quality control probe and the white control probe is provided with three A total of 39 probes were immobilized on the gene chip.

Further, in the above (1) to (10), the fluorescent group labeled at the 5 ′ end of each probe is any one of FAM, HEX, VIC, CY5, and TET; each probe The quenching group labeled at the 3 ′ end in the sintering group is any one of TAMRA, MGB, and BHQ.

Another inventive point of the present invention is to provide a method for preparing a gene chip for non-invasive prenatal detection of bilateral goblet ear malformations, which includes the following steps: acid-base pretreatment of the base, aldolization, and isothiocyanate For acid treatment, design of chip probes, and spotting of the probes, the slides were immediately baked at 80 ° C for 10 minutes to make microarray slides, stored in a box with a desiccant, and stored at room temperature.

Yet another aspect of the present invention is to provide a kit for non-invasive prenatal detection of bilateral goblet ear deformities, the kit comprising the gene chip according to any one of the above paragraphs.

Further, the kit further includes a washing solution, a lysing solution, a digestion solution, a standard DNA sample, a chip hybridization solution, and 0.2% SDS.

The last invention of the present invention is to provide a method for applying a gene chip. The method is: preparing a sample containing DNA, then quantifying the DNA sample, and then using the gene chip for hybridization.

The beneficial effects of the present invention are as follows: the present invention discloses a gene chip, and a probe with a specific base sequence is fixed on the chip to form a microarray, and then the chip is used to detect bilateral cupped ear deformities. This method has many advantages over direct use of the probe. Specifically, the detection method has simpler operation steps and shorter time. The test can usually be completed in 30 to 60 minutes, greatly reducing the time period, and the specificity of the test is good. , High resolution, high sensitivity, accuracy and speed; and high-throughput characteristics, can quickly screen for mutations in genes associated with bilateral goblet deformities, and improve the diagnosis of bilateral goblet deformities to At the genetic level; in short, this method saves time and costs, reduces patient suffering, and enables non-invasive prenatal diagnosis of fetal disease.

The microarray chip is based on cf-fDNA (mixture of fetal and maternal free DNA) in the peripheral blood of the pregnant woman to be tested as a template, and after quantitative extraction and labeling, hybridization with the chip of the present invention is performed to determine whether the fetus carries the There are genes related to bilateral goblet ear deformities; very simple, greatly reducing the error rate and time cost, improving accuracy; can be used for the diagnosis of prenatal congenital genetic diseases, and has great potential in the field of non-invasive prenatal diagnosis.

BRIEF DESCRIPTION OF THE DRAWINGS

The above and other objects, features, and advantages of the present invention will be more apparent from the following description of embodiments of the present invention with reference to the accompanying drawings, in which:

FIG. 1 is a schematic diagram of a distribution structure of probe sequences in a gene chip according to an embodiment of the present invention; FIG.

FIG. 2 is a scanning diagram of a fetus without carrying any bilateral goblet deformities and copy number variation of a regulatory region according to an embodiment of the present invention; FIG.

FIG. 3 is a scanning diagram of a copy number variation (CNV) in a regulatory region of a gene associated with bilateral goblet deformities in a fetus according to an embodiment of the present invention.

detailed description

In the following, specific experimental cases are taken as examples to explain specific implementation manners. It should be understood that the specific embodiments described here are only used to explain the present invention and are not used to limit the present invention.

Example 1

A gene chip for non-invasive prenatal detection of bilateral goblet ear deformities, the gene chip includes a substrate, and the base plate is provided with a probe set for detecting genes related to bilateral goblet deformities to form a microarray gene Chip; the probe set includes 10 probes, and the sequence of each probe is as follows: (1) probe P1: its nucleotide sequence is GTGGGTTATTGGGGGGAAGAAC; (2) probe P2: its nucleotide sequence is TAAATATTGCAGTTGACTTTATT; (3) Probe P3: Its nucleotide sequence is CAGGTTCGAGACACGGATCGCAT; (4) Probe P4: Its nucleotide sequence is CTGTCAACAGAGGAGAAAGCCTG; (5) Probe P5: Its nucleotide sequence is ATGGTGTCTGCAGCAGGAGGC; (6) Probe P6: Its nucleotide sequence is TTATCTCTTGTATGTAACTTGA; (7) Probe P7: Its nucleotide sequence is GTGGCAACTAAGAACCAACATT; (8) Probe P8: Its nucleotide sequence is GGCCTGTGAGTCCCTCTGCCAGGTG; (9) Probe P9: Its The nucleotide sequence is CCCACAGCCGGCTCCTGGCCTGG; (10) Probe P10: its nucleotide sequence is TCCCTTCCCTAACGCCCCCTGTGAG.

Preferably, the substrate includes a glass slide, a silicon wafer, or a film as a carrier; the substrate or the carrier may be made of a polymer material.

In the probes P1 to P10, the 5 'end of each probe is labeled with a fluorescent group, and the 3' end thereof is labeled with a quenching group. The sequence of the probes on the gene chip is shown in FIG. 1, that is, the probes P1 to P10 are arranged in order from left to right, and the probes are arranged in order, which facilitates the subsequent result determination.

The fluorescent group labeled at the 5 ′ end of the 10 probes is any one of FAM, HEX, VIC, CY5, and TET; the quenching group labeled at the 3 ′ end is in TAMRA, MGB, and BHQ. Either. Preferably, the fluorescent groups in the probes P1 to P13 are the same, and the quenching groups in the probes P1 to P13 are the same.

Preferably, on the gene chip, each of the probes is provided with three, that is, three times are repeated, then the gene chip contains 30 of the probes, and the position of each of them is shown in FIG. 1.

Preferably, a positive quality control probe (ie, C2 in FIG. 1), a negative quality control probe (ie, C1 in FIG. 1), and a blank control probe (ie, FIG. 1) are further fixed on the gene chip. C3); Preferably, there are 3 positive control probes, negative quality control probes, and white control probes each, for a total of 9, and a total of 39 probes are fixed on the gene chip.

In this embodiment, when detecting bilateral goblet ear deformities, it is only necessary to hybridize with the gene chip with a specific number of probes and a specific sequence fixed in this embodiment after cf-fDNA extraction and quantitative labeling, Finally, the corresponding evaluation is performed based on the hybridization results.

The 10 specific probe sequences and the coordination between the 10 sequences belong to one of the important invention points of the present invention.

Example 2

A method for preparing a gene chip for non-invasive prenatal detection of bilateral goblet ear deformities. A glass slide is selected as a carrier chip base of the gene chip. The preparation of the gene chip includes the following steps, in order: (1) loading Acid-base pretreatment of glass slides; (2) aldolization treatment; (3) isothiocyanation treatment; (4) chip probe design; (5) probe spotting; (6) chip placement after spotting Bake at 80 ° C for 10min to make microarray slides; (7) Store in a box with a desiccant and store at room temperature.

In this embodiment, the preparation method may be prepared according to a conventional method, and the focus is on the gene chip itself, not its preparation method.

Example 3

A kit for noninvasive prenatal risk assessment of congenital bilateral goblet ear deformities, the kit includes the gene chip described in Example 1.

In this embodiment, when detecting and evaluating bilateral goblet ear deformities, only cf-fDNA needs to be extracted and quantified, and then hybridized with the gene chip in which a probe with a specific sequence is immobilized in this embodiment. The results of the hybridization were evaluated accordingly.

Example 4

A method for applying a gene chip, characterized in that the method is: first, preparing a DNA-containing sample, that is, cf-fDNA, extracting and quantitatively labeling the cf-fDNA, and then using the gene chip for hybridization, After hybridization, data processing and image analysis were performed, and chip scanning was performed to evaluate the results. details as follows:

(1) Collecting blood from pregnant women and extracting fetal cf-fDNA from the blood;

S1: Prepare washing liquid (purchasing manufacturer: Changzhou Baidai Biotechnology Co., Ltd.), prepare washing liquid A and washing liquid B;

a) Washing liquid A: Take 21 ml of washing liquid and add 9 ml of absolute ethanol; if take 42 ml of washing liquid, add 18 ml of absolute ethanol.

b) Washing liquid B: Take 9 ml of washing liquid and add 21 ml of absolute ethanol; if take 18 ml of washing liquid, add 42 ml of absolute ethanol.

S2: Take a 1.5 ml centrifuge tube, add 200 μl of the collected pregnant woman blood sample, 4 μl DNA Carrier (DNA carrier, purchased by Changzhou Baidai Biotechnology Co., Ltd.) and mix well, add 300 μl of lysate (purchased by Changzhou Baidai Biological Technology Co., Ltd. Company), and 20 μl of digestive juice (purchasing manufacturer: Changzhou Baidai Biotechnology Co., Ltd.), shake and mix, and water bath at 56 ° C for 10 minutes.

S3: Add 1000 μl of absolute ethanol to the centrifuge tube in S2, gently invert and mix. If there is a translucent suspension, it will not affect the DNA extraction and subsequent experiments;

S4: Put the adsorption column into the collection tube, transfer 760 μl of the solution obtained in step S3 into the adsorption column, and let it stand for 2 minutes. Centrifuge the adsorption column containing the collection tube at 12,000 rpm and 4 ° C for 1 minute to take out the adsorption column. , Discard the waste liquid in the collection tube, put the adsorption column back into the collection tube, transfer the remaining 760 μl solution into the adsorption column, and repeat this step;

S5: Remove the liquid obtained in the collection tube in the repeated steps, and put the adsorption column back into the collection tube, add 500 μl of washing solution A to the adsorption column, and centrifuge at 12,000 rpm at 4 ° C for 1 minute. Put the column back into the collection tube;

S6: Add 500 μl of washing solution B to the adsorption column, centrifuge at 12,000 rpm and 4 ° C for 1 minute, discard the waste liquid in the collection tube, return the adsorption column to the collection tube, and centrifuge at 12,000 rpm and 4 ° C for 2 minutes to remove the remaining washing solution;

S7: Take out the adsorption column, put it into a new 1.5ml centrifuge tube, add 30-50μl eluent, let it stand for 3 minutes, and centrifuge at 12,000rpm for 2 minutes at 4 ° C to collect the cf-fDNA solution. The extracted cf-fDNA can be used in the next experiment or stored at -20 ° C.

(2) Labeling: The cf-fDNA extracted in step (1) and a standard DNA sample of a normal control (from a normal population, or can be obtained from a human genome database) are fluorescently labeled, and the sample is accurately quantified. The specific operation is as follows: Take 1ug standard DNA samples and fluorescently label them with random primers. Cf-fDNA is labeled with Fluorescein-12-dUTP, and the probe shows green fluorescence; normal control DNA is labeled with Tetramethylrhodamine-5-dUTP, and the probe shows Red fluorescence.

(3) Hybridization: first prepare a chip hybridization solution: the hybridization solution is prepared with, for example, 100 to 300 mM Hepes-HCl (pH 8.0), 1 to 3 M NaCl, 0.5 to 1 mM EDTA (pH 8.0); Take 500ng in equal proportion and mix the mixture with the hybridization solution in equal proportion. After denaturing at 95 ℃ for 10min, immediately place it in an ice bath for 5min. At the same time, rinse the gene chip in 0.2% SDS for 20s, and then ultrapure. Rinse in water for 5s, shake off the water on the surface of the gene chip, and dry at room temperature. Take 10 μl of the denatured amplification product and carefully add it to the reaction zone of the gene chip to make it evenly distributed (the hybridization reaction solution covers the hybridization reaction zone without overflow). When adding the hybridization mixture to the reaction zone of the gene chip, care should be taken not to contact the pipette tip with the gene chip, so as not to affect the probe array. The gene chip was placed flat in a hybridization box, and hybridization was performed in a water bath at a hybridization temperature to be determined for 1 hour. During the hybridization reaction, prevent condensation water from falling on the gene chip; care should be taken when moving the hybridization box to prevent cross-contamination of the reaction solution in each reaction zone. After the hybridization reaction is completed, the gene chip is rinsed in the SSC washing solution. Take out the gene chip, shake off the liquid remaining on the gene chip, and dry at room temperature.

(4) Data processing and image analysis: The hybridization results were scanned with the laser confocal gene chip scanner in step (3), and the signal analysis software was used for analysis.

Specifically, it can be operated according to the prior art.

(5) Validation of chip effect: using the above-mentioned gene chip test, 20 normal human samples and 20 congenital bilateral goblet genetic disease patients were verified by sequencing, for a total of 40. The test results are consistent with the high-density SNP chip test results and The second-generation sequencing results are consistent, which proves that the chip of the present invention has specificity when detecting congenital bilateral goblet deformity mutations.

Result judgment:

With reference to Figures 1-3, the positive scan results of the present invention are as shown in the drawings.

Filled icons; negative scan results are as shown in the figure

Filled with slash icons; heterozygous carriers are as shown in the figure

Fill triangle icon.

Figure 1 is a schematic diagram of the sequence or position of the probes on the gene chip. Figure 2: Scanning results of the fetus not carrying any gene related to bilateral goblet malformations and copy number variation of the regulatory region; Scanning results of copy number variation (CNV) in the regulatory region of bilateral goblet ear related genes.

Analysis of the test results. The sample to be tested was tested by gene chip hybridization. If the color of the 10 probes on the gene chip is consistent with Figure 3, it is a positive case, that is, it carries the disease-causing genes related to bilateral goblet deformities. After birth, the baby has bilateral goblet ear deformities; if the test results come out, the color of the 10 probes on the gene chip is the same as that in Figure 2. This is a negative case, that is, the detected fetus does not carry bilateral goblet ears. Malformation-related pathogenic genes, it can be known that babies after birth will not suffer from bilateral goblet deformities.

The analysis of the results after hybridization and scanning only needs to be compared with Figures 1-3 to reach a conclusion. It is very simple, no additional calculation of Ct values, etc., and no corresponding graphs are needed to assist in judgment, which greatly saves time and reduces The error rate and increase the accuracy of the results are of great importance for practical applications.

In the above step (1), for pregnant women, screening for the disease can be performed as early as 4 to 8 weeks of pregnancy, that is, by using the kit of the present invention, the peripheral blood of pregnant women from 4 to 8 weeks of pregnancy can be evaluated to determine the fetus. Whether you have bilateral goblet ear deformities, that is, if the test result is positive, the fetus has bilateral goblet ear deformities, and early intervention can be carried out. If it is negative, it is not.

Example 5

In order to verify the specificity of the probe and the like of the present invention and the effectiveness of the method, the present invention collected 4 negative samples and 4 positive samples in the sample bank (for the convenience of research, the applicant has a large sample bank), which are recorded as Samples A01 to A08 were tested according to the method described in Example 4, and the hybridization system used was the same as that in Example 4. The results obtained are shown in Table 1 below.

Table 1 Data analysis of test results

In Table 1, the negative positivity and the fetal phenotype are known. The negative and positive results detected by the method of the present invention are completely consistent with the information recorded in the sample bank. The predicted fetal manifestations The type is also exactly the same as the baby's phenotype in practice. In addition, the inventors have conducted verification studies on hundreds of cases in the sample database in many years of research, and the results are basically consistent with the actual ones. Therefore, the accuracy rate in this application is extremely high, which can basically reach 100%. the above.

Example 6

Subjects: Peripheral blood of pregnant women from 4 to 5 weeks of pregnancy were collected, and all pregnant women were collected with bilateral goblet ear phenotypes or their close relatives contained bilateral goblet ear deformities;

Collection location: collected in nearly 30 hospitals nationwide;

Time: 2017.1 ～ 2017.10;

Quantity: 192;

Method: The test was performed according to the method described in Example 4. The hybridization system used was the same as that of Example 4. The method of determining the results was the same as that of Example 5.

Results: Among them, 183 cases obtained ideal detection results by chip hybridization. Nine cases had less fetal cf-fDNA in the peripheral blood of pregnant women due to slow fetal development and other reasons. The results of hybridization detection were not ideal. The pregnant woman had a second acquisition during 7-8 weeks of pregnancy, and the method described in Example 4 was also used for detection. Finally, a hybridization signal was successfully obtained.

The specific hybridization test results and actual results are shown in Table 2 below. The actual results are the results obtained after postnatal follow-up observation and detection.

Table 2 Test results and prediction results

Test results	Quantity	forecast result	actual results
Positive	42 cases	With bilateral goblet ear deformities	Bilateral cup ear deformities
negative	141 cases	Not suffering from bilateral goblet ear deformities	Phenotype is normal

It can be seen that by tracking the 183 pregnant women tested above, it was found that the babies born to pregnant women who showed positive showed obvious bilateral cup ear deformities, and the babies born to pregnant women who showed negative were normal and did not have double Appearance characteristics of lateral cup ear deformities.

It can be further learned that the probes fixed in the gene chip of the present application have strong specificity and high accuracy, and the method of the present invention has accurate predictions, which can be accurate to 100%, so that pregnant women can know the condition of the fetus early, and help to treat early Or intervention has extremely important value for eugenics.

More importantly, when the pregnant woman is 4 to 5 weeks pregnant, almost immediately when pregnancy is found, about 97% of pregnant women can carry out the test of this item, and it can be detected at the latest 8 weeks, so as to make a more accurate estimation; Of course, it is more detectable after 8 weeks, but the sooner it is detected, the greater the significance.

Exception, in this embodiment, the sample is collected with the consent of the pregnant woman, and the test is performed with the blood collected during the routine inspection.

It should be noted that all the samples collected in this embodiment obtain the final results within 30 to 60 minutes, which is fast, efficient, and accurate. In addition, all the samples collected in this embodiment are tested with the blood collected during the routine checkup of the pregnant woman with the consent of the pregnant woman.

In the present invention, the specificity of the probe sequence in the gene chip used is strong. If one or several bases of one or several probes are changed, the specificity is greatly reduced, resulting in a high error rate. In addition, the primer set sequences in the kit of the present application also have very strong specificity. Changing the base positions in some primer sets will also have a great impact on the accurate expression of the results. The inventors have verified through years of research and testing Etc., the probe and primer set sequences in the present application with high specificity and accuracy were obtained.

The copy number change (CNV) of HMX1 regulatory region fragments is co-segregated with the occurrence of bilateral goblet ear deformities, and is directly related to the occurrence of bilateral goblet ear deformities. Therefore, the present invention is mainly directed to HMX1 regulatory region fragments. Research, the effect was pleasantly surprised.

The present invention is not limited to the above-mentioned best embodiment. Anyone can derive other various forms of products under the inspiration of the present invention, but regardless of any change in its shape or structure, any product that has the same or similar structure as the present application. The similar technical solutions all fall within the protection scope of the present invention.

Claims (10)

1. A gene chip for non-invasive prenatal detection of bilateral goblet ear malformations, characterized in that the gene chip includes a base, and the base is provided with a probe set for detecting genes related to bilateral goblet malformations. Forming a microarray gene chip;

   The probe set includes 10 probes, and the sequence of each probe is as follows:

   (1) Probe P1: its nucleotide sequence is GTGGGTTATTGGGGGGAAGAAC;

   (2) Probe P2: its nucleotide sequence is TAAATATTGCAGTTGACTTTATT;

   (3) Probe P3: its nucleotide sequence is CAGGTTCGAGACACGGATCGCAT;

   (4) Probe P4: its nucleotide sequence is CTGTCAACAGAGGAGAAAGCCTG;

   (5) Probe P5: its nucleotide sequence is ATGGTGTCTGCAGCAGGAGGC;

   (6) Probe P6: its nucleotide sequence is TTATCTCTTGTATGTAACTTGA;

   (7) Probe P7: its nucleotide sequence is GTGGCAACTAAGAACCAACATT;

   (8) Probe P8: its nucleotide sequence is GGCCTGTGAGTCCCTCTGCCAGGTG;

   (9) Probe P9: its nucleotide sequence is CCCACAGCCGGCTCCTGGCCTGG;

   (10) Probe P10: its nucleotide sequence is TCCCTTCCCTAACGCCCCCTGAG.
2. The gene chip according to claim 1, wherein in the probes P1 to P10, a 5 'end of each probe is labeled with a fluorescent group, and a 3' end is labeled with a quenching group. .
3. The gene chip according to claim 2, wherein the substrate comprises a glass slide, a silicon wafer, or a film as a carrier.
4. The gene chip according to claim 2, characterized in that: on the gene chip, each of the probes is 3, and then the gene chip contains 30 of the probes.
5. The gene chip according to claim 3, characterized in that: a positive quality control probe, a negative quality control probe and a blank control probe are further fixed on the gene chip; preferably a positive quality control probe, a negative quality control probe There are three needles and three white probes, and a total of 39 are fixed on the gene chip.
6. The gene chip according to claim 4, characterized in that in (1) to (10) of claim 1, the fluorescent group labeled at the 5 'end of each probe is FAM, HEX, Any of VIC, CY5, and TET; the quenching group labeled at the 3 'end of each probe is any of TAMRA, MGB, and BHQ.
7. A method for preparing a gene chip for non-invasive prenatal detection of bilateral goblet ear malformations, including the following steps: acid-base pretreatment of the base, aldolization treatment, isothiocyanation treatment, chip probe design, For the spotting of the probe, immediately bake the slide at 80 ° C for 10 min to make a microarray slide, store it in a box with a desiccant, and save at room temperature.
8. A kit for non-invasive prenatal detection of bilateral goblet ear deformities, characterized in that the kit includes the gene chip according to any one of claims 1 to 6.
9. The kit according to claim 8, further comprising a washing solution, a lysing solution, a digestion solution, a standard DNA sample, a chip hybridization solution, and 0.2% SDS.
10. A method for applying a gene chip, which is characterized in that: the method firstly prepares a sample containing DNA, then quantifies the DNA sample, and then uses the gene chip for hybridization detection.

Images