CA3087906A1 - Rape gene resistant to pyrimidine salicylic acid herbicides and use thereof - Google Patents

Abstract

Provided are a rape gene which is resistant to pyrimidine salicylic acid herbicides and the use thereof, and further provided are a rape plant and parts thereof which can withstand pyrimidine salicylic acid herbicides.

Description

Rape gene resistant to pyrimidinylsalicylate herbicide and use thereof Technical Field The present invention relates to the technical field of plant genetic engineering, specifically, relates to a rape gene which resistant to a pyrimidinylsalicylate herbicide and use thereof. More specifically, the present invention relates to a rape plant which resistant to a pyrimidinylsalicylate herbicide, and a part, resistance gene, mutant protein and use thereof.
Background Art Rape (Brassica napus I¨) is the number one oil crop in China, providing a source of edible oil for more than half of the country's population. One of the important biological hazards in rape production is farmland weeds, which not only competes with rape plants for water, fertilizer and light, but also changes the field microclimate of rape crop, and some weeds even are intermediate hosts for pests and diseases of rape crop, speeding up the spread of pests and diseases, seriously affecting the yield and quality of rape crop. However, manual weeding is time-consuming and laborious, increasing production costs. Therefore, the application of herbicides to control weeds in the field has become an inevitable choice.
Herbicides mainly inhibit plant growth or kill plants by inhibiting or interfering with key metabolic processes of plants. Targeting key enzymes in the process of amino acid biosynthesis is an important direction and hotspot in the development of new and highly effective herbicides.
The herbicides developed with acetolactate synthase (ALS; EC2.2..16) as the target enzyme have become the mainstream products of new high performance herbicides. ALS is an enzyme that catalyzes the first step of biosynthesis of branched-chain amino acids (valine, leucine, and isoleucine). ALS inhibitor herbicides can inhibit ALS enzyme activity in plant cells, hinder the biosynthesis of branched-chain amino acids (valine, leucine, and isolencine), thereby inhibiting the division and growth of plant cells. In the early 1990s, Kumiai Chemical Company of Japan developed a new class of ALS herbicides, i.e., pyrimidinylsalicylate herbicides, also known as pyrimidinyl (thio) benzoate herbicides, which use acetolactate synthase as the target. The first commercial variety of this class of herbicides is pyrithiobac-sodium.
Subsequently, pyrirninobac-methyl was developed in 1993, and bispyribac-sodium (Nominee) was developed in 1996.

Date Recue/Date Received 2020-07-08 Since the application of ALS herbicides to agriculture, it has been observed that sensitive plant species (including naturally occurring weeds) occasionally show spontaneous tolerance to such herbicides. The substitution of a single base at a specific site of the ALS gene usually results in more or less resistance. Plants with mutant ALS alleles show different levels of tolerance to ALS herbicides, depending on the chemical structure of the ALS
herbicide and the point mutation site of the ALS gene.
The study found that there were significant differences in the resistance functionality when amino acid substitution occurred at different sites on ALS and different amino acids were used for substitution at these sites (Yu Q, Han HP, Martin M, Vila-Aiub, Powles SH.
AHAS herbicide resistance endowing mutations: effect on AHAS functionality and plant growth.
J Exp Botany, 2010, 61: 3925-3934). The resistance effects against ALS inhibitor herbicides produced by amino acid substitutions at different sites are significantly different, and at the same time, mutations at different sites have a more complex cross-resistance relationship against other ALS
inhibitor herbicides.
There is also a great need in the art to obtain rape plants that have growth advantages over strong vitality weeds, and to obtain non-transgenic rape plants that can tolerate pyrimid iny Isalicy late herbicides.
Contents of the present invention The present invention addresses this need and provides a mutant nucleic acid of acetolactate synthase (ALS) and a protein encoded by such mutant nucleic acid. The present invention also relates to a rape plant, cell and seed comprising such mutant nucleic acid and protein, and the mutation endows the rape plant with tolerance to a pyrimidinylsalicylate herbicide, wherein an ALS polypeptide encoded by the ALS gene has an amino acid different from tryptophan at position 556 thereof and an amino acid different from serine at position 635 thereof. In a preferred embodiment, the ALS polypeptide encoded by the ALS gene has a double mutation selected from the group consisting of W556L and S635N; W556L and S635T; W556L
and S635I. In the most preferred embodiment, the ALS polypeptide encoded by the ALS gene has the following mutations: W556L and S635N.
In one embodiment, the present invention provides an isolated nucleic acid encoding a mutant acetolactate synthase (ALS3), and the mutant acetolactate synthase (ALS3) protein comprises the following mutations:
mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of

2 Date Recue/Date Received 2020-07-08 SEQ ID NO: 2; and mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;
preferably, the isolated nucleic acid has a nucleotide sequence as shown in SEQ ID NO: 3;
preferably, the mutant ALS3 protein has an amino acid sequence as shown in SEQ
ID NO:
4.
In one aspect, the present invention provides an expression cassette, vector or cell, which comprises the nucleic acid of the present invention. Accordingly, the present invention provides a use of the nucleic acid, expression cassette, vector or cell or the mutant acetolactate synthase (ALS3) protein of the present invention for producing a plant resistant to a pyrimidinylsalicylate herbicide, preferably, the plant is rape.
In another aspect, the present invention provides a method for producing a plant resistant to a pyrimidinylsalicylate herbicide, characterized in comprising the following steps:
introducing the nucleic acid of the present invention into a plant, preferably introducing the nucleic acid of the present invention into a plant through a step such as transgenosis, hybridization, backcross or vegetative propagation, wherein the plant expresses the mutant acetolactate synthase (ALS3) protein of the present invention and has resistance to a pyrimidinylsalicylate herbicide.
In yet another aspect, the present invention provides a non-transgenic plant or a part thereof resistant to a pyrimidinylsalicylate herbicide, which comprises an isolated nucleic acid encoding a mutant acetolactate synthase protein, the mutant acetolactate synthase protein comprising the following mutations:
mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2, preferably, wherein the plant is rape; wherein the part is an organ, tissue or cell of the plant, and preferably a seed;
preferably, wherein the protein comprises a mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2 and a mutation of serine (S) to asparagine (N) at a position corresponding to position 635 of SEQ ID NO: 2;
more preferably, wherein the mutant ALS3 protein has an amino acid sequence as shown in

3 Date Recue/Date Received 2020-07-08 SEQ ID NO: 4.
In another aspect, the present invention provides a method of controlling a weed in a field containing a rape plant, the method comprising: applying an effective amount of a pyrimidinylsalicylate herbicide to the field containing the weed and the rape plant, the rape plant comprises an isolated nucleic acid encoding a mutant acetolactate synthase protein, and the mutant acetolactate synthase protein comprises the following mutations:
mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;
preferably, wherein the protein comprises a mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2 and a mutation of serine (S) to asparagine (N) at a position corresponding to position 635 of SEQ ID NO: 2;
more preferably, wherein the mutant ALS3 protein has an amino acid sequence as shown in SEQ ID NO: 4.
Brief Description of the Drawings Figure 1 shows the alignment results of rape ALS3 amino acid partial sequences from different sources.
ALS3, a reference sequence of Genbank (accession number: Z11526); ALS3 amino acid partial sequence of ALS3 N131 wild type strain N131; ALS3 amino acid partial sequence of ALS3 EM28 resistant strain EM28; ALS3 amino acid partial sequence of ALS3 Sh4 resistant material Sh4; ALS3 amino acid partial sequence of ALS3_Sh5 resistant material Sh5; ALS3 amino acid partial sequence of ALS3_Sh6 resistant material Sh6; ALS3 amino acid partial sequence of ALS3 Sh7 resistant material Sh7. Arrows indicate mutant amino acids.
Figure 2 shows the in vitro activity inhibition of wild-type and mutant ALS
enzymes by Tribenuron-methly at different concentrations.
Figure 3 shows the in vitro activity inhibition of wild-type and mutant ALS
enzymes by Imazethapyr at different concentrations.
Figure 4 shows the in vitro activity inhibition of wild-type and mutant ALS
enzymes by Bispyribac-sodium at different concentrations.

4 Date Recue/Date Received 2020-07-08 Figure 5 shows the resistance performances of Arabidopsis thaliana and tobacco introduced with herbicide resistance gene after spraying herbicides (Col, wild-type Arabidopsis thaliana, 3A-I and 3A-2 Arabidopsis thaliana introduced with herbicide resistance gene;
Tob, wild-type tobacco, Y3A-1 and Y3A-2 tobacco introduced with herbicide resistance gene). +
Indicates spraying with 60 g a.i. ha Bispyribac-sodium, and - indicates no herbicide treatment.
Detailed DescriptionThe embodiments of the present invention and their different features and advantageous details will be explained more fully by reference to the non-limiting embodiments and examples described and/or illustrated in the drawings and detailed in the following description. It should be noted that the features described in the drawings are not necessarily drawn to scale, and the features of one embodiment can be used with other embodiments when one skilled in the art can recognize it although it is not clearly described here.
Definitions Unless otherwise stated, the terms used in the claims and the description are defined as listed below.
The term "non-transgenic" refers to not introducing individual genes via appropriate biological carriers or through any other physical means. However, a mutant gene can be passed through pollination (naturally or through breeding methods) to produce another non-transgenic plant containing that particular gene.
The term "endogenous" gene refers to a gene in a plant that is not introduced into the plant by genetic engineering techniques.
The terms "nucleotide sequence", "polynucleotide", "nucleic acid sequence", "nucleic acid", and "nucleic acid molecule" are used interchangeably herein and refer to nucleotides, ribonucleotides or deoxyribonucleotides or a combination of the both, in form of unbranched polymer of any length. Nucleic acid sequences comprise DNA, cDNA, genomic DNA, RNA, including synthetic forms and mixed polymers, including sense and antisense strands, or may contain unnatural or derived nucleotide bases, as those skilled in the art will understand this point.
As used herein, the term "polypeptide" or "protein" (both terms are used interchangeably herein) refers to a peptide, protein or polypeptide comprising an amino acid chain of a given length, wherein the amino acid residues are linked via covalent peptide bonds.
However, the present invention also comprises peptide mimics of the protein/polypeptide (wherein the amino Date Recue/Date Received 2020-07-08 acids and/or peptide bonds have been replaced with functional analogues), as well as amino acids such as selenocystine other than the amino acids encoded by the 20 genes.
Peptides, oligopeptides and proteins can be referred to as polypeptides. The term polypeptide also refers to (does not exclude) a modification of polypeptide, such as glycosylation, acetylation, phosphorylation and the like. This modification is well documented in the basic literature and in more detail in the monographs and research literature.
Amino acid substitution comprises an amino acid change, where an amino acid is replaced by a different naturally occurring amino acid residue. Such substitution can be classified as "conservative", in which an amino acid residue contained in the wild-type ALS
protein is replaced by an additional naturally occurring amino acid with similar characteristics; the substitution, for example or included in the present invention, may also be "non-conservative", in which an amino acid residue present in the wild-type ALS protein is substituted with an amino acid having different properties, for example, naturally occurring amino acid from a different group (for example, a charged or hydrophobic amino acid is substituted with alanine). As used herein, "similar amino acid" refers to an amino acid with a similar amino acid side chain, i.e., an amino acid with polar, non-polar, or near-neutral side chain. As used herein, "dissimilar amino acid" refers to an amino acid with a different amino acid side chain, for example, an amino acid with a polar side chain is not similar to an amino acid with a non-polar side chain. Polar side chains generally tend to exist on the surface of protein, where they can interact with the water environment present in the cell ("hydrophilic" amino acids). On the other hand, "non-polar"
amino acids tend to be located in the center of protein, where they can interact with similar non-polar neighboring molecules ("hydrophobic" amino acids). Examples of amino acids having polar side chains are arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, histidine, lysine, serine, and threonine (all are hydrophilic amino acids, except that eysteine is hydrophobic). Examples of amino acids with non-polar side chains are alanine, glycine, isoleucine, leucine, methionine, phenylalanine, proline and tryptophan (all hydrophobic, except that glycine is neutral).
In general, a person skilled in the art will know that the terms ALS, ALSL, AHAS, or AHASL refers to the nucleotide sequence or nucleic acid, or the amino acid sequence or polypeptide, respectively, according to his(her) common general knowledge and the context of using the terms.
As used herein, the term "gene" refers to nucleotides (ribonucleotides or deoxyribonucleosides) in form of polymer of any length. The term comprises double-stranded and single-stranded DNA and RNA, and further comprises known types of modifications, such Date Recue/Date Received 2020-07-08 as methylation, "capping", substitution of one or more naturally occurring nucleotides with analogs. Preferably, the gene comprises a coding sequence that encodes a polypeptide as defined herein. "Coding sequence" is a nucleotide sequence that can be transcribed into mRNA and/or translated into polypeptide when it is subjected to or under the control of an appropriate regulatory sequence. The boundaries of the coding sequence are determined by the translation initiation codon at the 5' end and the translation stop eodon at the 3' end.
The coding sequence may include but is not limited to mRNA, cDNA, recombinant nucleic acid sequence or genomic DNA, but in some cases an intron may also exist.
When used herein, the term "Brassica napus" may be abbreviated as "B. napus".
In addition, the term "rape" is used herein. The three terms are used interchangeably and should be understood to fully include rape plants in cultivated form. Similarly, for example, the term "Arabidopsis thaliana" may be abbreviated as "A. thaliana". These two terms are used interchangeably herein.
When used in the present invention, the term "position" refers to a position of amino acid in the amino acid sequence described herein or a position of nucleotide in the nucleotide sequence described herein, for example, a position in the coding sequence of the wild type rape ALS3 protein as shown in SEQ ID NO: I or the amino acid sequence of the wild type rape ALS3 protein as shown in SEQ ID NO: 2, or its corresponding position. The term "corresponding" as used herein means that the "position" also includes a position additional to the position determined by the aforementioned nucleotide/amino acid numbering. Due to the deletion or insertion of nucleotides at other positions in the ALS 5' tmtranslated region (UTR) (including promoter and/or any other regulatory sequences) or gene (including eX011 and intron), the position of a given nucleotide that can be substituted in the present invention may be different.
Similarly, due to the deletion or insertion of amino acids at other positions in the ALS
polypeptide, the position of a given amino acid that can be replaced in the present invention may be different. Therefore, the "corresponding position" in the present invention should be understood that the nucleotide/amino acid at the indicated number may be different, but may still have a similar adjacent nucleotide/amino acid. The nucleotide/amino acid that can be exchanged, deleted or inserted are also included in the term "corresponding position". In order to determine whether a nucleotide residue or an amino acid residue in a given ALS
nucleotide/amino acid sequence corresponds to a certain position in the nucleotide sequence SEQ ID
NO: 1 or the amino acid sequence SEQ ID NO: 2, the skilled person in the art can use tools and methods known in the art, such as alignment by human or by using computer programs, such as BLAST
(Altschul et al. (1990), Journal of Molecular Biology, 215, 403-410) (which represents Basic Date Recue/Date Received 2020-07-08 Local Alignment Search Tool) or ClustalW (Thompson et al. (1994), Nucleic Acid Res., 22, 4673-4680) or any other suitable programs suitable for generating sequence alignment.
Specifically, the present invention provides a rape plant, in which a tryptophan W
leucine L substitution occurs at position 556 of the polypeptide encoded by the endogenous ALS
gene of the rape plant, which is due to the mutation of "G" nucleotide to "T"
nucleotide at the position corresponding to the position 1667 of the nucleotide sequence as shown in SEQ ID
NO:1. Furthermore, a serine S
asparaginc N substitution occurs at position 635 of the polypeptide encoded by the endogenous ALS gene of the rape plant, which is due to the mutation of "G" nucleotide to "A" nucleotide at the position corresponding to the position 1904 of the nucleotide sequence as shown in SEQ ID NO: 1. In the most preferred embodiment, the present invention provides a rape plant, in which the endogenous ALS3 gene of the rape plant comprises (or consists of) the nucleotide sequence as shown in SEQ ID NO: 3, which encodes a mutant ALS3 polypeptide as shown in SEQ ID NO: 4.
ALS activity can be measured according to the assay method described in Singh (1991), Proc. Natl. Acad. Sci. 88: 4572-4576. The ALS nucleotide sequence encoding the ALS
polypeptide mentioned herein preferably confer tolerance to one or more pyrimidinylsalicylate herbicides described herein (or, lower sensitivity to the pyrimidinylsalicylate herbicides). This is due to the point mutations described herein that lead to amino acid substitutions. Therefore, the tolerance to pyrimidinylsalicylate herbicides (or lower sensitivity to pyrimidinylsalicylate herbicides) can be measured by obtaining ALS samples from cell extracts of a plant with a mutant ALS sequence and a plant without a mutant ALS sequence in the presence of the pyrimidinylsalicylate herbicides, and comparing their activities, for example, by the method described in Singh et al (1988) [J. Chromatogr., 444, 251-2611. When using plants, preferably in the presence of pyrimidinylsalicylate herbicides at various concentrations, more preferably in the presence of pyrimidinylsalicylate herbicide "Bispyribac-sodium" at various concentrations, the assay of ALS activities are carried out in the wild type cell extract or leaf extract and in the obtained mutant rape cell extract or leaf extract. When used herein, the lower the sensitivity, "the higher the tolerance" or "the higher the resistance", and vice versa.
Similarly, "the higher the tolerance" or "the higher the resistance", the "lower the sensitivity", and vice versa.
The term "pyrimidinylsalicylate herbicide" is not intended to be limited to a single herbicide that can interfere with ALS enzyme activity. Therefore, unless otherwise stated or obvious from the context, the "pyrimidinylsalicylate herbicide" can be one herbicide, or a mixture of two, three, four or more herbicides known in the art. The herbicides are preferably those listed herein, such as pyrithiobac-sodium, cloransulam-methyl, pyriftalid, bispyribac-sodium, pyriminobac-methyl, Date Recue/Date Received 2020-07-08 pyribenzoxirn, etc.
The present invention provides a rape plant with an endogenous acetolactate synthase (ALS) gene mutation, which is tolerable to a pyrimidinylsalicylate herbicide. As used herein, unless expressly stated otherwise, the term "plant" means a plant at any stage of development. A part of the plant may be connected to the whole plant or may be separated from the whole plant. Such part of the plant includes but is not limited to an organ, tissue and cell of the plant, preferably a seed. The rape plant of the present invention is non-transgenic with respect to the endogenous ALS gene. Of course, a foreign gene can be transferred into the plant by genetic engineering or by conventional methods such as hybridization.
The present invention is described below based on examples, but the present invention is not limited to these examples.
Example 1 In the previous patent application (Hu Maolong et al., Chinese patent: CN
107245480 A, Acetolactate synthase mutant protein with herbicide resistance and use thereof), the wild type rape strain N131 (known and publicly used, see Pu Huiming, et al., Jiangsu Journal of Agricultural Science, 2010, 26 (6): 1432-1434) was subjected to mutagenesis treatment with ethyl methanesulfonate (EMS). In the mutagenized M2 generation, we screened and identified mutant EM28 that was resistant to sulfonylurea herbicides. The EM28 plant seeds were deposited on June 19, 2017 at the China General Microbiological Culture Collection Center (CGMCC) of the China Committee for Culture Collection of Microorganisms, address: No. 3, No. 1, West Beichen Road, Chaoyang District, Beijing, 100101, the access number was CGMCC
No.14299, and the strain was named as Brassica napus. Subsequent genetic and resistance identification studies found that the resistance trait of EM28 was an incomplete dominant trait controlled by one nuclear gene, which was resistant to irnidazolinone and sulfonylurea herbicides but sensitive to pyrimidinylsalicylate herbicides. Therefore, in order to obtain a germplasm or resource of rape resistant to pyrimidinylsalicylate herbicides so as to meet the needs of breeding of herbicide resistant rape varieties, we performed EMS mutagenesis treatment on EM28 seeds again, and the EMS mutagenesis was carried out by the same method. When the M2 generation seedlings grew to the 3-4 leaf stage, they were sprayed with pyrimidinylsalicylate herbicide Bispyribac-sodium [Chemical name: sodium 2,6-bis(4,6-dimethoxypyrimidin-2-oxyl)benzoate.
Molecular formula: C19H17N4Na0s. CAS number: 125401-92-5 {sodium salt)], the sprayed Bispyribac-sodium had a concentration of 60 g a.i. ha--1 as recommended for weed control, thereby performing the screening of germplasm resistant to pyrimidinylsalicylate herbicide.

Date Recue/Date Received 2020-07-08 After 3 weeks of treatment, almost all rape seedlings were close to death, and only 10 seedlings survived and grew normally. These 10 strains were suspected to be individual rape plants resistant to pyrimidinylsalicylate herbicide and numbered as Shl to Sh10.
After these seedlings grew to the 5-6 leaf stage, they were moved to the rape breeding field, and M3 seeds were harvested by bagging self-cross during flowering phase in that year. In the light culture room, the M3 seedlings were sprayed with Bispyribac-sodium herbicide at the recommended concentration for weed control to identify resistance effects. From the week 1 after spraying, the phytotoxicity reactions were observed every day. The results showed that phytotoxicity reactions were observed in the 6 stains numbered Shl, Sh2, Sh3, Sh8, Sh9 and Sh10 and the control in the week I after spraying, in which the heart leaves of the seedlings began to turn yellow, and gradually rotted, and finally died, and these seedlings were the missed ones of spraying herbicide under high-density planting condition; while the 4 strains numbered Sh4, Sh5, Sh6 and Sh7 showed strong resistance without any symptoms of phytotoxicity and could grow normally. So far, we obtained 4 new germplasms of Brassica napus that were resistant to pyrimidinyisalicylate herbicide Bispyribac-sodium. Later, through classical genetic studies, it was found that the separation ratio of the survival and death strains in the F2 generation population was 3:1 respect with the resistance trait, which was consistent with the genetic rule of single dominant gene. In other words, the mutant gene was dominant and controlled by a single gene.
Example 2: Molecular cloning of resistance gene in the new Brassica napus germplasm resistant to pyrimidinylsalieylate herbicide Pyrimidinylsalicylate herbicides belong to the general category of ALS
inhibitor herbicides, and the target of these herbicides is acetolactate synthase. There are 3 functional acetolaetate synthase genes in the Brassica napus genome, which are located at ALS2 and ALS3 (Genebank accession numbers: Z11525 and Z11526) of A genome, as well as ALS1 (Genebank accession number: Z11524) of C genome. Based on the three ALS gene sequences, three pairs of PCR
primers were designed respectively. ALS I Primer 1: GTGGATCTAACTGTTCTTGA and Primer 2: AGAGATGAAGCTGGTGATC. ALS2 Primer 1: GAGTGTTGCGAGAAATTGCTT
and Primer 2: TTGATTATTCTATGCTCTCTTCTG. ALS3 Primer :
ATGGTTAGATGAGAGAGAGAGAG and Primer 2: GGTCGCACTAAGTACTGAGAG. The CTAB method was used to extract leaf genomic DNA samples of resistant strains Sh4, Sh5, Sh6, Sh7 and non-resistant strains Shl, Sh2, Sh3, Sh8, Sh9, Sh10 as well as N131, EM28, respectively, and the wild type and mutant ALS1 ALS2 and ALS3 genes were subjected to PCR
cloning. 504 PCR reaction system was prepared according to the instructions of high-fidelity DNA polymerase KOD-Plus kit of Toyobo (Shanghai) Biotechnology Co., Ltd.
Amplification Date Recue/Date Received 2020-07-08 was performed on a MJ Research PTC-200 PCR instrument, in which the reaction program was 94 C pre-denaturation for 5 min; 94 C denaturation for 30 s, 55 C annealing for 30 s, and 72 C
extension for 2.5 min, for a total of 35 cycles. After adding A to the blunt end, the product was separated by 1.2% (V/W) agarose gel electrophoresis, purified and recovered by the agarose gel DNA recovery kit (catalog number: DP209) of Beijing Tiangen Company, and the purified PCR
product was sequenced by Nanjing Jinsirui Biological Co., Ltd. As founding in the sequencing and comparison, the four resistant strains all showed in the detection the point mutations at two sites on the ALS3 gene. That was, in the ALS3 gene, a point mutation occurred at position +1667, where the nucleotide changed from G to T, resulting in the mutation of tryptophan (W) to leucine (L) at the position 556 of the correspondingly encoded protein; a point mutation occurred at position +1904, where the nucleotide changed from G to A, resulting in the mutation of serine (S) to asparagine (N) at the position 635 of the correspondingly encoded protein (Figure 1).
Therefore, compared with the mutant EM28, the ALS3 gene in the resistant strains had a newly added mutation site (S635N), the nucleotides of which were shown in SEQ ID NO:
3, and the amino acid sequence of which was shown in SEQ ID NO: 4. The double-site mutations (W556L
and S635N) of the ALS3 gene enhanced the resistance of the resistant mutant to pyrimidinylsalicylate herbicide.
Example 3: Evaluation and identification of herbicide resistance effects of resistant strains Sh7 with strong growth potential and good plant type was chosen, tentatively named as RP-1, and used as a representative of the resistant strains. N131 and EM28 were used as control materials, the identification and evaluation of resistance effects of RP-1 were performed by two methods, i.e., field identification test and greenhouse pot incubation test.
The field identification test of rape was conducted in the isolated breeding area for rape in Jiangsu Academy of Agricultural Sciences, and the greenhouse pot incubation test was conducted in a light cultivation room of constant temperature. After all the treatment materials were sown and grown to 3-4 leaf seedling age, three kinds of ALS inhibitor herbicides widely used in China were sprayed, in which the pyrimidinylsalicylate herbicide was Bispyribac-sodium [sodium 2,6-bis(4,6-dimethoxypyrimidin-2-oxy)benzoate], the SU herbicide was Tribenuron-methyl (methyl 2-[N -(4-methoxy-6-methy1-1,3,5-triazin-2-y1)-N -methylaminoformamidosulfony1]-benzoate), and the IMI herbicide was Irnazethapyr RRS)-5-ethy1-2-(4-isopropyl-4-methyl-5-oxo-IH-imidazolin-2-yl)nicotinic acid]. Three weeks after spraying herbicides, the resistance effects of seedlings at different herbicide concentrations were determined according to the growth performance of the seedlings. The results are shown in Table I. It can be seen from Table I that the material RP-I with double-site mutations (W556L and S635N) of the ALS3 gene showed Date Recue/Date Received 2020-07-08 enhanced resistance to the pyrimidinylsalicylate herbicide.
Table 1: Resistance performances of three rapes after being treated with ALS
inhibitor herbicides at different concentrations Bispyribae-sodium Tribenuron-methyl Imazethapyr Material (g a.i. ha-1) (g a.i. ha-1) (g a.i. ha-1) 60 120 22.5 45 45 90 Note: R represents that the rape plants grew well after the herbicide treatment, and there was no phytotoxicity; S represents that the growth of rape plants after the herbicide treatment was severely inhibited, the phytotoxicity performance was obvious, and the seedlings eventually died (the same below).
Example 4: Inhibition test of herbicides on ALS enzyme activity According to the resistance phenotype identification results, in vitro enzyme activity test was conducted to compare the inhibition effects of three types of herbicides, i.e., Bispyribac-sodium (PB type), Tribenuron-methyl (SU type) and Imazethapyr (IMI
type), on ALS enzyme in RP-1, EM28 and the original wild-type N131, and the differences between the three materials were compared. For the measurement of ALS enzyme activity, referred to the method of Singh et at (Singh BK, et al,, Analytical Biochemistry, 1988, 171:
173-179).
Specifically, 0.2 g of leaf sample was taken, ground and pulverized with liquid nitrogen in a mortar, and the ground sample was added into 4.5 ml of initial enzyme extract solution [100 mM
K2HPO4, 0.5 iriM MgCl2, 0.5 mM thiamine pyrophosphate (TPP), 10 ).tM flavin adenine dinucleotide (FAD), 10 mM sodium pyruvate, 10% (v/v) glycerin, 1 mM
dithiothreitol, 1 mM
benzylsulfonyl fluoride (PMSF), 0.5% (w/v) polyvinylpyrrolidone], centrifuged at 4 C and 12000 rpm for 20 min. The supernatant was taken, added with an equal volume of saturated (NH4)2SO4, placed on ice for 30min, centrifuged at 4 C and 12000rpm for 20min, discarded supernatant, added with lmL of the initial enzyme extract, and shaken to dissolve to obtain ALS
enzyme solution for each sample. 2004 of the extracted ALS enzyme solution was taken, and separately added with 3604 of 50mM Hepes-NaOH (PH-7.5) enzyme reaction buffer, 801.tL of 20 mM TPP, 804 of 2001iM FAD, 804 of 2M sodium pynivate + 200mM MgCl2 and ALS
herbicide at different concentrations, mixed well, reacted at 37 C for Iii, then added with 1604 of 3M H2SO4 to stop the reaction, and subjected to decarboxylation at 60 C for 15min; then Date Recue/Date Received 2020-07-08 added with 7804. of 5.5% a-naphthol solution and 7804 of 0.55% creatine, subjected to color development at 65 C for 15min and color matching at 530nm, the light absorbance value was read, and the enzyme activity was calculated according to the standard curve.
The ALS enzyme activity of the herbicide-free control was recorded as 100%, and the effects of Bispyribac-sodium (PB type), Tribenuron-methyl (SU type) and Imazethapyr (1M1 type) on ALS
enzyme activity in RP-1, EM28 and the original wild-type N131 were calculated.
As can be seen from Figures 2 and 3, with the increase of concentrations of SU
herbicide Tribenuron-methyl and IMI herbicide Imazethapyr, the ALS enzyme activity in the wild-type N131, EM28 and RP-1 were all inhibited, while the mutant enzymes in EM28 and RP-1 all showed a certain resistance to the herbicides, because compared with the wild type N131 , with the increase of concentration of Tribenuron-methyl, the inhibition trend of ALS enzyme activity in EM28 and RP-1 decreased slowly, and the both showed the same change trend.
It can be seen from Figure 4 that the mutant enzyme in RP-1 exhibited a strong resistance to pyrimidinylsalicylate herbicide Bispyribac-sodium, because compared with the N131 and EM28, with the increase of concentration of Bispyribac-sodium, the ALS enzyme activity in N131 and EM28 dropped rapidly and showed the same change trend, while the mutant enzyme activity in RP-I was less inhibited by the herbicide, that was, even under the condition of high concentration (250 mol L-1) of Bispyribac-sodium, the mutant enzyme activity in RP-1 was about 51% of the control. However, at this time, the inhibition rates of enzyme activity in N131 and EM28 were close to 100%, that was, the ALS in N131 and EM28 basically had no activity, being only 4% and 10% of the control, respectively. In summary, the sensitivity of the ALS
enzyme in the mutant RP-1 to the pyrimidinylsalicylate herbicide Bispyribac-sodium was significantly lower than those of the ALS enzymes in N131 and EM28. This further indicates that the double-site mutations of ALS gene (W556L and S635N) confer RP-1 with resistance to pyrimidinylsalicylate herbicides.
Example 5: Functional verification of resistance gene in Arahidopsis thaliana A plant expression vector was constructed, and the resistance gene was transferred into an Arahidopsis thaliana plant by conventional Agrohacterium-mediated transformation method, and positive homozygous transgenic lines were screened by PCR in the progeny of transgenes for herbicide phenotype identification. In brief, specific primers were designed according to the ALS3 gene sequence, ALS3 primer 3: 5'CGCGGTACCCTCTCTCTCTCTCATCTAACCAT3' and ALS3 primer 4: 5'CGCACTAGTCTCTCTCAGTACTTAGTGCGACC3I, Kpra and SpeI
enzyme modification sites were added at the 5' end, and the underlined sequences were enzyme digest sites. Using the genomic DNA of the mutant RP-1 as a template, the resistance gene was Date Recue/Date Received 2020-07-08 obtained by PCR amplification, the nucleotides of which were shown in SEQ ID
NO: 3, and the amino acid sequence of which was shown in SEQ ID NO: 4. The PCR product was recovered, cloned and sequenced according to the method of Example 2 to obtain a recombinant T vector carrying the gene encoding the mutant enzyme. The fragments containing the gene of interest were recovered by double digestion of the T vector with KpnI and Spel, and ligated into the pCAMBIA1390 vector (purchased from CAMBI, Australia), which was also double digested, to obtain a recombinant plant expression vector. The constructed recombinant vector was transformed into E. colt DH5u, and the plasmid was extracted for enzyme digestion and sequencing detection. The recombinant vector which was confirmed by detection to contain the target gene correctly was transformed into Agrobacterium EHA105 strain, and the plasmid was extracted for PCR and enzyme digestion identification. The obtained recombinant strain was cultured, and transformed into Arabidopsis thaliana by Agrobacterium infection flower dipping method. After TO generation was screened on medium by antibiotics, the obtained TI generation plants were transplanted into pots and placed in an artificial incubator for growth, and the T3 generation homozygous transgenic lines were obtained by PCR screening and propagation. At the 13 generation transgenic seedling stage, 60g a.i. ha Bispyribac-sodium was sprayed for resistance identification. After 3 weeks of spraying treatment, all transgenic Arabidopsis thaliana seedlings grew well, while non-transgenic Arabidopsis thaliana (Col) seedlings were all yellowed and died (Figure 5), indicating that the expression of nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown in SEQ ID NO: 3 in Arabidopsis thaliana had the function resistant to the pyrimidinylsalicylate herbicide.
Example 6: Functional verification of resistance gene in tobacco According to the method of Example 5, the nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown in SEQ ID NO: 3 were cloned into the plant expression vector pCAMBIA1390 plasmid (purchased from CAMBI, Australia). The positive clones were selected and transformed into Agrohacteritun EHAl 05, and Nicotiana benthamiana leaf disc was transformed by the conventional Agrobacterium-mediated transformation method.
After the transgenic tobacco plants were harvested, they were identified by PCR and sprayed with 60 g a.i.
ha-1 Bispyribac-sodium at the T3 transgenic tobacco seedling stage to identify resistance. After 3 weeks of spraying treatment, all the transgenic tobacco seedlings grew well, while the non-transgenic tobacco (Tob) seedlings were all yellowed and died (Figure 5), indicating that the expression of nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown in SEQ ID NO: 3 in tobacco also had the function resistant to the pyrimidinylsalicylate herbicide.
Example 7: Functional verification of resistance gene in common rape Date Recue/Date Received 2020-07-08 The nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown in SEQ ID
NO: 3 were introduced into other common rape varieties or strains that were not resistant to pyrimidinylsalicylate herbicides using a hybridization method. In brief, RP-1 was used to prepare hybrid combinations with common rape varieties restoring lines 3075R
(Pu Huiming et al., 2002, Jiangsu Agricultural Sciences, 4: 33-34) and 3018R (Pu Huiming et al., 1999, Jiangsu Agricultural Science, 6: 32-33), two Fl seeds were harvested in the same year and used for additional planting in a rape vernalization cultivation room, individual plants of uniform growth were subjected to bagging self-pollination at flowering stage, the F2 seeds were harvested and sown in Lishui Plant Science Base of the Academy of Agricultural Sciences of Jiangsu Province in Nanjing, each F2 population was sown with 20 rows. Individual plant leaves of the F2 population were taken at the seedling stage, DNA was extracted, the ALS3 gene was amplified by PCR, and the product was subjected to purification, recovery and sequencing according to steps of Example 2. According to the sequencing results, a homozygous F2 single plant having the nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown in SEQ ID NO: 3 was screened. At the flowering stage of rape, each selected F2 single plant was bagged for self-cross, and F3 seeds were harvested. At the seedling stage of F3 generation, 60g a.i. ha-1 Bispyribac-sodium was sprayed for resistance identification. After 3 weeks of spraying treatment, all selected rape seedlings introduced with resistance gene were in good growth status, while all rape seedlings without resistance gene were all yellowed and died, indicating that the expression of nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown in SEQ ID NO: 3 in rape also had the function resistant to the pyrimidinylsalicylate herbicide.
Example 8: Study on resistance function of substitutions with different amino acids at resistance mutation sites In order to clarify the resistance function produced by ALS3 when two sites Trp556 and Ser635 were mutated into other amino acids, we have consulted a large number of relevant literatures and designed 5 amino acid mutation combinations (Table 2), which were introduced manually into point-mutation sites and used to construct plant expression vectors thereof, and their resistance functions were verified by transforming Arabidopsis thaliana.
In brief, the mutant RP-1 genome was used as a template to perform site-directed mutagenesis using PCR
technology, which was carried out by commissioning Nanjing Zhongding Biotechnology Co., Ltd. As a result, 5 mutant genes were obtained: LT, in which the nucleotide at position +1667 of the ALS3 gene changed from G to T, and the nucleotide at position +1904 changed from G to C, resulting in the mutation of tryptophan (W) to leucine (L) at position 556 and the mutation of serine (S) to threonine (T) at position 635 of the correspondingly encoded protein; LI, in which Date Recue/Date Received 2020-07-08 the nucleotide at position +1667 of the ALS3 gene changed from G to T and the nucleotide at position +1904 changed from G to T, resulting in the mutation of tryptophan (W) to leueine (L) at position 556 and the mutation of serine (S) to isoIeueine (1) at position 635 of the correspondingly encoded protein; GN, in which the nucleotide at position +1666 of the ALS3 gene changed from T to G and the nucleotide at position +1904 changed from G
to A, resulting in the mutation of tryptophan (W) to glycine (G) at position 556 and the mutation of serine (S) to asparagine (N) at position 635 of the correspondingly encoded protein; GT, in which the nucleotide at position +1666 of the ALS3 gene changed from T to G and the nucleotide at position +1904 changed from G to C, resulting in the mutation of tryptophan (W) to glycine (G) at position 556 and the mutation of serine (S) to threonine (T)at position 635 of the correspondingly encoded protein; GI, in which the nucleotide at position +1666 of the ALS3 gene changed from T to G and the nucleotide at position +1904 changed from G
to T, resulting in the mutation of tryptophan (W) to glycine (G) at position 556 and the mutation of serine (S) to isoleucine (1) at position 635 of the correspondingly encoded protein (Table 2).
According to the method of Example 5, the above five mutant sequences were constructed into plant expression vector pCAMBIAI390 plasmid (purchased from CAMBI, Australia), and transformed into Arabidopsis thaliana. After obtaining positive transgenic seedlings, 60 g a.i.
Bispyribac-sodium was sprayed at the seedling stage for resistance identification. After 3 weeks of spraying treatment, all the transgenic Arcthidopsis thaliana seedlings of LT and LI grew well, while the transgenic Arabidopsis thaliana seedlings of GN, UT and Cl and the non-transgenic Arabidopsis thaliana seedlings all yellowed and died (Table 2), indicating that the expression of sequences of LT and LI amino acid mutation combinations in Arabiclopsis thaliana had the function resistant to the pyrimidinylsalicylate herbicide.
Table 2: Resistance performance of different amino acid mutation combination sequences in Arabidopsis thaliana Mutant Corresponding amino acid Resistance DNA mutation sites name site substitutions performance LT +1667: TGG/TTG; +1904: AGT/ACT W556L; S635T
LI +1667: TGG/TTG; +1904: AGT/ATIF W556L; S6351 GN +1666: TGG/GGG; +1904: AGT/AAT W5566; S635N
CT +1666: TGG/GGG; +1904: AGT/ACT W5566; S635T
GI +1666: TGG/GGG; +1904: AGT/AIT W5566; S6351 Note: Bold letters in italics indicate mutated bases; R represents that the transgenic plants grew well after herbicide treatment, and no phytotoxicity occurred; S
represents that the growth Date Recue/Date Received 2020-07-08 of rape plants was severely inhibited after herbicide treatment, indicating obvious phytotoxicity, and finally the rape seedlings died.
Although the specific embodiments of the present invention have been described above, those skilled in the art should understand that these arc merely examples, and the protection scope of the present invention is defined by the appended claims. Those skilled in the art can make various changes or modifications to these embodiments without departing from the principle and essence of the present invention, but these changes and modifications fall within the protection scope of the present invention.

Date Recue/Date Received 2020-07-08

Claims (7)

1. What is claimed is:
   I . An isolated nucleic acid encoding a mutant acetolactate synthase protein, the mutant acetolactate synthase protein comprising the following mutations:
   mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and rnutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;
   preferably, the isolated nucleic acid has a nucleotide sequence as shown in SEQ ID NO: 3;
   preferably, the rnutant acetolactate synthase protein has an amino acid sequence as shown in SEQ ID NO: 4.
2. 2. An expression cassette, vector or cell, which comprises the nucleic acid according to Claim I.
3. 3. A mutant acetolactate synthase protein, which comprises the following mutations:
   rnutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and rnutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;
   preferably, wherein the protein comprises a mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2 and a mutation of serine (S) to asparagine (N) at a position corresponding to position 635 of SEQ ID NO: 2;
   more preferably, wherein the mutant acetolactate synthase protein has an amino acid sequence of as shown in SEQ ID NO: 4.
4. 4. Use of the nucleic acid according to Claim 1 or the expression cassette, vector or cell according to Claim 2 or the mutant acetolactate synthase protein according to Clairn 3 in production of a plant resistant to a pyrimidinylsalicylate herbicide;
   preferably, the plant is rape, and the nucleic acid encodes Brassica napus ALS3 protein.
5. 5. A method for producing a plant resistant to a pyrirnidinylsalicylate herbicide, characterized in comprising the following steps:
   introducing the nucleic acid according to Claim 1 into a plant, preferably introducing the nucleic acid according to Claim I into a plant through steps such as transgene, cross, backcross or vegetative propagation, wherein the plant expresses the mutant acetolactate synthase protein 1 s Date Recue/Date Received 2020-07-08 according to Claim 3 and has resistance to a pyrimidinylsalicylate herbicide.
6. 6. A non-transgenic plant resistant to a pyrimidinylsalicylate herbicide or a part thereof, which comprises an isolated nucleic acid encoding a mutant acetolactate synthase protein, the mutant acetolactate synthase protein comprising the following mutations:
   mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2, preferably, wherein the plant is a rape; wherein the part is an organ, tissue and cell of the plant, and preferably a seed;
   preferably, wherein the rnutant acetolactate synthase protein comprises a mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2 and a rnutation of serine (S) to asparagine (N) at a position corresponding to position 635 of SEQ ID
   NO: 2;
   more preferably, the mutant acetolactate synthase protein has an arnino acid sequence as shown in SEQ ID NO: 4.
7. 7. A method of controlling a weed in a field containing a rape plant, the method cornprising applying an effective amount of a pyrirnidinylsalicylate herbicide to the field containing the weed and the rape plant, the rape plant comprising an isolated nucleic acid encoding a mutant acetolactate synthase protein, the mutant acetolactate synthase protein comprising the following mutations:
   mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2; and mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a position corresponding to position 635 of SEQ ID NO: 2;
   preferably, wherein the mutant acetolactate synthase protein cornprises a mutation of tryptophan (W) to leucine (L) at a position corresponding to position 556 of SEQ ID NO: 2 and a rnutation of serine (S) to asparagine (N) at a position corresponding to position 635 of SEQ ID
   NO: 2;
   rnore preferably, wherein the mutant aeetolactate synthase protein has an arnino acid sequence as shown in SEQ ID NO: 4.
   
   Date Recue/Date Received 2020-07-08