WO2020037648A1

WO2020037648A1 - Rape gene resistant to pyrimidine salicylic acid herbicides and use thereof

Info

Publication number: WO2020037648A1
Application number: PCT/CN2018/102232
Authority: WO
Inventors: 胡茂龙; 浦惠明; 龙卫华; 高建芹; 张洁夫; 陈松
Original assignee: 江苏省农业科学院
Priority date: 2018-08-24
Filing date: 2018-08-24
Publication date: 2020-02-27
Also published as: CA3087906A1; CN112154207B; CN112154207A; DE112018006599T5

Abstract

Provided are a rape gene which is resistant to pyrimidine salicylic acid herbicides and the use thereof, and further provided are a rape plant and parts thereof which can withstand pyrimidine salicylic acid herbicides.

Description

Rape pyrimidine-salicylic acid-resistant herbicide gene and application thereof

Technical field

The invention relates to the technical field of plant genetic engineering, in particular to rapeseed pyrimidine-salicylic acid herbicide gene and application thereof. More specifically, the present invention relates to a rape plant that is tolerant to pyrimidine salicylic acid herbicides and parts thereof, resistance genes, muteins, and applications thereof.

Background technique

Rape (Brassica napus L.) is China's largest oilseed crop, providing edible oil sources for more than half of the population in China. One of the important biological hazards in rapeseed production is farmland weeds. It not only competes with rapeseed for water and fertilizer, but also changes the microclimate of rapeseed fields. Some weeds are also intermediate hosts of rapeseed pests and diseases, and accelerate the spread of pests and diseases It severely affects the yield and quality of rapeseed crops. However, manual weeding is time consuming and laborious, increasing production costs. Therefore, the application of herbicides to control field weeds has become an inevitable choice for people.

Herbicides mainly inhibit or disrupt plants by inhibiting or interfering with key metabolic processes in plants. Targeting key enzymes in the amino acid biosynthesis process is an important direction and hot spot in the development of new and efficient herbicides. Herbicides developed with acetolactate synthase (ALS; EC2.2..16) as the target enzyme have become mainstream products of new high-efficiency herbicides. ALS is an enzyme that catalyzes the first step in the biosynthesis of branched-chain amino acids (valine, leucine, and isoleucine). ALS inhibitor herbicides can inhibit ALS enzyme activity in plant cells, hinder branch chain amino acids (valine, leucine, and isoleucine) biosynthesis, thereby inhibiting plant cell division and growth. In the early 1990s, the Japanese combination chemical company developed a new class of ALS herbicides, pyrimidyl-benzoates (PB) herbicides, targeting acetolactate synthase, also known as pyrimidineoxy (thio) benzoic acid Herbicides. The first commercial variety of this class of herbicide was pyrithiobac-sodium. Subsequently, pyriminobac-methyl was developed in 1993, and bispyribac-sodium (Nongmeili) was developed in 1996.

Since the application of ALS herbicides to agriculture, it has been observed that sensitive plant species, including naturally occurring weeds, occasionally show spontaneous tolerance to such herbicides. Substitution of a single base at a specific site in the ALS gene usually results in more or less resistance, and plants with mutated ALS alleles show different levels of tolerance to ALS herbicides, depending on The chemical structure of the ALS herbicide and the point mutation site of the ALS gene.

The study found that there are significant differences in the resistance function of ALS at the site where the amino acid substitution occurs and the substitution of different amino acids at the site (Yu Q, Han HP, Martin M, Vila-Aiub, Powles SB.AHAS, herbicide, resistance endowing, mutations: effect, functionality, and plant growth. J. Exp. Botany, 2010, 61: 3925-3934). There are significant differences in the resistance effects of ALS inhibitor herbicides caused by amino acid substitutions at different sites, and at the same time, different site mutations have a more complex cross-resistance relationship to other ALS inhibitor herbicides.

There is also a great need in the art to obtain rapeseed plants that have a growth advantage over strong weeds, and to obtain non-transgenic rapeseed plants that can tolerate pyrimidine salicylic acid herbicides.

Summary of invention

The present invention addresses this need and provides mutant acetolactate synthase (ALS) nucleic acids and proteins encoded by these mutant nucleic acids. The invention also relates to rapeseed plants, cells and seeds comprising these mutant nucleic acids and proteins, said mutations conferring tolerance to a pyrimidine salicylic acid herbicide, wherein the ALS polypeptide encoded by the ALS gene is at position 556 thereof Contains amino acids different from tryptophan and contains amino acids different from serine at position 635. In a preferred embodiment, the ALS polypeptide encoded by the ALS gene has a double mutation selected from the group consisting of: W556L and S635N; W556L and S635T; W556L and S635I. In the most preferred embodiment, the ALS polypeptide encoded by the ALS gene has the following mutations: W556L and S635N.

In one embodiment, the invention provides an isolated nucleic acid encoding a mutant acetolactate synthase (ALS3), said mutant acetolactate synthase (ALS3) protein comprising the following mutations:

Mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and

The serine (S) is mutated to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;

Preferably, the nucleotide sequence of the isolated nucleic acid is as shown in SEQ ID NO: 3;

Preferably, the amino acid sequence of the mutated ALS3 protein is as shown in SEQ ID NO: 4.

In one aspect, the invention provides an expression cassette, vector or cell, which contains a nucleic acid according to the invention. Accordingly, the present invention provides the use of a nucleic acid, an expression cassette, a vector or a cell or a mutant acetolactate synthase (ALS3) protein of the present invention for producing a pyrimidine salicylic acid herbicide-resistant plant. Preferably, the plant For rapeseed.

In another aspect, the present invention provides a method for producing a plant having pyrimidine salicylic acid herbicide resistance, which comprises the following steps:

The nucleic acid according to the present invention is introduced into a plant, and preferably the nucleic acid according to the present invention is introduced into a plant through steps such as transgenic, hybridization, backcrossing or asexual propagation, wherein the plant expresses the mutant acetolactate synthase according to the present invention. (ALS3) protein and has pyrimidine salicylic acid herbicide resistance.

In yet another aspect, the present invention provides a non-transgenic plant or part thereof that is resistant to a pyrimidine salicylic acid herbicide, comprising an isolated nucleic acid encoding a mutant acetolactate synthase protein, the mutant acetolactate synthase protein comprising The following mutations:

The serine (S) is mutated to asparagine (N), threonine (T) or isoleucine (I) at the position corresponding to position 635 of SEQ ID NO: 2,

Preferably, wherein said plant is rape; wherein said parts are organs, tissues and cells of the plant, and preferably seeds;

Preferably, wherein said protein comprises a mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2 and a position corresponding to position 635 of SEQ ID NO: 2 Mutation of serine (S) to asparagine (N);

More preferably, the amino acid sequence of the mutated ALS3 protein is shown in SEQ ID NO: 4.

In another aspect, the present invention provides a method for controlling weeds in a field containing rape plants, the method comprising applying an effective amount of a pyrimidine salicylic acid herbicide to the field containing the weeds and rape plants The rapeseed plant contains an isolated nucleic acid encoding a mutant acetolactate synthase protein, and the mutant acetolactate synthase protein contains the following mutations:

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the results of amino acid partial sequence alignment of rapeseed ALS3 from different sources.

ALS3, reference sequence on Genbank (accession number: Z11526); ALS3 amino acid partial sequence of ALS3_N131 wild type strain N131; ALS3_EM28 resistant EM3 amino acid partial sequence of EM28; ALS3_Sh4 resistant material Sh4; ALS3 amino acid partial sequence of Sh5; ALS3_Sh6 resistant material Sh6; ALS3 amino acid partial sequence of ALS3_Sh7 resistant material Sh7. Arrows indicate mutant amino acids.

Figure 2 shows the in vitro inhibition of wild-type and mutant ALS enzyme activity by bensulfuron-methyl at different concentrations.

Figure 3 shows the in vitro inhibition of ALS enzyme activity of wild-type and mutants by different concentrations of imidazolenic acid.

Figure 4 shows the in vitro inhibition of ALS enzyme activity of wild-type and mutants by bisamprol at different concentrations.

Figure 5 shows the resistance performance of herbicide-resistant Arabidopsis thaliana and tobacco after spraying with herbicide (Col, wild-type Arabidopsis, 3A-1 and 3A-2 Arabidopsis; Tob, wild-type tobacco, Y3A-1 and Y3A-2 transgenic tobacco-resistant tobacco). + Indicates spraying with 60 g of aiha ^-1 bispyrisol,-indicates no treatment with herbicide.

Detailed description of the invention

Reference will be made to the non-limiting embodiments and examples described and / or illustrated in the accompanying drawings and detailed in the description below to more fully illustrate the embodiments of the invention and their different features and advantageous details. It should be noted that the features described in the drawings are not necessarily drawn to scale, and that features of one embodiment may be used with other embodiments when recognized by those skilled in the art, although not explicitly illustrated herein.

definition

Unless otherwise stated, the terms used in the claims and the specification are defined as listed below.

The term "non-transgenic" means that the individual genes have not been introduced by an appropriate biological vector or by any other physical means. However, the mutated gene can be passed on by pollination (naturally or by breeding methods) to produce another non-transgenic plant containing the specific gene.

By "endogenous" gene is meant a gene in a plant that is not introduced into said plant by genetic engineering techniques.

The terms "nucleotide sequence", "polynucleotide", "nucleic acid sequence", "nucleic acid", "nucleic acid molecule" are used interchangeably herein and refer to a polymerized unbranched form of nucleotides of any length , Ribonucleotides or deoxyribonucleotides, or a combination of both. Nucleic acid sequences include DNA, cDNA, genomic DNA, RNA, including synthetic forms, and mixed polymers, including the sense and antisense strands, or may contain unnatural or derived nucleotide bases, as will be understood by those skilled in the art this point.

As used herein, the term "polypeptide" or "protein" (these two terms are used interchangeably herein) means a peptide, protein or polypeptide comprising an amino acid chain of a given length, wherein the amino acid residue is Covalent peptide bonds. However, the present invention also includes peptide mimics of the protein / polypeptide (in which amino acids and / or peptide bonds have been replaced by functional analogs), and amino acids other than the amino acids encoded by the 20 genes, such as selenohalides Cystine. Peptides, oligopeptides, and proteins can be referred to as polypeptides. The term polypeptide also refers to (but does not exclude) modification of the polypeptide, such as glycosylation, acetylation, phosphorylation, and the like. This modification is well documented in the basic literature and in more detail in monographs and research literature.

Amino acid substitutions include amino acid changes in which amino acids are replaced by different naturally occurring amino acid residues. Such substitutions can be classified as "conservative" in which the amino acid residues contained in the wild-type ALS protein are replaced by another naturally occurring and similarly characteristic amino acid. For example, or the substitutions included in the present invention may also be "non-conservative" ", Where the amino acid residues present in the wild-type ALS protein are replaced with amino acids having different properties, such as naturally occurring amino acids from different groups (such as the replacement of charged or hydrophobic amino acids with alanine). As used herein, "similar amino acids" refers to amino acids with similar amino acid side chains, ie, amino acids with polar, non-polar, or near neutral side chains. As used herein, "dissimilar amino acids" refer to amino acids with different amino acid side chains, for example, amino acids with polar side chains are not similar to amino acids with non-polar side chains. Polar side chains often tend to be present on the surface of proteins, where they can interact with the water environment present in the cell ("hydrophilic" amino acids). On the other hand, "non-polar" amino acids tend to be located in the center of the protein, where they can interact with similar non-polar neighboring molecules ("hydrophobic" amino acids). Examples of amino acids with polar side chains are arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, histidine, lysine, serine, and threonine ( All are hydrophilic amino acids except cysteine is hydrophobic). Examples of amino acids with non-polar side chains are alanine, glycine, isoleucine, leucine, methionine, phenylalanine, proline and tryptophan (all are hydrophobic, Except glycine is neutral).

Generally, those skilled in the art can know, based on their common sense and the context of using the terms ALS, ALSL, AHAS, or AHASL, to refer to the nucleotide sequence or nucleic acid, or the amino acid sequence or polypeptide, respectively.

As used herein, the term "gene" refers to a polymerized form of nucleotides (ribonucleotides or deoxyribonucleosides) of any length. This term includes double- and single-stranded DNA and RNA. It also includes known Types of modification, such as methylation, "capping," replacing one or more naturally occurring nucleotides with analogs. Preferably, the gene includes a coding sequence that encodes a polypeptide as defined herein. The "coding sequence" is when A nucleotide sequence that is placed or under the control of appropriate regulatory sequences that can be transcribed into mRNA and / or translated into a polypeptide. The boundaries of the coding sequence are the translation initiation codon at the 5 'end and the 3' end The translation stop codon is determined. The coding sequence can include, but is not limited to, mRNA, cDNA, recombinant nucleic acid sequence or genomic DNA, but introns may be present in some cases.

As used herein, the term "Brassica napus" may be abbreviated as "B. napus". In addition, the term "rapeseed" is used herein. The three terms are used interchangeably and should be understood to completely include rape in cultivated form. Similarly, for example, the term "Arabidopsis thaliana" can be abbreviated as "A. thaliana". These two terms are used interchangeably herein.

When used in the present invention, the term "position" means the position of an amino acid in an amino acid sequence described herein or the position of a nucleotide in a nucleotide sequence described herein, such as the wild type shown in SEQ ID NO: 1 The position in the coding sequence of the rape ALS3 protein or the amino acid sequence of the wild-type rape ALS3 protein shown in SEQ ID NO: 2 or its corresponding position. The term "corresponding" as used herein also includes positions determined not only by the aforementioned nucleotide / amino acid numbering. Due to deletions or insertions of nucleotides at other positions in the ALS 5 'untranslated region (UTR) (including promoters and / or any other regulatory sequences) or genes (including exons and introns), the present invention The position of a given nucleotide that can be substituted in the can be different. Similarly, given amino acid deletions or insertions at other positions in the ALS polypeptide, the positions of a given amino acid that can be replaced in the present invention may differ. Therefore, "corresponding positions" in the present invention should be understood as the nucleotides / amino acids at the indicated numbers may be different, but still may have similar adjacent nucleotides / amino acids. Said nucleotides / amino acids which can be exchanged, deleted or inserted are also included by the term "corresponding position". In order to determine whether a nucleotide residue or an amino acid residue in a given ALS nucleotide / amino acid sequence corresponds to a certain position in the nucleotide sequence SEQ ID NO: 1 or the amino acid sequence SEQ ID NO: 2, the art Skilled artisans can use tools and methods well known in the art, such as comparisons manually or by using computer programs, such as BLAST (Altschul et al. (1990), Journal of Molecular Biology, 215, 403-410) (which represents a substantial local Alignment Search Tool) or ClustalW (Thompson et al. (1994), Nucleic Acid Res., 22, 4673-4680) or any other suitable program suitable for generating sequence alignments.

Specifically, the present invention provides a rapeseed plant in which a tryptophan W → leucine L substitution occurs at a position 556 of a polypeptide encoded by the endogenous ALS gene of the rapeseed plant, which is due to corresponding to SEQ ID ID NO: The "G" nucleotide is mutated to the "T" nucleotide at the position 1667 of the nucleotide sequence shown in 1. And, a serine S → asparagine N substitution occurred at the position 635 of the polypeptide encoded by the endogenous ALS gene of the rape plant, which is due to the nucleotide sequence position 1904 corresponding to the nucleotide sequence shown in SEQ ID NO: 1 The "G" nucleotide is mutated to the "A" nucleotide at the position. In the most preferred embodiment, the present invention provides a rapeseed plant, and the endogenous ALS3 gene of the rapeseed plant comprises (or consists of) the nucleotide sequence shown in SEQ ID NO: 3, which encodes SEQ ID mutated ALS3 polypeptide shown by NO: 4.

ALS activity can be measured according to the assay described in Singh (1991), Proc. Natl. Acad. Sci. 88: 4572-4576. The ALS nucleotide sequences encoding ALS polypeptides referred to herein preferably confer resistance to one or more pyrimidinesalicylic acid herbicides described herein (alternatively, Low sensitivity). This is due to the point mutations described herein that lead to amino acid substitutions. Therefore, tolerance to pyrimidine salicylic acid herbicides (or, less sensitive to pyrimidine salicylic acid herbicides) can be derived from the presence of mutations in the presence of pyrimidine salicylic acid herbicides. ALS is obtained from cell extracts of plants of the ALS sequence and plants without a mutant ALS sequence and their activity is measured for comparison, for example the method described in Singh et al (1988) [J. Chromatogr., 444, 251-261]. When using plants, preferably in the presence of multiple concentrations of pyrimidinesalicylic acid herbicides, more preferably in the presence of multiple concentrations of pyrimidinesalicylic acid herbicide "bisoxafen," in the wild type ALS activity in cell extracts or leaf extracts of rapeseed and rapeseed cell extracts or leaf extracts of the obtained mutants. When used herein, the sensitivity is lower, and vice versa, can be considered as "resistant "Higher tolerance" or "higher resistance." Similarly, "higher tolerance" or "higher resistance", and vice versa, can be considered "less sensitive."

The term "pyrimidinesalicylic acid herbicide" is not intended to be limited to a single herbicide that can interfere with the enzyme activity of ALS. Therefore, unless otherwise stated or apparent from the context, a "pyrimidinesalicylic acid herbicide" may be one herbicide or two, three, four, or more herbicides known in the art. Mixtures of agents, the herbicides are preferably those listed herein, such as, for example, sulfamethoxazole, sulfachlor, ciprofen, bispyribac, sulfamethoxam, sulfamethoxam, and the like.

The present invention provides a rapeseed plant that is tolerant to pyrimidine salicylic acid herbicides and has an endogenous acetolactate synthase (ALS) gene mutation. As used herein, the term "plant" means a plant at any stage of development, unless explicitly stated otherwise. A part of the plant may be connected to the whole plant or may be separated from the whole plant. Parts of such plants include, but are not limited to, the organs, tissues and cells of the plant, preferably seeds. The rapeseed plant of the present invention is non-transgenic with respect to the endogenous ALS gene. Of course, the exogenous gene can be transferred into the plant by genetic engineering or by conventional methods such as crossing.

The present invention is described below based on examples, but the present invention is not limited to these examples.

Example 1

In the previously applied patents (Hu Maolong et al., Chinese Patent: CN 107245480 A, herbicide-resistant acetolactate synthase mutant protein and its application), the wild-type rapeseed line N131 (known and public, see Pu Huiming et al.) , Jiangsu Journal of Agricultural Sciences, 2010, 26 (6): 1432-1434) Ethyl methanesulfonate (EMS) mutagenesis treatment. In the M2 generation of mutagenesis, we screened and identified mutations resistant to sulfonylurea herbicides.体 EM28. The seed of EM28 plant was deposited on June 19, 2017 at the Common Microbiological Center (CGMCC) of the China Microbial Strain Collection Management Committee, Address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, 100101, deposit number CGMCC No .14299, the taxonomic name of this strain: Brassica napus. Subsequent genetic and resistance identification studies found that the resistance trait of EM28 is an incomplete dominant trait controlled by one nuclear gene. It is resistant to imidazolinone and sulfonylurea herbicides and resistant to pyrimidine salicylic acid. Herbicides are sensitive. Therefore, in order to obtain the germplasm or resources of pyrimidine-salicylic acid-resistant rapeseed to meet the needs of breeding of herbicide-resistant rapeseed varieties, we again performed EMS mutagenesis on EM28 seeds. When the M2 generation of vegetable seedlings reaches the 3-4 leaf stage, spray the pyrimidine salicylic acid herbicide bisoxafen [chemical name: 2,6-bis (4,6-dimethoxypyrimidin-2-oxy) Sodium benzoate. Molecular formula: C ₁₉ H ₁₇ N ₄ NaO ₈ . CAS number: 125401-92-5 (sodium salt)], spraying weeds is recommended to use oxadiazine at a concentration of 60g aiha ^-1 for screening of pyrimidine-salicylic acid-resistant herbicides. After 3 weeks of treatment, almost all rape seedlings were near death, and only 10 rape seedlings survived and grew normally. These 10 strains suspected to be pyrimidine-salicylic acid-resistant herbicide oil menu strains are numbered Sh1 to Sh10. After the vegetable seedlings have grown to the 5-6 leaf stage, they are moved to rapeseed breeding fields, and M3 seeds are harvested by self-bagging during flowering. In the light culture room, the recommended concentration of spraying the bispyribenzide herbicide weed control on M3 seeds at seedling stage was used to identify the resistance effect. From 1 week after spraying, observe the phytotoxicity reaction every day. It was found that the six strains numbered Sh1, Sh2, Sh3, Sh8, Sh9, and Sh10 had a phytotoxicity reaction one week after spraying. The heart leaves of the vegetable seedlings began to turn yellow, and gradually rot, and finally died. These seedlings should be caused by leakage of pesticides under high-density planting conditions; the four strains numbered Sh4, Sh5, Sh6, and Sh7 showed strong resistance without any symptoms of phytotoxicity and could grow normally. So far, we have obtained 4 new germplasms of Brassica napus resistant to pyrimidine salicylic acid herbicides. Later, through classical genetics research, it was found that the resistance traits in the F ₂ generation population had a 3: 1 separation ratio between the living and dead strains, which was consistent with the genetic rule of single dominant genes. In other words, the mutant gene is dominant and controlled by a single gene.

Example 2: Molecular cloning of a resistance gene in a new germplasm of Brassica napus resistant to pyrimidine salicylic acid herbicides

Pyrimidine salicylic acid herbicides belong to the class of ALS inhibitor herbicides. The target of this type of herbicide is acetolactate synthase. There are three functional acetolactate synthase genes in the Brassica napus genome, which are located in the A genome ALS2 and ALS3 (Genebank accession numbers: Z11525 and Z11526), and the C genome of ALS1 (Genebank accession number: Z11524). Based on these three ALS gene sequences, three pairs of PCR primers were designed. ALS1 primer 1: GTGGATCTAACTGTTCTTGA and primer 2: AGAGATGAAGCTGGTGATC. ALS2 primer 1: GAGTGTTGCGAGAAATTGCTT and primer 2: TTGATTATTCTATGCTCTCTTCTG. ALS3 primer 1: AGGGTTAGATGAGAGAGAGAGAG and primer 2: GGTCGCACTAAGTACTGAGAG. The CTAB method was used to extract leaf genomic DNA from resistant strains Sh4, Sh5, Sh6, Sh7 and non-resistant strains Sh1, Sh2, Sh3, Sh8, Sh9, Sh10, and N131 and EM28. PCR wild-type and mutant ALS1 were cloned. ALS2 and ALS3 genes. 50μL PCR reaction system was prepared according to the instructions of Toyobo (Shanghai) Biotechnology Co., Ltd. high-fidelity DNA polymerase KOD-Plus kit. Amplification was performed on a MJ Research PTC-200 PCR instrument. The reaction procedure was pre-denaturation at 94 ° C for 5 minutes; denaturation at 94 ° C for 30s, annealing at 55 ° C for 30s, and extension at 72 ° C for 2.5 minutes, a total of 35 cycles. After adding A to the blunt end, the product was separated by 1.2% (V / W) agarose gel electrophoresis, and then purified and recovered using an agarose gel DNA recovery kit (catalog number: DP209) produced by Beijing Tiangen Company. The purified PCR The products were commissioned by Nanjing Kingsray Biological Co., Ltd. for sequencing. Sequencing comparisons revealed that four resistant strains detected point mutations at two loci in the ALS3 gene. That is, a point mutation occurred at the + 1667th position of the ALS3 gene, and the nucleotide changed from G to T, which resulted in the 556th mutation of the corresponding encoded protein from tryptophan (W) to leucine (L); at +1904 A point mutation occurred, and the nucleotide changed from G to A, resulting in a mutation at position 635 of the corresponding encoded protein from serine (S) to asparaginic acid (N) (Figure 1). Therefore, compared with the mutant EM28, the ALS3 gene in the resistant strain has a new mutation site (S635N), the nucleotides of which are shown in SEQ ID NO: 3 and the amino acid sequence of which is shown in SEQ ID NO: 4 shown. A two-site mutation of the ALS3 gene (W556L and S635N) increased the resistance of resistant mutants to pyrimidine salicylic acid herbicides.

Example 3: Evaluation and identification of herbicide resistance effects of resistant lines

Sh7 with strong growth potential and good plant type was tentatively named RP-1. As a representative of the resistant strains, N131 and EM28 were used as control materials. Two methods, field identification and greenhouse pot test, were used for resistance to RP-1. Sexual effects are identified and evaluated. The rape field identification test was conducted in the rape isolation breeding area of the Jiangsu Academy of Agricultural Sciences, and the greenhouse pot experiment was performed in a constant temperature light culture room. After all the treated materials are sown and emerged to grow to 3-4 leaf seedling age, three kinds of ALS inhibitor herbicides widely used in China are sprayed, among which the pyrimidine salicylic acid herbicide is bispyrither [2,6-bis (4 , 6-dimethoxypyrimidin-2-oxy) sodium benzoate], SU-type herbicide is besulfuron-methyl (2- [N- (4-methoxy-6-methyl-1,3,5 -Triazin-2-yl) -N-methylcarbamidosulfonyl] benzoic acid methyl ester) and IMI herbicides are imidazolenicotinic acid ((RS) -5-ethyl-2- (4-isopropyl) 4-methyl-5-oxo-1H-imidazolin-2-yl) nicotinic acid]. Three weeks after spraying, the resistance effect of vegetable seedlings under different drug concentrations was determined according to the growth performance of vegetable seedlings. The results are shown in Table 1. As can be seen from Table 1, the two-site mutation (W556L and S635N) material RP-1 of the ALS3 gene increased resistance to pyrimidine salicylic acid herbicides.

Table 1 Resistance performance of ALS inhibitor herbicides at different concentrations after treating three rapeseed

Table note: R represents that the rapeseed plants grow well after herbicide treatment, and there is no phytotoxicity; S represents that the growth of rapeseed plants is severely inhibited after herbicide treatment, showing obvious phytotoxicity, and the final vegetable seedlings die (the same below).

Example 4: Inhibition test of ALS enzyme activity by herbicide

According to the results of resistance phenotypic identification, an in vitro enzyme activity test was performed to compare the ALS enzyme in RP-1, EM28 and the original wild-type N131 with three types of herbicides bispyribenzol (PB), benzsulfuron (SU type) and imidazolidinic acid (IMI type), compared the difference between the three materials. For the measurement of ALS enzyme activity, refer to the method of Singh et al. (Singh BK, et al., Analytical Biochemistry, 1988, 171: 173-179). Specifically, 0.2 g of leaf samples were taken and ground and pulverized with liquid nitrogen in a mortar. The ground sample was added to a 4.5 ml primary enzyme extract [100 mM K2HPO4, 0.5 mM MgCl2, 0.5 mM thiamine pyrophosphate ( TPP), 10 μM flavin adenine dinucleotide (FAD), 10 mM sodium pyruvate, 10% (v / v) glycerol, 1 mM dithiothreitol, 1 mM benzylsulfonyl fluoride (PMSF), 0.5 % (W / v) polyvinylpyrrolidone], centrifuged at 4 ° C and 12000 rpm for 20 min. Take the supernatant, add an equal volume of saturated (NH4) 2SO4, place it on ice for 30 minutes, centrifuge at 4 ° C and 12000 rpm for 20 minutes, discard the supernatant, add 1 mL of the initial enzyme extract, and shake to dissolve to obtain ALS for each sample Enzyme solution. Take 200 μL of the extracted ALS enzyme solution, and add 360 μL of 50 mM Hepes-NaOH (PH = 7.5) enzyme reaction buffer, 80 μL of 20 mM TPP, 80 μL of 200 μM FAD, 80 μL of 2 M sodium pyruvate + 200 mM MgCl2, and ALS herbicides with different concentrations After mixing and placing at 37 ° C for 1 hour, 160 μL of 3M H2SO4 was added to terminate the reaction, and decarboxylation was performed at 60 ° C for 15 minutes. Then add 780 μL of a 5.5% α-naphthol solution and 780 μL of 0.55% creatine, develop a color at 65 ° C for 15 minutes, and compare the color at 530 nm. Read the absorbance and calculate the enzyme activity according to the standard curve. The ALS enzyme activity of the herbicide-free control was recorded as 100%, respectively, and the bispyribenzol (PB type), besulfuron (SU type) and imidazolenic acid (IMI type) herbicide pair RP-1, EM28 and the original wild type were calculated. Effect of N131 ALS enzyme activity.

It can be seen from Figures 2 and 3 that with the increase of the concentrations of the SU herbicides bensulfuron and the IMI herbicide imidazolenicotinic acid, the ALS enzyme activities of wild-type N131, EM28, and RP-1 were all inhibited, but EM28 and RP- The mutant enzymes in 1 all showed a certain resistance to herbicides, because compared with wild-type N131, the inhibition of ALS enzyme activity in EM28 and RP-1 decreased more slowly with the increase of bensulfuron-methyl, and the change trends of both the same.

It can be seen from Figure 4 that the mutant enzyme in RP-1 shows strong resistance to the pyrimidine salicylic acid herbicide dioxadi because, as compared with N131 and EM28, N131 and EM28 increase with the increase of the dioxadi concentration The ALS enzyme activity in RP-1 decreased rapidly and showed the same trend, while the mutant enzyme activity in RP-1 was lightly inhibited by herbicides. Even under high concentration (250 μmol L-1) bispyrisol, The mutant enzyme activity was about 51% of the control. However, at this time, the inhibition rates of N131 and EM28 enzyme activity were close to 100%, that is, the ALS in N131 and EM28 had basically no activity, only 4% and 10% of the control, respectively. In summary, the sensitivity of the ALS enzyme in the mutant RP-1 to the pyrimidine salicylate herbicide dioxadi is significantly lower than that of the ALS enzymes in N131 and EM28, which further illustrates that the two-site mutation of the ALS3 gene (W556L and S635N) confers resistance to pyrimidine salicylic acid herbicides.

Example 5: Functional verification of resistance genes in Arabidopsis

A plant expression vector was constructed, and the resistance gene was transferred into an Arabidopsis thaliana plant by a conventional Agrobacterium-mediated method, and positive homozygous transgenic lines were screened by PCR in the transgenic offspring to identify the herbicide phenotype. In brief, specific primers were designed based on the ALS3 gene sequence. ALS3 primers 3: 5'CGC GGTACC CTCTCTCTCTCTCATCTAACCAT3 'and ALS3 primers 4: 5'CGC ACTAGT CTCTCAGTACTTAGTGCGACC3', 5 ′ of which were added with KpnI and SpeI restriction sites, underlined The sequence is a restriction site. Using the genomic DNA of the mutant RP-1 as a template, the resistance gene was obtained by PCR amplification. The nucleotides are shown in SEQ ID NO: 3 and the amino acid sequence is shown in SEQ ID NO: 4. The PCR product was recovered, cloned, and sequenced according to the method of Example 2 to obtain a recombinant T vector carrying a gene encoding a mutant enzyme. A KpnI and SpeI double-digested T vector was used to obtain a fragment containing the gene of interest, which was recovered and ligated to the same double-digested pCAMBIA1390 vector (purchased from Australian CAMBI) to obtain a recombinant plant expression vector. The constructed recombinant vector was transformed into E. coli DH5α, and the plasmid was extracted for digestion and sequencing. Agrobacterium tumefaciens EHA105 strain was transformed with the recombinant vector containing the correct target gene, and the plasmid was extracted for identification by PCR and enzyme digestion. The obtained recombinant strain was cultured, and the Arabidopsis thaliana was transformed by Agrobacterium flower dipping. After the T0 generation was screened with antibiotics on the medium, the T1 generation plants were transplanted into pots, grown in artificial incubators, and screened and expanded to obtain homozygous transgenic lines of the T3 generation. In the T3 generation of transgenic seedlings, 60g of aiha ^-1 bisoxafen was sprayed for resistance identification. After 3 weeks of spraying treatment, all transgenic Arabidopsis seedlings grew well, while all non-transgenic Arabidopsis (Col) seedlings were yellowed and died (Figure 5), indicating that the nucleotides in RP-1 are as shown in SEQ ID NO: 3 The shown acetolactate synthase mutant gene is expressed in Arabidopsis thaliana and functions as a pyrimidine salicylic acid herbicide.

Example 6: Functional verification of resistance genes in tobacco

According to the method of Example 5, the acetolactate synthase mutation gene of the nucleotide in RP-1 as shown in SEQ ID NO: 3 was cloned into the plant expression vector pCAMBIA1390 plasmid (purchased from Australian CAMBI company). The positive clones were selected to transform Agrobacterium EHA105. The conventional Agrobacterium-mediated transformation method was used to transform the tobacco leaf disc of Benn's. After the transgenic plants were harvested, they were identified by PCR. At the seedling stage of T3 generation transgenic tobacco, 60g aiha ^{-1 was} sprayed. Ether was identified for resistance. After 3 weeks of spraying treatment, all transgenic tobacco seedlings grew well, while all non-transgenic tobacco (Tob) seedlings yellowed and died (Figure 5), indicating that the nucleotides in RP-1 are as shown in SEQ ID NO: 3. The expression of lactate synthase mutant gene in tobacco also has the function of resistance to pyrimidine salicylic acid herbicides.

Example 7: Functional verification of resistance genes in common rapeseed

The acetolactate synthase mutation gene of nucleotides in RP-1 as shown in SEQ ID NO: 3 is introduced into other common rapeseed varieties or strains that are not resistant to pyrimidine salicylic acid herbicides by hybridization. In brief, RP-1 and 3075R (Pu Huiming et al., 2002, Jiangsu Agricultural Science, 4: 33-34) and 3018R (Pu Huiming et al., 1999, Jiangsu) were used to restore the non-resistant common rapeseed varieties. Agricultural Sciences, 6: 32-33) Prepare hybrid combinations, harvest two F1 seeds in the rape vernalization culture room for additional planting in the same year, select a single plant with self-bagging and self-consistent growth during flowering, and harvest F2 seeds in Nanjing Jiangsu Province. The plant was seeded at the Yuanshui Water Plant Science Base. Each F2 population was sown 20 rows. A single leaf of the F2 population was taken at seedling stage, DNA was extracted, and the ALS3 gene was amplified by PCR. The product was purified, recovered, and sequenced according to Example 2. According to the sequencing results, a homozygous F2 single strain having an acetolactate synthase mutation gene as shown in SEQ ID NO: 3 in RP-1 was screened. At the flowering stage of rape, each selected F2 single plant was self-bagging, and F3 seeds were harvested. In the F3 seedling stage, 60g of aiha ^-1 bisoxafen was sprayed for resistance identification. After 3 weeks of spraying treatment, all selected rapeseed seedlings with resistance genes introduced were growing well, but all rapeseed seedlings without resistance genes were yellowed and died, indicating that the nucleotides in RP-1 are shown in SEQ ID NO: 3 The expression of the acetolactate synthase mutant gene in rapeseed also has the function of resistance to pyrimidine salicylic acid herbicides.

Example 8: Study on resistance function of different amino acid substitutions in resistance mutation sites

In order to clarify the resistance function of ALS3 in the present invention after mutation of two sites of Trp556 and Ser635 into other amino acids, we have consulted a large number of relevant literatures and designed five combinations of amino acid mutations (Table 2). The mutant site was constructed and its plant expression vector was constructed and transformed into Arabidopsis to verify its resistance function. In short, the mutant RP-1 genome was used as a template and PCR was used to perform site-directed mutagenesis. The experiment was commissioned by Nanjing Zhongding Biotechnology Co., Ltd. As a result, five mutant genes were obtained: LT, the + 1667th nucleotide of the ALS3 gene changed from G to T, and the + 1904th nucleotide changed from G to C, resulting in the 556th position of the corresponding encoded protein. Tryptophan (W) is mutated to leucine (L), serine (S) is mutated to threonine (T) at position 635; LI, the nucleotide at +1667 of ALS3 gene is changed from G to T and The nucleotide at +1904 changed from G to T, which resulted in mutation of tryptophan (W) to leucine (L) at position 556 and mutation of serine (S) to isoleucine at position 635 ( I); GN, the + 1666th nucleotide at +1666 changed from T to G and the + 1904th nucleotide changed from G to A, resulting in mutation of tryptophan (W) at position 556 of the corresponding encoded protein Glycine (G) and 635 positions were mutated from serine (S) to asparaginic acid (N); GT, ALS3 genes changed from T to G at +1666 and from G to +1904 C, resulting in mutation of tryptophan (W) to glycine (G) at position 556 and threonine (T) of serine (S) at position 635; GI, +1666 nucleus of ALS3 gene Glycylic acid changes from T to G and +1904 nucleotide changes from G to T, resulting in 556 of the corresponding encoded protein from tryptophan (W) was mutated to glycine (G) and 635 with serine (S) was mutated to isoleucine (I) (Table 2).

According to the method of Example 5, the above five mutant sequences were constructed into the plant expression vector pCAMBIA1390 plasmid (purchased from Australian CAMBI company), and transformed into Arabidopsis thaliana. After obtaining a positive transgenic seedling, 60 g of aiha ^-1 was sprayed at the seedling stage. Glyoxysin was tested for resistance. After 3 weeks of spray treatment, all the transgenic Arabidopsis seedlings of LT and LI grew well, while the transgenic Arabidopsis thaliana and non-transgenic Arabidopsis seedlings of GN, GT and GI all yellowed and died (Table 2), indicating The sequence of the combination of LT and LI amino acid mutations is expressed in Arabidopsis and has the function of resistance to pyrimidine salicylic acid herbicides.

Table 2 Resistance performance of different amino acid mutation combination sequences in Arabidopsis

Note: Bold bold italics indicate mutated bases, R represents herbicide treatment, the transgenic plants grow well and have no phytotoxicity performance, S represents herbicide treatment. Rape plant growth is severely inhibited, showing significant phytotoxicity, and eventually vegetable seedlings die .

Although the specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely examples, and the protection scope of the present invention is defined by the appended claims. Those skilled in the art can make various changes or modifications to these embodiments without departing from the principle and essence of the present invention, but these changes and modifications fall within the protection scope of the present invention.

Claims

An isolated nucleic acid encoding a mutated acetolactate synthase protein comprising the following mutations:

Mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and

The serine (S) is mutated to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;

Preferably, the nucleotide sequence of the isolated nucleic acid is as shown in SEQ ID NO: 3;

Preferably, the amino acid sequence of the mutated acetolactate synthase protein is shown in SEQ ID NO: 4.
An expression cassette, vector or cell comprising the nucleic acid of claim 1.
Mutated acetolactate synthase protein, which contains the following mutations:

Mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and

The serine (S) is mutated to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;

Preferably, wherein said protein comprises a mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2 and a position corresponding to position 635 of SEQ ID NO: 2 Mutation of serine (S) to asparagine (N);

More preferably, the amino acid sequence of the mutated acetolactate synthase protein is shown in SEQ ID NO: 4.
The use of the nucleic acid according to claim 1 or the expression cassette, vector or cell according to claim 2 or the mutant acetolactate synthase protein according to claim 3 for producing a pyrimidine salicylic acid herbicide-resistant plant, preferably Preferably, the plant is rapeseed, and the nucleic acid encodes Brassica napus ALS3 protein.
A method for producing a plant having pyrimidine salicylic acid herbicide resistance, comprising the following steps:

The nucleic acid according to claim 1 is introduced into a plant, and preferably the nucleic acid according to claim 1 is introduced into a plant through steps such as transgenic, cross, backcross or asexual propagation, wherein the plant expresses the mutant acetyl group according to claim 3. Lactic acid synthase protein and has pyrimidine salicylic acid herbicide resistance.
Non-transgenic plants or parts thereof resistant to pyrimidine salicylic acid herbicides, comprising an isolated nucleic acid encoding a mutant acetolactate synthase protein, said mutant acetolactate synthase protein comprising the following mutations:

Mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and

The serine (S) is mutated to asparagine (N), threonine (T) or isoleucine (I) at the position corresponding to position 635 of SEQ ID NO: 2,

Preferably, wherein said plant is rape; wherein said parts are organs, tissues and cells of the plant, and preferably seeds;

Preferably, wherein the mutated acetolactate synthase protein comprises a tryptophan (W) mutation at a position corresponding to position 556 of SEQ ID NO: 2 to a leucine (L) and a SEQ ID NO: The serine (S) at position 635 of 2 is mutated to asparagine (N);

More preferably, the amino acid sequence of the mutated acetolactate synthase protein is shown in SEQ ID NO: 4.
Method for controlling weeds in a field containing rapeseed plants, said method comprising applying an effective amount of a pyrimidine salicylic acid herbicide to said field containing said weeds and rapeseed plants, said rapeseed plants comprising An isolated nucleic acid of an acetolactate synthase protein, the mutant acetolactate synthase protein contains the following mutations:

Mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and

The serine (S) is mutated to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;

Preferably, wherein the mutated acetolactate synthase protein comprises a tryptophan (W) mutation at a position corresponding to position 556 of SEQ ID NO: 2 to a leucine (L) and a SEQ ID NO: The serine (S) at position 635 of 2 is mutated to asparagine (N);

More preferably, the amino acid sequence of the mutated acetolactate synthase protein is shown in SEQ ID NO: 4.