WO2019136938A1 - Accase mutant protein enabling plant to have herbicide resistance, and application thereof - Google Patents

Abstract

Provided is a rice Acetyl-CoA Carboxylase (ACCase) mutant protein. The amino acid sequence of the ACCase mutant protein has any one or more of mutations in the 1792th position, the 2015th position, the 2038th position, the 2052th position and the 2089th position of the amino acid sequence of the rice ACCase. Also provided is a nucleic acid or a gene for encoding the protein. A plant expressing the mutant protein has resistance (tolerance) to an ACCase herbicide. After 3 mL quizalofop-ethyl/L water (2 times recommended concentration) is applied to a rice three-leaf seedling, the plant can still normally grow and seed.

Description

ACCase mutant protein with herbicide resistance in plants and application thereof Technical field

The invention belongs to the field of plant protein and plant herbicide resistance, relates to ACCase mutant protein which has herbicide resistance to plants and application thereof; in particular, the invention relates to rice acetyl-CoA carboxylase (ACCase) mutein, The mutein can confer properties to plants, especially rice anti-acetyl-CoA carboxylase inhibitor herbicides. The present invention discloses nucleotide and amino acid sequences of the muteins and their use in the field of plant herbicide resistance.

Background technique

Farmland weeds are one of the leading causes of crop yield reduction. Compared with traditional methods such as cultivation, artificial weeding and mechanical weeding, the use of chemical herbicides is recognized as the most efficient, simple and economical treatment method for controlling weeds in farmland.

Acetyl-CoA Carboxylase (ACCase) is a key enzyme that catalyzes the synthesis of plant fatty acids in plant metabolism and is a target for herbicides discovered in 1958. ACCase belongs to the type I (type I) of Biotin containing enzyme and is found in most organisms, mainly including bacteria, yeast, fungi, plants, animals and humans. It has been determined that there are two isoforms of ACCase in plants, mainly in plastids and cytosols, and their functional regions are structurally very different. ACCase in most plant plastids has four subunits: a biotin carboxyl carrier-protein (BCCP), a biotin carboxylase (BC), and a carboxyl transferase (carboxyl transferase). , CT) two subunits CTα and CTβ, which are covalently linked. The ACCase in most plant cytosols belongs to the same type in yeast, rat and human. Its one polypeptide chain contains all four subunits of prokaryotic ACCase, and the order is BC, BCCP, CTβ, CTα. 3 functional domains (CTβ and CTα count a functional domain). The inhibition of ACCase by herbicides is mainly through inhibition of CT, which leads to inhibition of acyl lipid biosynthesis, affecting cell membrane permeability, causing leakage of metabolites, resulting in plant death, thereby achieving the purpose of controlling weeds.

ACCase herbicides include Aryloxyphenoxypropanoates (APP), Cyclohexanedione oximes (CHD) and Phenylpyrazoline (DEN). Because of its high selectivity, it can prevent one-year or perennial grass weeds after planting, and it is transmitted in plants. It has the advantages of high efficiency, low toxicity, long application period, safety to crops, etc. These herbicides develop rapidly. With the increasing variety and rapid expansion of the use area, it has become the third important herbicide in the world.

ACCase catalyzes the formation of malonyl-CoA from acetyl-CoA. This reaction is the first critical step in the total synthesis of fatty acids. It is also the rate-limiting step. The reaction catalyzed by ACCase is actually a two-step reaction consisting of three subunits. . In the first step, ATP is first supplied with energy to bicarbonate to produce an activated carboxyl group (carboxylic acid, phosphoric acid complex), and then the carboxyl group is linked to the urea ring N1 of biotin in BCCP under the action of BC to form a carboxylated organism. A carboxyl group carrier protein in which Mg2+ or Mn2+ is involved, and bicarbonate is a carboxyl donor. In the second step, under the action of CT, the carboxyl group on the biotin urea ring N1 is transferred to the methyl group of the acetyl-CoA to produce malonyl-CoA, and the process does not require other auxiliary energy. Synthetic malonyl-CoA is involved in biological processes such as de novo synthesis of fatty acids.

ACCase has two main types of inhibitors, including aryloxy oxypropionate (APP) and cyclohexanedione (CHD), and several herbicide varieties have been developed, such as herbicide and turfgrass. Propargyl, ketone, clethethene and the like. As early as the 1960s and 1970s, APP and CHD herbicides were widely used in farmland weeds, but with long-term and large-area use, weeds quickly developed resistance to these two herbicides. Sexually, up to 35 weeds have been found in 26 countries to develop resistance to these two types of inhibitors.

However, at present, the mechanism of action of ACCase inhibitor herbicides has not been determined. It is difficult to predict in advance whether mutations in other amino acid sites of ACCase protein will produce herbicide resistance, and can only rely on long-term and painstaking practice of researchers. Some luck may reveal new herbicide resistance sites for ACCase proteins.

Summary of the invention

OBJECT OF THE INVENTION The technical problem to be solved by the present invention is to provide a rice ACCase mutant protein.

A technical problem to be solved by the present invention is to provide a nucleic acid or gene encoding a rice ACCase mutant protein.

The technical problem to be solved by the present invention is to provide an expression cassette, a recombinant vector or a cell containing the rice ACCase mutant gene described above.

A technical problem to be solved by the present invention is to provide a method for obtaining a herbicide-resistant plant. Specifically, a method for enhancing the tolerance of plants, plant tissues, plant cells to at least one herbicide, the herbicide interfering with the activity of the ACCase enzyme. Thus, herbicide resistance herein refers to an anti-(resistant) acetyl-CoA carboxylase-type herbicide.

The method for enhancing the resistance of a plant, a plant tissue or a plant cell to a herbicide according to the present invention can be carried out by a method of transformation or hybridization, selfing and vegetative propagation, or can be obtained by chemical mutagenesis or genetic site-directed mutagenesis. The altered plant has any one of the nucleotide sequence of the present invention, SEQ ID No: 1, SEQ ID No: 3, SEQ ID No: 5, SEQ ID No: 7, or SEQ ID No: 9, the mutation Subsequent plants have one or more of the above-described mutated nucleotide sequences.

Through long-term and arduous research, the inventors conducted EMS mutagenesis treatment on the wild-type rice variety Zhenjing 19 (obtained from Zhenjiang Agricultural Science Research Institute, Jiangsu Hilly Region), and conducted long-term and continuous screening of these EMS mutant plants. A series of ACCase muteins, including some of the known ACCase muteins and new ACCase muteins described above, are insensitive to ACCase inhibitor herbicides, thereby rendering plants ACCase inhibitor herbicide resistant. The use of the present invention in plant breeding can be used to grow plants having herbicide resistance, especially crops, and the development of these proteins and their coding genes in transgenic or non-transgenic plants such as rice.

Technical Solution: In order to solve the above technical problem, the technical scheme adopted by the present invention is as follows: a rice ACCase mutant protein, wherein the amino acid sequence of the ACCase mutant protein has any one or more of the following mutations: it corresponds to rice ACCase Mutations occurred at positions 1792, 2015, 2038, 2052, and 2089 of the amino acid sequence.

Preferably, the amino acid sequence of the amino acid sequence of rice ACCase is mutated from isoleucine to leucine, the amino acid at position 2015 is alanine to valine, and the amino acid at 2038 is derived from tryptophan. It becomes cysteine, the amino acid at position 2052 is mutated from isoleucine to asparagine, and the amino acid at position 2089 is changed from aspartic acid to glycine.

The amino acid mutated by the ACCase mutant protein of the present invention includes, but is not limited to, the following mutations, and it is also within the scope of the present invention to mutate to other amino acids at the following position, for example, the amino acid at position 1792 is isoammine. Acid mutation to phenylalanine, serine, tyrosine, cysteine, valine, threonine, valine, alanine, aspartic acid, glycine, arginine, glutamine, Tryptophan, lysine, histidine, methionine; the 2015 acid is alanine to phenylalanine, serine, tyrosine, cysteine, proline, threonine Acid, isoleucine, aspartic acid, glycine, arginine, glutamine, tryptophan, lysine, histidine, methionine, leucine; amino acid 2038 from color ammonia Acid to phenylalanine, serine, tyrosine, alanine, valine, threonine, valine, isoleucine, aspartic acid, glycine, arginine, glutamine, Lysine, histidine, methionine, leucine; amino acid 2052 is mutated from isoleucine to phenylalanine, serine , tyrosine, cysteine, valine, threonine, valine, aspartic acid, glycine, arginine, glutamine, tryptophan, lysine, histidine, Thionine, leucine, alanine, amino acid 2089 from aspartic acid to phenylalanine, serine, tyrosine, cysteine, proline, threonine, proline , isoleucine, arginine, glutamine, tryptophan, lysine, histidine, methionine, leucine, alanine.

The invention also includes a rice ACCase mutant protein comprising:

(a) having an amino acid sequence as set forth in SEQ ID NO. 2 or SEQ ID NO. 4 or SEQ ID NO. 6 or SEQ ID NO. 8 or SEQ ID NO. 10;

(b) a protein derived from (a) wherein the amino acid sequence in (a) is substituted and/or deleted and/or one or more amino acids are added and has acetyl-CoA carboxylase activity.

The invention also includes nucleic acids or genes encoding the proteins.

The nucleic acid or gene of the present invention comprises:

(a) it encodes the protein; or

(b) a nucleotide sequence which hybridizes under stringent conditions to (a) a defined nucleotide sequence and which encodes a protein having acetyl-CoA carboxylase activity;

(c) its nucleotide sequence is shown as SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7 or SEQ ID NO: 9.

The stringent conditions are: highly stringent hybridization conditions in which a membrane is washed at 65 ° C for 15 minutes in a solution of 0.1 x SSC and 0.1% SDS.

Nucleotides in which the ACCase mutant gene of the present invention is mutated include, but are not limited to, the following mutations, and it is also within the scope of the present invention to mutate to other nucleotides at the following positions, for example, A mutation is T, C, G; or C mutation to T, A, G; or T mutation to A, C, G; or G mutation to T, C, A, etc. are within the scope of the present invention.

Further, in the rice ACCase mutant gene of the present invention, the rice ACCase gene has one or more of the following mutations: nucleotide 5374 of the rice ACCase gene, nucleotide 6044 of the rice ACCase gene, The mutation was carried out at nucleotide position 6114 of the rice ACCase gene, nucleotide 6155 of the rice ACCase gene, and nucleotide 6266 of the rice ACCase gene.

Preferably, in the rice ACCase mutant gene of the present invention, the rice ACCase gene has one or several mutations: a mutation in the 5374th nucleotide of the rice ACCase gene from A to T, and a 6042 in the rice ACCase gene. The nucleotide is mutated from C to T, and the nucleotide at position 6114 of the rice ACCase gene is mutated from G to T, and the nucleotide at position 6155 of the ACCase gene in rice is mutated from T to A, and the second in the rice ACCase gene. The 6266 nucleotide is mutated from A to G.

The invention also includes an expression cassette, a recombinant vector or a cell comprising the nucleic acid or gene.

The present invention also encompasses the use of the rice ACCase mutant protein, nucleic acid or gene, expression cassette, recombinant vector or cell in plant herbicide resistance.

Wherein the herbicide is one or more selected from the group consisting of quizalofop, halofloxacin, clethethene and flufenoxacillin.

The present invention also includes a method of obtaining a herbicide-resistant plant, comprising the steps of:

1) causing the plant to comprise the nucleic acid or gene; or

2) causing the plant to express the rice ACCase mutant protein.

The method comprises a cristr gene editing, transgene, hybridization, backcrossing or vegetative propagation step.

The invention also includes a method of identifying a plant, wherein the plant is a plant comprising the nucleic acid or gene, a plant expressing the protein, or a plant obtained by the method, comprising the steps of:

1) determining whether the plant comprises the nucleic acid or gene; or

2) Determine whether the plant expresses the protein.

The present invention also encompasses a herbicide-protecting agent made from the rice ACCase mutant protein.

The invention also includes a method of controlling weeds comprising: applying an effective amount of a herbicide to a field in which the crop is grown, the crop comprising the nucleic acid or gene or the expression cassette, recombinant vector or cell, The herbicide is one or more of quizalofop, halofloxacin, clethethene, and flufenoxacil.

The present invention also encompasses a method for protecting a plant from damage caused by a herbicide, comprising: applying an effective amount of a herbicide to a field in which the crop is grown, the crop comprising the nucleic acid or gene or the described The expression cassette and the recombinant vector are introduced into the plant, and the introduced plant produces a herbicide resistance protein, and the herbicide is one or more of quizalofop, halofloxacin, ketoxifen, and flufenoxacil. .

Further, the wild-type gene of the present invention is derived from the scorpion 19 of rice.

Further, the mutant plant of the scorpion 19 of the present invention has quizalofop- herbicide resistance, and the nucleotide sequence or amino acid sequence of the mutant gene of the scorpion 19 mutant plant of the present invention can confer rice plants when expressed in plants. Increased tolerance to acetyl-CoA carboxylase herbicides.

Further, the present invention obtains a herbicide-resistant rice plant ACCase-5374 mutant, ACCase-6044 mutant, ACCase-6114 mutant, ACCase-6155 mutant, ACCase-6266 by mutation of Zhenjing 19. Mutants, the five plants were deposited with the China Center for Type Culture Collection (CCTCC).

Wherein the numbering of the mutant gene sequence of the scorpion 19 of the present invention and the corresponding nucleotide and amino acid sequences thereof are: a mutation which mutates the nucleotide 5374 of the ACCase gene of the scorpion 19 from A to T, respectively. The ACCase-5374 mutant has the nucleotide sequence of SEQ ID No: 1 and the amino acid sequence of SEQ ID No: 2;

Among them, the mutant at the 6044th nucleotide of the ACCase gene of the scorpion 19 was changed from C to T, and the ACCase-6044 mutant had the nucleotide sequence of SEQ ID No. :3, the amino acid sequence thereof is shown as SEQ ID No: 4;

Among them, the mutant of the 6th and 114th nucleotides of the rice ACCase gene of the scorpion 19, which is mutated from G to T, is named as ACCase-6114 mutant, and the nucleotide sequence of the ACCase-6114 mutant ACCase gene is SEQ ID No. :5, the amino acid sequence thereof is shown as SEQ ID No: 6;

Among them, the mutant of the 6155th nucleotide of the rice ACCase gene of the scorpion 19 was renamed as ACCase-6155 mutant, and the ACCase-6155 mutant ACCase gene has the nucleotide sequence of SEQ ID No. :7, the amino acid sequence thereof is shown as SEQ ID No: 8.

Among them, the mutation of the 6266th nucleotide of the rice ACCase gene of Zhenjing 19 from A to G was named as ACCase-6266 mutant, and the ACCase gene of ACCase-6266 mutant had the nucleotide sequence of SEQ. ID No: 9, the amino acid sequence of which is shown in SEQ ID No: 10;

The nucleotide sequence of the wild type ACCase gene of the scorpion 19 is shown in SEQ ID No: 11, and the amino acid sequence thereof is shown in SEQ ID No. 12.

Advantageous Effects: Compared with the prior art, the present invention has the following advantages:

1) In the present invention, a herbicide-resistant rice plant ACCase-5374 mutant, ACCase-6044 mutant, ACCase-6114 mutant, ACCase-6155 mutant, ACCase-6266 mutant were obtained by random mutation. The plants are deposited in the China Center for Type Culture Collection (CCTCC).

2) The results of spraying the ACCase inhibitor herbicide quizalofop in the field showed that the rice trifoliate seedling containing the rice ACCase mutant protein of the present invention was administered with twice the recommended concentration of the acetyl-CoA carboxylase inhibitor. After the herbicides, the plants still grow and develop normally. However, after the application of the recommended concentration of acetyl-CoA carboxylase inhibitor herbicides in the wild type rice seedlings, the plant growth gradually stops, and the leaves gradually lose green and change. Light yellow, the plants can not be knotted, and eventually the whole plant dies.

DRAWINGS

Figure 1 shows resistant rice mutants obtained by quizalofop herbicide screening;

Figure 2 shows the full-length results of ACCase gene amplification of 5 rice herbicide-resistant mutants; the first lane is Marker; the molecular weight of Marker is 15kb, 8kb, 5kb, 3kb, 1kb, 1.5kb, 1kb, 750bp from top to bottom. 500 bp, the second lane is the DNA of the wild type scorpion 19, the third lane is the DNA of the herbicide resistant mutant plant (ACCase-5374 mutant), and the fourth lane is the herbicide resistant mutant plant (ACCase-6044 mutant). DNA, lane 5 is the DNA of the herbicide-tolerant mutant plant (ACCase-6114 mutant), lane 6 is the DNA of the herbicide-tolerant mutant plant (ACCase-6155 mutant), and lane 7 is the herbicide-resistant mutant plant. DNA of (ACCase-6266 mutant).

Detailed ways

The embodiments of the present invention will be described in detail below with reference to the accompanying drawings, however, the following examples are intended to illustrate the invention and are not intended to limit the scope of the invention. Those who do not specify the specific conditions in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are conventional products that can be obtained commercially.

Example 1: Acquisition process of rice anti-quinemarin herbicide mutant

Zhenzhen No. 19 (Gongjiang Agricultural Science Research Institute of Jiangsu Hilly Region) (this is M0, soaked in water for 2 hours) 120kg divided 6 times with 0.4-0.6% (w / w) ethyl methanesulfonate (EMS) room temperature Soak for 6-9 hours, shake the seeds every 1 hour; discard the EMS solution, tap the seeds for 5 times, 5 minutes each time, then rinse the seeds with tap water overnight, plant the field the next day, and carry out conventional fertilizer management. (This is M1). After the plants are mature, the seeds are mixed, dried, and preserved in winter. Sowing the fields the following year. When the seedlings of rice (this is M2) grow to the three-leaf stage, spray 3mL quizalofop/L water (the recommended minimum concentration is 1.5mL quizalofop/1L water), and it will be normal green after 1 month. The plants that can grow normally are rice mutant plants resistant to quizalofop- herbicide (Fig. 1). A total of 28 M2 plants resistant to herbicides were obtained. These resistant plants were routinely fertilized and managed, and they were all normal. After the seeds were mature, the plants were harvested, dried, and preserved in winter. We harvested 28 plants of M2 obtained above and planted M3 seeds.

Example 2: Obtainment of the wild type Accase full-length gene of Rice Zhenjing 19

The leaves of the wild type plant of Zhenjing No. 19 were selected, genomic DNA was extracted, and primers were designed according to the Nippon ACCase gene (NCBI: XM_015783727) in NCBI, and the ACCase gene was amplified by KOD DNA polymerase polymerase (purchased from Toyobo). The reaction system is as follows:

10×Buffer5.0μl

10μM forward primer (GTCAGATTTCACACATCTGGGGAT) 1.0μl

10μM reverse primer (ACTTGCACTTTCATCTGGCAGAAC) 1.0μl

20-30ng/μL rice Zhenjing 19 genomic DNA 1.0μl

2mMdNTP 2.0μl

25mM MgSO ₄ 2.0μl

KOD DNA polymerase polymerase (1U/μl) 1.0μl

Add sterile water to a total volume of 50μl

The PCR amplification reaction procedure uses a two-step process, annealing and extension together, using 68 degrees.

The procedure was as follows: pre-denaturation: 94 ° C for 3 min; 35 cycles: denaturation 94 ° C for 10 sec; extension 68 ° C for 10 min; incubation: 72 ° C for 10 min.

2 μl of the PCR product was detected by 1% agarose gel electrophoresis and found to have the expected size of the fragment (Fig. 2). The remaining PCR product was cleaned and recovered by PCR cleaning kit (purchased from Axygen) and cloned into pMD19-T. The vector (purchased from Takara) was then transformed into E. coli. Each transformation randomly picked 12 E. coli monoclonals for PCR detection, and took 6 monoclonal clones positive for PCR. They were sent to Nanjing Biotech Co., Ltd. for sequencing, and the mutant ACCase gene sequence was obtained. The length of the gene fragment was 13127 bp. After the intron was removed, the full-length gene of 6984 bp was obtained, and the sequencing results of the full-length gene fragment of the wild-type ACCase sequence of the scorpion 19 were as follows:

Example 3: Identification of molecular level of rice mutants resistant to quizalofop-ethyl herbicide

In all the herbicide-tolerant rice mutant plants obtained in the above Example 1, the leaves of the plurality of mutant plants and the leaves of the wild type plant of Zhenjing No. 19 were selected, and genomic DNA was extracted respectively, and ACCase-F (GTCAGATTTCACACATCTGGGGAT) and ACCase-R were used. ACTTGCACTTTCATCTGGCAGAAC) PCR amplification was performed separately. The PCR amplification conditions and amplification system were the same as in Example 2. The sequencing results showed that, compared with the wild type plants of Example 2, we obtained a total of five rice mutants, and the above herbicide-resistant rice mutants were in the ACCase gene sequence. Mutations occur on both. The specific mutations are as follows:

The ACCase-5374 mutant ACCase gene sequence, the 5374th nucleotide of the nucleotide sequence is mutated from A to T, resulting in the mutation of the amino acid sequence 1792 of the encoded amino acid sequence from isoleucine to leucine, Its nucleotide sequence is shown in SEQ ID No: 1, and its encoded amino acid sequence is shown as SEQ ID No: 2;

The ACCase-6044 mutant ACCase gene sequence, whose nucleotide sequence of nucleotide 6044 is mutated from C to T, causes the amino acid sequence of the amino acid sequence of the encoded amino acid sequence to change from alanine to proline. The nucleotide sequence is shown in SEQ ID No: 3, and the encoded amino acid sequence is shown in SEQ ID No: 4;

The ACCase-6114 mutant ACCase gene sequence, whose nucleotide sequence of nucleotide sequence 6114 is mutated from G to T, causes the 2038th amino acid of the encoded amino acid sequence to change from tryptophan to cysteine. Its nucleotide sequence is shown in SEQ ID No: 5, and its encoded amino acid sequence is shown as SEQ ID No: 6.

The ACCase-6155 mutant ACCase gene sequence, the nucleotide sequence of position 6155 from T to A, resulting in the amino acid sequence of the encoded amino acid sequence of the 2052 amino acid from isoleucine to asparagine, its nucleotide The sequence is shown in SEQ ID No: 7, and the encoded amino acid sequence is shown in SEQ ID No: 8.

The ACCase-6266 mutant ACCase gene sequence, the nucleotide sequence of position 6266 from A to G, resulting in its encoded amino acid sequence 2089 amino acid from aspartic acid to glycine, its nucleotide sequence is SEQ As shown in ID No: 9, the encoded amino acid sequence is shown in SEQ ID No: 10.

The ACCase-5374 mutant of the present invention is classified as rice seed zhen19-21 (Oryza sativa Japonica Group zhen19-21), and the material has been deposited with the China Center for Type Culture Collection (CCTCC) on December 20, 2017. : Wuhan University Depository Center, Wuchang District, Wuhan City, Hubei Province (opposite to the First Affiliated Primary School of Wuhan University), Zip Code: 430072, with the accession number CCTCC No: P201803.

The ACCase-6044 mutant of the present invention is classified as rice seed zhen19-60 (Oryza sativa Japonica Group zhen19-60), and the material has been deposited with the China Center for Type Culture Collection (CCTCC) on December 20, 2017. : Wuhan University Depository Center, Wuchang District, Wuhan City, Hubei Province (opposite to the First Affiliated Primary School of Wuhan University), Zip Code: 430072, and the deposit number is CCTCC No: P201804.

The ACCase-6114 mutant of the present invention is classified as rice seed zhen19-26 (Oryza sativa Japonica Group zhen19-26), and the material has been deposited with the China Center for Type Culture Collection (CCTCC) on December 20, 2017. : Wuhan University Depository Center, Wuchang District, Wuhan City, Hubei Province (opposite to the First Affiliated Primary School of Wuhan University), Zip Code: 430072, with the accession number CCTCC No: P201805.

The ACCase-6155 mutant of the present invention is classified as rice seed zhen19-38 (Oryza sativa Japonica Group zhen19-38), and the material has been deposited with the China Center for Type Culture Collection (CCTCC) on December 20, 2017. : Wuhan University Depository Center, Wuchang District, Wuhan City, Hubei Province (opposite to the First Affiliated Primary School of Wuhan University), Zip Code: 430072, with the accession number CCTCC No: P201806.

The ACCase-6266 mutant of the present invention is classified as rice seed zhen19-7 (Oryza sativa Japonica Group zhen19-7), and the material has been deposited with the China Center for Type Culture Collection (CCTCC) on December 20, 2017. : Wuhan University Depository Center, Wuchang District, Wuhan City, Hubei Province (opposite to the First Affiliated Primary School of Wuhan University), Zip Code: 430072, with the accession number CCTCC No: P201807.

Example 4 Resistance of acetal-CoA carboxylase inhibitor herbicides to the anti-Quinfowl herbicide rice mutant progeny

The five mutant rice lines identified as homozygous mutants in Example 3 were planted and sown, and when the rice was grown to the three-leaf stage, the acetyl-CoA carboxylase inhibitor herbicide quinhefa was sprayed separately. Ling (spraying concentration is 1.5mL quizalofop/L water (1 times recommended concentration)), flupirtine (spraying concentration is 1.5mL flupirtine / L water (1 times recommended) Concentration)), chlorfenone (spraying concentration is 1.5 mL of chlorfenone / L water (1 times recommended concentration)), flufenoxacilin (spraying concentration is 1.5mL of flufenoxanin / L Water (1 times recommended concentration)), one month after spraying, the dead condition was investigated, and the wild type control was sprayed and the same concentration of acetyl-CoA carboxylase inhibitor herbicide quizalofop-p-butyl After the spirit, the ketene, and the flurazepam, the growth almost stopped, and the newly grown leaves were completely yellow and gradually died. The herbicide-resistant mutant positive seedlings we screened at different sites all showed an anti-phenotype against acetyl-CoA carboxylase inhibitor herbicides, and their normal growth and development were almost unaffected, and finally normal jointing Heading. Table 1 shows that the five mutant rice of the present invention is more resistant to ACCase-inhibiting herbicide than the wild type, and the percentage of damage is lower than 60%. This indicates that the herbicide-resistant mutants we screened were indeed able to stably inherit the resistance to anti-acetyl-CoA carboxylase inhibitor herbicides.

Table 1 Damage ratio of acetyl-CoA carboxylase herbicides to wild type and mutant rice

At the same time, we transplanted five mutant rice lines identified as homozygous mutants and sowed them. When the rice grows to the three-leaf stage, spray the acetyl-CoA carboxylase inhibitor herbicide quizalofop- ing ( The spray concentration is 3 mL of quizalofop/L water (2 times recommended concentration), and flupirtine (spraying concentration of 3 mL of flupirtine/L water (2 times recommended concentration)), alkene Oxalone (spraying concentration is 3mL of chlorfenone / L water (2 times recommended concentration)), flurazepam (spraying concentration of 3m flurazepam / L water (2 times recommended concentration)), The plants are still normally growing and developing, while the wild-type rice seedlings are administered with the acetyl-CoA carboxylase inhibitor herbicide quizalofop-methyl (spraying concentration is 1.5 mL quizalofop/L water (1 times recommended concentration) ), flupirtine (spraying concentration of 1.5mL flupirtine / L water (1 times recommended concentration)), clethone (spraying concentration of 1.5mL ketene / L water (1 times) It is recommended to use the concentration)), flurazepam (spraying concentration of 1.5mL flurazepam / L water (1 times recommended concentration)), after the plant growth gradually stops, the leaves gradually lose green, light yellow, Plants cannot be jointed Eventually the whole plant death.

Example 5: Two-to-two hybridization of resistant materials

In order to detect whether resistant plants with double mutation sites are more tolerant to herbicides with single-point resistant plants, we performed the two-to-two hybridization of resistant plants with different mutation sites obtained in Example 3. . ACCase-5374 mutant strain M021 (sequence corresponding to SEQ ID No: 1), ACCase-6044 mutant strain M098 (sequence corresponding to SEQ ID No: 3) and ACCase-6144 mutant strain M138 (sequence corresponding to SEQ ID) were selected. No: 5), these three strains were planted in a greenhouse, and M021 was hybridized with M098, M021 and M138, M098 and M138 at the flowering stage. The specific method is as follows: the female parent is artificially emascated and bagged, and when the male plant is flowering, the pollen in the paternal anther is shaken out, pollinated to the female stigma, repeated twice, and the seed is matured and then harvested. F1 with hybrids. The harvested F1 hybrids were propagated for one generation, and the F2 generation population was harvested. The F2 generation population of M021 and M098 hybrids identified plants with homozygous ACCase-5374 and ACCase-6044 mutations; the M2 and M138 hybrid F2 populations were identified with Plants homozygous for ACCase-5374 and ACCase-6144 mutations; plants with homozygous ACCase6044 and ACCase-6144 mutations were identified in the F2 population of M098 and M138 hybrids. When the above hybrid rice plants grow to the three-leaf stage, spray the acetyl-CoA carboxylase inhibitor herbicide quizalofop-methyl (spraying concentration is 1.5mL quizalofop/L water (1 times recommended concentration)) , flupirtine (spraying concentration is 1.5mL of flupirtine / L water (1 times recommended concentration)), clethone (spraying concentration is 1.5mL of ketolone / L water (1 It is recommended to use the concentration)), flurazepam (spraying concentration is 1.5mL of flurazepam / L water (1 times recommended concentration)), the results show that the plants at the same time mutating two sites relative to Plants with only one mutation site showed significant improvement in herbicide resistance (Table 2).

Table 2 Damage ratio of acetyl-CoA carboxylase herbicides to wild type and mutant rice

Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and substitutions may be made to those details in accordance with the teachings of the invention, which are within the scope of the invention. The full scope of the invention is given by any equivalents of the appended claims.

Claims (11)

1. A rice ACCase mutant protein comprising:

   (a) having an amino acid sequence as set forth in SEQ ID NO. 2 or SEQ ID NO. 4 or SEQ ID NO. 6 or SEQ ID NO. 8 or SEQ ID NO. 10;

   (b) a protein derived from (a) wherein the amino acid sequence in (a) is substituted and/or deleted and/or one or more amino acids are added and has acetyl-CoA carboxylase activity.
2. A nucleic acid or gene encoding the protein of claim 1.
3. The nucleic acid or gene of claim 2 comprising:

   (a) encoding the protein of any one of claims 1 to 2; or

   (b) a nucleotide sequence which hybridizes under stringent conditions to (a) a defined nucleotide sequence and which encodes a protein having acetyl-CoA carboxylase activity;

   (c) its nucleotide sequence is shown as SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7 or SEQ ID NO: 9.
4. An expression cassette, recombinant vector or cell comprising the nucleic acid or gene of claim 3 or 4.
5. The rice ACCase mutant protein according to claim 1, the nucleic acid or gene of claim 3 or 4, the expression cassette according to claim 5, a recombinant vector or a cell for use in a plant herbicide resistance.
6. The use according to claim 5, wherein the herbicide is one or more selected from the group consisting of quizalofop, halofloxacin, clethethene, and flufenoxacil.
7. A method for obtaining a herbicide-resistant plant, comprising the steps of:

   1) causing the plant to comprise the nucleic acid or gene of claim 3 or 4; or

   2) The plant is expressed by the rice ACCase mutant protein of claim 1.
8. The method of claim 7, comprising the step of editing, transgenic, hybridizing, backcrossing or vegetative propagation of the craspr gene.
9. A method for identifying a plant, wherein the plant is a plant comprising the nucleic acid or gene of claim 3 or 4, a plant expressing the protein of claim 1, or a plant according to any one of claims 8 to 9, It is characterized in that it comprises the following steps:

   1) determining whether the plant comprises the nucleic acid or gene of claim 3 or 4; or

   2) It is determined whether the plant expresses the protein of any one of claims 1 to 2.
10. A method for controlling weeds, comprising: applying an effective amount of a herbicide to a field for growing crops, the crop comprising the nucleic acid or gene of claim 3 or 4 or the expression cassette of claim 5. And a recombinant vector or a cell, wherein the herbicide is one or more of quizalofop, halofloxacin, clethodimone or fluridin.
11. A method for protecting a plant from damage caused by a herbicide, comprising: applying an effective amount of a herbicide to the field of the crop plant, the crop comprising the nucleic acid or gene of claim 3 or Or the expression cassette according to claim 5 or a recombinant vector introduced into the plant, wherein the introduced plant produces a herbicide resistance protein, and the herbicide is quizalofop, halofloxacin, ketoxifen, and flufenoxacillin. One or several of them.

Images