WO2020028816A1 - Variant rnai against alpha-synuclein - Google Patents

Variant rnai against alpha-synuclein Download PDF

Info

Publication number
WO2020028816A1
WO2020028816A1 PCT/US2019/044924 US2019044924W WO2020028816A1 WO 2020028816 A1 WO2020028816 A1 WO 2020028816A1 US 2019044924 W US2019044924 W US 2019044924W WO 2020028816 A1 WO2020028816 A1 WO 2020028816A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
rnai
promoter
aav
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/044924
Other languages
English (en)
French (fr)
Inventor
Bradford ELMER
Brenda RICHARDS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genzyme Corp
Original Assignee
Genzyme Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201980063972.6A priority Critical patent/CN112805382A/zh
Priority to MX2021001395A priority patent/MX2021001395A/es
Priority to KR1020217006255A priority patent/KR102931619B1/ko
Priority to PH1/2021/550254A priority patent/PH12021550254A1/en
Priority to CA3108526A priority patent/CA3108526A1/en
Priority to EP19752626.2A priority patent/EP3830265A1/en
Priority to SG11202101072UA priority patent/SG11202101072UA/en
Priority to BR112021001980-4A priority patent/BR112021001980A2/pt
Priority to AU2019314529A priority patent/AU2019314529B2/en
Application filed by Genzyme Corp filed Critical Genzyme Corp
Priority to JP2021529252A priority patent/JP2021534814A/ja
Priority to US17/265,489 priority patent/US12365895B2/en
Publication of WO2020028816A1 publication Critical patent/WO2020028816A1/en
Priority to IL280581A priority patent/IL280581A/en
Anticipated expiration legal-status Critical
Priority to CONC2021/0002637A priority patent/CO2021002637A2/es
Priority to JP2024115452A priority patent/JP2024156715A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/38Vector systems having a special element relevant for transcription being a stuffer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11001Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase

Definitions

  • the present disclosure relates to variant RNAi molecules.
  • the disclosure relates to variant RNAi against alpha-synuclein.
  • RNA interference is a mechanism whereby target mRNAs are reduced by introducing RNA (siRNA) that is complementary to the target.
  • siRNA RNA
  • the siRNA sequence can also be inserted into an artificial miRNA scaffold (“shmiRNA”) which allows for constitutive, polymerase II- based expression while also eliminating the neuronal toxicity associated with the introduction of siRNA or shRNA in the brain (1).
  • RNAi RNAi
  • UTR untranslated region
  • Attempts to reduce off-target silencing include the use of algorithms to identify candidate seed sequences with high specificity for the target mRNA with minimal off-target potential (Boudreau RL el al., (2012) Nad. Acids Res. 4l(l):e9) and placing an internal bulge in the guide region of the RNAi (Terasawa et al., (2011) Journal of nucleic acids 2011 : 131579).
  • the present application also provides methods for screening or identifying RNAi molecules against SNCA and construct for preparing these RNAi molecules.
  • the invention provides an RNAi comprising a first strand and a second strand, wherein a) the first strand and the second strand form a duplex; b) the first strand comprises a guide region, wherein the guide region comprises a nucleic acid having at least about 90% identity to the sequence 5’-UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) or at least about 90% identity to the sequence 5’-UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO: 8); and c) the second strand comprises a non-guide region.
  • the guide region comprises the nucleic acid sequence 5’-UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) and the non-guide region comprises the sequence 5’- GGCUGAGAACCAAAGAGUA-3’ (SEQ ID NO: 53).
  • the first strand comprises a nucleic acid sequence having about 90% identity to SEQ ID NO:24 or about 90% identity to SEQ ID NO:53.
  • the guide region comprises the nucleic acid sequence 5’-UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO:8) and the non-guide region comprises the sequence 5’-UGCUCAGUCAAUGUGCCUA -3’ (SEQ ID NO:37).
  • the second strand comprises a nucleic acid sequence having about 90% identity to SEQ ID NO:37 or about 90% identity to SEQ ID NO:37.
  • the first strand and the second strand are linked by means of a RNA linker capable of forming a loop structure.
  • the RNA linker comprises from 4 to 50 nucleotides. In some embodiments, the RNA linker comprises from 4 to 50 nucleotides. In some
  • the loop structure comprises 4 to 20 nucleotides.
  • the RNAi comprises 5’ to 3’ the second strand, the RNA linker, and the first strand. In some embodiments, the RNAi comprises 5’ to 3’ the first strand, the RNA linker, and the second strand.
  • the RNAi comprises the nucleic acid sequence of SEQ ID NO: 61 or SEQ ID NO:63. In some embodiments, the RNAi comprises a nucleotide sequence about 90% identical to the nucleotide sequence of SEQ ID NO: 61 or SEQ ID NO:63.
  • the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA).
  • the RNAi targets RNA encoding a polypeptide associated with a neurodegenerative synucleinopathy.
  • the polypeptide is alpha-synuclein (SNCA).
  • the alpha synuclein is human alpha-synuclein.
  • the neurodegenerative RNAi targets RNA encoding a polypeptide associated with a neurodegenerative synucleinopathy.
  • the polypeptide is alpha-synuclein (SNCA).
  • the alpha synuclein is human alpha-synuclein.
  • Parkinson Parkinson’s disease
  • MSA multiple system atropy
  • DLB dementia with Lewy bodies
  • the invention provides an expression construct comprising nucleic acid encoding the RNAi described herein.
  • the nucleic acid encoding the RNAi comprises a miRNA scaffold.
  • the nucleic acid encoding the RNAi is operably linked to a promoter.
  • the promoter is selected from a cytomegalovirus (CMV) immediate early promoter, an RSV LTR, a MoMLV LTR, a phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter, a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, a chimeric liver-specific promoter (LSP), an E2F promoter, a telomerase (hTERT) promoter; a cytomegalovirus enhancer/chicken beta-actin/Rabbit b-globin promoter (CAG) promoter, an elongation factor 1 -alpha promoter (EFl-alpha) promoter, a human b- glucuronidase promoter, a chicken b
  • CAG
  • the expression construct further comprises an intron.
  • the intron is a CBA intron or an hEFl alpha intron.
  • the intron is a chimeric intron.
  • the expression vector is a self-complementary vector and the intron is a delta chimeric intron.
  • the expression construct further comprises a polyadenylation signal.
  • the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or a HSV TK polyadenylation signal.
  • the invention provides a vector comprising any of the expression constructs described herein.
  • the vector is a recombinant adeno-associated virus (rAAV) vector.
  • the expression construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences.
  • the expression construct is flanked by two AAV ITRs.
  • the AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471 A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype ITRs.
  • the AAV ITRs are AAV2 ITRs.
  • the vector further comprises a stuffer nucleic acid.
  • the stuffer nucleic acid is located upstream or downstream of the nucleic acid encoding the RNAi.
  • the vector is a self-complementary rAAV vector.
  • the vector comprises first nucleic acid sequence encoding the RNAi and a second nucleic acid sequence encoding a complement of the RNAi, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.
  • the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and comprises a mutation of the terminal resolution sequence.
  • the invention provides a cell comprising any of the rAAV vectors as described herein.
  • the invention provides a recombinant AAV particle comprising any of the rAAV vectors as described herein.
  • the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2/2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1 , AAVHSC15, AAVHSC17, a goat AAV, AAV1/AAV2 chimeric, bovine AAV, or mouse AAV capsid rAAV2/HBoVl serotype capsid.
  • the ITR and the capsid of the rAAV viral particle are derived from the same AAV serotype. In some embodiments, the ITR and the capsid of the rAAV viral particle are derived from different AAV serotypes. In some embodiments, the ITR is derived from AAV2 and the capsid of the rAAV particle is derived from AAV1.
  • the invention provides a composition comprising any of the rAAV particles described herein.
  • the composition further comprises a pharmaceutically acceptable carrier.
  • the invention provides a kit comprising any of the RNAi described herein. In some embodiments, the invention provides a kit comprising any of the AAV particles described herein. In some embodiments, the invention provides a kit comprising any of the compositions described herein. In some embodiments, the kit further comprises instructions for use.
  • the invention provides methods for treating a neurodegenerative synucleinopathy in a mammal comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) or a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’-
  • the second nucleic acid comprises nucleic acid having at least about 90% identity to the sequence the sequence 5’-
  • GGCUGAGAACCAAAGAGUA-3’ SEQ ID NO: 53
  • nucleic acid having at least about 90% identity to the sequence 5’- El passenger-3’ SEQ ID NO:37.
  • the invention provides methods for treating a neurodegenerative synucleinopathy in a mammal comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid having at least about 90% identity to the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ (SEQ ID NO: 53) or a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGGGCACAUUGGAACUGAGCA -3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid having at least about 90% identity to the sequence 5’- UGCUCAGUCAAUGUGCCUA -3’ (SEQ ID NO:37).
  • the invention provides methods for inhibiting the expression of alpha-synuclein in a mammal with a neurodegenerative disease comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) or a first strand comprising a nucleic acid having at least about 90% identity to the sequence 5’- UGGGCACAUUGGAACUGAGCA -3’ (SEQ ID NO: 8), and a second strand comprising a second nucleic acid.
  • the second nucleic acid comprises nucleic acid having at least about 90% identity to the sequence 5’- GGCUGAGAACCAAAGAGUA -3’
  • the invention provides methods for inhibiting the expression of alpha-synuclein in a mammal with a neurodegenerative disease comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid having at least about 90% identity to the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ (SEQ ID NO:53) or a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGGGCACAUUGGAACUGAGCA -3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid having at least about 90% identity to the sequence 5’- UGCUCAGUCAAUGUGCCUA -3’ (SEQ ID NO:37).
  • the first strand comprises the nucleic acid sequence having the sequence of SEQ ID NO:24 or nucleic acid having the sequence of SEQ ID NO: 8.
  • the second strand comprises the nucleic acid having the sequence of SEQ ID NO: 53 or the nucleic acid having the sequence of SEQ ID NO: 37.
  • the first strand and the second strand are linked by means of a RNA linker capable of forming a loop structure.
  • the RNA linker comprises from 4 to 50 nucleotides.
  • the loop structure comprises 4 to 20 nucleotides.
  • the RNAi comprises 5’ to 3’ the second strand, the RNA linker, and the first strand. In some embodiments, the RNAi comprises 5’ to 3’ the first strand, the RNA linker, and the second strand. In some embodiments, the RNAi comprises the nucleic acid sequence of SEQ ID NO:6l or SEQ ID NO:63. In some embodiments, the RNAi comprises a nucleotide sequence about 90% identical to the nucleotide sequence of SEQ ID NO: 61 or SEQ ID NO:63. In some embodiments, the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA).
  • siRNA small inhibitory RNA
  • miRNA microRNA
  • shRNA small hairpin RNA
  • the RNAi targets RNA encoding a polypeptide associated with a neurodegenerative synucleinopathy.
  • the polypeptide is alpha-synuclein (SNCA).
  • the alpha synuclein is human alpha-synuclein.
  • the neurodegenerative synucleinopathy is Parkinson’s disease (PD), multiple system atropy (MSA), or dementia with Lewy bodies (DLB).
  • the invention provides an expression construct comprising nucleic acid encoding the RNAi described herein.
  • the nucleic acid encoding the RNAi comprises a miRNA scaffold.
  • the nucleic acid encoding the RNAi is operably linked to a promoter.
  • the promoter is selected from a cytomegalovirus (CMV) immediate early promoter, an RSV LTR, a MoMLV LTR, a phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter, a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, a chimeric liver-specific promoter (LSP), an E2F promoter, a telomerase (hTERT) promoter; a cytomegalovirus (CMV) immediate early promoter, an RSV LTR, a MoMLV LTR, a phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter, a CK6 promoter, a transthyreti
  • the expression construct further comprises an intron.
  • the intron is a CBA intron or an hEFl alpha intron.
  • the intron is a chimeric intron.
  • the expression vector is a self-complementary vector and the intron is a delta chimeric intron.
  • the expression construct further comprises a
  • the invention provides a vector comprising any of the expression constructs described herein.
  • the vector is a recombinant adeno-associated virus (rAAV) vector.
  • the expression construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences.
  • the expression construct is flanked by two AAV ITRs.
  • the AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV 10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype ITRs.
  • the AAV ITRs are AAV2 ITRs.
  • the vector further comprises a stuffer nucleic acid.
  • the stuffer nucleic acid is located upstream or downstream of the nucleic acid encoding the RNAi.
  • the vector is a self-complementary rAAV vector.
  • the vector comprises first nucleic acid sequence encoding the RNAi and a second nucleic acid sequence encoding a complement of the RNAi, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.
  • the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and comprises a mutation of the terminal resolution sequence.
  • the invention provides a recombinant AAV particle comprising any of the rAAV vectors as described herein.
  • the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2/2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2- HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, a goat AAV, AAV1/AAV2 chimeric, bovine AAV, or mouse AAV capsid rAAV2/HBoVl serotype capsid.
  • the ITR and the capsid of the rAAV viral particle are derived from the same AAV serotype. In some embodiments, the ITR and the capsid of the rAAV viral particle are derived from different AAV serotypes. In some embodiments, the ITR is derived from AAV2 and the capsid of the rAAV particle is derived from AAV1. In some embodiments, the rAAV particle is in a composition. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. [0025] All references cited herein, including patent applications and publications, are incorporated by reference in their entirety.
  • FIG. 1A shows the structure if Dl shmiRNA (SEQ ID NO:6l) and FIG. IB shows the structure of El shmiRNA (SEQ ID NO:63).
  • FIG. 2 shows RNAi-mediated reduction of human SNCA in vitro. Quantification of SNCA in whole cell extracts of HEK293T cells 72 hours post-transfection with plasmids encoding the indicated RNAi sequences in shmiRNA format and human SNCA cDNA. SNCA levels were normalized to GAPDH loading control, and normalized to control (non-targeting control RNAi) to calculate percent knockdown.
  • FIG. 3 shows RNAi-mediated reduction of mouse SNCA in vitro. Quantification of SNCA in whole cell extracts of HEK293T cells 72 hours post-transfection with plasmids encoding the indicated RNAi sequences in miRNA format and mouse SNCA cDNA. SNCA levels were normalized to GAPDH loading control, and normalized to control (non-targeting control RNAi) to calculate percent knockdown.
  • FIGS. 4A-D show RNAi-mediated reduction of mouse or human alpha-synuclein protein in vitro.
  • SNCA protein levels were normalized to beta tubulin, and normalized to control (non-targeting control RNAi) to calculate percent knockdown as shown in the western blotting images for human SNCA (FIG. 4C) and mouse SNCA (FIG. 4D).
  • FIGS. 5A-B shows the toxicity of indicated RNAi sequences in transfected
  • LUHMES cells LUHMES cells were transfected with the indicated RNAi sequences in miRNA format, and then treated with rotenone to induce cell toxicity.
  • FIG. 5A Cell viability measured via Cell Titer Blue ® assay 48hours post-rotenone treatment and demonstrated significant neuroprotection by both Dl and El RNAi sequences (38% and 40% respectively), but not with the control RNAi sequence. % mean neuroprotection is calculated at % change from control.
  • FIG. 5B Reactive oxygen species measured as an additional readout of rotenone-induced toxicity.
  • FIG. 6 shows the positive correlation of SNCA knockdown with neuroprotection. Percent neuroprotection (as cell viability) from FIG. 5 were plotted vs the level of knockdown from Dl or El in each respective experiment. Both RNAi sequences showed significant, positive correlation (Pearson’s) of percent knockdown with the level of neuroprotection in rotenone-treated LUHMES cells.
  • FIG. 7 shows target mRNA knockdown by indicated RNAi in miRNA format in vivo. Bars indicate the mean +/- SEM. Circles represent individual animals. Significance assessed via one-way ANOVA with multiple comparisons.
  • FIG. 8 shows reduction of SNCA mRNA throughout the midbrain in mice after injection of AAV-D1 vector.
  • Mice were injected unilaterally with lelO GC control or Dl virus. Tissue was collected and processed for in situ hybridization 1 month later.
  • the SNCA anti-sense probe clearly shows target reduction at three different anatomical levels rostal to caudal relative to the contralateral hemisphere.
  • the control RNAi virus did not show any decrease in SNCA mRNA relative to the uninjected hemisphere.
  • FIG. 9 shows reduction of SNCA protein and mRNA in mice via SNc
  • FIG. 10 shows reduction of SNCA protein and mRNA in mice via SNc
  • FIG. 11 shows a-synuclein normalized expression in individual biological replicates for each sample group; EV stands for“empty vector”.
  • the disclosure provides RNAi for treating neurodegenerative synucleinopathies.
  • the neurodegenerative synucleinopathy is Parkinson’s disease or multiple system atrophy (MSA).
  • the RNAi targets alpha- synuclein.
  • the RNAi reduces expression of alpha-synuclein.
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24).
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’-GGCUGAGAACCAAAGAGUA-3’ (SEQ ID NO: 53).
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO: 8).
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- ErGGGCACAETETGGAACUGAGCA-3’ (SEQ ID NO:8) and a second strand comprising a second nucleic acid comprising the sequence 5’- UGCUCAGUCAAUGUGCCUA -3’ (SEQ ID NO: 37).
  • the disclosure provides expression constructs, vectors ( e.g ., recombinant AAV vectors), cells, viral particles (e.g., AAV particles), and pharmaceutical compositions comprising an RNAi of the present disclosure.
  • the disclosure provides methods for treating neurodegenerative synucleinopathies, inhibiting the expression of SNCA, and inhibiting the accumulation of SNCA in a cell in a mammal comprising
  • the disclosure provides for the use of a pharmaceutical composition comprising an RNAi of the present disclosure to treat neurodegenerative synucleinopathies (e.g., ameliorate the symptoms of neurodegenerative synucleinopathies), inhibit the expression of SNCA, or inhibit the accumulation of SNCA in a cell in a mammal with neurodegenerative synucleinopathies.
  • the synucleinopathy is Parkinson’s disease, multiple system atropy or dementia with Lewy bodies.
  • Antibodies A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (V.T. DeVita et al., eds., J.B. Lippincott Company, 2011).
  • A‘ vector,” as used herein, refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo.
  • polynucleotide or“nucleic acid” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides.
  • this term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
  • the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
  • the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P-NH 2 ) or a mixed phosphoramidate- phosphodiester oligomer.
  • a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
  • polypeptide and“protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full- length proteins and fragments thereof are encompassed by the definition.
  • the terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like.
  • polypeptide refers to a protein which includes modifications, such as deletions, additions, and substitutions (generally conservative in nature), to the native sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
  • A‘‘recombinant viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of viral origin).
  • the recombinant nucleic acid is flanked by at least one and in some embodiments two, inverted terminal repeat sequences (ITRs).
  • A‘‘recombinant AAV vector (rAAV vector)” refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin) that are flanked by at least one, and in embodiments two, AAV inverted terminal repeat sequences (ITRs).
  • rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e. AAV Rep and Cap proteins).
  • a rAAV vector When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a“pro-vector” which can be“rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions.
  • An rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, particularly an AAV particle.
  • a rAAV vector can be packaged into an AAV virus capsid to generate a“recombinant adeno-associated viral particle (rAAV particle)”.
  • Heterologous means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated.
  • a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide).
  • a cellular sequence e.g ., a gene or portion thereof
  • transgene refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and/or expressed under appropriate conditions. In aspects, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. In another aspect, it may be transcribed into a molecule that mediates RNA interference, such as miRNA, siRNA, or shRNA.
  • Chicken b-actin (CBA) promoter refers to a polynucleotide sequence derived from a chicken b-actin gene (e.g., Gallus gallus beta actin, represented by GenBank Entrez Gene ID 396526).
  • “chicken b-actin promoter” may refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of the chicken b-actin gene, and the splice acceptor of the rabbit beta-globin gene, such as the sequences described in Miyazaki, J. et al. (1989) Gene 79(2):269-77.
  • CAG promoter may be used interchangeably.
  • the term“CMV early enhancer/chicken beta actin (CAG) promoter” may be used interchangeably.
  • the terms“genome particles (gp),”“genome equivalents,” or“genome copies” as used in reference to a viral titer, refer to the number of virions containing the recombinant AAV DNA genome, regardless of infectivity or functionality.
  • the number of genome particles in a particular vector preparation can be measured by procedures such as described in the Examples herein, or for example, in Clark et al. (1999) Hum. Gene Ther., 10: 1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.
  • vector genome (vg) may refer to one or more
  • polynucleotides comprising a set of the polynucleotide sequences of a vector, e.g., a viral vector.
  • a vector genome may be encapsidated in a viral particle.
  • a vector genome may comprise single-stranded DNA, double-stranded DNA, or single- stranded RNA, or double-stranded RNA.
  • a vector genome may include endogenous sequences associated with a particular viral vector and/or any heterologous sequences inserted into a particular viral vector through recombinant techniques.
  • a recombinant AAV vector genome may include at least one ITR sequence flanking a promoter, a stuffer, a sequence of interest (e.g., an RNAi), and a polyadenylation sequence.
  • a complete vector genome may include a complete set of the polynucleotide sequences of a vector.
  • the nucleic acid titer of a viral vector may be measured in terms of vg/mL. Methods suitable for measuring this titer are known in the art (e.g., quantitative PCR).
  • the term“inhibit” may refer to the act of blocking, reducing, eliminating, or otherwise antagonizing the presence, or an activity of, a particular target.
  • inhibiting the expression of a gene may refer to any act leading to a blockade, reduction, elimination, or any other antagonism of expression of the gene, including reduction of mRNA abundance (e.g., silencing mRNA transcription), degradation of mRNA, inhibition of mRNA translation, and so forth.
  • inhibiting the expression of SNCA may refer a blockade, reduction, elimination, or any other antagonism of expression of SNCA, including reduction of SNCA mRNA abundance (e.g., silencing SNCA mRNA transcription), degradation of SNCA mRNA, inhibition of SNCA mRNA translation, and so forth.
  • inhibiting the accumulation of a protein in a cell may refer to any act leading to a blockade, reduction, elimination, or other antagonism of expression of the protein, including reduction of mRNA abundance (e.g., silencing mRNA transcription), degradation of mRNA, inhibition of mRNA translation, degradation of the protein, and so forth.
  • reduction of mRNA abundance e.g., silencing mRNA transcription
  • degradation of mRNA e.g., inhibition of mRNA translation
  • degradation of the protein e.g., and so forth.
  • inhibiting the accumulation of SNCA protein in a cell refers to a blockade, reduction, elimination, or other antagonism of expression of the SNCA protein in a cell, including reduction of SNCA mRNA abundance (e.g ., silencing SNCA mRNA transcription), degradation of SNCA mRNA, inhibition of SNCA mRNA translation, degradation of the SNCA protein, and so forth
  • infectious unit (iu),”“infectious particle,” or“replication unit,” as used in reference to a viral titer refer to the number of infectious and replication-competent recombinant AAV vector particles as measured by the infectious center assay, also known as replication center assay, as described, for example, in McLaughlin et al. (1988) J Virol., 62: 1963-1973.
  • transducing unit (tu) refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product as measured in functional assays such as described in Examples herein, or for example, in Xiao et al. (1997) Exp. Neurobiol., 144: 113-124; or in Fisher et al. (1996) J Virol., 70:520-532 (LFU assay).
  • An“inverted terminal repeat” or“ITR” sequence is a term well understood in the art and refers to relatively short sequences found at the termini of viral genomes which are in opposite orientation.
  • An“AAV inverted terminal repeat (ITR)” sequence is an approximately 145 -nucleotide sequence that is present at both termini of the native single-stranded AAV genome.
  • the outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome.
  • the outermost 125 nucleotides also contains several shorter regions of self-complementarity (designated A, A', B, B', C, C and D regions), allowing intrastrand base-pairing to occur within this portion of the ITR.
  • A‘‘terminal resolution sequence” or“trs” is a sequence in the D region of the AAV
  • a mutant terminal resolution sequence is refractory to cleavage by AAV rep proteins.
  • AAV helper functions refer to functions that allow AAV to be replicated and packaged by a host cell.
  • AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents.
  • A“helper virus” for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell.
  • a helper virus provides "helper functions" which allow for the replication of AAV.
  • helper viruses include adenoviruses, herpesviruses and, poxviruses such as vaccinia and baculovirus.
  • the adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most commonly used.
  • Ad5 Adenovirus type 5 of subgroup C
  • Numerous adenoviruses of human, non human mammalian and avian origin are known and are available from depositories such as the ATCC.
  • Viruses of the herpes family which are also available from depositories such as ATCC, include, for example, herpes simplex viruses (HSV), Epstein-Barr viruses (EBV),
  • CMV cytomegaloviruses
  • PRV pseudorabies viruses
  • adenovirus helper functions for the replication of AAV include El A functions, E1B functions, E2A functions, VA functions and E4orf6 functions.
  • Baculoviruses available from depositories included e Autographa califomica nuclear polyhedrosis virus.
  • a preparation of rAAV is said to be“substantially free” of helper virus if the ratio of infectious AAV particles to infectious helper virus particles is at least about 10 2 : 1 ; at least about 10 4 :1, at least about 10 6 :1; or at least about 10 8 :1 or more.
  • preparations are also free of equivalent amounts of helper virus proteins (i.e., proteins as would be present as a result of such a level of helper virus if the helper virus particle impurities noted above were present in disrupted form).
  • Viral and/or cellular protein contamination can generally be observed as the presence of Coomassie staining bands on SDS gels (e.g ., the appearance of bands other than those corresponding to the AAV capsid proteins VP1, VP2 and VP3).
  • Percent (%) sequence identity with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid or nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software programs, for example, those described in Current Protocols in Molecular Biology (Ausubel et al, eds., 1987), Supp.
  • the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows: 100 times the fraction X/Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A.
  • the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows: 100 times the fraction W/Z, where W is the number of nucleotides scored as identical matches by the sequence alignment program in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C.
  • An“isolated” molecule e.g ., nucleic acid or protein
  • cell means it has been identified and separated and/or recovered from a component of its natural environment.
  • An“effective amount” is an amount sufficient to effect beneficial or desired results, including clinical results (e.g., amelioration of symptoms, achievement of clinical endpoints, and the like).
  • An effective amount can be administered in one or more administrations. In terms of a disease state, an effective amount is an amount sufficient to ameliorate, stabilize, or delay development of a disease.
  • An“individual” or“subject” is a mammal. Mammals include, but are not limited to, domesticated animals (e.g ., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.
  • beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (e.g., not worsening) state of disease, preventing spread (e.g., metastasis) of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.“Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.
  • prophylactic treatment refers to treatment, wherein an individual is known or suspected to have or be at risk for having a disorder but has displayed no symptoms or minimal symptoms of the disorder. An individual undergoing prophylactic treatment may be treated prior to onset of symptoms.
  • neurodegenerative synucleinopathy refers to
  • Parkinson's disease PD
  • MSA-P and MSA-C multiple system atrophy
  • DLB dementia with Lewy bodies
  • PAF pure autonomic failure
  • LVAD Lewy body variant of Alzheimer’s disease
  • LVAD Lewy body dysphagia
  • incidental Lewy body disease PD
  • RNAi may refer to any RNA molecule that induces RNA interference in a cell.
  • RNAi include without limitation small inhibitory RNAs (siRNAs), microRNAs (miRNAs), and small hairpin RNAs (shRNAs).
  • RNA scaffold may refer to a polynucleotide containing (i) a double-stranded sequence targeting a gene of interest for knockdown by RNAi and (ii) additional sequences that form a stem-loop structure resembling that of endogenous miRNAs.
  • a sequence targeting a gene of interest for RNAi e.g., a short, ⁇ 20-nt sequence
  • this duplex may hybridize imperfectly, e.g., it may contain one or more unpaired or mispaired bases. Upon cleavage of this polynucleotide by Dicer, this duplex containing the sequence targeting a gene of interest may be unwound and incorporated into the RISC complex.
  • a miRNA scaffold may refer to the miRNA itself or to a DNA polynucleotide encoding the miRNA.
  • An example of a miRNA scaffold is the miR-l55 sequence (Lagos- Quintana, M. et al. (2002) Curr. Biol. 12:735-9).
  • kits for cloning a sequence into a miRNA scaffold are known in the art (e.g., the InvitrogenTM BLOCK-iTTM Pol II miR RNAi expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA).
  • a“bulge” refers to a region of nucleic acid that is non-complementary to nucleic acid opposite it in a duplex nucleic acid.
  • a bulge may refer to a nucleic acid sequence that is noncomplementary to nucleic acid opposite in a duplex nucleic acid where the bulge is flanked by regions of nucleic acid that are complementary to nucleic acid opposite in a duplex nucleic acid.
  • the bulge may be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10 bases in length.
  • the bulge may be the result of mispairing (e.g., the opposite strand contains a base that is noncomplementary) or the bulge may be the result of nonpairing (e.g., the opposite strand comprises nucleic acid complementary to nucleic acid flanking the bulge but the opposite strand does not contain nucleic acid opposite the bulge).
  • the term“sense” nucleic acid is a nucleic acid comprising a sequence that encodes all or a part of a transgene.
  • mRNA for a transgene is a sense nucleic acid.
  • “antisense” nucleic acid is a sequence of nucleic acid that is complementary to a“sense” nucleic acid.
  • an antisense nucleic acid may be complementary to an mRNA encoding a transgene.
  • the“guide region” of an RNAi is the strand of the RNAi that binds the target mRNA, typically on the basis of complementarity.
  • the region of complementarity may encompass the all or a portion of the guide region.
  • the region of complementarity includes at least the seed region.
  • the antisense region of an RNAi is the guide region.
  • the“passenger region,” or“non-guide region,” used interchangeably herein, of an RNAi is the region of the RNAi that is complementary to the guide region.
  • the sense region of an RNAi is the passenger region.
  • the“seed region” of an RNAi is a region of about 1-8 nucleotides in length of a microRNA.
  • the seed region and the 3'-UTR of its target mRNA may be a key determinant in RNAi recognition.
  • off-target gene silencing refers to the pairing of a seed region of an RNAi with sequences in 3'-UTRs of unintended mRNAs and directs translational repression and destabilization of those transcripts (e.g., reduces expression of the unintended mRNAs).
  • Reference to“about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to“about X” includes description of“X.”
  • the disclosure provides improved RNAi.
  • the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA).
  • siRNA small inhibitory or interfering RNA
  • a small inhibitory or interfering RNA (siRNA) is known in the art as a double- stranded RNA molecule of approximately 19-25 (e.g., 19-23) base pairs in length that induces RNAi in a cell.
  • the siRNA sequence can also be inserted into an artificial miRNA scaffold (“shmiRNA”).
  • a small hairpin RNA is known in the art as an RNA molecule comprising approximately 19-25 (e.g., 19-23) base pairs of double stranded RNA linked by a short loop (e.g., ⁇ 4-l 1 nucleotides) that induces RNAi in a cell.
  • a microRNA is known in the art as an RNA molecule that induces RNAi in a cell comprising a short ( e.g ., 19-25 base pairs) sequence of double-stranded RNA linked by a loop and containing one or more additional sequences of double-stranded RNA comprising one or more bulges (e.g., mispaired or unpaired base pairs).
  • “miRNA” encompasses endogenous miRNAs as well as exogenous or heterologous miRNAs.
  • “miRNA” may refer to a pri-miRNA or a pre-miRNA. During miRNA processing, a pri-miRNA transcript is produced.
  • the pri-miRNA is processed by Drosha- DGCR8 to produce a pre-miRNA by excising one or more sequences to leave a pre-miRNA with a 5’flanking region, a guide strand, a loop region, a non- guide strand, and a 3’flanking region; or a 5’flanking region, a non-guide strand, a loop region, a guide strand, and a 3’flanking region.
  • the pre-miRNA is then exported to the cytoplasm and processed by Dicer to yield a siRNA with a guide strand and a non-guide (or passenger) strand.
  • the guide strand is then used by the RISC complex to catalyze gene silencing, e.g., by recognizing a target RNA sequence complementary to the guide strand. Further description of miRNAs may be found, e.g., in WO 2008/150897.
  • the recognition of a target sequence by a miRNA is primarily determined by pairing between the target and the miRNA seed sequence, e.g., nucleotides 1-8 (5’ to 3’) of the guide strand (see, e.g., Boudreau, R.L. et al. (2013) Nucleic Acids Res. 4l :e9).
  • the guide strand: non-guide strand interface in a duplex is formed in part through complementary base pairing (e.g., Watson-Crick base pairing). However, in some embodiments, this complementary base pairing does not extend through the entire duplex.
  • a bulge in the interface may exist at one or more nucleotide positions.
  • the term "bulge" may refer to a region of nucleic acid that is non- complementary to the nucleic acid opposite it in a duplex. In some embodiments, the bulge is formed when the regions of complementary nucleic acids bind to each other, whereas the regions of central non-complementary region do not bind.
  • the bulge is formed when the two strands of nucleic acid positioned between the two complementary regions are of different lengths. As described below, a bulge may 1 or more nucleotides.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the RNAi described in this disclosure is inhibitory against alpha- synuclein (SNCA).
  • the SNCA is mouse SNCA.
  • the SNCA is human SNCA.
  • the RNAi targets RNA encoding SNCA.
  • the RNAi inhibits the expression of SNCA in a subject. In some embodiments, the RNAi inhibits the accumulation of SNCA in a subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.
  • RNAi-based therapies can be hampered by the ability of small inhibitory RNAs (siRNAs) to bind to unintended mRNAs and reduce their expression, an effect known as off-target gene silencing. Off-targeting primarily occurs when the seed region
  • Reduced off-targeting RNAi may be designed by substituting bases within the guide and nonguide sequences; e.g., by creating CpG motifs. Potential substitutions that may result in a significantly lower off-target score can be evaluated using the SiSPOTR algorithm, a specificity-focused siRNA design algorithm which identifies candidate sequences with minimal off-targeting potentials and potent silencing capacities (Boudreau et al, Nucleic Acids Res. 2013 Jan; 41(1) e9. A reduced
  • the SiSPOTR score predicts sequences that have a lower number of potential human off targets compared parent RNAi molecules.
  • the RNAi is improved to reduce off-target gene silencing.
  • the RNAi comprises one or more CpG motifs.
  • the RNAi comprises one or more CpG motifs in a seed region.
  • the first strand and the second strand are linked by means of a RNA (e.g., a RNA linker) capable of forming a loop structure.
  • a RNA e.g., a RNA linker
  • an RNA loop structure e.g., a stem-loop or hairpin
  • a loop structure may form in the RNA molecule A-B- C if sequences A and C are complementary or partially complementary such that they base pair together, but the bases in sequence B do not base pair together.
  • the loop sequence is 5’ -GTTTTGGCCACTGACTGAC-3’ (SEQ ID NO:59) in DNA form or 5’- GUUUUGGCCACUGACUGAC-3’ (SEQ ID NO: 60) in RNA form.
  • the RNA capable of forming a loop structure comprises from 4 to 50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In some embodiments, the number of nucleotides in the RNA capable of forming a loop is from 4 to 50 nucleotides or any integer therebetween. In some
  • the term“loop structure” is a sequence that joins two complemantary strands of nucleic acid.
  • 1 -3 nucleotides of the loop structure are contiguous to the complementary strands of nucleic acid and may be complementary to 1 -3 nucleotides of the distal portion of the loop structure.
  • the three nucleotides at the 5’ end of the loop structure may be complementary to the three nucleotides at the 3’ end of the loop structure.
  • nucleic acid encoding an RNAi of the present disclosure comprises a heterologous miRNA scaffold.
  • use of a heterologous miRNA scaffold is used to modulate miRNA expression; for example, to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art may be used.
  • the miRNA scaffold is derived from a miR-l 55 scaffold (see, e.g., Lagos-Quintana, M. el al. (2002) Curr. Biol. 12:735-9 and the InvitrogenTM BLOCK-iTTM Pol II miR RNAi expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA).
  • the RNAi is selected from Table 1.
  • the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to any guide sequences. In some embodiments, the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to any guide sequences but maintains the CpG motif. In some embodiments, the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the corresponding passenger sequence. In some
  • the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the corresponding passenger sequence but maintains the CpG motif.
  • Neurodegenerative synucleinopathies are neurodegenerative diseases characterized by increased levels of alpha-synuclein (SNCA) protein in neurons, nerve fibers or glial cells.
  • Main types of neurodegenerative synucleinopathies include dementia with Lewy bodies (DLB), Parkinson’s disease, and multiple system atrophy (MSA).
  • neurodegenerative synucleinopathies include, but are not limited to, Parkinson's disease (PD), multiple system atrophy (MSA-P and MSA-C), dementia with Lewy bodies (DLB), pure autonomic failure (PAF), Lewy body variant of Alzheimer’s disease (LBV AD), Lewy body dysphagia, and incidental Lewy body disease.
  • PD Parkinson's disease
  • MSA-P and MSA-C dementia with Lewy bodies
  • DLB dementia with Lewy bodies
  • PAF pure autonomic failure
  • LBV AD Lewy body variant of Alzheimer’s disease
  • Lewy body dysphagia and incidental Lewy body disease.
  • RNAi against SNCA Provided in this disclosure is RNAi against SNCA.
  • the disclosure provides methods and compositions for treating Neurodegenerative synucleinopathies in a mammal comprising administering to the mammal a pharmaceutical composition of the present disclosure (e.g ., a pharmaceutical composition comprising a viral particle of the present disclosure).
  • a pharmaceutical composition of the present disclosure e.g ., a pharmaceutical composition comprising a viral particle of the present disclosure.
  • the disclosure provides methods and compositions for inhibiting the expression of SNCA in a mammal with a neurodegenerative synucleinopathy comprising administering to the mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising a viral particle of the present disclosure).
  • the disclosure provides methods and compositions for inhibiting the accumulation of SNCA in a cell of a mammal with a
  • neurodegenerative synucleinopathy comprising administering to the mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising a viral particle of the present disclosure).
  • a pharmaceutical composition of the present disclosure e.g., a pharmaceutical composition comprising a viral particle of the present disclosure.
  • the disclosure provides methods and compositions for ameliorating a symptom of a neurodegenerative synucleinopathy, comprising administration of an effective amount of recombinant viral particles comprising a vector encoding an RNAi of the present disclosure to the nervous system of a mammal.
  • the symptoms of a neurodegenerative synucleinopathy include, but are not limited to, parkinsonism, impaired cognition, sleep disorders, visual hallucinations, impaired speech, constipation, pyramidal or cerebellar signs, anosmia, autonomic dysfunction such as orthostatic hypotension, decreased sweating, erectile dysfunction, urine retention or incontinence and pupillary dysfunction.
  • the disclosure provides methods to prevent or delay progression of a neurodegenerative synucleinopathy.
  • Synucleinopathies like PD are typically diagnosed clinical by the presence of tremor, bradykinesia, stiffness, and postural instability. Differentiation from PD is typical performed by checking for additional signs such as orthostatic hypotension, pyramidal signs, cognitive changes or hallucinations.
  • some synucleinopathies can be diagnosed by brain imaging, for example by looking for abnormalities in brain regions such as the pons, cerebellum, putamen in MSA.
  • Some synucleinopathies can be directly identified via genotyping for common mutations not necessarily limited the SNCA gene.
  • Delay or prevention of disease progression could be defined by improvement in any of the following symptoms: motor function (bradykinesia, dyskinesia, dystonia, postural instability, stooped posture, tremor, myoclonus etc), cognition, sleep disorders, visual hallucinations, speech, constipation, pyramidal signs, anosmia, autonomic dysfunction such as orthostatic hypotension, decreased sweating, erectile dysfunction, urine retention or incontinence and pupillary dysfunction.
  • the methods and compositions are used for the treatment of humans with a neurodegenerative synucleinopathy.
  • the disclosure provides an improved RNAi for targeting SNCA mRNA in a mammal with a neurodegenerative synucleinopathy.
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ (SEQ ID NO: 53 ), where the first strand and second strand form a duplex and wherein the A residue at residue 19 of SEQ ID NO: 53 of the second strand does not form a basepair with a residue in the first strand.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the first strand and the second strand are linked by a loop sequence.
  • the loop sequence is 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 60).
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO:8) and a second strand comprising a second nucleic acid comprising the sequence 5’- ETGCIJCAGIJCAAIJGIJGCCIJA -3’ (SEQ ID NO: 37), where the first strand and second strand form a duplex and wherein the A residue 19 of SEQ ID NO:37 of the second strand does not form a basepair with a residue in the first strand.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the first strand and the second strand are linked by a loop sequence.
  • the loop sequence is 5'- GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 60).
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- UGCGCUUUGGUCUUCAGCC-3’ (SEQ ID NO: 14) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGCGUA-3’ (SEQ ID NO:43), where the first strand and second strand form a duplex and wherein the A residue at residue 19 of SEQ ID NO:43 of the second strand does not form a basepair with a residue in the first strand.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the first strand and the second strand are linked by a loop sequence.
  • the loop sequence is 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 60).
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCGCAUUGGAACUGAGCA-3’ (SEQ ID NO:7) and a second strand comprising a second nucleic acid comprising the sequence 5’- UGCUCAGUCAAUGCGCCUA -3’ (SEQ ID NO: 36), where the first strand and second strand form a duplex and wherein the A residue at residue 19 of SEQ ID NO: 36 of the second strand does not form a basepair with a residue in the first strand.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the first strand and the second strand are linked by a loop sequence.
  • the loop sequence is 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 60).
  • the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5’- uUCCAACAUUUGUCACUUGCU-3’ (SEQ ID NO:5) and a second strand comprising a second nucleic acid comprising the sequence 5’- AGCAAGUGAAAUGUUCGAA-3’ (SEQ ID NO: 34), where the first strand and second strand form a duplex and wherein the A residue at residue 18 or residue 19 of SEQ ID NO:34 of the second strand does not form a basepair with a residue in the first strand.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the first strand and the second strand are linked by a loop sequence.
  • the loop sequence is 5'-GETUETUGGCCACUGACUGAC-3' (SEQ ID NO: 60).
  • the RNAi is improved to reduce off-target gene silencing.
  • the RNAi comprises one or more CpG motifs.
  • the RNAi comprises one or more CpG motifs in a seed region.
  • the disclosure provides methods for treating a
  • RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ (SEQ ID NO: 53), where the first strand and second strand form a duplex.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the disclosure provides methods for inhibiting the expression of SNCA in a mammal with a neurodegenerative synucleinopathy comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ (SEQ ID NO: 53), where the first strand and second strand form a duplex.
  • the disclosure provides methods for inhibiting the accumulation of SNCA in a cell of a mammal with a neurodegenerative synucleinopathy comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGAGUA-3’ (SEQ ID NO: 53), where the first strand and second strand form a duplex.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%,
  • the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:24 but maintains the CpG motif.
  • the first strand and the second strand are linked by a loop sequence.
  • the loop sequence is 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO:60).
  • the disclosure provides methods for treating a
  • RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid comprising the sequence 5’- UGCUCAGUCAAUGUGCCUA-3’ (SEQ ID NO:37), where the first strand and second strand form a duplex.
  • the disclosure provides methods for inhibiting the expression of SNCA in a mammal with a neurodegenerative synucleinopathy comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid comprising the sequence 5’- UGCUCAGUCAAUGUGCCUA -3’ (SEQ ID NO:37), where the first strand and second strand form a duplex.
  • the disclosure provides methods for inhibiting the accumulation of SNCA in a cell of a mammal with a neurodegenerative synucleinopathy comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- 5’- UGGGCACAUUGGAACUGAGCA-3’-3’ (SEQ ID NO:8) and a second strand comprising a second nucleic acid comprising the sequence 5’- UGCUCAGUCAAUGUGCCUA-3’ (SEQ ID NO:37), where the first strand and second strand form a duplex.
  • the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.
  • the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%,
  • the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 37.
  • the first strand and the second strand are linked by a loop sequence.
  • the loop sequence is 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 60).
  • the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA).
  • siRNA small inhibitory or interfering RNA
  • a small inhibitory or interfering RNA (siRNA) is known in the art as a double-stranded RNA molecule of approximately 19-25 ( e.g ., 19-23) base pairs in length that induces RNAi in a cell.
  • a small hairpin RNA (shRNA) is known in the art as an RNA molecule comprising approximately 19-25 (e.g., 19-23) base pairs of double stranded RNA linked by a short loop (e.g., -4-11 nucleotides) that induces RNAi in a cell.
  • the miRNA comprises a guide sequence that is about 90% identical to SEQ ID NO: 24. In some embodiments, the miRNA comprises a guide sequence that is about any of 90% identical, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 24.
  • the miRNA comprises a non-guide sequence that is about 90% identical to SEQ ID NO: 24. In some embodiments, the miRNA comprises a non-guide sequence that is about any of 90% identical, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO:53.
  • Any RNAi described herein e.g., as part of a rAAV vector
  • any RNAi described in Table 1 can be used in treating a neurodegenerative synucleinopathy.
  • the miRNA comprises a guide sequence that is about 90% identical to SEQ ID NO: 8. In some embodiments, the miRNA comprises a guide sequence that is about any of 90% identical, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 8.
  • the miRNA comprises a non-guide sequence that is about 90% identical to SEQ ID NO:37. In some embodiments, the miRNA comprises a non-guide sequence that is about any of 90% identical, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO:37.
  • Any RNAi described herein e.g., as part of a rAAV vector
  • any RNAi described in Table 1 can be used in treating a neurodegenerative synucleinopathy.
  • the first strand and the second strand are linked by means of RNA capable of forming a loop structure.
  • RNA loop structure e.g., a stem-loop or hairpin
  • an RNA loop structure is formed when an RNA molecule comprises two sequences of RNA that basepair together separated by a sequence of RNA that does not base pair together.
  • a loop structure may form in the RNA molecule A-B-C if sequences A and C are complementary or partially complementary such that they base pair together, but the bases in sequence B do not base pair together.
  • the RNA capable of forming a loop structure comprises from 4 to 50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises the nucleotide sequence of SEQ ID NO:60. In some embodiments, the vector genome comprises a nucleotide sequence that is at least about any of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 60.
  • delivery of recombinant viral particles is by injection of viral particles to the brain. In some embodiments, delivery of recombinant viral particles is by injection of viral particles to the striatum. Intrastriatal administration delivers recombinant viral particles to an area of the brain, the striatum (including the putamen and caudate nucleus), that is highly affected by a neurodegenerative synucleinopathy.
  • recombinant viral particles e.g., rAAV particles
  • recombinant viral particles e.g., rAAV particles
  • the recombinant viral particles are delivered by convection enhanced delivery (e.g., convection enhanced delivery to the striatum).
  • the disclosure provides methods for treating a neurodegenerative synucleinopathy in a mammal comprising administering to the mammal the pharmaceutical composition of the present disclosure.
  • the disclosure provides methods for inhibiting the accumulation of SNCA in a cell of a mammal with a neurodegenerative synucleinopathy comprising administering to the mammal the pharmaceutical composition of the present disclosure.
  • the disclosure provides methods for inhibiting the expression of SNCA in a mammal with a neurodegenerative synucleinopathy comprising administering to the mammal the pharmaceutical composition of the present disclosure.
  • the SNCA is a mutant SNCA (e.g., human SNCA mutations including one or more of A53T, E46K, A30P, G51D, H50Q, A53E, A29S, A18T, and duplications and triplications of the gene locus).
  • expression and/or accumulation of a wild-type SNCA is also inhibited.
  • a cell comprises a vector (e.g., a vector comprising an expression construct encoding an RNAi of the present disclosure).
  • the vector is a rAAV vector.
  • the vector is a recombinant adenoviral vector, a recombinant lentiviral vector or a recombinant herpes simplex virus (HSV) vector.
  • the cell is a central nervous system (CNS) cell.
  • the cell is a HEK293 cell.
  • the administration of an effective amount of recombinant viral particles comprising a vector encoding an RNAi of the present disclosure transduces neurons (e.g., striatal neurons, such as spiny neurons) at or near the site of administration.
  • neurons e.g., striatal neurons, such as spiny neurons
  • more than about any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 100% of neurons are transduced.
  • about 5% to about 100%, about 10% to about 50%, about 10% to about 30%, about 25% to about 75%, about 25% to about 50%, or about 30% to about 50% of the neurons are transduced.
  • RNA detection e.g., qPCR, Northern blotting, RNA- seq, in situ hybridization, and the like
  • a co-expressed marker such as enhanced green fluorescent protein
  • the methods comprise administration to the brain of a mammal an effective amount of recombinant viral particles comprising a vector encoding an RNAi of the present disclosure for treating a mammal, e.g., a human, with a neurodegenerative synucleinopathy.
  • the composition is injected to one or more locations in the brain to allow expression of an RNAi of the present disclosure in at least the neurons.
  • the composition is injected into any one of one, two, three, four, five, six, seven, eight, nine, ten or more than ten locations in the brain.
  • the composition is injected into the striatum. In some embodiments, the composition is injected into the dorsal striatum. In some embodiments, the composition is injected into the putamen. In some embodiments, the composition is injected into the caudate nucleus. In some embodiments, the composition is injected into the putamen and into the caudate nucleus. In some embodiments, administration routes may include CSF delivery via intracerebroventricular, cisterna magna or intrathecal injection. In some embodiments, administration may also include intravenous delivery of the viral vector.
  • the recombinant viral particles are administered to one hemisphere of the brain. In some embodiments, the recombinant viral particles are administered to both hemispheres of the brain.
  • the recombinant viral particles are administered to more than one location simultaneously or sequentially. In some embodiment, multiple injections of recombinant viral particles are no more than one hour, two hours, three hours, four hours, five hours, six hours, nine hours, twelve hours or 24 hours apart. [0115] In some embodiments, the disclosure provides a method for treating a human with a neurodegenerative synucleinopathy by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an RNAi of the present disclosure to suppress the activity of a mutant SNCA. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.
  • the viral titer of the viral particles is about any of 5 x 10 12 to 6 x 10 12 , 6 x l0 12 to 7 x 10 12 , 7 x 10 12 to 8 x 10 12 , 8 x 10 12 to 9 x 10 12 , 9 x 10 12 to 10 x 10 12 , 10 x l0 12 to 11 x 10 12 , 11 x l0 12 to 15 x 10 12 , 15 x l0 12 to 20 x 10 12 , 20 x 10 12 to 25 x 10 12 , 25 x 10 12 to 30 x 10 12 , 30 x 10 12 to 50 x 10 12 , or 50 x 10 12 to 100 x 10 12 genome copies/mL.
  • the viral titer of the viral particles is about any of 5 x 10 12 to 10 x 10 12 , 10 x 10 12 to 25 x 10 12 , or 25 x 10 12 to 50 x l0 12 genome copies/mL.
  • the viral titer of the viral particles is at least about any of 5 x 10 9 , 6 x 10 9 , 7 x 10 9 , 8 x 10 9 , 9 x 10 9 , 10 x 10 9 , 11 x 10 9 , 15 x 10 9 , 20 x 10 9 , 25 x 10 9 , 30 x 10 9 , or 50 x 10 9 transducing units /mL.
  • the viral titer of the viral particles is about any of 5 x 10 9 to 6 x 10 9 , 6 x 10 9 to 7 x 10 9 , 7 x 10 9 to 8 x 10 9 , 8 x l0 9 to 9 x 10 9 , 9 x l0 9 to 10 x 10 9 , 10 x l0 9 to 11 x 10 9 , 11 x 10 9 to 15 x 10 9 , 15 x l 0 9 to 20 x 10 9 , 20 x l 0 9 to 25 x 10 9 , 25 x l 0 9 to 30 x 10 9 , 30 x 10 9 to 50 x 10 9 or 50 x 10 9 to 100 x 10 9 transducing units /mL.
  • the viral titer of the viral particles is about any of 5 x 10 9 to 10 x 10 9 , 10 x 10 9 to 15 x 10 9 , 15 x 10 9 to 25 x 10 9 , or 25 x 10 9 to 50 x 10 9 transducing units /mL.
  • the viral titer of the viral particles is at least any of about 5 x 10 10 , 6 x 10 10 , 7 x 10 10 , 8 x 10 10 , 9 x 10 10 , 10 x 10 10 , 11 x 10 10 , 15 x 10 10 , 20 x 10 10 , 25 x 10 10 , 30 x 10 10 , 40 x 10 10 , or 50 x 10 10 infectious units/mL.
  • the viral titer of the viral particles is at least any of about 5 x 10 10 to 6 x 10 10 , 6 x 10 10 to 7 x 10 10 , 7 x 10 10 to 8 x 10 10 , 8 x 10 10 to 9 x 10 10 , 9 x l0 10 to 10 x 10 10 , 10 x l0 10 to 11 x 10 10 , 1 1 x l0 10 to 15 x 10 10 , 15 x 10 10 to 20 x 10 10 , 20 x 10 10 to 25 x 10 10 , 25 x 10 10 to 30 x 10 10 , 30 x 10 10 to 40 x 10 10 , 40 x 10 10 to 50 x 10 10 , or 50 x 10 10 to 100 x 10 10 infectious units/mL.
  • the viral titer of the viral particles is at least any of about 5 x 10 10 to 10 x 10 10 , 10 x 10 10 to 15 x 10 10 , 15 x 10 10 to 25 x 10 10 , or 25 x 10 10 to 50 x 10 10 infectious units/mL.
  • the dose of viral particles administered to the individual is at least about any of 1 x 10 8 to about 1 x 10 13 genome copies/kg of body weight. In some embodiments, the dose of viral particles administered to the individual is about any of 1 x 10 8 to about 1 x 10 13 genome copies/kg of body weight.
  • the total amount of viral particles administered to the individual is at least about any of 1 x 10 9 to about 1 x 10 14 genome copies.
  • the total amount of viral particles administered to the individual is about any of 1 x 10 9 to about 1 x 10 14 genome copies.
  • the volume of the composition injected to the striatum is more than about any one of 1 m ⁇ , 2 m ⁇ , 3 m ⁇ , 4 m ⁇ , 5 m ⁇ , 6 m ⁇ , 7 m ⁇ , 8 m ⁇ , 9 m ⁇ , 10 m ⁇ , 15 m ⁇ , 20 m ⁇ , 25 m ⁇ , 50 m ⁇ , 75 m ⁇ , 100 m ⁇ , 200 m ⁇ , 300 m ⁇ , 400 m ⁇ , 500 m ⁇ , 600 m ⁇ , 700 m ⁇ , 800 m ⁇ , 900 m ⁇ , or 1 mL, or any amount there in between.
  • a first volume of the composition is injected into a first region of the brain, and a second volume of the composition is injected into a second region of the brain.
  • a first volume of the composition is injected into the caudate nucleus, and a second volume of the composition is injected into the putamen.
  • a IX volume of the composition is injected into the caudate nucleus, and a 1.5X, 2X, 2.5X, 3X, 3.5X, or 4X volume of the composition is injected into the putamen, where X is a volume that is more than about any one of 1 m ⁇ , 2 m ⁇ , 3 m ⁇ , 4 m ⁇ , 5 m ⁇ , 6 m ⁇ , 7 m ⁇ , 8 m ⁇ , 9 m ⁇ , 10 m ⁇ , 15 m ⁇ , 20 m ⁇ , 25 m ⁇ , 50 m ⁇ , 75 m ⁇ , 100 m ⁇ , 200 m ⁇ , 300 m ⁇ , 400 m ⁇ , 500 m ⁇ , 600 m ⁇ , 700 m ⁇ , 800 m ⁇ , 900 m ⁇ , or 1 mL, or any amount therebetween.
  • the disclosure provides expression constructs, vectors and viral particles for expression of the RNAi described herein.
  • nucleic acid encoding an RNAi of the present disclosure comprises a heterologous miRNA scaffold.
  • use of a heterologous miRNA scaffold is used to modulate miRNA expression; for example, to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art may be used.
  • the miRNA scaffold is derived from a miR-l 55 scaffold (see, e.g., Lagos-Quintana, M. el al. (2002) Curr. Biol. 12:735-9 and the InvitrogenTM BLOCK-iTTM Pol II miR RNAi expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA).
  • nucleic acid encoding an RNAi of the present disclosure comprises a miRNA scaffold.
  • miRNA scaffold comprises the sequence
  • the miRNA in the scaffold comprises the sequence
  • the RNAi targets RNA encoding a polypeptide associated with a neurodegenerative synucleinopathy.
  • the polypeptide is alpha-synuclein.
  • an RNAi may be used to reduce or eliminate the expression and/or activity of a polypeptide whose gain-of-function has been associated with a neurodegenerative synucleinopathy.
  • the promoter comprises a human b-glucuronidase promoter or a cytomegalovirus enhancer linked to a chicken b-actin (CBA) promoter.
  • the promoter can be a constitutive, inducible or repressible promoter.
  • the disclosure provides a recombinant vector comprising nucleic acid encoding a heterologous transgene of the present disclosure operably linked to a CBA promoter. Exemplary promoters and descriptions may be found, e.g., in U.S. PG Pub. 20140335054.
  • the promoter is a CBA promoter, a minimum CBA promoter, a CMV promoter or a GUSB promoter.
  • the promoter is a hEFla promoter.
  • constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41 :52l-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the l3-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen]
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • PGK phosphoglycerol kinase
  • Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only.
  • Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art.
  • inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al, Proc. Natl. Acad. Sci.
  • MT zinc-inducible sheep metallothionine
  • Dex dexamethasone
  • MMTV mouse mammary tumor virus
  • T7 polymerase promoter system WO 98/10088
  • ecdysone insect promoter No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)
  • inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.
  • the native promoter, or fragment thereof, for the transgene will be used.
  • the native promoter may be preferred when it is desired that expression of the transgene should mimic the native expression.
  • the native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissue- specific manner, or in response to specific transcriptional stimuli.
  • other native expression control elements such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.
  • the regulatory sequences impart tissue-specific gene expression capabilities.
  • the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner.
  • tissue-specific regulatory sequences e.g., promoters, enhancers, etc.
  • tissue-specific regulatory sequences are well known in the art.
  • tissue-specific regulatory sequences include, but are not limited to the following tissue specific promoters: neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol, 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)).
  • NSE neuron-specific enolase
  • the tissue-specific promoter is a promoter of a gene selected from: neuronal nuclei (NeuN), glial fibrillary acidic protein (GFAP), adenomatous polyposis coli (APC), and ionized calcium-binding adapter molecule 1 (Iba-l).
  • GFAP glial fibrillary acidic protein
  • APC adenomatous polyposis coli
  • Iba-l ionized calcium-binding adapter molecule 1
  • the promoter is a chicken Beta-actin promoter.
  • the promoter expresses the heterologous nucleic acid in a cell of the CNS.
  • a therapeutic polypeptide or a therapeutic nucleic acid of the disclosure may be used to treat a disorder of the CNS.
  • the promoter expresses the heterologous nucleic acid in a brain cell.
  • a brain cell may refer to any brain cell known in the art, including without limitation a neuron (such as a sensory neuron, motor neuron, interneuron, dopaminergic neuron, medium spiny neuron, cholinergic neuron, GABAergic neuron, pyramidal neuron, etc.), a glial cell (such as microglia, macroglia, astrocytes, oligodendrocytes, ependymal cells, radial glia, etc.), a brain parenchyma cell, microglial cell, ependemal cell, and/or a Purkinje cell.
  • the promoter expresses the heterologous nucleic acid in a neuron and/or glial cell.
  • the neuron is a medium spiny neuron of the caudate nucleus, a medium spiny neuron of the putamen, a neuron of the cortex layer IV and/or a neuron of the cortex layer V.
  • promoters that express transcripts e.g ., a heterologous transgene
  • Such promoters can comprise control sequences normally associated with the selected gene or heterologous control sequences.
  • useful heterologous control sequences include those derived from sequences encoding mammalian or viral genes.
  • Examples include, without limitation, the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP), a herpes simplex virus (HSV) promoter, a cytomegalovirus (CAW) promoter such as the CMV immediate early promoter region (CMV1E), a rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like.
  • sequences derived from nonviral genes such as the murine metallothionem gene, may also be used.
  • Such promoter sequences are commercially available from, e.g., Stratagene (San Diego, CA).
  • CNS-specific promoters and inducible promoters may be used.
  • CNS-specific promoters include without limitation those isolated from CNS-specific genes such as myelin basic protein (MBP), glial fibrillar ⁇ ' acid protein (GFAP), and neuron specific enolase (NSE).
  • MBP myelin basic protein
  • GFAP glial fibrillar ⁇ ' acid protein
  • NSE neuron specific enolase
  • inducible promoters include DNA responsive elements for ecdysone, tetracycline, nietallothionein, and hypoxia, inter alia.
  • the present disclosure contemplates the use of a recombinant viral genome for introduction of one or more nucleic acid sequences encoding for a RNAi as described herein or packaging into an AAV viral particle.
  • the recombinant viral genome may include any element to establish the expression of a RNAi, for example, a promoter, a heterologous nucleic acid, an ITR, a ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal, and/or origin of replication.
  • the rAAV vector comprises one or more of an enhancer, a splice donor/splice acceptor pair, a matrix attachment site, or a polyadenylation signal.
  • the administration of an effective amount of rAAV particles comprising a vector encoding a RNAi transduces cells (e.g., CNS cells, brain cells, neurons, and/or glial cells) at or near the site of administration (e.g., the striatum and/or cortex) or more distal to the site of administration.
  • a RNAi transduces cells e.g., CNS cells, brain cells, neurons, and/or glial cells
  • the site of administration e.g., the striatum and/or cortex
  • more distal to the site of administration e.g., more distal to the site of administration.
  • RNA detection e.g, qPCR, Northern blotting, RNA-seq, in situ hybridization, and the like
  • a co-expressed marker such as enhanced green fluorescent protein
  • the disclosure provides viral particles comprising a recombinant self complementing genome (e.g, a self-complementary rAAV vector).
  • a recombinant self complementing genome e.g, a self-complementary rAAV vector.
  • AAV viral particles with self-complementing vector genomes and methods of use of self-complementing AAV genomes are described in US Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154;
  • a rAAV comprising a self complementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g ., complementing coding and non-coding strands of a heterologous nucleic acid).
  • the vector comprises first nucleic acid sequence encoding the heterologous nucleic acid and a second nucleic acid sequence encoding a complement of the nucleic acid, where the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.
  • the first heterologous nucleic acid sequence encoding a RNAi and a second heterologous nucleic acid sequence encoding the complement of the RNAi are linked by a mutated ITR (e.g., the right ITR).
  • the ITR comprises the polynucleotide sequence 5’-CACTCCCTCTCTGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3’ (SEQ ID NO: 69).
  • the mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence.
  • a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR.
  • the disclosure provides, inter alia, recombinant viral particles comprising a nucleic acid encoding an RNAi of the present disclosure, as well as methods of use thereof to treat a disease or disorder in a mammal; e.g., a neurodegenerative synucleinopathy.
  • the disclosure provides viral particles comprising the RNAi as disclosed herein.
  • the disclosure provides viral particles for delivering the RNAi of the disclosure as disclosed herein.
  • the disclosure provides methods of using recombinant viral particles to deliver RNAi to treat a disease or disorder in a mammal; e.g., rAAV particles comprising RNAi to treat a neurodegenerative synucleinopathy.
  • the recombinant viral particle is a recombinant AAV particle.
  • the viral particle is a recombinant AAV particle comprising a nucleic acid comprising a sequence an RNAi of the present disclosure flanked by one or two ITRs.
  • the nucleic acid is encapsidated in the AAV particle.
  • the AAV particle also comprises capsid proteins.
  • the nucleic acid comprises the coding sequence(s) of interest (e.g ., nucleic acid an RNAi of the present disclosure) operatively linked components in the direction of transcription, control sequences including transcription initiation and termination sequences, thereby forming an expression construct.
  • the expression construct is flanked on the 5' and 3' end by at least one functional AAV ITR sequences.
  • By“functional AAV ITR sequences” it is meant that the ITR sequences function as intended for the rescue, replication and packaging of the AAV virion.
  • the recombinant vectors comprise at least all of the sequences of AAV essential for
  • AAV ITRs for use in the vectors of the disclosure need not have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801), and may be altered by the insertion, deletion or substitution of nucleotides or the AAV ITRs may be derived from any of several AAV serotypes. More than 40 serotypes of AAV are currently known, and new serotypes and variants of existing serotypes continue to be identified.
  • a rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471 A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like.
  • AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471 A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like.
  • the nucleic acid in the AAV comprises an ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV 10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like.
  • the nucleic acid in the AAV further encodes an RNAi as described herein.
  • the rAAV particle comprise an AAV1, an AAV2HBKO capsid (e.g., as described in WO2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an OligOOl capsid.
  • the nucleic acid in the AAV can comprise at least one ITR of any AAV serotype contemplated herein and can further encode an RNAi comprising a first strand and a second strand, wherein a) the first strand and the second form a duplex; b) the first strand comprises a guide region, and c) the second strand comprises a non-guide region, wherein the non-guide region comprises a two nucleotide deletion at bases 9 and 10 to create bulge in the guide strand.
  • the rAAV can comprise a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ (SEQ ID NO: 53).
  • the rAAV can comprise a first strand comprising a first nucleic acid comprising the sequence 5’- ETGGGCACAETUGGAACUGAGCA-3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid comprising the sequence 5’- ETGCETCAGIJCAAIJGIJGCCIJA-3’ (SEQ ID NO:37).
  • the nucleic acid in the AAV comprises 5’ to 3’ nucleic acid encoding the following: an ITR (e.g ., an AAV2 ITR), a promoter, a nucleic acid encoding an RNAi as disclosed herein, a polyadenylation signal, and an AAV ITR (e.g., an AAV2 ITR).
  • an ITR e.g ., an AAV2 ITR
  • a promoter e.g., a promoter
  • a nucleic acid encoding an RNAi as disclosed herein e.g., a polyadenylation signal
  • an AAV ITR e.g., an AAV2 ITR
  • the nucleic acid in the AAV comprises 5’ to 3’ nucleic acid encoding the following: an ITR (e.g., an AAV2 ITR), a promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGAGUA-3’ (SEQ ID NO: 53), a polyadenylation signal, and an AAV ITR (e.g., an AAV2 ITR).
  • an ITR e.g., an AAV2 ITR
  • a promoter e.g., a promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUC
  • the nucleic acid in the AAV comprises 5’ to 3’ nucleic acid encoding the following: an ITR (e.g., an AAV2 ITR), a promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid comprising the sequence 5’- UGCUCAGUCAAUGUGCCUA-3’ (SEQ ID NO:37), a polyadenylation signal, and an AAV ITR (e.g., an AAV2 ITR).
  • an ITR e.g., an AAV2 ITR
  • a promoter e.g., a promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCACAUUGGAACUGAGCA
  • the nucleic acid in the AAV comprises 5’ to 3’ nucleic acid encoding the following: an ITR (e.g., an AAV2 ITR), a CBA promoter, a nucleic acid encoding an RNAi as disclosed herein, a polyadenylation signal (e.g., a bovine growth hormone poly A), and an AAV ITR (e.g., an AAV2 ITR).
  • an ITR e.g., an AAV2 ITR
  • CBA promoter e.g., an AAV2 ITR
  • RNAi e.g., a polyadenylation signal
  • a bovine growth hormone poly A e.g., a bovine growth hormone poly A
  • the RNAi is selected from Table 1.
  • the nucleic acid in the AAV comprises 5’ to 3’ nucleic acid encoding the following: an ITR (e.g ., an AAV2 ITR), a CBA promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid comprising the sequence 5’- GGCUGAGAACCAAAGAGUA-3’ (SEQ ID NO:53), a polyadenylation signal (e.g., a bovine growth hormone poly A), and an AAV ITR (e.g., an AAV2 ITR).
  • an ITR e.g ., an AAV2 ITR
  • CBA promoter e.g a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5
  • the nucleic acid in the AAV comprises 5’ to 3’ nucleic acid encoding the following: an ITR (e.g., an AAV2 ITR), a CBA promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5’- UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid comprising the sequence 5’- UGCUCAGUCAAUGUGCCUA -3’ (SEQ ID NO:37), a polyadenylation signal (e.g., a bovine growth hormone poly A), and an AAV ITR (e.g., an AAV2 ITR).
  • the first and second strands are selected from Table 1.
  • a vector may include a stuffer nucleic acid.
  • the stuffer nucleic acid may encode a green fluorescent protein.
  • the stuffer nucleic acid may be located between the promoter and the nucleic acid encoding the RNAi.
  • the stuffer nucleic acid is an Al AT stuffer nucleic acid.
  • the nucleic acid in the AAV comprises the nucleic acid of SEQ ID NO: 65.
  • the nucleic acid in the AAV comprises a nucleic acid that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 65.
  • the rAAV particle comprises capsid proteins of AAV1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9, AAVrh.8, AAVrh8R, AAVrh. lO, AAV11, AAV12, or mutants of these capsid proteins.
  • a mutant capsid protein maintains the ability to form an AAV capsid.
  • the rAAV particle comprises AAV5 tyrosine mutant capsid (Zhong L. et al, (2008) Proc Natl Acad Sci USA l05(22):7827-7832.
  • the rAAV particle comprises capsid proteins of an AAV serotype from Clades A-F (Gao, et al, J. Virol 2004, 78(l2):638l). [0143] Different AAV serotypes are used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g ., a diseased tissue).
  • a rAAV particle can comprise viral proteins and viral nucleic acids of the same serotype or a mixed serotype.
  • a rAAV particle can comprise AAV1 capsid proteins and at least one AAV2 ITR or it can comprise AAV2 capsid proteins and at least one AAV1 ITR. Any combination of AAV serotypes for production of a rAAV particle is provided herein as if each combination had been expressly stated herein.
  • the invention provides rAAV particles comprising an AAV1 capsid and a rAAV vector of the present disclosure (e.g., an expression construct comprising nucleic acid encoding an RNAi of the present disclosure), flanked by at least one AAV2 ITR.
  • the invention provides rAAV particles comprising an AAV2 capsid.
  • the rAAV particle comprise an AAV1, an AAV2HBKO capsid (e.g., as described in WO2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an OligOOl.
  • the invention provides viral particles comprising a recombinant self complementing genome.
  • AAV viral particles with self-complementing genomes and methods of use of self-complementing AAV genomes are described in US Patent Nos. 6,596,535;
  • a rAAV comprising a self-complementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a transgene).
  • the invention provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heterologous polynucleotide sequence (e.g., an RNAi of the present disclosure) and a second heterologous polynucleotide sequence (e.g., antisense strand of an RNAi of the present disclosure) wherein the first heterologous polynucleotide sequence can form intrastrand base pairs with the second polynucleotide sequence along most or all of its length.
  • a first heterologous polynucleotide sequence e.g., an RNAi of the present disclosure
  • a second heterologous polynucleotide sequence e.g., antisense strand of an RNAi of the present disclosure
  • the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a sequence that facilitates intrastrand basepairing; e.g., a hairpin DNA structure. Hairpin structures are known in the art, for example in miRNA or siRNA molecules.
  • the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a mutated ITR (e.g., the right ITR).
  • the ITR comprises the polynucleotide sequence
  • the mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence.
  • a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologous
  • the invention provides AAV viral particles comprising a recombinant viral genome comprising a functional AAV2 ITR, a first polynucleotide sequence encoding an RNAi of the present disclosure, a mutated AAV2 ITR comprising a deletion of the D region and lacking a functional terminal resolution sequence, a second polynucleotide sequence comprising the complementary sequence to the sequence encoding an RNAi of the present disclosure, of the first polynucleotide sequence and a functional AAV2 ITR.
  • rAAV particles can be produced using methods known in the art. See, e.g., U.S. Pat. Nos. 6,566,118; 6,989,264; and 6,995,006.
  • host cells for producing rAAV particles include mammalian cells, insect cells, plant cells, microorganisms and yeast.
  • Host cells can also be packaging cells in which the AAV rep and cap genes are stably maintained in the host cell or producer cells in which the AAV vector genome is stably maintained.
  • Exemplary packaging and producer cells are derived from 293, A549 or HeLa cells.
  • AAV vectors are purified and formulated using standard techniques known in the art.
  • Methods known in the art for production of rAAV vectors include but are not limited to transfection, stable cell line production, and infectious hybrid virus production systems which include adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al, (1997) J.
  • rAAV production cultures for the production of rAAV virus particles all require; 1) suitable host cells, including, for example, human-derived cell lines such as HeLa, A549, or 293 cells, or insect-derived cell lines such as SF-9, in the case of baculovirus production systems; 2) suitable helper virus function, provided by wild-type or mutant adenovirus (such as temperature sensitive adenovirus), herpes virus, baculovirus, or a plasmid construct providing helper functions; 3) AAV rep and cap genes and gene products; 4) a nucleic acid (such as a therapeutic nucleic acid) flanked by at least one AAV ITR sequences ; and 5) suitable media and media components to support rAAV production.
  • suitable host cells including, for example, human-derived cell lines such as HeLa, A549, or 293 cells, or insect-derived cell lines such as SF-9, in the case of baculovirus production systems
  • suitable helper virus function provided by wild-type or mutant
  • the AAV rep and cap gene products may be from any AAV serotype.
  • the AAV rep gene product is of the same serotype as the ITRs of the rAAV vector genome as long as the rep gene products may function to replicated and package the rAAV genome.
  • Suitable media known in the art may be used for the production of rAAV vectors. These media include, without limitation, media produced by Hyclone Laboratories and JRH including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom formulations such as those described in U.S. Patent No. 6,566,118, and Sf-900 II SFM media as described in U.S. Patent No.
  • the AAV helper functions are provided by adenovirus or HSV.
  • the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).
  • rAAV particles may be produced by a triple transfection method, such as the exemplary triple transfection method provided infra. Briefly, a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid, may be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and virus may be collected and optionally purified.
  • a triple transfection method such as the exemplary triple transfection method provided infra.
  • a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid may be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and virus may be collected and optionally purified.
  • the rAAV particle was produced by triple transfection of a nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions into a host cell, wherein the transfection of the nucleic acids to the host cells generates a host cell capable of producing rAAV particles.
  • rAAV particles may be produced by a producer cell line method, such as the exemplary producer cell line method provided infra (see also (referenced in Martin et al., (2013) Human Gene Therapy Methods 24:253-269).
  • a cell line e.g., a HeLa cell line
  • a cell line may be stably transfected with a plasmid containing a rep gene, a capsid gene, and a promoter-heterologous nucleic acid sequence.
  • Cell lines may be screened to select a lead clone for rAAV production, which may then be expanded to a production bioreactor and infected with an adenovirus (e.g ., a wild- type adenovirus) as helper to initiate rAAV production.
  • adenovirus e.g ., a wild- type adenovirus
  • Virus may subsequently be harvested, adenovirus may be inactivated (e.g., by heat) and/or removed, and the rAAV particles may be purified.
  • the rAAV particle was produced by a producer cell line comprising one or more of nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions.
  • a method for producing any rAAV particle as disclosed herein comprising (a) culturing a host cell under a condition that rAAV particles are produced, wherein the host cell comprises (i) one or more AAV package genes, wherein each said AAV packaging gene encodes an AAV replication and/or encapsidation protein; (ii) an rAAV pro vector comprising a nucleic acid encoding an RNAi of the present disclosure as described herein flanked by at least one AAV ITR, and (iii) an AAV helper function; and (b) recovering the rAAV particles produced by the host cell.
  • the RNAi comprises the nucleotide sequence of SEQ ID NO:6l (FIG. 1A) or SEQ ID NO:63 (FIG. 1B).
  • said at least one AAV ITR is selected from the group consisting of AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471 A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype ITRs or the like.
  • said encapsidation protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., a wild-type AAV6 capsid, or a variant AAV6 capsid such as ShHlO, as described in U.S. PG Pub. 2012/0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g, a wild-type AAV9 capsid, or a modified AAV9 capsid as described in U.S. PG Pub.
  • AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 e.g., a wild-type AAV6 capsid, or a variant AAV6 capsid such as ShHlO, as described in U.S. PG Pub. 2012/0164106
  • AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 e.g, a wild-type AAV
  • AAV DJ capsid e.g., an AAV-DJ/8 capsid, an AAV- DJ/9 capsid, or any other of the capsids described in U.S. PG Pub.
  • AAV2 N587A capsid AAV2 E548A capsid
  • AAV2 N708A capsid AAV V708K capsid
  • goat AAV capsid AAV1/AAV2 chimeric capsid
  • bovine AAV capsid mouse AAV capsid
  • the AAV capsid is an AAV2HBKO capsid as described in WO2015168666.
  • the AAV capsid is an AAV9 capsid.
  • the AAV capsid is a PHP.B, PHP.eB or an OligOOl capsid.
  • a mutant capsid protein maintains the ability to form an AAV capsid.
  • the encapsidation protein is an AAV5 tyrosine mutant capsid protein.
  • the rAAV particle comprises capsid proteins of an AAV serotype from Clades A-F.
  • the rAAV particles comprise an AAV1 capsid and a recombinant genome comprising AAV2 ITRs and nucleic acid encoding an RNAi of the present disclosure.
  • the rAAV particles are purified.
  • the term“purified” as used herein includes a preparation of rAAV particles devoid of at least some of the other components that may also be present where the rAAV particles naturally occur or are initially prepared from.
  • isolated rAAV particles may be prepared using a purification technique to enrich it from a source mixture, such as a culture lysate or production culture supernatant.
  • Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase-resistant particles (DRPs) or genome copies (gc) present in a solution, or by infectivity, or it can be measured in relation to a second, potentially interfering substance present in the source mixture, such as contaminants, including production culture contaminants or in- process contaminants, including helper virus, media components, and the like.
  • DNase-resistant particles DNase-resistant particles
  • gc genome copies
  • adenoviral vector particles For a gutted adenoviral vector, the adenoviral vector genome and a helper adenovirus genome may be transfected into a packaging cell line (e.g ., a 293 cell line).
  • the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes may be transfected into a packaging cell line that expresses a recombinase (e.g., the Cre/loxP system may be used), such that the adenoviral vector of interest is packaged more efficiently than the helper adenovirus (see, e.g., Alba, R. et al. (2005) Gene Ther. 12 Suppl TS18-27).
  • Adenoviral vectors may be harvested and purified using standard methods, such as those described herein.
  • lentiviral vector particles Numerous methods are known in the art for production of lentiviral vector particles.
  • a vector containing the lentiviral genome of interest with gag and pol genes may be co-transfected into a packaging cell line (e.g., a 293 cell line) along with a vector containing a rev gene.
  • the lentiviral genome of interest also contains a chimeric LTR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. 72:8463-71).
  • Lentiviral vectors may be harvested and purified using methods ( e.g .,
  • HSV vectors may be harvested and purified using standard methods, such as those described herein.
  • an HSV genome of interest that lacks all of the immediate early (IE) genes may be transfected into a complementing cell line that provides genes required for virus production, such as ICP4, ICP27, and ICP0 (see, e.g., Samaniego, L.A. et al. (1998) J. Virol. 72:3307-20).
  • HSV vectors may be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology 1144:63-79).
  • compositions comprising a recombinant viral particle comprising a transgene encoding an RNAi of the present disclosure and a pharmaceutically acceptable carrier.
  • the pharmaceutical compositions may be suitable for any mode of administration described herein.
  • a pharmaceutical composition of a recombinant viral particle comprising a nucleic acid encoding an RNAi of the present disclosure can be introduced to the brain.
  • a recombinant viral particle comprising a nucleic acid encoding an RNAi of the present disclosure can be administered intrastriatally. Any of the recombinant viral particles of the present disclosure may be used, including rAAV, adenoviral, lentiviral, and HSV particles.
  • the pharmaceutical compositions comprising a recombinant viral particle comprising a transgene encoding an RNAi of the present disclosure described herein and a pharmaceutically acceptable carrier is suitable for administration to human.
  • Such carriers are well known in the art (see, e.g., Remington's Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 and 1570-1580).
  • the pharmaceutical compositions comprising a rAAV described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).
  • the pharmaceutical compositions comprising a recombinant lentiviral particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).
  • the pharmaceutical compositions comprising a recombinant adenoviral particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal ( e.g ., intrastriatal administration).
  • the pharmaceutical compositions comprising a recombinant HSV particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).
  • Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like. Saline solutions and aqueous dextrose, polyethylene glycol (PEG) and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • the pharmaceutical composition may further comprise additional ingredients, for example preservatives, buffers, tonicity agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, viscosity-increasing agents, and the like.
  • the pharmaceutical compositions described herein can be packaged in single unit dosages or in multidosage forms. The compositions are generally formulated as sterile and substantially isotonic solution.
  • kits or articles of manufacture for use in the methods described herein.
  • the kits comprise the compositions described herein (e.g., a recombinant viral particle of the present disclosure, such as a rAAV particle comprising nucleic acid encoding an RNAi of the present disclosure) in suitable packaging.
  • suitable packaging for compositions (such as intrastriatal compositions) described herein are known in the art, and include, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and/or sealed.
  • kits comprising compositions described herein and may further comprise instruction(s) on methods of using the composition, such as uses described herein.
  • the kits described herein may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing any methods described herein.
  • the kit comprises a composition of recombinant viral particles comprising a transgene encoding an RNAi of the present disclosure for delivery of at least 1 x 10 9 genome copies into the brain of a mammal ( e.g ., through intrastriatal administration) to a primate as described herein, a pharmaceutically acceptable carrier suitable for injection into the brain of a primate, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing injections into the brain of a primate (e.g., intrastriatal administration).
  • the kit comprising instructions for treating a
  • the kit comprising instructions for using the recombinant viral particles described herein according to any one of the methods described herein
  • RNAi comprising a first strand and a second strand, wherein a) the first strand and the second strand form a duplex; b) the first strand comprises a guide region, wherein the guide region comprises a nucleic acid having at least about 90% identity to the sequence 5’- UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) or at least about 90% identity to the sequence 5’-UGGGCACAUUGGAACUGAGCA-3’ (SEQ ID NO:8); and c) the second strand comprises a non-guide region.
  • RNAi of embodiment 1, wherein the guide region comprises the nucleic acid sequence 5’-UGCUCUUUGGUCUUCUCAGCC-3’ (SEQ ID NO:24) and the non-guide region comprises the sequence 5’- GGCUGAGAACCAAAGAGUA-3’ (SEQ ID NO:53).
  • RNAi of embodiment 1, wherein the first strand comprises a nucleic acid sequence having about 90% identity to SEQ ID NO:24 or about 90% identity to SEQ ID NO: 53.
  • RNAi of embodiment 1, wherein the second strand comprises a nucleic acid sequence having about 90% identity to SEQ ID NO:37 or about 90% identity to SEQ ID NO:37.
  • RNA linker capable of forming a loop structure.
  • RNAi of embodiment 6 or 7, wherein the loop structure comprises 4 to 20 nucleotides.
  • RNAi of any one of embodiments 6-8, wherein the RNAi comprises 5’ to 3’ the second strand, the RNA linker, and the first strand.
  • RNAi of any one of embodiments 6-8, wherein the RNAi comprises 5’ to 3’ the first strand, the RNA linker, and the second strand.
  • RNAi of embodiment 10 wherein the RNAi comprises the nucleic acid sequence of SEQ ID NO:6l or SEQ ID NO:63.
  • RNAi of embodiment 11 wherein the RNAi comprises a nucleotide sequence about 90% identical to the nucleotide sequence of SEQ ID NO: 61 or SEQ ID NO:63.
  • RNAi any one of embodiments 1-12, wherein the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA).
  • siRNA small inhibitory RNA
  • miRNA microRNA
  • shRNA small hairpin RNA
  • RNAi of embodiment 14, wherein the polypeptide is alpha-synuclein
  • RNAi of embodiment 15, wherein the alpha synuclein is human alpha- synuclein.
  • PD Parkinson’s disease
  • MSA multiple system atropy
  • DLB dementia with Lewy bodies
  • RNAi comprises a miRNA scaffold.
  • cytomegalovirus (CMV) immediate early promoter an RS V LTR, a MoMLV LTR, a phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter, a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, a chimeric liver-specific promoter (LSP), an E2F promoter, a telomerase (hTERT) promoter; a cytomegalovirus enhancer/chicken beta-actin/Rabbit b-globin promoter (CAG) promoter, an elongation factor 1- alpha promoter (EFl-alpha) promoter, a human b-glucuronidase promoter
  • CMV cytomegalovirus
  • RS V LTR RS V L
  • polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or a HSV TK polyadenylation signal.
  • polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or a HSV TK polyadenylation signal.
  • a vector comprising the expression construct of any one of embodiments 18-27.
  • rAAV vector of embodiment 36 wherein the vector comprises first nucleic acid sequence encoding the RNAi and a second nucleic acid sequence encoding a complement of the RNAi, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.
  • a cell comprising the rAAV vector of any one of embodiments 29-38.
  • a recombinant AAV particle comprising the rAAV vector of any one of embodiments 29-38.
  • the rAAV particle of embodiment 40 wherein the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2/2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B,
  • AAVPHP.eB AAVBR1, AAVHSC15, AAVHSC17, a goat AAV, AAV1/AAV2 chimeric, bovine AAV, or mouse AAV capsid rAAV2/HBoVl serotype capsid.
  • composition comprising the rAAV particle of any one of embodiments 40-44.
  • composition of embodiment 45 wherein the composition further comprises a pharmaceutically acceptable carrier.
  • kits comprising the RNAi of any one of embodiments 1-17.
  • a kit comprising the AAV particle of any one of embodiments 40-44.
  • 51. A method for treating a neurodegenerative synucleinopathy in a mammal comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’-
  • UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) or a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’-
  • nucleic acid having at least about 90% identity to the sequence the sequence 5’- GGCUGAGAACCAAAGAGUA-3’ SEQ ID NO: 53
  • nucleic acid having at least about 90% identity to the sequence 5’- El passenger-3’ SEQ ID NO:37.
  • a method for treating a neurodegenerative synucleinopathy in a mammal comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’-
  • a method for inhibiting the expression of alpha-synuclein in a mammal with a neurodegenerative disease comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) or a first strand comprising a nucleic acid having at least about 90% identity to the sequence 5’- UGGGCACAUUGGAACUGAGCA -3’ (SEQ ID NO: 8), and a second strand comprising a second nucleic acid.
  • nucleic acid having at least about 90% identity to the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ SEQ ID NO: 53
  • nucleic acid having at least about 90% identity to the sequence 5’- UGCUCAGUCAAUGUGCCUA -3’ SEQ ID NO:37.
  • a method for inhibiting the expression of alpha-synuclein in a mammal with a neurodegenerative disease comprising administering to the mammal an RNAi comprising a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGCUCUUUGGUCUUCUCAGCC -3’ (SEQ ID NO:24) and a second strand comprising a second nucleic acid having at least about 90% identity to the sequence 5’- GGCUGAGAACCAAAGAGUA -3’ (SEQ ID NO: 53) or a first strand comprising a first nucleic acid having at least about 90% identity to the sequence 5’- UGGGCACAUUGGAACUGAGCA -3’ (SEQ ID NO: 8) and a second strand comprising a second nucleic acid having at least about 90% identity to the sequence 5’- UGCUCAGUCAAUGUGCCUA -3’ (SEQ ID NO:37).
  • RNA linker comprises from 4 to 50 nucleotides.
  • RNAi comprises the nucleic acid sequence of SEQ ID NO:6l or SEQ ID NO:63.
  • RNAi comprises a nucleotide sequence about 90% identical to the nucleotide sequence of SEQ ID NO:6l or SEQ ID NO:63.
  • RNAi in the brain of a mammal RNAi in the brain of a mammal.
  • PGK phosphoglycerate kinase- 1
  • SV40 simian virus 40
  • CK6 transthyretin promoter
  • TTR transthyretin promoter
  • TK tetracycline responsive promoter
  • HBV HBV promoter
  • LSP LSP promoter
  • LSP chimeric liver-specific promoter
  • E2F E2F promoter
  • hTERT telomerase promoter
  • CAG cytomegalovirus enhancer/chicken beta-actin/Rabbit b-globin
  • EFl-alpha elongation factor 1 -alpha promoter
  • human b-glucuronidase promoter phosphoglycerate kinase- 1 promoter
  • nucleic acid further comprises a polyadenylation signal.
  • AAV2 ITR a promoter, an intron, nucleic acid encoding the RNAi, a polyadenylation signal, and an AAV2 ITR.
  • AAV2 ITR the CBA promoter, a chimeric intron, nucleic acid encoding the RNAi, a bovine growth hormone polyadenylation signal, and an AAV2 ITR.
  • the vector comprises first nucleic acid sequence encoding the RNAi and a second nucleic acid sequence encoding a complement of the RNAi, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.
  • composition further comprises a pharmaceutically acceptable carrier.
  • Example 1 shmiRNA reduces human SNCA target in vitro.
  • HEK293T cells were transfected with plasmids encoding candidate RNAi sequences and a plasmid encoding the human SNCA cDNA A (NM_000345.3) under the control of a cytomegalovirus enhancer and hEFla promoter/intron and followed by a Tbgh polyA sequence.
  • SNCA cDNA and miRNA plasmids were co-transfected.
  • RNAi sequences were designed internally to have maximum homology to human/macaque/mouse SNCA, while balancing this with low-off targeting potential.
  • siRNAs were synthesized by Sigma. Off targets in the human transcriptome were predicted using the siSPOTR algorithm (world wide web at https://sispotr.icts.uiowa.edu/ sispotr/tools.html).
  • RNAi sequences targeting SNCA were embedded within the murine mirl55 scaffold driven by a cytomegalovirus enhancer and hEFla promoter/intron. RNAi sequences can be found in Table 1.
  • HEK293T cells were grown to -70-90% confluency in DMEM + 10% FBS + pen/strep. Cells were transfected with Lipfectamine 2000 (for miRNA format plasmids) or RNAiMAX (for siRNA format). Three days post-transfection, cells were rinsed with phosphate buffered saline, whole cell extracts were prepared by cell lysis in reducing Laemmli buffer and were boiled for 5 minutes before storage at -20°C.
  • Antibodies used Alpha-synuclein (BD 610787), GAPDH (Sigma G8795), Tubulin (BioLegend MMS-435P-100). HRP-goat anti-mouse or rabbit (CST 7076). Results
  • shmiRNAs reduced human SNCA protein levels in vitro. With 19/27 sequences showing more than 50% reduction in protein levels.
  • Example 2 shmiRNA reduces mouse SNCA target in vitro.
  • the indicated miRNAs reduced mouse SNCA protein levels in vitro with 14/27 sequences showing greater than 50% reduction in protein levels.
  • Example 3 siRNA reduces human and mouse SNCA target in vitro.
  • HEK293T cells were grown to -70-90% confluency in DMEM + 10% FBS + pen/step. Cells were transfected with Lipfectamine 2000 (for miRNA format plasmids) or RNAiMAX (for siRNA format). Three days post-transfection, cells were rinsed with phosphate buffered saline, whole cell extracts were prepared by cell lysis in reducing Laemmli buffer and were boiled for 5 minutes before storage at -20°C.
  • siRNAs reduced human and mouse SNCA levels in vitro as would be expected based on their performance in the miRNA format.
  • Example 4 Toxicity and neuroprotection properties of RNAi indicated.
  • LUHMES cells (ATCC CRL-2927) cells were grown and differentiated as described in (10) with some modifications to allow for electroporation of plasmid DNA. Briefly, LUHMES cells were subcultured in proliferation media (10) on flasks coated with poly-L- ornithine and fibronectin. Differentiation into dopaminergic cells was initiated by the addition differentiation media (10). Cells were dissociated 2 days later, electroporated (LONZA 4D NucleofectorTM X system according to the manufacturer’s instructions) with the desired DNA, and replated in 96 well plates in recovery media to minimize electroporation toxicity. 4 hours post transfection, media was changed back to differentiation media. Cells were treated and collected at the indicated days post-transfection for specific experiments.
  • LUHMES cells prepared as above were treated with the indicated concentrations of rotenone at day 6 of differentiation (day 4 of transfection).
  • Cell viability was measured using the Cell Titer Blue ® assay as per manufacturer’s instructions (Promega) 48 hours following treatment with rotenone.
  • Reactive oxygen species (ROS) production was measured via the DCFDA kit (Abeam) 24 hours following treatment. Values were normalized to untreated,
  • SNCA knockdown is not toxic on its own, and significantly protects against cell death (FIG. 5A) and lowers rotenone-dependent ROS production (FIG. 5B).
  • Control, Dl and El sequences did not alter cell viability on their own.
  • Rotenone treatment of Control transfected cells resulted in -75% cell death, but transfection with SNCA knockdown vectors significantly protected against this toxicity.
  • Example 5 in vivo target knockdown by Dl and El vectors
  • RNAi sequences were injected into the SNc of wild type mice. SNc tissue was collected 1 month post-injection. RNA was isolated and levels of SNCA mRNA quantified via Taqman qPCR. Relative levels of transcript were normalized to GAPDH.
  • the mirl55 cassette was cloned into an AAV2 ITR plasmid containing the l.6kb CAG promoter for AAV virus production using a modified AAV2HBKO capsid (WO 2015168666 A2). All viral vectors were produced by the triple-transfection method in 293 cells, and purified as described (11). Titers were determined via qPCR and are expressed as genome copies (GC)/mL or as total vector genomes (vg)
  • mice Male C57BL/6J mice (10-12 weeks of age) were purchased from Charles River Laboratories, France. Animals were housed in group of four in each cage with free access to food and water, with controlled room temperature, humidity and under a 12: 12 h light/dark cycle.
  • mice were deeply anesthetized with an intraperitoneal injection of mixture (volume lOmL/Kg): ketamine (100 mg/kg ; Imalgene ® ; Merial, France) and xylazine (10 mg/Kg;
  • mice were shaved and disinfected with Vetidine (Vetoquinol ® , France), a local anesthetic bupivacaine (2 mg/kg at a volume of 5 ml/kg; Aguettant, France) was injected subcutaneously on the skin of the skull and Emla (Lidocaine, Astrazeneca) was applied into the ears.
  • Vetidine Vetoquinol ® , France
  • Emla Lidocaine, Astrazeneca
  • the cannula was maintained in the SNpc for an additional 5 min to avoid backflow. It was then slowly removed from the mouse brain and the scalp was closed by suturing. Mice were monitored daily and after surgery they received subcutaneous injection of carprofen (5mg/kg sc; volume 5ml/kg; Rimadyl ® , Zoetis) and intraperitoneal injection of about 200 pL of sterile saline to prevent dehydration. The animals are then placed in MediHeat ® Warming Cabinet until they are completely awake. One-month post injection, the animals were anesthetized with isoflurane 4% and the brains were processed for immunohistochemical and biochemical analysis. All the experiments have been done in blind.
  • Dl and El vectors showed 55% and 66% knockdown of SNCA mRNA, respectively, relative to Control RNAi demonstrating significant target mRNA knockdown in vivo in the target structure using AAV-mediated delivery of SNCA-targeting miRNA.
  • the SNCA anti-sense probe clearly shows target reduction at three different anatomical levels rostal to caudal relative to the contralateral hemisphere.
  • the control RNAi virus did not show any decrease in SNCA mRNA relative to the uninjected hemisphere demonstrating the specificity of the effect.
  • alpha-synuclein protein signal in the VTA needed to be saturated to observe somal synuclein expression, precluding any determination of SNCA reduction in that brain region.
  • Example 6 AAV-D1 vector reduces SNCA mRNA in mice by SNc immunohistochemistry
  • mice were injected unilaterally with le9 GC of Control or Dl AAV vector as described in Example 5. Tissue was collected and coronal sections were processed for immunohistochemistry (IHC) one month later to assess alpha-synuclein protein levels in the substantia nigra pars compacta.
  • IHC immunohistochemistry
  • Brains were immersion-fixed in 4% formaldehyde for at least 2 days at 4°C and cryopreserved in 30% sucrose solution, then frozen. Frozen brains were cut into serial coronal sections along the entire antero-posterior axis of the substantia nigra (sn). Sections were placed in pbs-0.4% sodium azide and stored at 4°C. [0290] Randomly selected series of 20 mih-thick free-floating sections were used to perform immunolabelling with primary mouse monoclonal antibody against a-syn (mouse monoclonal, 1 :2000, clone 42, BD transductions laboratories). This antibody can detect endogenous levels of mouse a-syn protein predominantly with localization at synaptic membranes but also within da neuronal cell bodies of ventral tegmental area (VTA) and SN.
  • VTA ventral tegmental area
  • Sections were rinsed 3 times in O. lm pbs-0,l 5% triton, 0.2% gelatin from bovine skin (Sigma, G9391) solution and pretreated in blocking buffer (i.e., O. lm PBS-l0% albumin from bovine serum, Sigma, A8022) for 30 min. They were then incubated overnight with primary antibody solution in O. lm PBS at room temperature. After rinsing in O. lm PBS-0. l5% triton, 0.2% gelatin, fluorochome-conjugated antibody (goat anti-mouse 647, Abeam 150119) was used as secondary antibody (1 :400 in 0.
  • fluorochome-conjugated antibody (goat anti-mouse 647, Abeam 150119) was used as secondary antibody (1 :400 in 0.
  • ISH images from adjacent brain sections show the parallel reduction in SNCA mRNA by the Dl RNAi vector but not Control vector.
  • Example 7 in vivo target knockdown by El in the vector AAVrh.10
  • AAV.rhlO vectors encoding El or control RNAi sequences were injected into the SNc of wild type mice. Mice were injected unilaterally with l0e9 GC of Control or AAV.rhlO El vector as described previously. SNc tissue was collected 1 month post-injection. SNCA mRNA expression was quantified by In situ
  • the mirl55 cassette was cloned into an AAV2 ITR plasmid containing the l.6kb CAG promoter for AAV virus production using a the capsid of an rh. lO serotype of AAV (Gao, G. P. et al, 2002, Proc. Natl. Acad. Sci. USA 99: 11854 - 11859.). All viral vectors were produced by the triple-transfection method in 293 cells, and purified as described (11). Titers were determined via qPCR and are expressed as genome copies (GC)/mL or as total vector genomes (vg).
  • GC genome copies
  • vg total vector genomes
  • mice Male C57BL/6J mice (10-12 weeks of age) were purchased from Charles River Laboratories, France. Animals were housed in group of four in each cage with free access to food and water, with controlled room temperature, humidity and under a 12: 12 h light/dark cycle. Stereotaxic injection
  • mice were deeply anesthetized with an intraperitoneal injection of mixture (volume lOmL/Kg): ketamine (100 mg/kg; Imalgene ® ; Merial, France) and xylazine (10 mg/Kg;
  • mice were shaved and disinfected with Vetidine (Vetoquinol ® , France), a local anesthetic bupivacaine (2mg/kg at a volume of 5ml/kg; Aguettant, France) was injected subcutaneously on the skin of the skull and Emla (Lidocaine, Astrazeneca) was applied into the ears.
  • Vetidine Vetoquinol ® , France
  • Emla Lidocaine, Astrazeneca
  • mice 10/group were injected with AAV. Infusion was performed at a rate of 0.2 pL/min and a final volume of 1 pL was injected. After the final injection, the cannula was maintained in the SNpc for an additional 5 min to avoid backflow. It was then slowly removed from the mouse brain and the scalp was closed by suturing. Mice were monitored daily and after surgery they received subcutaneous injection of carprofen (5mg/kg sc; volume 5ml/kg; Rimadyl, Zoetis) and intraperitoneal injection of about 200pL of sterile saline to prevent dehydration. The animals are then placed in MediHeat ® Warming Cabinet (Peco services) until they are completely awake. One- month post injection, the animals were anesthetized with isoflurane 4% and the brains were processed for immunohistochemical and biochemical analysis. All the experiments have been done in blind.
  • Brains were immersion-fixed in 4% Formaldehyde for at least 2 days at 4 °C and cryopreserved in 30% sucrose solution, then frozen. Frozen brains were cut into serial coronal sections along the entire antero-posterior axis of the substantia nigra (SN). Sections were placed in PBS-0.4% sodium azide and stored at 4°C.
  • RNAscope assay that improve the signal-to- noise ratio of RNA ISH by amplifying target- specific signals but not background noise from nonspecific hybridization.
  • 20pm thick cryostat sections mounted over slides was run on Roche Ventana Medical Systems DISCOVERY XT (VS) automate.
  • RNAscope® 2.5 VS antisense probe- Hs-SNCA (Cat No. 313289) and control sense probe (Cat No.511079) were hybridized for 2 h at 43°C followed by RNAscope amplification and Red chromogen detection using VS detection reagents.
  • RNAscope probe design as described hereby. Stained slides were scanned with the VS 120 Olympus system using the 40X objective.
  • SNCA protein in the cell bodies is clearly reduced by the construct El in AAVrh. 10 capsid (upper panel).
  • ISH images from adjacent brain sections show the parallel target reduction in SNCA mRNA by AAVrh.10 but not in the contralateral hemisphere.
  • the control RNAi virus did not show any decrease in SNCA mRNA relative to the uninjected hemisphere demonstrating the specificity of the effect.
  • the efficiency of knock down of SNCA by El is not dependent of the serotype of the capsid at least after intranigral injection of the vector.
  • Lund Human Mesencephalic (LUHMES) cells were differentiated in culture then transfected with plasmids expressing the Dl, El, or CTL3 (control) microRNA on the optimized murine endogenous miR-l55 scaffold (ThermoFisher).
  • Total RNA was isolated from the cells using the miRNeasy ® kit (Qiagen), and next-generation sequencing libraries prepared using the TruSeq stranded Total RNA Library Prep kit (Illumina), followed by sequencing on an Illumina HiSeq instrument (Genewiz, Plainfield NJ).
  • TNFRSF6B on the Dl list is a predicted tumor suppressor in the NCKU database only, and none of the genes in the El list are predicted to be tumor suppressors in either the NCKEi or TSGene database. Both Dl and El lists of potential off-targets were overlapped with predicted targets for the Dl and El microRNAs identified using the miRanda, siSPOTR, and TargetRank (data not included) algorithms.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Virology (AREA)
  • Psychiatry (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2019/044924 2018-08-03 2019-08-02 Variant rnai against alpha-synuclein Ceased WO2020028816A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
AU2019314529A AU2019314529B2 (en) 2018-08-03 2019-08-02 Variant RNAi against alpha-synuclein
KR1020217006255A KR102931619B1 (ko) 2018-08-03 2019-08-02 알파-시뉴클레인에 대한 변이형 RNAi
PH1/2021/550254A PH12021550254A1 (en) 2018-08-03 2019-08-02 Variant rnai against alpha-synuclein
CA3108526A CA3108526A1 (en) 2018-08-03 2019-08-02 Variant rnai against alpha-synuclein
EP19752626.2A EP3830265A1 (en) 2018-08-03 2019-08-02 Variant rnai against alpha-synuclein
SG11202101072UA SG11202101072UA (en) 2018-08-03 2019-08-02 Variant rnai against alpha-synuclein
BR112021001980-4A BR112021001980A2 (pt) 2018-08-03 2019-08-02 rnai variante contra alfa-sinucleína
CN201980063972.6A CN112805382A (zh) 2018-08-03 2019-08-02 针对α-突触核蛋白的变体RNAi
JP2021529252A JP2021534814A (ja) 2018-08-03 2019-08-02 アルファ−シヌクレインに対するバリアントRNAi
MX2021001395A MX2021001395A (es) 2018-08-03 2019-08-02 Arni variante contra alfa-sinucleína.
US17/265,489 US12365895B2 (en) 2018-08-03 2019-08-02 Variant RNAi against alpha-synuclein
IL280581A IL280581A (en) 2018-08-03 2021-02-02 RNAi variant against alpha-synuclein
CONC2021/0002637A CO2021002637A2 (es) 2018-08-03 2021-02-26 Arni variante frente a alfa-sinucleína
JP2024115452A JP2024156715A (ja) 2018-08-03 2024-07-19 アルファ-シヌクレインに対するバリアントRNAi

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862714616P 2018-08-03 2018-08-03
US62/714,616 2018-08-03

Publications (1)

Publication Number Publication Date
WO2020028816A1 true WO2020028816A1 (en) 2020-02-06

Family

ID=67587976

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/044924 Ceased WO2020028816A1 (en) 2018-08-03 2019-08-02 Variant rnai against alpha-synuclein

Country Status (16)

Country Link
US (1) US12365895B2 (cg-RX-API-DMAC7.html)
EP (1) EP3830265A1 (cg-RX-API-DMAC7.html)
JP (2) JP2021534814A (cg-RX-API-DMAC7.html)
KR (1) KR102931619B1 (cg-RX-API-DMAC7.html)
CN (1) CN112805382A (cg-RX-API-DMAC7.html)
AR (1) AR114540A1 (cg-RX-API-DMAC7.html)
AU (1) AU2019314529B2 (cg-RX-API-DMAC7.html)
BR (1) BR112021001980A2 (cg-RX-API-DMAC7.html)
CA (1) CA3108526A1 (cg-RX-API-DMAC7.html)
CO (1) CO2021002637A2 (cg-RX-API-DMAC7.html)
IL (1) IL280581A (cg-RX-API-DMAC7.html)
MX (1) MX2021001395A (cg-RX-API-DMAC7.html)
PH (1) PH12021550254A1 (cg-RX-API-DMAC7.html)
SG (1) SG11202101072UA (cg-RX-API-DMAC7.html)
TW (2) TW202509215A (cg-RX-API-DMAC7.html)
WO (1) WO2020028816A1 (cg-RX-API-DMAC7.html)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022268835A1 (en) * 2021-06-21 2022-12-29 Uniqure Biopharma B.V. Gene constructs for silencing alpha-synuclein and uses thereof
WO2023196862A1 (en) * 2022-04-06 2023-10-12 Genzyme Corporation Targeted gene therapy for dm-1 myotonic dystrophy
JP2023544385A (ja) * 2020-10-01 2023-10-23 アルナイラム ファーマシューティカルズ, インコーポレイテッド Snca関連神経変性疾患を治療又は予防するためのsnca irna組成物及びその使用方法
WO2024211480A3 (en) * 2023-04-05 2024-11-21 Genzyme Corporation Targeted gene therapy for dm-1 myotonic dystrophy
US12365895B2 (en) 2018-08-03 2025-07-22 Genzyme Corporation Variant RNAi against alpha-synuclein
WO2025160429A1 (en) * 2024-01-26 2025-07-31 Genzyme Corporation Artificial micrornas targeting snca

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111356763B (zh) * 2017-09-22 2024-03-12 建新公司 变体RNAi
US20210363524A1 (en) * 2020-03-18 2021-11-25 University Of Massachusetts Oligonucleotides for snca modulation
US20260103703A1 (en) * 2022-09-29 2026-04-16 Atalanta Therapeutics, Inc. siRNA COMPOSITIONS AND METHODS TARGETING ALPHA-SYNUCLEIN NUCLEIC ACIDS
WO2025162214A1 (en) * 2024-01-30 2025-08-07 Shanghai Argo Biopharmaceutical Co., Ltd. Compositions and methods for inhibiting expression of synuclein alpha (snca) gene

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998010088A1 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
WO2003042397A2 (en) 2001-11-13 2003-05-22 The Trustees Of The University Of Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
US6723551B2 (en) 2001-11-09 2004-04-20 The United States Of America As Represented By The Department Of Health And Human Services Production of adeno-associated virus in insect cells
US6989264B2 (en) 1997-09-05 2006-01-24 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
WO2008150897A2 (en) 2007-05-31 2008-12-11 University Of Iowa Research Foundation Reduction of off-target rna interference toxicity
US7465583B2 (en) 2000-06-01 2008-12-16 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
WO2012027713A2 (en) * 2010-08-26 2012-03-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibition of snca
US20120066783A1 (en) 2006-03-30 2012-03-15 The Board Of Trustees Of The Leland Stanford Junior University Aav capsid library and aav capsid proteins
WO2012068405A2 (en) * 2010-11-17 2012-05-24 Isis Pharmaceuticals, Inc. Modulation of alpha synuclein expression
US20120164106A1 (en) 2010-10-06 2012-06-28 Schaffer David V Adeno-associated virus virions with variant capsid and methods of use thereof
US8283151B2 (en) 2005-04-29 2012-10-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes
US20130323226A1 (en) 2011-02-17 2013-12-05 The Trustees Of The University Of Pennsylvania Compositions and Methods for Altering Tissue Specificity and Improving AAV9-Mediated Gene Transfer
US20140335054A1 (en) 2010-04-23 2014-11-13 University Of Massachusetts Cns targeting aav vectors and methods of use thereof
WO2015168666A2 (en) 2014-05-02 2015-11-05 Genzyme Corporation Aav vectors for retinal and cns gene therapy
WO2016130589A2 (en) * 2015-02-10 2016-08-18 Genzyme Corporation VARIANT RNAi

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050137155A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated treatment of Parkinson disease using short interfering nucleic acid (siNA)
GB0816778D0 (en) 2008-09-12 2008-10-22 Isis Innovation Gene silencing
WO2013130824A1 (en) 2012-02-29 2013-09-06 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
KR102931619B1 (ko) 2018-08-03 2026-02-26 젠자임 코포레이션 알파-시뉴클레인에 대한 변이형 RNAi

Patent Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998010088A1 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase
US6989264B2 (en) 1997-09-05 2006-01-24 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6995006B2 (en) 1997-09-05 2006-02-07 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US7846729B2 (en) 1999-08-09 2010-12-07 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US7785888B2 (en) 1999-08-09 2010-08-31 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
US7125717B2 (en) 1999-08-09 2006-10-24 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US8093054B2 (en) 1999-08-09 2012-01-10 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US7465583B2 (en) 2000-06-01 2008-12-16 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
US7790154B2 (en) 2000-06-01 2010-09-07 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
US8361457B2 (en) 2000-06-01 2013-01-29 The University Of North Carolina At Chapel Hill Duplexed parvovirus vectors
US6723551B2 (en) 2001-11-09 2004-04-20 The United States Of America As Represented By The Department Of Health And Human Services Production of adeno-associated virus in insect cells
WO2003042397A2 (en) 2001-11-13 2003-05-22 The Trustees Of The University Of Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
US8283151B2 (en) 2005-04-29 2012-10-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes
US20120066783A1 (en) 2006-03-30 2012-03-15 The Board Of Trustees Of The Leland Stanford Junior University Aav capsid library and aav capsid proteins
WO2008150897A2 (en) 2007-05-31 2008-12-11 University Of Iowa Research Foundation Reduction of off-target rna interference toxicity
US20140335054A1 (en) 2010-04-23 2014-11-13 University Of Massachusetts Cns targeting aav vectors and methods of use thereof
WO2012027713A2 (en) * 2010-08-26 2012-03-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibition of snca
US20120164106A1 (en) 2010-10-06 2012-06-28 Schaffer David V Adeno-associated virus virions with variant capsid and methods of use thereof
WO2012068405A2 (en) * 2010-11-17 2012-05-24 Isis Pharmaceuticals, Inc. Modulation of alpha synuclein expression
US20130323226A1 (en) 2011-02-17 2013-12-05 The Trustees Of The University Of Pennsylvania Compositions and Methods for Altering Tissue Specificity and Improving AAV9-Mediated Gene Transfer
WO2015168666A2 (en) 2014-05-02 2015-11-05 Genzyme Corporation Aav vectors for retinal and cns gene therapy
WO2016130589A2 (en) * 2015-02-10 2016-08-18 Genzyme Corporation VARIANT RNAi

Non-Patent Citations (57)

* Cited by examiner, † Cited by third party
Title
"Cell and Tissue Culture: Laboratory Procedures", August 1993, J. WILEY AND SONS
"Current Protocols in Molecular Biology", 1987
"Gene Transfer Vectors for Mammalian Cells", 1987
"Oligonucleotide Synthesis", 1984
ALBA, R. ET AL., GENE THER, vol. 12, no. 1, 2005, pages 18 - 27
ANDERSEN ET AL., CELL. MOL. NEUROBIOL., vol. 13, 1993, pages 503 - 15
BOSHART ET AL., CELL, vol. 41, 1985, pages 521 - 530
BOUDREAU ET AL., NUCLEIC ACIDS RES., vol. 41, no. 1, January 2013 (2013-01-01), pages e9
BOUDREAU RL ET AL., NITCL. ACIDS RES., vol. 41, no. 1, 2012, pages e9
BOUDREAU, R.L. ET AL., NUCLEIC ACIDS RES., vol. 41, 2013, pages e9
CLARK ET AL., HUM. GENE THER., vol. 10, 1999, pages 1031 - 1039
CONWAY, JE ET AL., J. VIROLOGY, vol. 71, no. 11, 1997, pages 8780 - 8789
D. ALVAREZ-FISCHER ET AL.: "Characterization of the striatal 6-OHDA model of Parkinson's disease in wild type and alpha-synuclein-deleted mice", EXPERIMENTAL NEUROLOGY, vol. 210, 2008, pages 182 - 193
DAVIDSON ET AL., PNAS, vol. 97, no. 7, 2000, pages 3428 - 32
FISHER ET AL., J. VIROL., vol. 70, 1996, pages 520 - 532
GAO ET AL., PNAS, vol. 100, no. 10, 2003, pages 6081 - 6
GAO ET AL., PNAS, vol. 99, no. 18, 2002, pages 11854 - 6
GAO, G. P. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 11854 - 1038,1570-1580
GAO, J. VIROL., vol. 78, no. 12, 2004, pages 6381
GOINS, WF ET AL., HERPES SIMPLEX VIRUS METHODS IN MOLECULAR BIOLOGY, vol. 1144, 2014, pages 63 - 79
GOSSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547 - 5551
GOSSEN ET AL., SCIENCE, vol. 268, 1995, pages 1766 - 1769
GUO ET AL., GENE THER., vol. 3, no. 9, 1996, pages 802 - 10
H. JAVED ET AL.: "Development of Nonviral Vectors Targeting the Brain as a Therapeutic Approach For Parkinson's Disease and Other Brain Disorders", MOLECULAR THERAPY : THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 24, 2016, pages 746 - 758
HARVEY ET AL., CURR. OPIN. CHEM. BIOI., vol. 2, 1998, pages 512 - 518
K. UBHI ET AL.: "Alpha-synuclein deficient mice are resistant to toxin-induced multiple system atrophy", NEUROREPORT, vol. 21, 2010, pages 457 - 462
KIM ET AL., GENE, vol. 91, no. 2, 1990, pages 217 - 23
KOTIN, HUM. GENE THER., vol. 5, 1994, pages 793 - 801
LAGOS-QUINTANA, M. ET AL., CURR. BIOL., vol. 12, 2002, pages 735 - 9
MAGARI ET AL., J. CLIN. INVEST., vol. 100, 1997, pages 2865 - 2872
MARTIN ET AL., HUMAN GENE THERAPY METHODS, vol. 24, 2013, pages 253 - 269
MCLAUGHLIN ET AL., J. VIROL., vol. 62, 1988, pages 1963 - 1973
MIYAZAKI, J. ET AL., GENE, vol. 79, no. 2, 1989, pages 269 - 77
NIWA ET AL., GENE, vol. 108, no. 2, 1991, pages 193 - 9
NO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 3346 - 3351
P. KLIVENYI ET AL.: "Mice lacking alpha-synuclein are resistant to mitochondrial toxins", NEUROBIOLOGY OF DISEASE, vol. 21, 2006, pages 541 - 548, XP024901672, doi:10.1016/j.nbd.2005.08.018
PASSINI ET AL., J. VIROL., vol. 77, no. 12, 2003, pages 6799 - 810
PECHAN ET AL., GENE THER., vol. 16, 2009, pages 10 - 16
PICCIOLI ET AL., NEURON, vol. 15, 1995, pages 373 - 84
PICCIOLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 5611 - 5
R. E. DROLETB. BEHROUZK. J. LOOKINGLANDJ. L. GOUDREAU: "Mice lacking alpha-synuclein have an attenuated loss of striatal dopamine following prolonged chronic MPTP administration", NEUROTOXICOLOGY, vol. 25, 2004, pages 761 - 769
S. MITTAL ET AL.: "beta2-Adrenoreceptor is a regulator of the alpha-synuclein gene driving risk of Parkinson's disease", SCIENCE, vol. 357, 2017, pages 891 - 898
S. SCHILDKNECHT ET AL.: "Generation of genetically-modified human differentiated cells for toxicological tests and the study of neurodegenerative diseases", A ILEX, vol. 30, 2013, pages 427 - 444
S. T. BAEK ET AL.: "Off-target effect of doublecortin family shRNA on neuronal migration associated with endogenous microRNA dysregulation", NEURON, vol. 82, 2014, pages 1255 - 1262
SAMANIEGO, L.A. ET AL., J. VIROL., vol. 72, 1998, pages 3307 - 20
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS
SEGURA MM ET AL., EXPERT OPIN BIOL THER, vol. 13, no. 7, 2013, pages 987 - 1011
TERASAWA ET AL., JOURNAL OF NUCLEIC ACIDS, vol. 2011, 2011, pages 131579
VELDWIJK ET AL., MOL. THER., vol. 6, 2002, pages 272 - 278
W. DAUER ET AL.: "Resistance of alpha -synuclein null mice to the parkinsonian neurotoxin MPTP", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 99, 2002, pages 14524 - 14529
WANG ET AL., GENE THER., vol. 4, 1997, pages 432 - 441
WANG ET AL., NAT. BIOTECH., vol. 15, 1997, pages 239 - 243
WANG Z. ET AL., GENE THER, vol. 10, 2003, pages 2105 - 2111
X. XIAOJ. LIR. J. SAMULSKI: "Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus", JOURNAL OF VIROLOGY, vol. 72, 1998, pages 2224 - 2232
XIAO ET AL., EXP. NEUROBIOL., vol. 144, 1997, pages 113 - 124
Y. LIM ET AL.: "alpha-Syn suppression reverses synaptic and memory defects in a mouse model of dementia with Lewy bodies", THE JOURNAL OF NEUROSCIENCE : THE OFFICIAL JOURNAL OF THE SOCIETY FOR NEUROSCIENCE, vol. 31, 2011, pages 10076 - 10087, XP055195947, doi:10.1523/JNEUROSCI.0618-11.2011
ZHONG L., PROC NATL ACAD SCI USA, vol. 105, no. 22, 2008, pages 7827 - 7832

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12365895B2 (en) 2018-08-03 2025-07-22 Genzyme Corporation Variant RNAi against alpha-synuclein
JP2023544385A (ja) * 2020-10-01 2023-10-23 アルナイラム ファーマシューティカルズ, インコーポレイテッド Snca関連神経変性疾患を治療又は予防するためのsnca irna組成物及びその使用方法
EP4221838A4 (en) * 2020-10-01 2025-04-16 Alnylam Pharmaceuticals, Inc. Snca irna compositions and methods of use thereof for treating or preventing snca-associated neurodegenerative diseases
WO2022268835A1 (en) * 2021-06-21 2022-12-29 Uniqure Biopharma B.V. Gene constructs for silencing alpha-synuclein and uses thereof
WO2023196862A1 (en) * 2022-04-06 2023-10-12 Genzyme Corporation Targeted gene therapy for dm-1 myotonic dystrophy
WO2024211480A3 (en) * 2023-04-05 2024-11-21 Genzyme Corporation Targeted gene therapy for dm-1 myotonic dystrophy
WO2025160429A1 (en) * 2024-01-26 2025-07-31 Genzyme Corporation Artificial micrornas targeting snca

Also Published As

Publication number Publication date
AU2019314529B2 (en) 2025-09-11
EP3830265A1 (en) 2021-06-09
TW202022116A (zh) 2020-06-16
JP2021534814A (ja) 2021-12-16
KR102931619B1 (ko) 2026-02-26
PH12021550254A1 (en) 2023-02-06
IL280581A (en) 2021-03-25
JP2024156715A (ja) 2024-11-06
AU2019314529A1 (en) 2021-03-25
CN112805382A (zh) 2021-05-14
BR112021001980A2 (pt) 2021-05-04
AR114540A1 (es) 2020-09-16
CO2021002637A2 (es) 2021-07-30
US12365895B2 (en) 2025-07-22
CA3108526A1 (en) 2020-02-06
KR20210062627A (ko) 2021-05-31
TW202509215A (zh) 2025-03-01
US20210309999A1 (en) 2021-10-07
MX2021001395A (es) 2021-08-11
SG11202101072UA (en) 2021-03-30

Similar Documents

Publication Publication Date Title
US20240182896A1 (en) VARIANT RNAi
US12365895B2 (en) Variant RNAi against alpha-synuclein
US20250290075A1 (en) VARIANT RNAi
EP3119437A2 (en) Gene therapy for retinitis pigmentosa
WO2023196862A1 (en) Targeted gene therapy for dm-1 myotonic dystrophy
US20250197862A1 (en) ARTIFICIAL microRNAs TARGETING TAU
WO2025160429A1 (en) Artificial micrornas targeting snca
WO2025160434A1 (en) Artificial micrornas targeting huntington's disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19752626

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3108526

Country of ref document: CA

Ref document number: 2021529252

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2021/001395

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021001980

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: NC2021/0002637

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: DZP2021000091

Country of ref document: DZ

ENP Entry into the national phase

Ref document number: 20217006255

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019752626

Country of ref document: EP

Effective date: 20210303

ENP Entry into the national phase

Ref document number: 2019314529

Country of ref document: AU

Date of ref document: 20190802

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112021001980

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210202

WWP Wipo information: published in national office

Ref document number: NC2021/0002637

Country of ref document: CO

WWP Wipo information: published in national office

Ref document number: MX/A/2021/001395

Country of ref document: MX

WWG Wipo information: grant in national office

Ref document number: MX/A/2021/001395

Country of ref document: MX