WO2019228498A1

WO2019228498A1 - Lentiviral vector used for treatment of sanfilippo b syndrome, lentivirus, and preparation method and application thereof

Info

Publication number: WO2019228498A1
Application number: PCT/CN2019/089519
Authority: WO
Inventors: Yingying Wang
Original assignee: Shenzhen Geno-Immune Medical Institute
Priority date: 2018-05-31
Filing date: 2019-05-31
Publication date: 2019-12-05
Also published as: CN108715867A

Abstract

The present application provides a lentiviral vector used for the treatment of sanfilippo B syndrome, lentivirus, and preparation method and application thereof, wherein the lentiviral vector may be obtained by applying pTYF or modifying a pTYF lentiviral vector at the 5'-end splice donor site and it further comprises a NAGLU gene. The NAGLU gene is specifically connected into the pTYF or the modified lentiviral vector of the present invention, thereby achieving a more efficient gene delivery while ensuring safety, significantly increasing the expression level of the NAGLU gene in transgenic brain-related cells, and more efficiently accomplishing the transfer of normal genes during the gene therapy of sanfilippo B syndrome.

Description

[Title established by the ISA under Rule 37.2] LENTIVIRAL VECTOR USED FOR TREATMENT OF SANFILIPPO B SYNDROME, LENTIVIRUS, AND PREPARATION METHOD AND APPLICATION THEREOF

FIELD OF THE INVENTION

The present application belongs to the field of genetic engineering technology and relates to a lentiviral vector pTYF used for the treatment of sanfilippo B syndrome, a lentivirus, and a preparation method and application thereof, and particularly relates to use of a lentiviral vector improved for optimizing the expression of NAGLU gene in the preparation of a medicament for the treatment of sanfilippo B syndrome.

BACKGROUND

Mucopolysaccharidosis (MPS) type III B (also known as Sanfilippo B syndrome) causes progressive cognitive dysfunction. The disease is caused by the accumulation of partially degraded heparan sulfate oligosaccharide. Mutations in the Sanfilippo B related gene NAGLU leads to α-N-glucuronidase to lose its catalytic activity. The symptoms and pathological features of Sanfilippo B syndrome are similar to those of Sanfilippo-A. The accumulation of heparan sulfate oligosaccharides not only affects tissues and organs, especially neurons and non-neuronal cells in the CNS, but also leads to the appearance of secondary pathological features in the CNS, including a large number of metabolic damage, neuroinflammation, oxidative stress and neurological deterioration, and also has a profound impact on the peripheral nervous system (PNS) . Sanfilippo B syndrome occurs mostly in children. The symptoms are not obvious before 2-4 years of age, after which, the condition will progess significantly and eventually die.

Sanfilippo B is a lysosomal storage disorder (LSD) caused by single gene mutation, involving the gene NAGLU. Therefore, a gene therapy can theoretically achieve complete treatment of the disease. Direct injection of a viral vector carrying the normal NAGLU gene into the brain can directly transfect the gene-deficient cells in the brain, to repair various brain cells, secret the desired alaninease, and reduce the accumulation of heparan sulfate for the subsequent degradation, and repair surrounding cells or even cells throughout the brain by cross correction. The viral vector is modified in vitro and directly injected into the brain. This method is convenient, rapid, low in cost, and has high applicability and a good application prospect in clinical gene therapy.

Although many gene therapies for gene delivery using viral vectors are currently available in China and other countries, the gene transfer efficiency, which directly affects the therapeutic effects on a disease, is significantly different between different viral vectors or even between different preparation methods of the same vector. Most of the methods currently used for the treatment of inherited diseases by using cell therapy are inefficient and only modify blood stem cells, such that the obtained clinical therapeutic effects on the disease is less than expected. Therefore, methods for maximizing the viral gene delivery efficiency to improve the therapeutic effects on inherited diseases are greatly in need.

Abeona Therapeutics Inc. (Nasdaq: ABEO) , a clinical-stage biopharmaceutical company focused on developing gene therapies for life-threatening rare diseases, announced that the European Medicines Agency (EMA) Committee for Orphan Medicinal Products has granted Orphan Drug Designation (EMA/OD/226/16) for Abeona’s gene therapy program for children impacted by Sanfilippo syndrome type B (MPS IIIB) . This gene therapy program has previously been granted the U.S. Food and Drug Administration (FDA) Orphan Product Designation in the United States and received the Rare Pediatric Disease Designation as a pre-requisite part of the FDA’s Priority Review Voucher (PRV) process. The FDA has allowed the Investigational New Drug (IND) for a Phase 1/2 clinical trial, and enrollments are anticipated to begin in the second quarter of 2017.

SUMMARY OF THE INVENTION

In view of the deficiencies in the prior art, the present application provides a lentiviral vector used for the treatment of sanfilippo B syndrome, a lentivirus, and a preparation method and application thereof. The lentiviral vector used for the treatment of sanfilippo B syndrome has higher transduction efficiency, stability and safety.

To achieve this purpose, the present application uses the following technical solutions:

In a first aspect, the application provides a lentiviral vector that is obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site, to be used for the treatment of sanfilippo B syndrome, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination between a packaging vector and the reference lentivirus pTYF;

(b) it still has the function of the packaging signal of a virus;

wherein, the lentiviral vector further comprises a NAGLU gene.

In an embodiment of the present application, the application provides a lentiviral vector that can be obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site and the gag AUG codon, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination;

(b) the 5'-end gag AUG codon thereof is modified so that the modified lentiviral vector does not contain a functional gag AUG codon;

wherein, the lentiviral vector further comprises a NAGLU gene.

Materials and procedures used for the modification can be found, for example, in references 1-6.

In an embodiment of the present application, the NAGLU gene is a codon optimized and humanized sequence.

In the present application, the 5'-end splice donor site is deleted or modified and the gag AUG may be deleted or modified so that the splice donor site of the lentiviral vector is not a potential site for homologous recombination between a packaging vector and the reference lentivirus packaging plasmids, that is, the lentiviral vector is unlikely to become pathogenic due to homologous recombination. This allow the HIV-derived virus genetic materials to lose its self-replication function, thereby greatly improving the safety of the lentiviral vector used in gene therapy. This is a safety improvement that none of the other lentiviral vectors have, and in addition, this is the first application using pTYF derived vector expressing NAGLU. The modified lentiviral vector has higher transduction efficiency, high stability and improved safety, and it can express the delivered genes at higher efficiency during the gene therapy. The NAGLU gene is specifically cloned into the modified lentiviral vector which is then transfected into cells to produce lentiviral vector, which can infect cells to achieve a successful and stable expression of the NAGLU gene in the target neuronal cells including stem cells, achieving a gene therapy of sanfilippo B syndrome with the lentiviral vector.

According to the present application, nucleotide sequences used in the deletion or modification of the 5'-end splice donor site of the lentiviral vector are listed below, for example:

In a specific embodiment, the wild type 5' splice donor site GT is mutated to CA, wherein specific sequences are as follows:

Wild type (SEQ ID NO. 3) : GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

Mutant (SEQ ID NO. 4) : GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA.

In a specific embodiment, the wild type 5' splice donor site GT is mutated to GG, wherein specific sequences are as follows:

Wild type (SEQ ID NO. 5) : GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

Mutant (SEQ ID NO. 6) : GGCAAGAGGCGAGGGGCGGCGACTGGGGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA.

According to the present application, the NAGLU gene has the nucleotide sequence as shown in SEQ ID NO. 1, or a nucleotide sequence that shares at least 80%homology, preferably at least 85%homology, further preferably at least 95%homology therewith.

In some embodiments, the NAGLU gene has a nucleotide sequence that shares at least 80%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the NAGLU gene has a nucleotide sequence that shares at least 82%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the NAGLU gene has a nucleotide sequence that shares at least 85%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the NAGLU gene has a nucleotide sequence that shares at least 88%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the NAGLU gene has a nucleotide sequence that shares at least 90%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the NAGLU gene has a nucleotide sequence that shares at least 92%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the NAGLU gene has a nucleotide sequence that shares at least 95%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In the present application, the inventor has found that the sequence that shares at least 80%homology with the nucleotide sequence as shown in SEQ ID NO. 1 is a modified NAGLU gene which still functions as a NAGLU gene. It may be a shortened form of the NAGLU protein or it may use only the functional domain sequence of the NAGLU. Loading any one of these modified nucleotide sequences into the lentiviral vector can achieve the function of the NAGLU gene to repair the NAGLU gene. The nucleotide sequence shown in SEQ ID NO. 1 is as follows:

According to the present application, a promoter sequence is further comprised in front of the NAGLU gene, wherein the promoter sequence is EF1α and/or CMV, preferably EF1α.

In the present application, any promoter can be used as long as it is capable of initiating NAGLU gene expression. The inventor has found that use of the whole EF1α promoter achieves more efficient gene delivery while ensuring safety.

According to the present application, the EF1α has the nucleotide sequence as shown in SEQ ID NO. 2, or a nucleotide sequence that shares at least 90%homology, preferably at least 95%homology therewith.

In some embodiments, the EF1α has a nucleotide sequence that shares at least 90%homology with the nucleotide sequence as shown in SEQ ID NO. 2.

In some embodiments, the EF1α has a nucleotide sequence that shares at least 92%homology with the nucleotide sequence as shown in SEQ ID NO. 2.

In some embodiments, the EF1α has a nucleotide sequence that shares at least 95%homology with the nucleotide sequence as shown in SEQ ID NO. 2.

In the present application, the inventor has found that the sequence that shares at least 90%homology with the nucleotide sequence as shown in SEQ ID NO. 2 is a modified EF1α which still functions as a promoter. It may be a shortened form of the EF1α. Loading any one of these modified nucleotide sequences into the lentiviral vector can achieve the function of the promoter to initiate the expression of the NAGLU gene. The nucleotide sequence shown in SEQ ID NO. 2 is as follows:

In a second aspect, the present application provides a recombinant lentivirus that is obtained by co-transfecting a mammalian cell with the lentiviral vector pTYF according to the first aspect and packaging helper plasmids pNHP and pHEF-VSV-G.

Materials and procedures used for the co-transfection can be found, for example, in references 1-6.

Preferably, the mammalian cell is a HEK293T cell and/or a TE671 cell.

In a third aspect, the present application provides a method for preparing the lentivirus according to the second aspect, comprising the steps of:

(1) modifying the lentiviral vector pTYF;

(2) synthesizing the sequences of a promoter and a NAGLU gene by whole gene synthesis, and inserting the same into the point-mutated lentiviral vector of step (1) ;

(3) co-transfecting the constructed lentiviral vector and a packaging helper plasmid into a mammalian cell to obtain the recombinant lentivirus.

According to the present application, the insertion site in step (2) may be any restriction site that can be synthesized by genetic engineering, although restriction sites BamHI and SpeI are preferably used in the present application.

According to the present application, the packaging helper plasmid in step (3) is pNHP and pHEF-VSV-G.

According to the present application, the mammalian cell is a HEK293T cell and/or a TE671 cell.

According to the present application, the co-transfected mammalian cell is cultured for 24-72 h, for example, 24 h, 25 h, 26 h, 27 h, 28 h, 29 h, 30 h, 31 h, 32 h, 33 h, 34 h, 35 h, 36 h, 37 h, 38 h, 39 h, 40 h, 41 h, 42 h, 43 h, 44 h, 45 h, 46 h, 47 h, 48 h, 50 h, 52 h, 55 h, 58 h, 60 h, 62 h, 65 h, 68 h, 70 h or 72 h.

In a fourth aspect, the present application provides a recombinant cell which comprises the lentiviral vector according to the first aspect and/or the recombinant lentivirus according to the second aspect.

According to the present application, the recombinant cell is a recombinant stem cell and/or a progenitor cell, preferably a blood stem cell and/or a mesenchymal stem cell.

In the present application, the lentivirus-transfected stem cells are capable of stably expressing the NAGLU gene in a large amount. The recombinant lentivirus may be introduced into peripheral blood stem cells and mesenchymal stem cells to form a double stem cell treatment strategy, which can further improve the delivery efficiency and expression level of the NAGLU gene in the brain, thereby achieving a faster resolution of sanfilippo B syndrome symptoms and a more comprehensive and long-term gene therapy.

In a fifth aspect, the present application provides a pharmaceutical composition which comprises any one selected from the group consisting of the lentiviral vector according to the first aspect, the recombinant lentivirus according to the second aspect, and the recombinant cell according to the forth aspect, or a combination of at least two selected therefrom.

According to the present application, the composition further comprises a pharmaceutically acceptable adjuvant which is any one selected from the group consisting of a growth-stimulating factor, an excipient, a diluent, a carrier, a flavoring agent, a binder and a filler, or a combination of at least two selected therefrom.

In a sixth aspect, the present application provides use of the lentiviral vector according to the first aspect, the recombinant lentivirus according to the second aspect, the recombinant cell according to the forth aspect, or the pharmaceutical composition according to the fifth aspect in the preparation of a medicament and/or an agent for the treatment of sanfilippo B syndrome.

In a specific embodiment, peripheral blood of a patient is collected and stem cells are isolated therefrom which are then transduced with the lentiviral vector, followed by i. v. retransfusion into the patient for the treatment of sanfilippo B syndrome disease.

In a specific embodiment, the lentiviral vector can be injected directly into the lesion cell site for the treatment of sanfilippo B syndrome disease.

In a specific embodiment, the lentiviral vector can be used to transfect blood for the treatment of sanfilippo B syndrome disease.

Compared with the prior art, the present application has the following beneficial effects:

(1) In the present application, the lentiviral vector is specifically modified so that the HIV virus lose its self-replication function, thereby greatly improving the safety performance of the lentiviral vector itself used in gene therapy. The modified lentiviral vector has higher transduction efficiency, stability and safety, and it can more efficiently complete the delivery of normal genes during the gene therapy;

(2) A human codon optimized NAGLU gene is specifically connected into the modified lentiviral vector of the present invention under the EF1α promoter, thereby achieving a more efficient gene delivery while ensuring safety, significantly increasing the expression level of the NAGLU gene in transgenic brain-related cells, and more efficiently accomplishing the transfer of normal genes during the gene therapy of sanfilippo B syndrome;

(3) In the present application, the lentiviral vector can directly correct the functionally defect NAGLU gene in cells, and can effectively improve the delivery efficiency and expression level of the NAGLU gene in the brain, which has great significance in ensuring the effectiveness of gene therapy and lays foundation for a faster resolution of sanfilippo B syndrome symptoms and a more comprehensive and long-term gene therapy.

DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic diagram showing the modification of the lentiviral vector pTYF;

Figure 2 is a schematic diagram showing the structure of the lentiviral vector;

Figure 3 is a schematic diagram showing the purification process of the lentiviral vector;

Figure 4 is a schematic diagram showing the treatment process of sanfilippo B syndrome by directly injecting a lentiviral vector carrying a functional NAGLU gene into the brain.

DETAILED DESCRIPTION

In order to further illustrate the technical measures adopted by the present application and the effects thereof, the present application is further described below with reference to the embodiments and accompanying drawings. It can be understand that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.

In the examples, techniques or conditions, which are not specifically indicated, are performed according to techniques or conditions described in the literature of the art, or according to product instructions. The reagents or instruments for use, which are not indicated with manufacturers, are conventional products that are commercially available from formal sources.

Example 1 Construction of a lentiviral vector

This example provides a method for constructing a lentiviral vector, which specifically includes the following steps:

(1) The schematic diagram of the modification of the lentiviral vector pTYF is shown in Figure 1. The specific mutations were mutation of the wild type 5' splice donor site GT to CA and deletion of the enhancer in U3. For specific modification methods, see "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p. 6171–6176". Specific steps are as follows:

Modification of the 5' splice donor site:

Mutant (SEQ ID NO. 4) : GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

(2) Insertion of a promoter and the human codon optimized NAGLU gene:

The sequences of the normal NAGLU gene (as shown in SEQ ID NO. 1) and the human EF1α promoter (as shown in SEQ ID NO. 2) were synthesized by whole gene synthesis, which were then connected into the lentiviral vector TYF via restriction sites. The obtained product was identified by sequencing and digestion with double enzymes (the NEB original recommendation was referred to for the best reaction condition; BamHI clone site (ggatccacc) -AUG was used for 5’a nd SpeI clone site (actagt) was used for 3’ ) to obtain a correctly linked lentiviral vector which carried the normal NAGLU gene inserted under the hEF1α promoter. The specific link position and the structure of the lentiviral vector are shown in Figure 2.

Specifically, the nucleotide sequence shown in SEQ ID NO. 1 is as follows:

Specifically, the nucleotide sequence shown in SEQ ID NO. 2 is as follows:

Example 2 Preparation and Identification of a Lentivirus

1) Preparation of a lentivirus

The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain a lentivirus. The specific process is shown in FIG. 3, and the specific steps are as follows:

(1) The lentiviral vector constructed in Example 1 and packaging helper plasmids pNHP and pHEF-VSV-G were co-transfected into mammalian cell HEK293T, and cultured for 24-72h;

(2) The lentivirus obtained after the culture was purified and concentrated to obtain a lentivirus.

2) Identification of the lentivirus

The collected lentivirus carrying normal NAGLU gene were used to transduce neuronal cells and glial cells which were then identified for protein expression to confirm the expression of the NAGLU gene in neuronal cells.

As can be seen from the results, there was no NAGLU protein expression in negative control cells which were neuronal cells without transduction of lentivirus, but a significantly larger amount of NAGLU protein expression was observed in neuronal cells transduced with the lentivirus carrying the normal NAGLU gene.

This indicates that the present application can successfully allow a neuronal cell to express NAGLU protein in a large amount by lentivirus, having a good therapeutic potential for diseases.

Example 3 Therapeutic effect of the lentivirus

The lentivirus carrying normal NAGLU prepared in Example 2 was directly injected into the brain to treat sanfilippo B syndrome disease. The schematic diagram of the treatment process is shown in Figure 4. The site and specific coordinate in the brain at which the lentiviral vector was injected was determined by MRI or CT of the brain, and the lentiviral vector carrying normal NAGLU gene was delivered into the patient's brain via direct intracranial injection for disease treatment.

It can be seen from the results that the delivery efficiency and expression level of the NAGLU gene in the brain were effectively increased after direct injection of the lentivirus.

In summary in the present application, the lentiviral vector can directly repair the defective NAGLU gene in cells, and can effectively improve the delivery efficiency and expression level of the NAGLU gene in the brain, which has great significance in ensuring the effectiveness of gene therapy and lays foundation for a faster resolution of sanfilippo B syndrome symptoms and a more comprehensive and long-term gene therapy.

The applicant states that detailed methods of the present application are demonstrated in the present application through the above embodiments, however, the present application is not limited to the above detailed methods, and does not mean that the present application must rely on the above detailed methods to implement. It should be apparent to those skilled in the art that, for any improvement of the present application, the equivalent replacement of the raw materials of the present application, the addition of auxiliary components, and the selection of specific modes, etc., will all fall within the protection scope and the disclosure scope of the present application.

References:

1. Chang, L. -J., V. Urlacher, T. Iwakuma, Y. Cui, and J. Zucali (1999) . Efficacy and safety analyses of a recombinant human immunodeficiency virus derived vector system. Gene Therapy 6, 715-728.

2. Cui, Y., T. Iwakuma and L. -J. Chang (1999) . Contributions of viral splice sites and cis-regulatory elements to lentivirus vector functions. J Virol 73, 6171-6176.

3. Iwakuma T., Y. Cui, and L. -J. Chang (1999) . Self-inactivating lentiviral vectors with U3 and U5 modifications. Virology 261, 120-132.

4. Chang, L. -J. and Gay, E. (2001) The molecular genetics of lentiviral vectors -current and future perspectives. Current Gene Therapy 1, 237-251.

5. L-J Chang, X Liu and J He. Lentiviral siRNAs targeting multiple highly conserved RNA sequences of human immunodeficiency virus type 1. Gene Therapy (2005) 12, 1133–1144.

6. Ayed O. Ayed, Lung-Ji Chang, Jan S. Moreb. Immunotherapy for multiple myeloma: Current status and future directions. Critical Reviews in Oncology/Hematology. Volume 96, Issue 3, December 2015, Pages 399-412.

Claims

A lentiviral vector that is obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site, used for the treatment of sanfilippo B syndrome, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination between the packaging vector and the reference lentivirus;

(b) it still has the function of the packaging signal of a virus;

wherein, the lentiviral vector further comprises a NAGLU gene.
The lentiviral vector according to claim 1, wherein the lentiviral vector is based on pTYF or obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site and gag AUG codon, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination between a packaging vector and the reference lentivirus;

(b) the 5'-end gag AUG codon thereof is modified so that the modified lentiviral vector does not contain a gag AUG codon;

(c) it still has the function of the packaging signal of a virus;

wherein, the lentiviral vector further comprises a NAGLU gene.
The lentiviral vector according to claim 1 or 2, wherein the NAGLU gene is a humanized sequence.
The lentiviral vector according to any one of claims 1 to 3, wherein the NAGLU gene has the nucleotide sequence as shown in SEQ ID NO. 1, or a nucleotide sequence that shares at least 80%homology, preferably at least 85%homology, further preferably at least 95%homology therewith.
The lentiviral vector according to any one of claims 1 to 4, wherein a promoter sequence is further comprised in front of the NAGLU gene;

preferably, the promoter sequence is EF1α and/or CMV, preferably EF1α;

preferably, the EF1α has the nucleotide sequence as shown in SEQ ID NO. 2, or a nucleotide sequence that shares at least 90%homology, preferably at least 95%homology therewith.
A recombinant lentivirus that is obtained by co-transfecting a mammalian cell with the lentiviral vector pTYF according to any one of claims 1 to 5 and packaging helper plasmids pNHP and pHEF-VSV-G.
The recombinant lentivirus according to claim 6, wherein the mammalian cell is a HEK293T cell and/or a TE671 cell.
A method for preparing the lentivirus according to claim 6 or 7, comprising the steps of:

(1) subjecting the 5'-end splice donor site of lentiviral vector pTYF to point mutation;

(2) synthesizing the sequences of a promoter and a NAGLU gene by whole gene synthesis, and inserting the same into the point-mutated lentiviral vector of step (1) ;

(3) co-transfecting the constructed lentiviral vector and a packaging helper plasmid into a mammalian cell to obtain the recombinant lentivirus.
The method according to claim 8, wherein the packaging helper plasmid in step (3) is pNHP and pHEF-VSV-G;

preferably, the mammalian cell is a HEK293T cell and/or a TE671 cell;

preferably, the co-transfected mammalian cell is cultured for 24-72h.
A recombinant cell comprising the lentiviral vector according to any one of claims 1 to 5 and/or the recombinant lentivirus according to claim 6 or 7.
The recombinant cell according to claim 10, wherein the recombinant cell is a recombinant stem cell and/or a progenitor cell, preferably a blood stem cell and/or a mesenchymal stem cell.
A pharmaceutical composition comprising any one selected from the group consisting of the lentiviral vector according to any one of claims 1 to 5, the recombinant lentivirus according to claim 6 or 7, and the recombinant cell according to claim 10 or 11, or a combination of at least two selected therefrom.
The pharmaceutical composition according to claim 12, wherein the composition further comprises a pharmaceutically acceptable adjuvant;

preferably, the adjuvant is any one selected from the group consisting of a growth-stimulating factor, an excipient, a diluent, a carrier, a flavoring agent, a binder and a filler, or a combination of at least two selected therefrom.
Use of the lentiviral vector according to any one of claims 1 to 5, the recombinant lentivirus according to claim 6 or 7, the recombinant cell according to claim 10 or 11, or the pharmaceutical composition according to claim 12 or 13 in the preparation of a medicament and/or an agent for the treatment of sanfilippo B syndrome.