CN109182495B

CN109182495B - Gene chip and kit for noninvasive prenatal detection of bilateral goblet-shaped ear deformity

Info

Publication number: CN109182495B
Application number: CN201811071168.6A
Authority: CN
Inventors: 张娇; 章庆国; 赵驰
Original assignee: Individual
Current assignee: Zhang Jiao
Priority date: 2018-09-14
Filing date: 2018-09-14
Publication date: 2021-02-23
Anticipated expiration: 2038-09-14
Also published as: CN109182495A; WO2020052603A1

Abstract

The invention relates to a gene chip, a kit and an application method of the gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformation, wherein the gene chip comprises a film base, and a probe group for detecting genes related to the bilateral goblet-shaped ear malformation is arranged on the film base to form a microarray gene chip; the probe group comprises 10 probes; the kit comprises the gene chip. The gene chip enables the detection operation steps to be simpler and more convenient, the time is shorter, the detection can be completed within 30-60 minutes generally, the time period is greatly shortened, the detection specificity is good, the resolution ratio is high, and the gene chip has the characteristics of high sensitivity, accuracy and rapidness; the kit has the characteristic of high flux, can quickly screen the variation of genes related to bilateral goblet-shaped ear deformity, and improves the diagnosis of the bilateral goblet-shaped ear deformity to the gene level; in a word, the method saves cost and time, reduces the pain of patients and can carry out noninvasive prenatal diagnosis on the fetal illness probability.

Description

Gene chip and kit for noninvasive prenatal detection of bilateral goblet-shaped ear deformity

Technical Field

The invention relates to the technical field of biology and medicine, in particular to a gene chip, a kit and an application method of the gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear deformities.

Background

Congenital ear deformity is a common birth defect affecting the position and shape of auricle, and abnormal growth of ear cartilage affects the appearance and normal function of ear. Epidemiological investigations have shown that about 5% of the population have congenital ear development malformations of varying degrees, mainly including jug-ear, cupped ear and congenital auricle (or ear-free) malformations.

The goblet-shaped ear deformity is one of congenital ear deformities, is a congenital malformation disease between a jug-ear and a small ear, and has the main clinical phenotypes: the auricle of the upper part of the auricle contracts, the auricle and the cartilage of the auricle curl and adhere, the crus of the auricle moves downwards, the antihelix and the hind crus of the auricle are flat and even disappear, the auricular boat becomes wider, the edge of the auricle bends to the concha, the auricle is cup-shaped, and the serious auricle curls into a tube shape. Cupping ear deformities account for approximately 10% of various congenital ear deformities; unlike other common ear abnormalities, cupped ear abnormalities occur more bilaterally with distinct genetic predisposition.

Although cup-shaped ear deformities are generally not associated with severe middle ear, inner ear or other organ deformities, significant psychological stress and burden is often placed on patients due to the loss of appearance and its apparent genetic predisposition resulting from varying degrees of severity. Therefore, the method has important scientific value and social significance for identifying susceptibility genes based on the pedigree of the goblet-shaped ear deformity.

From a developmental biology perspective, human facial formation is primarily affected by neural crest cells in the head, originating at the outer edges of the preplaced neural plate, which locate at the closure when the neural canal closes, and then migrate away from the closure to a specific site. The outer and middle ear are derived from the migration of cells in the first and second gill arches and neural crest. At the 6 th week of the embryo, mesenchymal bodies around the first gill groove proliferate to form 6 nodular caves surrounding the external auditory meatus, and gradually evolve into auricles; the middle ear is mainly differentiated from the mesenchymal tissue of the neural crest. The occurrence of the outer and middle ear is the result of neural crest cell migration and cartilage differentiation, various cell interactions, and is influenced by a variety of structural and regulatory proteins and signaling pathways.

The gene chip technology is that specific oligonucleotide fragment as probe is fixed on the support, the target DNA fragment with label is amplified through PCR, hybridized according to base pairing principle, and the chip is scanned with signal detecting system and matched with relevant analysis software to compare and detect the signal in each probe. The technology is widely applied to the field of disease detection at present.

The traditional method has no special prenatal detection method for diagnosing bilateral cupular ear deformities, can only carry out operation treatment after birth, and brings double pains on spirit and body of patients. Therefore, it is necessary to find a highly sensitive method for non-invasive prenatal diagnosis of bilateral goblet-shaped ear malformation genetic diseases.

According to the early research results, the peripheral blood of the pregnant woman is collected, free DNA (cf-fDNA) of a fetus in the peripheral blood of the pregnant woman is extracted, amplification detection is carried out by adopting a specific primer or probe pair, bilateral cupped ear malformation fertility risk assessment is carried out, more selections and early warning are provided for an infant patient and parents, and a powerful tool is provided for prenatal and postnatal care.

Disclosure of Invention

The invention aims to provide a gene chip, a kit and an application method of the gene chip for non-invasive prenatal detection of bilateral goblet-shaped ear deformities, so as to overcome the defects in the prior art. The purpose of the invention is realized by the following technical scheme:

a gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear deformities comprises a film base, wherein a probe set for detecting genes related to the bilateral goblet-shaped ear deformities is arranged on the film base to form a microarray gene chip.

The probe set comprises 10 probes, and the sequence of each probe is as follows:

(1) probe P1: the nucleotide sequence is GTGGGTTATTGGGGGGAAGAAC;

(2) probe P2: the nucleotide sequence is TAAATATTGCAGTTGACTTTATT;

(3) probe P3: the nucleotide sequence is CAGGTTCGAGACACGGATCGCAT;

(4) probe P4: the nucleotide sequence is CTGTCAACAGAGGAGAAAGCCTG;

(5) probe P5: the nucleotide sequence is ATGGTGTCTGCAGCAGGAGGC;

(6) probe P6: the nucleotide sequence is TTATCTCTTGTATGTAACTTGA;

(7) probe P7: the nucleotide sequence is GTGGCAACTAAGAACCAACATT;

(8) probe P8: the nucleotide sequence is GGCCTGTGAGTCCCTCTGCCAGGTG;

(9) probe P9: the nucleotide sequence is CCCACAGCCGGCTCCTGGCCTGG;

(10) probe P10: the nucleotide sequence is TCCCTTCCCTAACGCCCCCTGAG;

in each of probes P1 to P10, the 5 'end of each probe is labeled with a fluorophore, and the 3' end thereof is labeled with a quencher.

Further, the film base comprises a glass slide, a silicon wafer or a film as a carrier.

Furthermore, on the gene chip, each probe is provided with 3 probes, and the gene chip contains 30 probes.

Furthermore, a positive quality control probe, a negative quality control probe and a blank control probe are fixed on the gene chip; preferably, 3 positive quality control probes, 3 negative quality control probes and 3 white control probes are arranged, and 39 probes are fixed on the gene chip.

Further, in the above (1) to (10), the fluorophore labeled at the 5' -end of each probe is any one of FAM, HEX, VIC, CY5, and TET; the quenching group marked at the 3' end in each probe is any one of TAMRA, MGB and BHQ.

A preparation method of a gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations comprises the following steps: acid-base pretreatment of a film substrate, hydroformylation treatment, isothiocyanic acidification treatment, design of a chip probe and spotting of the probe, wherein the slide is immediately baked for 10min at 80 ℃ to prepare a microarray slide, and the microarray slide is stored in a box with a drying agent and is stored at room temperature.

A kit for noninvasive prenatal detection of bilateral goblet-shaped ear malformations, which comprises the gene chip.

An application method of a gene chip, which comprises the following steps: a sample containing DNA is prepared, and then the DNA sample is quantified, followed by hybridization using the gene chip.

The invention has the beneficial effects that: the invention discloses a gene chip, and fixes a probe with a specific base sequence on the chip to form a microarray, and then the chip is adopted to detect bilateral goblet-shaped ear deformity, and the detection is carried out by the gene chip, compared with the method of directly using the probe, the method has a plurality of advantages, in particular, the detection method has simpler and more convenient operation steps and shorter time, can complete the detection within 30-60 minutes usually, greatly shortens the time period, and has the characteristics of good detection specificity, high resolution, high sensitivity, accuracy and rapidness; the kit has the characteristic of high flux, can quickly screen the variation of genes related to bilateral goblet-shaped ear deformity, and improves the diagnosis of the bilateral goblet-shaped ear deformity to the gene level; in a word, the method saves cost and time, reduces the pain of patients and can carry out noninvasive prenatal diagnosis on the fetal illness probability.

The microarray chip takes cf-fDNA (mixture of fetus and maternal free DNA) of the peripheral blood of a pregnant woman to be detected as a template, is extracted, quantitatively marked, hybridized with the chip, and whether the fetus carries genes related to bilateral goblet-shaped ear deformity or not is determined according to a hybridization result; the method is very simple, the error rate and the time cost are greatly reduced, and the accuracy is improved; can be used for diagnosing prenatal congenital genetic diseases and has great potential in the field of noninvasive prenatal diagnosis.

Drawings

The above and other objects, features and advantages of the present invention will become more apparent from the following description of the embodiments of the present invention with reference to the accompanying drawings, in which:

FIG. 1 is a schematic diagram showing the distribution structure of the probe sequences in the gene chip according to the embodiment of the present invention;

FIG. 2 is a scan of a fetus according to an embodiment of the present invention without any bilateral goblet-ear abnormalities and copy number variation in the regulatory region;

FIG. 3 is a scanning image of the mixed fetal Copy Number Variation (CNV) carrying the regulatory region of the gene associated with bilateral goblet-shaped ear malformation according to the present invention.

Detailed Description

The following description will be given by taking specific experimental cases as examples, and it should be understood that the specific examples described herein are only for illustrating the present invention and are not intended to limit the present invention.

Example 1

A gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear deformities comprises a film base, wherein a probe group for detecting genes related to the bilateral goblet-shaped ear deformities is arranged on the film base to form a microarray gene chip; the probe set comprises 10 probes, and the sequence of each probe is as follows: (1) probe P1: the nucleotide sequence is GTGGGTTATTGGGGGGAAGAAC; (2) probe P2: the nucleotide sequence is TAAATATTGCAGTTGACTTTATT; (3) probe P3: the nucleotide sequence is CAGGTTCGAGACACGGATCGCAT; (4) probe P4: the nucleotide sequence is CTGTCAACAGAGGAGAAAGCCTG; (5) probe P5: the nucleotide sequence is ATGGTGTCTGCAGCAGGAGGC; (6) probe P6: the nucleotide sequence is TTATCTCTTGTATGTAACTTGA; (7) probe P7: the nucleotide sequence is GTGGCAACTAAGAACCAACATT; (8) probe P8: the nucleotide sequence is GGCCTGTGAGTCCCTCTGCCAGGTG; (9) probe P9: the nucleotide sequence is CCCACAGCCGGCTCCTGGCCTGG; (10) probe P10: the nucleotide sequence is TCCCTTCCCTAACGCCCCCTGAG.

Preferably, the film base comprises a glass slide, a silicon wafer or a film as a carrier; the film base or the carrier can be made of high polymer materials.

In each of the probes P1 to P10, the 5 'end of each probe is labeled with a fluorescent group, and the 3' end thereof is labeled with a quencher group. The sequence of the probes on the gene chip is shown in FIG. 1, i.e., probes P1 to P10 are arranged in the order from left to right, which facilitates the subsequent result determination.

The fluorescent group marked at the 5' end of 10 probes is any one of FAM, HEX, VIC, CY5 and TET; the quenching group marked at the 3' end is any one of TAMRA, MGB and BHQ. Preferably, the fluorescent groups in probes P1 to P13 are the same and the quenching groups in probes P1 to P13 are the same.

Preferably, there are 3 probes on each gene chip, i.e. three times of repetition, and the gene chip contains 30 probes, and the position of each probe is shown in fig. 1.

Preferably, on the gene chip, a positive quality control probe (i.e. C2 in figure 1), a negative quality control probe (i.e. C1 in figure 1) and a blank control probe (i.e. C3 in figure 1) are also immobilized; preferably, 3 positive quality control probes, 3 negative quality control probes and 9 white control probes are arranged respectively, and 39 probes are fixed on the gene chip.

In this embodiment, when detecting bilateral goblet-shaped ear deformities, it is only necessary to perform hybridization with the gene chip of this embodiment on which a specific number of probes having specific sequences are immobilized after cf-fDNA is extracted and quantitatively labeled, and finally perform corresponding evaluation according to the hybridization result.

The 10 specific probe sequences and the coordination among the 10 sequences belong to one of the important inventions of the present invention.

Example 2

A method for preparing gene chip used for detecting bilateral goblet-shaped ear deformity noninvasively prenatally selects a glass slide as a carrier film base of the gene chip, and the preparation of the gene chip comprises the following steps: (1) carrying out acid-base pretreatment on the glass slide; (2) performing hydroformylation treatment; (3) carrying out isothiocyanate acidification treatment; (4) designing a chip probe; (5) preparing a probe; (6) placing the spotted chip at 80 ℃ and baking for 10min to prepare a microarray slide; (7) storing in a box with desiccant, and storing at room temperature.

In this example, the preparation method may be a conventional method or may be a method in which the emphasis is placed on the gene chip itself, rather than on the preparation method.

Example 3

A kit for noninvasive prenatal risk assessment of congenital bilateral goblet-shaped ear malformations, comprising the gene chip described in example 1.

In this embodiment, when detecting and evaluating bilateral goblet-shaped ear malformations, the cfDNA is extracted and quantified, and then hybridization with the gene chip immobilized with the probe having the specific sequence is detected, so that the corresponding evaluation can be performed according to the hybridization result.

Example 4

An application method of a gene chip is characterized in that the method comprises the following steps: firstly, preparing a sample containing DNA, namely cf-fDNA, extracting and quantitatively marking the cf-fDNA, then carrying out hybridization by using the gene chip, carrying out data processing and image analysis after hybridization, carrying out chip scanning and the like, and then carrying out result evaluation. The method comprises the following specific steps:

(1) collecting blood of a pregnant woman, and extracting fetal cf-fDNA in the blood;

s1: preparing a washing solution (a purchase manufacturer: Living Biotechnology Co., Ltd., Changzhou), and preparing a washing solution A and a washing solution B;

a) washing solution A: adding 9ml of absolute ethyl alcohol into 21ml of washing solution; if 42ml of washing solution is taken, 18ml of absolute ethyl alcohol is added.

b) Washing solution B: adding 21ml of absolute ethyl alcohol into 9ml of washing solution; if 18ml of washing solution is taken, 42ml of absolute ethyl alcohol is added.

S2: a1.5 ml centrifuge tube was added with 200. mu.l of the collected maternal blood sample, 4. mu.l of DNA Carrier (DNA Carrier, manufacturer: Changzhou Bai Biotech Co., Ltd.), mixed well, added with 300. mu.l of lysis buffer (manufacturer: Changzhou Bai Biotech Co., Ltd.) and 20. mu.l of digestive juice (manufacturer: Changzhou Bai Biotech Co., Ltd.), shaken well mixed, and subjected to 56 ℃ water bath for 10 minutes.

S3: adding 1000 mu l of absolute ethyl alcohol into the centrifuge tube in S2, slightly reversing and uniformly mixing, and if translucent suspended matters exist, not influencing the extraction of DNA and subsequent experiments;

s4: placing the adsorption column into a collection tube, transferring 760 mul of the solution obtained in the step S3 into the adsorption column, standing for 2 minutes, centrifuging the adsorption column containing the collection tube at 12,000rpm and 4 ℃ for 1 minute, taking out the adsorption column, removing the waste liquid in the collection tube, placing the adsorption column back into the collection tube again, transferring the residual 760 mul of the solution into the adsorption column, and repeating the step once;

s5: removing the liquid in the collecting tube in the repeated steps, putting the adsorption column back into the collecting tube, adding 500 μ l of washing solution A into the adsorption column, centrifuging at 12,000rpm and 4 ℃ for 1 min, discarding the waste liquid in the collecting tube, and putting the adsorption column back into the collecting tube;

s6: adding 500 μ l of washing solution B into the adsorption column, centrifuging at 12,000rpm and 4 deg.C for 1 min, discarding the waste liquid in the collection tube, placing the adsorption column back into the collection tube, centrifuging at 12,000rpm and 4 deg.C for 2 min, and removing the residual washing solution;

s7: the adsorption column was taken out, put into a new 1.5ml centrifuge tube, 30 to 50. mu.l of the eluent was added, allowed to stand for 3 minutes, centrifuged at 12,000rpm at 4 ℃ for 2 minutes, and the cf-fDNA solution was collected. The extracted cf-fDNA can be used for the next experiment or stored at-20 ℃.

(2) Marking: fluorescence labeling the cfDNA extracted in the step (1) and a standard DNA sample of a normal control (from a normal population or can be obtained from a human genome database), and accurately quantifying the sample. The specific operation is as follows: respectively taking 1ug of standard DNA samples, carrying out fluorescence labeling by a random primer method, labeling cf-fDNA by fluoroescein-12-dUTP, and enabling a probe to show green fluorescence; the normal control DNA was labeled with tetramethylrhododamine-5-dUTP, and the probe was fluorescent in red.

(3) And (3) hybridization: firstly, preparing a chip hybridization solution: the proportion of the hybridization solution is as follows: 100 to 300mM Hepes-HCl (pH 8.0), 1 to 3M NaCl, 0.5 to 1mM EDTA (pH 8.0); then, 500ng of each DNA which is quantified and marked is mixed in equal proportion, the mixture is mixed with the hybridization solution in equal proportion, after the DNA is denatured for 10min at the temperature of 95 ℃, the mixture is immediately placed in an ice bath for 5min, meanwhile, the gene chip is rinsed for 20s in 0.2% SDS, then rinsed for 5s in ultrapure water, the water on the surface of the gene chip is thrown off, and the mixture is dried in the air at the room temperature. Mu.l of the denatured amplification product was carefully added to the reaction area of the gene chip to make the distribution uniform (based on the hybridization mixture covering the hybridization reaction area and not overflowing). When the hybridization mixture is added to the reaction region of the gene chip, care should be taken not to bring the tip into contact with the gene chip, so as not to affect the probe array. The gene chip was placed in a hybridization cassette in a horizontal position and hybridized in a water bath at a temperature to be determined for 1 hour. During hybridization reaction, condensed water should be prevented from dropping on the gene chip; care should be taken when moving the hybridization cassette to prevent cross-contamination of the reaction solutions in the reaction zones. After the hybridization reaction, the gene chip was rinsed in SSC washing solution. Taking out the gene chip, throwing off the residual liquid on the gene chip, and drying at room temperature.

(4) Data processing and image analysis: and (4) scanning the gene chip in the step (3) by using a laser confocal gene chip scanner, and analyzing by using signal analysis software.

In particular, it can be operated according to the prior art.

(5) Chip effect verification: the gene chip detection is verified to be 20 parts of normal human samples and 20 parts of congenital bilateral cupped ear hereditary disease patients through sequencing, the total amount is 40 parts, and the detection results are consistent with the high-density SNP chip detection results and the second-generation sequencing results, so that the chip provided by the invention has specificity when being used for detecting congenital bilateral cupped ear malformation mutation.

And (4) judging a result:

with reference to FIGS. 1-3, the results of the positive scan of the present invention are shown as ●, filled in color; the negative scanning result is shown in the figure

Filling slash icons inside; the hybrid carriers are shown in the figure

And filling the triangular icon.

FIG. 1 is a schematic diagram showing the arrangement of the order or position of probes on a gene chip; FIG. 2: the scanning result schematic diagram of the fetus without carrying any gene related to bilateral goblet-shaped ear malformation and copy number variation of the regulatory region; FIG. 3: scanning result diagram of mixed fetus carrying Copy Number Variation (CNV) of gene regulatory region related to bilateral goblet-shaped ear deformity.

Analyzing the detection result, performing hybridization detection on a sample to be detected by using a gene chip, and if the colors of 10 probes on the gene chip are consistent with those in the figure 3, determining that the sample is a positive case, namely the sample carries pathogenic genes related to bilateral goblet-shaped ear deformity, so that the postnatal infant suffers from the bilateral goblet-shaped ear deformity; if the color of 10 probes on the gene chip is consistent with that in FIG. 2, the case is negative, i.e. the fetus to be tested does not carry the pathogenic genes related to bilateral goblet-shaped ear deformity, and it is known that the infant after birth does not suffer from bilateral goblet-shaped ear deformity.

The result analysis after hybridization and scanning can be concluded by only comparing fig. 1-3, which is very simple, does not need to calculate Ct value and the like additionally, does not need to draw a corresponding curve chart for auxiliary judgment, greatly saves time, reduces error rate, increases result accuracy, and has extremely important value for practical application.

In the step (1), the disease of the pregnant woman can be screened at the earliest time of 4-8 weeks of pregnancy, namely, the kit of the invention can be used for collecting the peripheral blood of the pregnant woman who is pregnant for 4-8 weeks to evaluate and judge whether the fetus has bilateral goblet-shaped ear deformity, namely, if the detection result is positive, the fetus has bilateral goblet-shaped ear deformity, early intervention can be carried out, and if the detection result is negative, the fetus does not have bilateral goblet-shaped ear deformity.

Example 5

In order to verify the specificity of the probes and the like of the present invention and the validity of the method, 4 negative samples and 4 positive samples (for the sake of research, the applicant has a large-scale library) were collected from the library and designated as samples a01 to a08, respectively, and the detection was performed according to the method described in example 4 using the same hybridization system as in example 4. The results obtained are shown in table 1 below.

TABLE 1 analysis of test results data

In table 1, the negative-positive and postnatal phenotypes are known, and the negative and positive results detected by the method of the present invention are completely consistent with the information recorded in the sample library, and the predicted fetal phenotype is also completely consistent with the actual infant phenotype. In addition, the inventor has already carried out verification research on hundreds of cases in a sample library in many years of research, and the results are basically consistent with those in practice, so that the accuracy in the application is extremely high and can basically reach more than 100%.

Example 6

Object: collecting peripheral blood of pregnant women who are pregnant for 4-5 weeks, wherein the collected pregnant women have bilateral goblet-shaped ear malformation phenotypes or family relatives of the pregnant women have bilateral goblet-shaped ear malformations;

the collection place comprises: collecting nearly 30 hospitals nationwide;

time: 2017.1-2017.10;

quantity: 192, the number of the channels is 192;

the method comprises the following steps: the detection was carried out in accordance with the method described in example 4, and the hybridization system used was the same as in example 4, and the method for determining the result used was the same as in example 5.

As a result: among them, 183 cases obtain ideal detection results by chip hybridization; in 9 cases, because the development of the fetus is slow, the amount of the fetal cf-fDNA in the peripheral blood of the pregnant woman is small, and the hybridization detection result is not ideal, therefore, the second collection is performed when the 9 cases of pregnant women are pregnant for 7-8 weeks, the method in the embodiment 4 is also adopted for detection, and finally the hybridization signal is successfully obtained.

Specific hybridization detection results and actual results are shown in table 2 below, and the actual results are obtained by tracking, observing and detecting postpartum.

TABLE 2 test results and prediction results

The result of the detection	Number of	Predicted results	Practical results
				Positive for	42 examples of	Suffering from bilateral goblet-shaped ear deformity	Bilateral cupular ear deformity
Negative of	141 example (b)	Does not suffer from bilateral goblet-shaped ear deformity	Normal phenotype

It is found from the above results by tracking 183 pregnant women, that all the infants born by the pregnant women who showed positive were marked with bilateral cupular ear deformity, and that the infants born by the pregnant women who showed negative were normal and did not have the appearance characteristic of bilateral cupular ear deformity.

The method has the advantages that the specificity of the probe fixed in the gene chip is high, the accuracy is high, the prediction is accurate and can be accurate to 100%, so that a pregnant woman can know the fetal condition as soon as possible, the early treatment or intervention is facilitated, and the method has an extremely important value for the good prenatal and postnatal care.

More importantly, about 97% of pregnant women can be detected when the pregnant women are pregnant for 4-5 weeks and almost just discovered, and can be detected at the latest 8 weeks, so that more accurate estimation is performed; of course, after 8 weeks, the detection is more likely, but the earlier the detection is more meaningful.

In addition, the sample is collected in this example using blood taken routinely from a pregnant woman under the consent of the pregnant woman.

It should be noted that, in this embodiment, the final result is obtained in 30 to 60 minutes for all the samples collected, and the speed is high, the efficiency is high, and the accuracy is high. Furthermore, all samples collected in this example were tested with blood taken routinely for delivery with the pregnant women's consent.

In the present invention, the probe sequence in the gene chip has high specificity, and if one or several bases in one or several probes are changed, the specificity is greatly reduced, resulting in high error rate. The sequences of the primer groups in the kit have extremely high specificity, and the change of base sites in some primer groups also has extremely great influence on the accurate expression of results.

The copy number Change (CNV) of the HMX1 regulatory region fragment is in linkage coseparation with the generation of bilateral goblet-shaped ear malformation families, and is directly related to the generation of bilateral goblet-shaped ear malformations, so the invention mainly aims at the research of the HMX1 regulatory region fragment, and the effect is surprised.

The present invention is not limited to the above-mentioned preferred embodiments, and any other products in various forms can be obtained by anyone in the light of the present invention, but any changes in the shape or structure thereof, which have the same or similar technical solutions as those of the present application, fall within the protection scope of the present invention.

Claims

1. A gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations is characterized in that: the gene chip comprises a film base, wherein the film base is provided with a probe group for detecting related genes of bilateral goblet-shaped ear deformity to form a microarray gene chip;

(1) probe P1: the nucleotide sequence is GTGGGTTATTGGGGGGAAGAAC;

(2) probe P2: the nucleotide sequence is TAAATATTGCAGTTGACTTTATT;

(3) probe P3: the nucleotide sequence is CAGGTTCGAGACACGGATCGCAT;

(4) probe P4: the nucleotide sequence is CTGTCAACAGAGGAGAAAGCCTG;

(5) probe P5: the nucleotide sequence is ATGGTGTCTGCAGCAGGAGGC;

(6) probe P6: the nucleotide sequence is TTATCTCTTGTATGTAACTTGA;

(7) probe P7: the nucleotide sequence is GTGGCAACTAAGAACCAACATT;

(8) probe P8: the nucleotide sequence is GGCCTGTGAGTCCCTCTGCCAGGTG;

(9) probe P9: the nucleotide sequence is CCCACAGCCGGCTCCTGGCCTGG;

(10) probe P10: the nucleotide sequence is TCCCTTCCCTAACGCCCCCTGAG.

2. The gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations of claim 1, wherein: in the probes P1-P10, the 5 'end of each probe is labeled with a fluorescent group, and the 3' end of each probe is labeled with a quenching group.

3. The gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations of claim 2, wherein: the film base comprises a glass slide, a silicon chip or a film as a carrier.

4. The gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations of claim 2, wherein: on the gene chip, each probe is provided with 3 probes, and the gene chip contains 30 probes.

5. The gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations of claim 3, wherein: on the gene chip, a positive quality control probe, a negative quality control probe and a blank control probe are fixed.

6. The gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations of claim 5, wherein: the positive quality control probe, the negative quality control probe and the white control probe are respectively provided with 3 probes, and 39 probes are fixed on the gene chip.

7. The gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations of claim 4, wherein: in the above (1) to (10), the fluorescent group labeled at the 5' -end in each probe is any one of FAM, HEX, VIC, CY5, and TET; the quenching group marked at the 3' end in each probe is any one of TAMRA, MGB and BHQ.

8. A method for preparing the gene chip for noninvasive prenatal detection of bilateral goblet-shaped ear malformations according to any one of claims 1 to 7, comprising the following steps: acid-base pretreatment of a film substrate, hydroformylation treatment, isothiocyanic acidification treatment, design of a chip probe and spotting of the probe, wherein the slide is immediately baked for 10min at 80 ℃ to prepare a microarray slide, and the microarray slide is stored in a box with a drying agent and is stored at room temperature.

9. The utility model provides a kit that is used for having noninvasive prenatal detection two side cup ear deformities which characterized in that: the kit comprises the gene chip as claimed in claim 1-6.

10. Kit for the non-invasive prenatal detection of bilateral cupped ear malformations as claimed in claim 9, characterized in that: the kit also comprises a washing solution, a lysis solution, a digestive juice, a standard DNA sample, a chip hybridization solution and 0.2% SDS.