WO2020052602A1

WO2020052602A1 - Dna microarray, kit and application method of dna microarray for non-invasive prenatal assessment of hemifacial microsomia syndrome

Info

Publication number: WO2020052602A1
Application number: PCT/CN2019/105448
Authority: WO
Inventors: 张娇; 章庆国; 赵驰
Original assignee: 张娇
Priority date: 2018-09-14
Filing date: 2019-09-11
Publication date: 2020-03-19
Also published as: CN109182494B; CN109182494A

Abstract

The invention provides a DNA microarray, a kit and an application method of the DNA microarray for non-invasive prenatal assessment of hemifacial microsomia syndrome. The DNA microarray comprises a P1-P13 probe set, and the kit comprises the DNA microarray/a primer set, an enzyme system, and the like. The microarray can perform multiplex PCR amplification using cf-fDNA of peripheral blood of a pregnant woman to be tested as a template, hybridizing the obtained PCR amplification product with the DNA microarray of the invention and, according to the hybridization result, determining whether the fetus carries a congenital hemifacial microsomia syndrome-related gene.

Description

Gene chip, kit and gene chip application method for non-invasive prenatal assessment of hemifacial short syndrome

Technical field

The invention relates to the technical field of biology and medicine, in particular to a gene chip, a kit and a method for applying a gene chip for non-invasive prenatal assessment of hemifacial short syndrome.

Background technique

Craniofacial microsomia (CFM) is a group of major birth defects that include external and middle ear deformities, maxillary deformities, facial nerves, and maxillofacial soft tissue deformities. Worldwide, the incidence of hemifacial shortness is between 1 / 3000-1 / 5000, and the male to female ratio is approximately 3: 2. China is located in one of the three high-incidence areas (Central and South America, East Asia, and Northern Europe) with short facial faces. Birth defect monitoring data show that the incidence rate in China is 1 in 3000 newborns, the second largest skull after cleft lip and palate. Facial deformity. Hemifacial shortness is high in some areas of China. For example, the incidence of hemifacial shortness with external ear deformities in Guangdong and other places is as high as 2/1000. At the same time, the incidence in rural areas is significantly higher than in cities. Based on China ’s huge population base and the liberalization of the second child policy, there will be about 17 million newborns each year after 2016, of which more than 4,000 new cases of hemifacial short syndrome will occur.

Hemifacial short syndrome is mainly manifested as dysplasia of the maxillofacial bone and cartilage tissue, which can cause severe asymmetry of the face, closed ear canal, and facial cleft, which seriously affects the physical and mental health of the patient. pass

At present, the etiology of hemifacial short syndrome is relatively lagging, and most of them focus on the exploration of environmental risk factors, including teratogenicity caused by medication or exposure during pregnancy, advanced age, and multiple births. In terms of genetic etiology, there is no large-scale omics study of hemifacial short syndrome, except for this research team. Other studies are limited to the research of syndrome diseases including craniofacial deformities, the repetitiveness of pathogenic genes is poor, and genetic etiology is difficult to make breakthroughs. From a developmental perspective, the two etiology hypotheses recognized for this malformation are: "Neural Crest Cell (NCC) Disturbance" and "Craniofacial Developmental Ischemia", but there has been a lack of strong evidence to verify the hypothesis. reliability.

In recent years, the incidence of birth defects in China has been on the rise, with about 900,000 new cases each year, which places a heavy burden on society and families. With the liberalization of the second child policy, a large number of high-risk environmental factors such as advanced pregnancy and multiple births will emerge, which will further increase the potential risk of congenital malformations. The inventors carried out the world's first large-scale genome-wide pathogenic gene research on hemifacial short syndrome, and found 12 risk genes, suggesting that "neural crest cell disturbance" is the true etiological explanation of short hemifacial shortness . This research is aimed at the most important research results of the disease at present, and the publication of its results (Nature communication) points the direction for the etiology of hemifacial syndrome, in order to further reveal the genetic basis of the disease, the regulatory mechanism, and the development of prenatal Laying the foundation for diagnostic technology.

Gene chip technology refers to immobilizing a specific oligonucleotide fragment as a probe on a support, the target DNA fragment incorporating the label is amplified by PCR, hybridized according to the principle of base pairing, and the chip is then detected by a signal detection system. Scan and compare and detect the signal on each probe with relevant analysis software. This technology has been widely used in the field of disease detection. By detecting the mutations in the genes causing hemifacial short syndrome in pregnant women and their spouses, early detection of the birth risk of hemifacial short syndrome can be combined with prenatal diagnosis to effectively reduce the incidence of hemifacial short syndrome. Compared with the traditional method, gene chip test for hemifacial short syndrome has the advantages of high reliability, high throughput, fast speed, and strong maneuverability, which is suitable for prenatal gene detection of hemifacial short syndrome.

The traditional hemifacial short syndrome has no specific prenatal detection method. It can only undergo surgical treatment after birth, after a long wait to 5-7 years of age, which brings double mental and physical pain to the patient's family. Therefore, it is necessary to find a high-sensitivity non-invasive prenatal diagnosis of hemifacial short syndrome.

Summary of the Invention

The purpose of the present invention is to provide a gene chip, a kit and a gene chip application method for non-invasive prenatal assessment of hemifacial short syndrome, in order to overcome the deficiencies mentioned in the prior art. The object of the present invention is achieved by the following technical solutions:

A gene chip for non-invasive prenatal assessment of hemifacial short syndrome. The gene chip includes a base on which a probe set for detecting genes related to hemifacial short syndrome forms a microarray gene. chip;

The probe set includes 13 probes, and the sequence of each probe is as follows:

(1) Probe P1: its nucleotide sequence is AGAGTAATGCTGTCCATTGCCCA;

(2) Probe P2: its nucleotide sequence is AAGATATTCACTCTCTGGCTAGGCCTA;

(3) Probe P3: its nucleotide sequence is ATATGAAATAAGGAGGAGATAAGAGA;

(4) Probe P4: its nucleotide sequence is GCTGGGATTACAGGCATGAGCCACTGT;

(5) Probe P5: its nucleotide sequence is AAAGAAAATATCTCAAAGAATCAAC;

(6) Probe P6: its nucleotide sequence is AAGCTCAGGGGCTCAGGAGGCAGGA;

(7) Probe P7: its nucleotide sequence is CTGAATCCTTGTTGGCTTCAGAGTCAG;

(8) Probe P8: its nucleotide sequence is CTGATCCTCTGAGGGATTGATGACA;

(9) Probe P9: its nucleotide sequence is TAAAGTGGGAGGATTGCTTGAGCCC;

(10) Probe P10: its nucleotide sequence is GGGAAAGAAATGGGAAGAGGAGG;

(11) Probe P11: its nucleotide sequence is CAACTACTGCCAAATATAAACAAAGG;

(12) Probe P12: its nucleotide sequence is AATAACCTTATTGTGTTGTTGTGACAA;

(13) Probe P13: its nucleotide sequence is TGAATATATGTTACCTAACATTGATCA;

In the probes P1 to P13, the 5 'end of each probe is labeled with a fluorescent group, and the 3' end thereof is labeled with a quenching group.

Further, the substrate is a substrate using a glass slide, a silicon wafer, or a film as a carrier.

Further, on the gene chip, each of the probes is provided with three (that is, repeated three times), and then the gene chip contains 39 of the probes.

Further, a positive quality control probe, a negative quality control probe and a blank control probe are also fixed on the gene chip; preferably, each of the positive quality control probe, the negative quality control probe and the white control probe is provided with 3 Strip, 48 probes are fixed on the gene chip.

Further, in the above (1) to (13), the fluorescent group labeled at the 5 ′ end of each probe is any one of FAM, HEX, VIC, CY5, and TET; each probe The quenching group labeled at the 3 ′ end in the sintering group is any one of TAMRA, MGB, and BHQ.

Further, the fluorescent groups in the probes P1 to P13 are the same, and the quenching groups in the probes P1 to P13 are the same.

A kit for non-invasive prenatal assessment of hemifacial short syndrome, the kit includes the gene chip described above.

Further, the kit further includes a primer set, and the primer set is 13 sets of primers, as shown below:

(1) Primer group 1: Primer F1: Its nucleotide sequence is ATTCCCCTTCATCATTGTC; ② Primer R1A: Its nucleotide sequence is GGTCAGCTTAGTATCCAGG; ③ Primer R1: Its nucleotide sequence is GGTCAGCTTAGTATCCAGA;

(2) Primer group 2: ① primer F2: its nucleotide sequence is TGGATTCTACATTTCCTAA; ② primer F2A: its nucleotide sequence is TGGATTCTACATTTCCTAG; ③ primer R2: its nucleotide sequence is GGCAGTAGTGATAGGAGAA;

(3) Primer group 3: ① primer F3: its nucleotide sequence is TTAGAAAATGGTTAAGTGT; ② primer F3A: its nucleotide sequence is TTAGAAAATGGTTAAGTGG; ③ primer R3: its nucleotide sequence is ACTCCAGCTAGAGGTAAAT;

(4) Primer group 4: primer F4: its nucleotide sequence is GACCTTAGGTGATCTGCCC; ② primer F4A: its nucleotide sequence is GACCTTAGGTGATCTGCCT; ③ primer R4: its nucleotide sequence is CTGCTTGTGAATCCCAAAT;

(5) Primer group 5: primer F5: its nucleotide sequence is ACCTTTTGCAGTCTCCAAG; ② primer F5A: its nucleotide sequence is ACCTTTTGCAGTCTCCAAT; ③ primer R5: its nucleotide sequence is TCTTCTGGGACATCTGGTT;

(6) Primer group 6: ① primer F6: its nucleotide sequence is AAACTGGGAGCAGCGTGGG; ② primer R6: its nucleotide sequence is TGCGTGTGCGTGTGAATGC; ③ primer R6A: its nucleotide sequence is TGCGTGTGCGTGTGAATGT;

(7) Primer group 7: Primer F7: Its nucleotide sequence is AGGCTGACATCTGTCCCCA; ② Primer F7A: Its nucleotide sequence is AGGCTGACATCTGTCCCCG; ③ Primer R7: Its nucleotide sequence is TGCTGCTCTCCCTTGGCTGT;

(8) Primer group 8: primer F8: its nucleotide sequence is CTCCCTGCACTTCCCCCAA; ② primer F8A: its nucleotide sequence is CTCCCTGCACTTCCCCCAG; ③ primer R8: its nucleotide sequence is GCGTGTTCCCTTGTGTTTC;

(9) Primer group 9: ① primer F9: its nucleotide sequence is ACTTGTAGTCCCAGCTATC; ② primer F9A: its nucleotide sequence is ACTTGTAGTCCCAGCTATT; ③ primer R9: its nucleotide sequence is ATGGTCATAGCTCACTCTA;

(10) Primer group 10: ① primer F10: its nucleotide sequence is GCTTATTCCAACCCACAGT; ② primer R10: its nucleotide sequence is AAGGGAAATCAGCAATCCAG; ③ primer R10A: its nucleotide sequence is AAGGGAAATCAGCAATCCAA;

(11) Primer group 11: primer F11: its nucleotide sequence is CAAGAAATGTTTTTAGAGC; ② primer R11: its nucleotide sequence is CACATTAGTTGATGATGTC; ③ primer R11A: its nucleotide sequence is CACATTAGTTGATGATGTA;

(12) Primer group 12: ① primer F12: its nucleotide sequence is GCCTTCTTCTGAGCCTTGG; ② primer R12: its nucleotide sequence is CCAGATGTTGAGGGCTTCG; ③ primer R12A: its nucleotide sequence is CCAGATGTTGAGGGCTTCT;

(13) Primer group 13: primer F13: its nucleotide sequence is ACACTATGTCGCTTCCACA; ② primer R13: its nucleotide sequence is AAAACCAGTGCCAGTTATG; ③ primer R13A: its nucleotide sequence is AAAACCAGTGCCAGTTATC.

Further, the sample loading amount of the 13 primer sets was the same, and the volume ratio of the 3 primers in each group was 1: 1: 1.

Further, the kit further comprises an enzyme system, and the enzyme system includes any one of the following ① or ②: ① Tfl DNA polymerase and Stoffel fragment; ② Tfl DNA polymerase, MMLV reverse transcriptase and Stoffel fragment.

A method for applying a gene chip, the method is as follows: first, a sample containing DNA is prepared, then PCR is amplified, and then the gene chip is used for hybridization.

Further, a primer set needs to be added in the PCR amplification, and the primer set is the primer set described above.

The beneficial effects of the present invention are as follows: the present invention discloses a gene chip, and 13 specific base sequences are fixed on the chip to form a microarray, and then the chip is used for detection and evaluation of the short-sided facial syndrome, and the gene chip is used. This method has many advantages over using a probe directly. Specifically, the detection technique for the hemifacial short syndrome syndrome has simpler operation steps and shorter time. The test can usually be completed in 30 to 60 minutes, greatly shortening the time period, and has good specificity and high resolution. , High sensitivity, accuracy, fast; and high-throughput characteristics, can quickly screen for mutations in hemifacial syndrome related genes, and improve the diagnosis of hemifacial syndrome syndrome to the genetic level; In short, this method saves time and cost, reduces patient suffering, and can non-invasively diagnose prenatal fetal disease.

The microarray chip is subjected to multiplex PCR amplification using cf-fDNA (mixture of fetal and maternal free DNA) of the peripheral blood of the pregnant woman to be tested as a template, and the obtained PCR amplified product is then hybridized with the chip of the present invention. The hybridization results determine whether the fetus carries genes related to congenital hemifacial syndrome; it is very simple, greatly reduces the error rate and time cost, and improves accuracy; it can be used for the detection of prenatal congenital genetic diseases and non-invasive prenatal diagnosis The field has great potential.

BRIEF DESCRIPTION OF THE DRAWINGS

The above and other objects, features, and advantages of the present invention will be more apparent from the following description of embodiments of the present invention with reference to the accompanying drawings, in which:

FIG. 1 is a schematic diagram of a distribution structure of probe sequences in a gene chip according to an embodiment of the present invention; FIG.

FIG. 2 is a schematic diagram of a scanning result of a heterozygous gene carrying a hemifacial syndrome;

FIG. 3 is a schematic diagram of a scanning result that is partially positive.

detailed description

In the following, specific experimental cases are taken as examples to explain specific implementation manners. It should be understood that the specific embodiments described here are only used to explain the present invention and are not used to limit the present invention.

Example 1

A gene chip for non-invasive prenatal assessment of hemifacial short syndrome. The gene chip includes a base on which a probe set for detecting genes related to hemifacial short syndrome forms a microarray gene. Chip; the probe set includes 13 probes, and the sequence of each probe is as follows: (1) probe P1: its nucleotide sequence is AGAGTAATGCTGTCCATTGCCCA; (2) probe P2: its nucleotide sequence is AAGATATTCACTCTCTGGCTAGGCCTA; (3) probe P3: its nucleotide sequence is ATATGAAATAAGGAGGAGATAAGAGA; (4) probe P4: its nucleotide sequence is GCTGGGATTACAGGCATGAGCCACTGT; (5) probe P5: its nucleotide sequence is AAAGAAAATATCTCAAAGAATCAAC; (6) Probe P6: its nucleotide sequence is AAGCTCAGGGGCTCAGGAGGCAGGA; (7) Probe P7: its nucleotide sequence is CTGAATCCTTGTTGGCTTCAGAGTCAG; (8) Probe P8: its nucleotide sequence is CTGATCCTCTGAGGGATTGATGACA; (9) Probe P9: its The nucleotide sequence is TAAAGTGGGAGGATTGCTTGAGCCC; (10) Probe P10: its nucleotide sequence is GGGAAAGAAATGGGAAGAGGAGG; (11) Probe P11: its nucleotide sequence is CAACTACTGCCAAATATAAACAAAGG; (12) Probe P12: nucleotide sequence AATAACCTTATTGTGTTGTTGTGACAA; (13) probes P13: nucleotide sequence TGAATATATGTTACCTAACATTGATCA.

Preferably, the substrate is a substrate using a glass slide, a silicon wafer, or a film as a carrier; the carrier or substrate may be made of a polymer material.

In the probes P1 to P13, the 5 'end of each probe is labeled with a fluorescent group, and the 3' end thereof is labeled with a quenching group. The sequence of the probes on the gene chip is shown in Figure 1. It consists of two rows. The top row is from P1 to P7 from left to right, and the bottom row is from P8 to P13 from left to right. The result judgment is convenient.

Preferably, on the gene chip, each of the probes is provided with 3 (that is, three times repeated), then the gene chip contains 39 of the probes, as shown in FIG. 1, that is, the microarray. 39 probes of wild type and mutant type of 13 related genes and 13 related mutation sites of the congenital hemifacial short syndrome.

Preferably, on the gene chip, a positive quality control probe (ie, PC2 in FIGS. 1 to 3), a negative quality control probe (ie, PC1 in FIGS. 1 to 3), and a blank control probe ( (Ie, NC in Figures 1 to 3); preferably, three positive control probes, negative quality control probes, and white control probes are each provided, for a total of nine, and a total of 48 probes are fixed on the gene chip.

The fluorescent group labeled at the 5 'end of the 13 probes is any one of FAM, HEX, VIC, CY5, and TET; the quenching group labeled at the 3' end is any of TAMRA, MGB, and BHQ Species. Preferably, the fluorescent groups in the probes P1 to P13 are the same, and the quenching groups in the probes P1 to P13 are the same.

In this embodiment, to detect and evaluate the hemifacial short syndrome, after PCR amplification, it only needs to hybridize with the gene chip with a specific number of probes and specific sequences in this embodiment after PCR amplification. Appropriate assessment.

Example 2

A method for preparing a gene chip for non-invasive prenatal assessment of hemifacial short syndrome. A glass slide is selected as a carrier chip of the gene chip. The preparation of the gene chip includes the following steps, in order: (1) Acid-base pretreatment of glass slides; (2) aldolization treatment; (3) isothiocyanation treatment; (4) chip probe design; (5) probe spotting; (6) spotted chip Bake at 80 ° C for 10min to make microarray slides; (7) Store in a desiccant box and store at room temperature.

In this embodiment, the preparation method may be prepared according to a conventional method, and the focus is on the gene chip itself, not its preparation method.

Example 3

A kit for non-invasive prenatal risk assessment of congenital hemifacial short syndrome. The kit includes the gene chip described in Example 1.

The kit also includes a primer set, and the primer set is preferably 13 sets of primers, and the 13 sets of primers are as follows:

The amount of sample added in the 13 primer sets was the same. The volume ratio or quantity ratio of the 3 primers in each group was 1: 1: 1.

In this embodiment, when detecting and evaluating hemifacial short syndrome, it is only necessary to add the above 13 sets of primers before PCR amplification, and then perform amplification. After amplification, a specific number and specific sequence are fixed in this embodiment. The gene chip of the probe can be hybridized, and the corresponding evaluation is performed according to the hybridization result.

Example 4

Based on Example 3, the kit further includes an enzyme system, and the enzyme system includes an enzyme mixture of Tfl DNA polymerase and Stoffel fragment (purchasing company of Stoffel fragment: Cetus); preferably, the enzyme The line also includes MMLV reverse transcriptase, which is an enzyme mixture of Tfl DNA polymerase, Stoffel fragment and MMLV reverse transcriptase.

In addition, the kit also includes a reaction reagent, which includes: (1) Tris-sulfuric acid; (2) MOPS buffer solution; (3) sodium citrate; (4) (NH ₄ ) ₂ SO ₄ ; (5 ) MgSO4 and (6) acetylated BSA.

Then, in this embodiment, the amount of each component in the kit is: 0.5 ml of a primer set of 300 to 800 nM, an enzyme mixed solution, 1 ml of Tris-sulfate at pH 8.5 of 20 to 50 mM, and pH 7.9 of 10 to 20 mM 1 ml of MOPS buffer, 1 ml of 2 to 5 mM sodium citrate, 1 ml of 10 to 20 mM (NH ₄ ) ₂ SO _4, 1 ml of 5 to 10 mM MgSO _{4, and} 1 ml of acetylated BSA at 0.1 mg / ml.

Among them, the primer set includes 13 primer sets in (1) to (13) in Example 3, and the concentration of the primers in each set is controlled within a range of 300 to 800 nM, and the volume is consistent ; Enzyme mixture is made by 0.5 ～ 1unit (concentration) of Tfl DNA polymerase 0.5mL and 0.5 ～ 1unit (concentration) of Stoffel fragment 0.5ml, or enzyme mixture is made by 0.5 ～ 1unit (concentration) of Tfl DNA Polymerase 0.5ml, 0.5-1 unit (concentration) Stoffel fragment 0.5ml, 0.5-1 unit (concentration) MMLV reverse transcriptase 0.5ml.

In this embodiment, when detecting and evaluating the hemifacial short syndrome, only 13 sets of primer sets, enzymes, and reaction reagents need to be added before PCR amplification, and then PCR amplification is performed. After amplification, it is the same as in this embodiment. Only a certain number of gene chips fixed with a specific sequence of probes can be hybridized, and the corresponding evaluation is performed according to the hybridization results. The application of the gene chip simplifies the detection process and confirms the results, saving time and improving accuracy.

Example 5

A method for applying a gene chip, which is characterized in that the method is: first, preparing a sample containing DNA, then PCR amplification, and then using the gene chip for hybridization, and then performing data processing and image analysis after hybridization, Scan the chip and then evaluate the results. details as follows:

(1) Collect blood from pregnant women and extract fetal cf-DNA from blood

S1: Prepare washing liquid (purchasing manufacturer: Changzhou Baidai Biotechnology Co., Ltd.), prepare washing liquid A and washing liquid B;

a) Washing liquid A: Take 21 ml of washing liquid and add 9 ml of absolute ethanol; if take 42 ml of washing liquid, add 18 ml of absolute ethanol.

b) Washing liquid B: Take 9 ml of washing liquid and add 21 ml of absolute ethanol; if take 18 ml of washing liquid, add 42 ml of absolute ethanol.

S2: Take a 1.5 ml centrifuge tube, add 200 μl of the collected pregnant woman blood sample, 4 μl DNA Carrier (DNA carrier, purchased by Changzhou Baidai Biotechnology Co., Ltd.) and mix well, add 300 μl of lysate (purchased by Changzhou Baidai Biological Technology Co., Ltd. Company), and 20 μl of digestive juice (purchasing manufacturer: Changzhou Baidai Biotechnology Co., Ltd.), shake and mix, and water bath at 56 ° C for 10 minutes.

S3: Add 1000 μl of absolute ethanol to the centrifuge tube in S2, gently invert and mix. If there is a translucent suspension, it will not affect the DNA extraction and subsequent experiments;

S4: Put the adsorption column into the collection tube, transfer 760 μl of the solution obtained in step S3 into the adsorption column, and let it stand for 2 minutes. Centrifuge the adsorption column containing the collection tube at 12,000 rpm and 4 ° C for 1 minute to take out the adsorption column. , Discard the waste liquid in the collection tube, put the adsorption column back into the collection tube, transfer the remaining 760 μl solution into the adsorption column, and repeat this step;

S5: Remove the liquid obtained in the collection tube in the repeated steps, and put the adsorption column back into the collection tube, add 500 μl of washing solution A to the adsorption column, centrifuge at 12,000 rpm at 4 ° C for 1 minute, discard the waste liquid in the collection tube, and absorb the Put the column back into the collection tube;

S6: Add 500 μl of washing solution B to the adsorption column, centrifuge at 12,000 rpm at 4 ° C for 1 minute, discard the waste liquid in the collection tube, return the adsorption column to the collection tube, centrifuge at 12,000 rpm at 4 ° C for 2 minutes, and remove the remaining washing solution;

S7: Take out the adsorption column, put it into a new 1.5ml centrifuge tube, add 30-50μl of eluent, let it stand for 3 minutes, and centrifuge at 12,000rpm and 4 ° C for 2 minutes to collect the DNA solution. The extracted DNA can be used in the next experiment or stored at -20 ° C.

(2) Real-time q-PCR reaction

The real-time fluorescence quantitative RT-PCR reaction system is: 0.5ul primer set of 300-800nM, 1.5ul of enzyme mixture, 1ul of 20-50mM Tris-sulfate pH8.5, 1ul of 10-20mM MOPS buffer pH7.9 1 ul of 2 to 5 mM sodium citrate, 1 ul of 10 to 20 mM (NH4) ₂ SO _4, 1 ul of 5 to 10 mM MgSO41, 1 ul of 0.1 mg / ml acetylated BSA, and 1 ul of 420 mM dNTP, RNAase-free ddH2O was added to 50 μl. The primer set includes 13 primer sets in (1) to (13) in Example 3, and the concentration in each set is in the range of 300 to 800 nM, and the volume of the primer sets in the 13 sets is the same or Same; the enzyme mixture is: 0.5ul Tfl DNA polymerase with a concentration of 0.5-1unit and 0.5ul Stoffel fragment with a concentration of 0.5-1unit, or the enzyme mixture is: 0.5ul Tfl DNA polymerization with a concentration of 0.5-1unit A mixture of enzyme, 0.5 ml of Stoffel fragment at a concentration of 0.5-1 unit, and 0.5 ul of MMLV reverse transcriptase at a concentration of 0.5-1 unit.

The real-time quantitative RT-PCR reaction program is: first step: 45 ° C, 20-45 minutes; 94-96 ° C, 2 minutes; second step: 94-95 ° C, 15-30 seconds; 65-69 ° C, 30 ~ 75 seconds; 68-72 ° C, 30-40 seconds; 6-9 cycles; third step: 93-95 ° C, 15-20 seconds; 60 ° C, 30 seconds; 68-72 ° C, 30 seconds; 8 Cycle; fourth step: 93-95 ° C, 15 seconds; 52-55 ° C, 30-60 seconds; 40 cycles; collect fluorescence at 55 ° C;

(3) Hybrid

First prepare the chip hybridization solution: hybridization solution such as: 100 ～ 300mM Hepes-HCl (pH 8.0), 1 ～ 3M NaCl, 0.5 ～ 1mM EDTA (pH 8.0); then mix the PCR product and hybridization solution in equal proportions at 95 ℃ After denaturing for 10 minutes under conditions, immediately place it in an ice bath for 5 minutes, and at the same time rinse the gene chip in 0.2% SDS for 20 seconds, then rinse it in ultrapure water for 5 seconds, shake off the surface of the gene chip, and dry at room temperature. . Take 10 μl of the denatured amplification product and carefully add it to the reaction zone of the gene chip to make it evenly distributed (the hybridization reaction solution covers the hybridization reaction zone without overflow). When adding the hybridization mixture to the reaction zone of the gene chip, care should be taken not to contact the pipette tip with the gene chip, so as not to affect the probe array. The gene chip was placed flat in a hybridization box, and hybridization was performed in a water bath at a hybridization temperature to be determined for 1 hour. During the hybridization reaction, prevent condensation water from falling on the gene chip; care should be taken when moving the hybridization box to prevent cross-contamination of the reaction solution in each reaction zone. After the hybridization reaction is completed, the gene chip is rinsed in the SSC washing solution. Take out the gene chip, shake off the liquid remaining on the gene chip, and dry at room temperature.

(4) Data processing and image analysis

The hybridization results were scanned by a laser confocal gene chip scanner in step (3), and analyzed by signal analysis software.

Specifically, it can be operated according to the prior art.

(5) Gene chip effect verification

Using the above gene chip test, 20 normal human samples and 20 ROBO1 mutant samples, 10 SHROOM3 mutant samples, 8 SEMA7A mutant samples, 15 NRP2 mutant samples, 20 GBX2 mutant samples, etc. There are 12 mutant samples with a total of 100 copies (including mixed cases), and the detection results are consistent with the Sanger sequencing results, which proves that the gene chip of the present invention has specificity when detecting mutations in the hemifacial syndrome syndrome.

Result judgment:

With reference to Figures 1-3, the positive scan results of the present invention are as shown in the drawings.

Filled icons; negative scan results are as shown in the figure

Filled with slash icons; heterozygous carriers are as shown in the figure

Fill triangle icon.

FIG. 1 is a schematic diagram of the sequence of the probes on the gene chip. The sequence numbers are omitted in FIGS. 2 and 3. Figure 2 shows the scanning results of fetuses that are only heterozygous and carry genes related to hemifacial syndrome. That is, 13 pathogenic gene sequences are all negative or heterozygous. Among them, P1 |, P4, P7, P10, P12 For heterozygous carry, the rest are negative. Figure 3 is a schematic diagram of scanning of 13 pathogenic genes such as SHROOM3, SEMA7A, NRP2, ROBO1, GBX2 and other pathogenic genes mixed in the fetus. P1 |, P4, P7, P10, and P12 are positive carriers; P3 , P5, P6, P8, and P9 are heterozygous; P2, P11, and P13 are negative results.

Then you only need to compare Figures 1 to 3 for analysis after hybridization and scanning. It is very simple, you don't need to calculate Ct value, etc., and you don't need to draw the corresponding curve to aid judgment, which greatly saves time and reduces the error rate. Increasing the accuracy of the results is extremely important for practical applications.

For the final results shown by the gene chip, through the study of the synergy of each risk gene and multiple risk genes and the verification of big data cases, it was found that the more risk gene loci are, the phenotype of hemifacial short syndrome appears. The greater the risk, specifically, if the test sample carries 13 disease-causing sites at the same time, the fetus has at least one characteristic of half-sided facial syndrome with a risk of more than 90%, with at least 2 half-sided facial short The risk of the syndrome is above 80%. For example: when the test sample carries 10-12 risk-causing sites at the same time, the risk of having at least one characteristic of hemifacial short syndrome is more than 80%; when the test sample carries 7-9 risk factors at the same time At the diseased site, the risk of having at least one hemifacial short syndrome feature is 60-80%; when the tested sample carries 4-6 risky pathogenic sites at the same time, it has at least one hemifacial short The risk of the syndrome's characteristic manifestation is 40-60%; when the tested sample carries 1-3 risky pathogenic sites, the risk of having at least one hemifacial short syndrome is below 15%.

The above-mentioned features of the hemifacial short syndrome include microtia, short hemifacial face, congenital heart disease, kidney deformity or rib cartilage deformity, etc.

In the above step (1), for pregnant women, screening for the disease can be carried out as early as 4-8 weeks of pregnancy, that is, by using the kit of the present invention, the peripheral blood of pregnant women from 4-8 weeks of pregnancy can be evaluated to determine the fetus. It has the possibility of hemifacial short syndrome. If the test result is positive, the fetus is very likely to have hemifacial short syndrome and early intervention can be performed.

In this embodiment, the 13-probe probe set can be amplified simultaneously in one real-time fluorescent quantitative RT-PCR, or can be divided into multiple amplifications, which can be determined according to experimental conditions and actual needs.

It should be noted that the primer probe set and the kit in this application are developed based on 13 risk-causing genes in humans, and the gene sequences of the 13 risk-causing genes are shown in SEQ NO. 1 to SEQ NO. 13 respectively. As shown.

Example 6

In order to verify the specificity of the probe and primer set of the present invention and the effectiveness of the method, the present invention collected four negative samples and four positive samples in the sample library (for the convenience of research, the applicant has a large sample library), respectively Recorded as samples A01 to A08, and detected according to the method described in Example 5, and the fluorescent group labeled at the 5 ′ end of probe 3, probe 10 and probe 11 is FAM, probe 1, probe 2 The fluorophores labeled at the 5 'ends of probes 9 and 5 are HEX, the fluorophores labeled at the 5' ends of probes 4 and 13 are TET, 5 of probes 7 and 12 The fluorophore labeled on the 'end is CY5, and the fluorophore labeled on the 5' end of probe 6 and probe 8 is VIC; probe 3, probe 4, probe 7, probe 9, and probe 12 The quenching group labeled at the 3 ′ end of the probe is BHQ, and the quenching group labeled at the 3 ′ end of probe 2, probe 5, probe 10, and probe 13 is TAMRA, probe 1, and probe 6. The quenching group labeled at the 3 ′ ends of the probes 8 and 11 is MGB.

The real-time quantitative RT-PCR reaction system and the real-time quantitative q-PCR reaction were consistent with those in Example 5.

The results obtained are shown in Table 1 below.

Table 1 Data analysis results of real-time quantitative RT-PCR amplification results

*: The above results are completely consistent with the results of the fetal phenotype after birth.

In Table 1, the type and the carrying status of risk sites are known, and the negative and positive results detected by the method of the present invention, including which genes are positive, are completely consistent with the information recorded in the sample bank. The predicted number of phenotypes that the fetus may contain is basically the same as the number of babies in reality. In addition, the inventors have conducted verification studies on hundreds of cases in the sample database in many years of research, and the results are basically consistent with the actual ones. Therefore, the accuracy rate in this application is extremely high, which can basically reach 97%. the above.

In this embodiment, the fluorescent group and the quenching group labeled in each of the probes described above may be replaced by other fluorescent groups and the quenching group mentioned in the present invention.

Example 7

Subjects: Peripheral blood of pregnant women from 4 to 5 weeks of pregnancy were collected, and all the pregnant women were collected with hemifacial short syndrome phenotype or their close relatives contained hemifacial short syndrome;

Collection location: collected in nearly 30 hospitals nationwide;

Time: 2017.1 ～ 2017.10;

Quantity: 188;

Method: The detection was performed according to the method described in Example 5, and the fluorescent group labeled at the 5 ′ end of probe 3, probe 10 and probe 11 was FAM, probe 1, probe 2, probe 9 and The fluorophore labeled at the 5 'end of probe 5 is HEX, the fluorophore labeled at the 5' ends of probe 4 and probe 13 is TET, and the 5 'ends of probe 7 and probe 12 are labeled The fluorescent group is CY5, and the fluorescent group labeled at the 5 ′ end of probe 6 and probe 8 is VIC; the 3 ′ ends of probe 3, probe 4, probe 7, probe 9 and probe 12 are The labeled quenching group is BHQ, the quenching groups labeled at the 3 ′ ends of probe 2, probe 5, probe 10 and probe 13 are TAMRA, probe 1, probe 6, probe 8 and The quenching group labeled at the 3 ′ end of the probe 11 is MGB. The real-time quantitative RT-PCR reaction system and the real-time quantitative q-PCR reaction were consistent with those in Example 5.

Results: Among them, 181 cases were amplified by real-time quantitative RT-PCR reaction results; 7 cases were due to slow fetal development and other reasons, resulting in fewer fetal genes in the peripheral blood of pregnant women, so PCR was not ideal. Therefore, in These 7 pregnant women were collected for the second time when they were 7-8 weeks pregnant, and were also tested using the method described in Example 5. Finally, amplified products were successfully obtained.

The specific RT-PCR results and actual results are shown in Table 2 below. The actual results are the results obtained after follow-up observation and testing.

Table 2 Sample genotype test results and actual results comparison

As can be seen from Table 2 above, this application collects the peripheral blood of pregnant women in the early stages of pregnancy, uses the kit of the present invention to test 13 risk-treating genes, and counts their positive rates; and then performs follow-up tests after birth and finds that The actual results obtained are all within the scope of the prediction results of this application. It can be further learned that the kit of the present application has high accuracy, accurate prediction, and can be accurate to about 95%, so that the pregnant woman can know the condition of the fetus early, and it is helpful for early treatment or intervention. It is extremely important for eugenics value.

More importantly, when the pregnant woman is 4 to 5 weeks pregnant, almost 99% of pregnant women can be tested for this item when they are just pregnant, and can be detected at the latest 8 weeks to make a more accurate estimation; Of course, it is more detectable after 8 weeks, but the sooner it is detected, the greater the significance.

It should be noted that all the samples collected in this embodiment obtain the final results within 30 to 60 minutes, which is fast, efficient, and accurate. In addition, all the samples collected in this embodiment are tested with the blood collected during the routine checkup of the pregnant woman with the consent of the pregnant woman.

In the present invention, the specificity of the probe sequence in the gene chip used is strong. If one or several bases of one or several probes are changed, the specificity is greatly reduced, resulting in a high error rate. In addition, the primer set sequences in the kit of the present application also have very strong specificity. Changing the base positions in some primer sets will also have a great impact on the accurate expression of the results. The inventors have verified through years of research and testing Etc., the probe and primer set sequences in the present application with high specificity and accuracy were obtained.

In the present invention, the pathogenic genes targeted are EPAS1, NRP2, ROBO1, GATA3, FGF3, ARID3B, SEMA7A, KLF12, SHROOM3, EDNRB, PLCD3, GBX2 and the like.

The present invention is not limited to the above-mentioned best embodiment. Anyone can derive other various forms of products under the inspiration of the present invention, but regardless of any change in its shape or structure, any product that has the same or similar structure as the present application. The similar technical solutions all fall within the protection scope of the present invention.

Claims

A gene chip for non-invasive prenatal assessment of hemifacial short syndrome is characterized in that the gene chip includes a base, and the base is provided with a probe set for detecting genes related to hemifacial short syndrome. To form a microarray gene chip;

The probe set includes 13 probes, and the sequence of each probe is as follows:

(1) Probe P1: its nucleotide sequence is AGAGTAATGCTGTCCATTGCCCA;

(2) Probe P2: its nucleotide sequence is AAGATATTCACTCTCTGGCTAGGCCTA;

(3) Probe P3: its nucleotide sequence is ATATGAAATAAGGAGGAGATAAGAGA;

(4) Probe P4: its nucleotide sequence is GCTGGGATTACAGGCATGAGCCACTGT;

(5) Probe P5: its nucleotide sequence is AAAGAAAATATCTCAAAGAATCAAC;

(6) Probe P6: its nucleotide sequence is AAGCTCAGGGGCTCAGGAGGCAGGA;

(7) Probe P7: its nucleotide sequence is CTGAATCCTTGTTGGCTTCAGAGTCAG;

(8) Probe P8: its nucleotide sequence is CTGATCCTCTGAGGGATTGATGACA;

(9) Probe P9: its nucleotide sequence is TAAAGTGGGAGGATTGCTTGAGCCC;

(10) Probe P10: its nucleotide sequence is GGGAAAGAAATGGGAAGAGGAGG;

(11) Probe P11: its nucleotide sequence is CAACTACTGCCAAATATAAACAAAGG;

(12) Probe P12: its nucleotide sequence is AATAACCTTATTGTGTTGTTGTGACAA;

(13) Probe P13: its nucleotide sequence is TGAATATATGTTACCTAACATTGATCA;

In the probes P1 to P13, the 5 'end of each probe is labeled with a fluorescent group, and the 3' end thereof is labeled with a quenching group.
The gene chip according to claim 1, wherein the substrate comprises a glass slide, a silicon wafer, or a film;

On the gene chip, each of the described probes is provided with 3, then the gene chip contains 39 of the probes.
The gene chip according to claim 2, characterized in that: a positive quality control probe, a negative quality control probe and a blank control probe are further fixed on the gene chip; preferably, the positive quality control probe and the negative quality control There are three probes and three white probes, and 48 probes are fixed on the gene chip.
The gene chip according to claim 3, wherein in the above (1) to (13), the fluorescent group labeled at the 5 'end of each probe is FAM, HEX, VIC, CY5, and Any one of TET; the quencher group labeled at the 3 'end of each probe is any one of TAMRA, MGB, and BHQ.
The gene chip according to claim 4, wherein the fluorescent groups in the probes P1 to P13 are the same, and the quenching groups in the probes P1 to P13 are the same.
A kit for non-invasive prenatal assessment of hemifacial short syndrome, characterized in that the kit includes the gene chip according to any one of claims 1 to 5.
The kit according to claim 6, wherein the kit further comprises a primer set, wherein the primer set is 13 sets of primers, and the sequences of the 13 sets of primers are as follows:

(1) Primer group 1: Primer F1: Its nucleotide sequence is ATTCCCCTTCATCATTGTC; ② Primer R1A: Its nucleotide sequence is GGTCAGCTTAGTATCCAGG; ③ Primer R1: Its nucleotide sequence is GGTCAGCTTAGTATCCAGA;

(2) Primer group 2: ① primer F2: its nucleotide sequence is TGGATTCTACATTTCCTAA; ② primer F2A: its nucleotide sequence is TGGATTCTACATTTCCTAG; ③ primer R2: its nucleotide sequence is GGCAGTAGTGATAGGAGAA;

(3) Primer group 3: ① primer F3: its nucleotide sequence is TTAGAAAATGGTTAAGTGT; ② primer F3A: its nucleotide sequence is TTAGAAAATGGTTAAGTGG; ③ primer R3: its nucleotide sequence is ACTCCAGCTAGAGGTAAAT;

(4) Primer group 4: primer F4: its nucleotide sequence is GACCTTAGGTGATCTGCCC; ② primer F4A: its nucleotide sequence is GACCTTAGGTGATCTGCCT; ③ primer R4: its nucleotide sequence is CTGCTTGTGAATCCCAAAT;

(5) Primer group 5: primer F5: its nucleotide sequence is ACCTTTTGCAGTCTCCAAG; ② primer F5A: its nucleotide sequence is ACCTTTTGCAGTCTCCAAT; ③ primer R5: its nucleotide sequence is TCTTCTGGGACATCTGGTT;

(6) Primer group 6: ① primer F6: its nucleotide sequence is AAACTGGGAGCAGCGTGGG; ② primer R6: its nucleotide sequence is TGCGTGTGCGTGTGAATGC; ③ primer R6A: its nucleotide sequence is TGCGTGTGCGTGTGAATGT;

(7) Primer group 7: Primer F7: Its nucleotide sequence is AGGCTGACATCTGTCCCCA; ② Primer F7A: Its nucleotide sequence is AGGCTGACATCTGTCCCCG; ③ Primer R7: Its nucleotide sequence is TGCTGCTCTCCCTTGGCTGT;

(8) Primer group 8: primer F8: its nucleotide sequence is CTCCCTGCACTTCCCCCAA; ② primer F8A: its nucleotide sequence is CTCCCTGCACTTCCCCCAG; ③ primer R8: its nucleotide sequence is GCGTGTTCCCTTGTGTTTC;

(9) Primer group 9: ① primer F9: its nucleotide sequence is ACTTGTAGTCCCAGCTATC; ② primer F9A: its nucleotide sequence is ACTTGTAGTCCCAGCTATT; ③ primer R9: its nucleotide sequence is ATGGTCATAGCTCACTCTA;

(10) Primer group 10: ① primer F10: its nucleotide sequence is GCTTATTCCAACCCACAGT; ② primer R10: its nucleotide sequence is AAGGGAAATCAGCAATCCAG; ③ primer R10A: its nucleotide sequence is AAGGGAAATCAGCAATCCAA;

(11) Primer group 11: primer F11: its nucleotide sequence is CAAGAAATGTTTTTAGAGC; ② primer R11: its nucleotide sequence is CACATTAGTTGATGATGTC; ③ primer R11A: its nucleotide sequence is CACATTAGTTGATGATGTA;

(12) Primer group 12: ① primer F12: its nucleotide sequence is GCCTTCTTCTGAGCCTTGG; ② primer R12: its nucleotide sequence is CCAGATGTTGAGGGCTTCG; ③ primer R12A: its nucleotide sequence is CCAGATGTTGAGGGCTTCT;

(13) Primer group 13: primer F13: its nucleotide sequence is ACACTATGTCGCTTCCACA; ② primer R13: its nucleotide sequence is AAAACCAGTGCCAGTTATG; ③ primer R13A: its nucleotide sequence is AAAACCAGTGCCAGTTATC.
The kit according to claim 7, characterized in that: the loading amount of the 13 primer sets is the same, and the volume ratio of the 3 primers in each set is 1: 1: 1.
The kit according to claim 7, characterized in that: the kit further comprises an enzyme system, the enzyme system includes the following ① or ②: ① Tfl DNA polymerase and Stoffel fragment; ② Tfl DNA polymerase, MMLV reverse transcription Enzymes and Stoffel fragments.
A method for applying a gene chip, characterized in that the method is: first, preparing a sample, then PCR amplification, and then using the gene chip for hybridization.
The method for applying a gene chip according to claim 10, characterized in that a primer set needs to be added in the PCR amplification, wherein the primer set is the primer set according to claim 7.