WO2019219024A1 - Use of crrna-mediated crispr/cas13a gene editing system in tumor cells - Google Patents

Abstract

Provided is use of a crRNA-mediated CRISPR/Cas13a gene editing system in inhibiting and killing tumor cells. Cas13a protein, in U87 glioma cell line, can be mediated by a single-stranded crRNA onto a complementary RNA of interest and perform cleavage. Meanwhile, the Cas13a protein can also trigger the effect of associated cleavage in eukaryotic cells, that is, after starting to cleave the first RNA of interest, the Cas13a protein performs a random, non-targeted cleavage on other encountered RNA, thereby achieving effects of inhibiting and killing tumors such as reducing tumor cell index, and inhibiting the tumor formation rate and tumor size of mice.

Description

Application of crRNA-mediated CRISPR/Cas13a gene editing system in tumor cells Technical field

The present invention relates to DNA recombination techniques, and more particularly to the use of a crRNA-mediated CRISPR/Cas13a gene editing system in tumor cells.

Background technique

The clustered regular interspaced shot palindromic repeat (CRISPR) and the CRISPR-associated proteins (Cas) are the acquired immune systems of archaea and bacteria. Cas proteins are mainly divided into two categories: acquisition modules and effector modules. The acquisition module can import exogenous nucleic acid information into the CRISPR sequence and generate CRISPR RNAs (crRNAs) as a guide to the system. The effector module cleaves the foreign invading nucleic acid under the mediated by crRNA. In the CRISPR-Cas system, the acquired modules are highly similar, mainly including Cas1 and Cas2. In contrast, there are many types of effect systems. According to the number of subunits, they are mainly classified into Class 1 systems (C1) and Class 2 systems (C2). The C1 system is a combination of multiple proteins that work together to function, including Type I, Type III, and Type IV; the C2 system functions from Cas proteins alone, including Type II and Type V. The Type II CRISPR system primarily functions using the RuvC and HNH endonuclease domains, while the V-type CRISPR system uses a separate RuvC endonuclease domain, including Cpf1, C2c1 and C2c3. These systems are all targeted to DNA. The Type VI CRISPR system consists of a separate C2c2 effector protein that has no deoxyribonuclease domain but has two nuclease domains (Higher Eukaryotes and Prokaryotes Nucleotide-binding domain, HEPN). Thus, C2c2 is a CRISPR-mediated CRISPR effector that targets RNA and is a single-molecule endoribonuclease. Further reports have shown that C2c2 is a single-stranded RNA (ssRNA) endozyme mediated by crRNA. The targeted cleavage of C2c2 depends both on the targeting sequence and on the secondary structure of the sequence. In ex vivo experiments, the C2c2-crRNA complex is able to non-specifically cleave other RNA after being activated by the targeted RNA and beginning to cleave. The properties of this system are applied to nucleic acid detection in vitro. At the same time, Cas13a derived from Leptotrichia shahii was used for its more efficient RNase activity. However, in eukaryotes, the research on Cas13a related applications has not yet begun, and the application of the CRISPR/Cas13a system in eukaryotic and tumor cells is bound to have great value.

Summary of the invention

In order to solve the problem that the CRISPR/Cas13a system is less applied in eukaryotic and tumor cells, the present invention proposes a crRNA-mediated CRISPR/Cas13a gene editing system for use in tumor cells.

The present invention has been achieved in accordance with the following technical solutions.

Application of crRNA-mediated CRISPR/Cas13a gene editing system in tumor cells.

Further, the CRISPR/Cas13a gene editing system inhibits or kills tumor cells in tumor cells by triggering random shear effects.

Further, the tumor cell is a glioma cell line, a glioma mutant cell or a human kidney cancer cell line.

Further, the glioma cell is a human U87 cell, a human LN229 cell line or a mouse GL261 cell line; the glioma mutant cell is U87EGFR VIII cell; and the human renal cancer cell line is a human ACHN cell line.

Further, the expression vector of the Cas13a gene in tumor cells is a plasmid expression vector or a viral expression vector.

Further, the plasmid expression vector is a prokaryotic and eukaryotic plasmid expression vector; the viral expression vector is an adenovirus vector or a lentiviral vector.

Further, the plasmid expression vector is pcDNA3.1, and the viral expression vector is GV341.

Further, the sequence of the crRNA in U87-Cas13a-EGFP cells is SEQ ID NO.

Further, the sequence of the crRNA in U87-Cas13a-EGFR VIII cells is SEQ ID NO.

The invention also discloses the use of the crRNA-mediated CRISPR/Cas13a gene editing system for treating tumor diseases.

Further, the CRISPR/Cas13a gene editing system inhibits or kills tumor cells in tumor cells by triggering random shear effects.

Further, the tumor cell is a glioma cell line, a glioma mutant cell or a human kidney cancer cell line.

Further, the glioma cell is a human U87 cell, a human LN229 cell line or a mouse GL261 cell line; the glioma mutant cell is U87EGFR VIII cell; and the human renal cancer cell line is a human ACHN cell line.

Further, the expression vector of the Cas13a gene in tumor cells is a plasmid expression vector or a viral expression vector.

Further, the plasmid expression vector is a prokaryotic and eukaryotic plasmid expression vector; the viral expression vector is an adenovirus vector or a lentiviral vector.

Further, the plasmid expression vector is pcDNA3.1, and the viral expression vector is GV341.

Further, the sequence of the crRNA in U87-Cas13a-EGFP cells is SEQ ID NO.

Further, the sequence of the crRNA in U87-Cas13a-EGFR VIII cells is SEQ ID NO.

The present invention achieves the following advantageous effects.

The Cas13a protein of the present invention can be mediated by a single-stranded crRNA to a complementary RNA of interest in a U87 glioma cell line and cleavage. At the same time, Cas13a protein can also trigger the effect of ligated cleavage in eukaryotic cells, that is, after starting to cleave the first entry of RNA, Cas13a protein performs non-target random cleavage on other encountered RNA, thereby reducing The tumor cell index inhibits the tumor formation rate and tumor size of mice and inhibits and kills tumors.

DRAWINGS

Figure 1 is a diagram showing the expression of the Cas13a virus of the present invention in eukaryotic cells;

Figure 2 is a diagram showing that the CRISPR-Cas13a system of the present invention effectively knocks down the expression of EGFP in U87 cells;

Figure 3 is a graph showing the mRNA expression level of EGFP of the present invention (with GAPDH as an internal reference);

Figure 4 is a random cut diagram of a ribosome triggered by a CRISPR-Cas13a system of the invention in U87 eukaryotic cells;

Figure 5 is a single cell sequencing tSNE map of the present invention;

Figure 6 is a graph showing the results of imaging of different crRNA-treated mouse glioma models of the present invention.

Figure 7 is a graph showing the non-specific cleavage effect of the CRISPR-Cas13a system of the present invention in LN229, GL261 and ACHN cells.

Detailed ways

The invention is further described below in conjunction with the drawings and embodiments.

Cas13a gene sequence is: ATGAAAGTGACCAAGGTCGACGGCATCAGCCACAAGAAGTACATCGAAGAGGGCAAGCTCGTGAAGTCCACCAGCGAGGAAAACCGGACCAGCGAGAGACTGAGCGAGCTGCTGAGCATCCGGCTGGACATCTACATCAAGAACCCCGACAACGCCTCCGAGGAAGAGAACCGGATCAGAAGAGAGAACCTGAAGAAGTTCTTTAGCAACAAGGTGCTGCACCTGAAGGACAGCGTGCTGTATCTGAAGAACCGGAAAGAAAAGAACGCCGTGCAGGACAAGAACTATAGCGAAGAGGACATCAGCGAGTACGACCTGAAAAACAAGAACAGCTTCTCCGTGCTGAAGAAGATCCTGCTGAACGAGGACGTGAACTCTGAGGAACTGGAAATCTTTCGGAAGGACGTGGAAGCCAAGCTGAACAAGATCAACAGCCTGAAGTACAGCTTCGAAGAGAACAAGGC CAACTACCAGAAGATCAACGAGAACAACGTGGAAAAAGTGGGCGGCAAGAGCAAGCGGAACATCATCTACGACTACTACAGAGAGAGCGCCAAGCGCAACGACTACATCAACAACGTGCAGGAAGCCTTCGACAAGCTGTATAAGAAAGAGGATATCGAGAAACTGTTTTTCCTGATCGAGAACAGCAAGAAGCACGAGAAGTACAAGATCCGCGAGTACTATCACAAGATCATCGGCCGGAAGAACGACAAAGAGAACTTCGCCAAGATTATCTACGAAGAGATCCAGAACGTGAACAACATCAAAGAGCTGATTGAGAAGATCCCCGACATGTCTGAGCTGAAGAAAAGCCAGGTGTTCTACAAGTACTACCTGGACAAAGAGGAACTGAACGACAAGAATATTAAGTACGCCTTCTGCCACTTCGTGGAAATCGAGATGTCCCAGCTGCTGAAAAACTACGTGTACAAGCGGCTGAGCAACATCAGCAACGATAAGATCAAGCGGATC TTCGAGTACCAGAATCTGAAAAAGCTGATCGAAAACAAACTGCTGAACAAGCTGGACACCTACGTGCGGAACTGCGGCAAGTACAACTACTATCTGCAAGTGGGCGAGATCGCCACCTCCGACTTTATCGCCCGGAACCGGCAGAACGAGGCCTTCCTGAGAAACATCATCGGCGTGTCCAGCGTGGCCTACTTCAGCCTGAGGAACATCCTGGAAACCGAGAACGAGAACGGTATCACCGGCCGGATGCGGGGCAAGACCGTGAAGAACAACAAGGGCGAAGAGAAATACGTGTCCGGCGAGGTGGACAAGATCTACAATGAGAACAAGCAGAACGAAGTGAAAGAAAATCTGAAGATGTTCTACAGCTACGACTTCAACATGGACAACAAGAACGAGATCGAGGACTTCTTCGCCAACATCGACGAGGCCATCAGCAGCATCAGACACGGCATCGTGCACTTCAACCTGGAACTGGAAGGCAAGGACATCTTCGCCTTCAAGAATATCGCCCCCAGCGAGATCTCCAAGAAGATGTTTCAGAACGAAATCAACGAAAAGAAGCTGAAGCTGAAAATCTTCAAGCAGCTGAACAGCGCCAACGTGTTCAACTACTACGAGAAGGATGTGATCATCAAGTACCTGAAGAATACCAAGTTCAACTTCGTGAACAAAAACATCCCCTTCGTGCCCAGCTTCACCAAGCTGTACAACAAGATTGAGGACCTGCGGAATACCCTGAAGTTTTTTTGGAGCGTGCCCAAGGACAAAGAAGAGAAGGACGCCCAGATCTACCTGCTGAAGAATATCTACTACGGCGAGTTCCTGAACAAGTTCGTGAAAAACTCCAAGGTGTTCTTTAAGATCACCAATGAAGTGATCAAGATTAACAAGCAGCGGAACCAGAAAACCGGCCACTACAAGTATCAGAAGTTCGAGAACATCGAGAAAACCGTGCCCGTGGAATACCTGGCCATCATCCAGAGCAGAGAGATGATCA ACAACCAGGACAAAGAGGAAAAGAATACCTACATCGACTTTATTCAGCAGATTTTCCTGAAGGGCTTCATCGACTACCTGAACAAGAACAATCTGAAGTATATCGAGAGCAACAACAACAATGACAACAACGACATCTTCTCCAAGATCAAGATCAAAAAGGATAACAAAGAGAAGTACGACAAGATCCTGAAGAACTA TGAGAAGCACAATCGGAACAAAGAAATCCCTCACGAGATCAATGAGTTCGTGCGCGAGATCAAGCTGGGGAAGATTCTGAAGTACACCGAGAATCTGAACATGTTTTACCTGATCCTGAAGCTGCTGAACCACAAAGAGCTGACCAACCTGAAGGGCAGCCTGGAAAAGTACCAGTCCGCCAACAAAGAAGAAACCTTCAGCGACGAGTTGGAACTGATCAACCTGCTGAACCTGGACAACAACAGAGTGACCGAGGACTTCGAGCTGGAAGCCAACGAGATCGGCAAGTTCCTGGACTTCAACGAAAACAAAATCAAGGACCGGAAAGAGCTGAAAAAGTTCGACACCAACAAGATCTATTTCGACGGCGAGAACATCATCAAGCACCGGGCCTTCTACAATATCAAGAAATACGGCATGCTGAATCTGCTGGAAAAGATCGCCGATAAGGCCAAGTATAAGATCAGCCTGAAAGAACTGAAAGAGTACAGCAACAAGAAGAATGAGATTGAAAAGAACTACACCATGCAGCAGAACCTGCACCGGAAGTACGCCAGACCCAAGAAGGACGAAAAGTTCAACGACGAGGACTACAAAGAGTATGAGAAGGCCATCGGCAACATCCAGAAGTACACCCACCTGAAGAACAAGGTGGAATTCAATGAGCTGAACCTGCTGCAGGGCCTGCTGCTGAAGATCCTGCACCGGCTCGTGGGCTACACCAGCATCTGGGAGCGGGACCTGAGATTCCGGCTGAAGGGCGAGTTTCCCGAGAACCACTACATCGAGGAAATTTTCA ATTTCGACAACTCCAAGAATGTGAAGTACAAAAGCGGCCAGATCGTGGAAAAGTATATCAACTTCTACAAAGAACTGTACAAGGACAATGTGGAAAAGCGGAGCATCTACTCCGACAAGAAAGTGAAGAAACTGAAGCAGGAAAAAAAGGACCTGTACATCCGGAACTACATTGCCCACTTCAACTACATCCCCCACGCCGAGATTAGCCTGCTGGAAGTGCTGGAAAACCTGCGGAAGCTGCTGTCCTACGACCGGAAGCTGAAGAACGCCATCATGAAGTCCATCGTGGACATTCTGAAAGAATACGGCTTCGTGGCCACCTTCAAGATCGGCGCTGACAAGAAGATCGAAATCCAGACCCTGGAATCAGAGAAGATCGTGCACCTGAAGAATCTGAAGAAAAAGAAACTGATGACCGACCGGAACAGCGAGGAACTGTGCGAACTCGTGAAAGTCATGTTCGAGTACAAGGCCCTGGAA (Gootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, Verdine V, Donghia N, Daringer NM, Freije CA, Myhrvold C, Bhattacharyya RP, Livny J, Regev A, Koonin EV, Hung DT, Sabeti PC, Collins JJ, Zhang F. Nucleic acid detection with CRISPR-Cas13a/C2c2.Science.2017Apr 28;356(6336):438-442.doi:10.1126/science.aam9321.Epub 2017Apr 13)

The target gene Cas13a was chemically synthesized by Shanghai Aibosi Biotechnology Co., Ltd.

First, the expression of Cas13a in the eukaryotic system

The Cas13a protein gene was first cloned into eukaryotic expression of lentivirus, vector name: GV341 (purchased from Jikai gene); element sequence: Ubi-MCS-3FLAG-SV40-puromycin; cloning site: AgeI/NheI.

The specific steps are as follows:

1. Using linear restriction enzyme digestion to obtain a linearized vector

A 50 μl digestion system was prepared. The various reagents were sequentially added in the order of the list, gently pipetted with a pipette, briefly centrifuged, and placed at 37 ° C for 3 h or overnight. The vector digested product was subjected to agarose gel electrophoresis to recover the target band.

Reagent	Volume (μl)
ddH 2 O	41
10×CutSmart Buffer 2	5
Purified plasmid DNA (1 μg/μL)	2
Age I (10U/μl)	1
NheI (10U/μl)	1
Total	50

2. PCR amplification to prepare the target gene fragment

The amplification primer used is designed to add a homologous recombination sequence at its 5' end. The primer is used to amplify the target gene fragment, and the 5' and 3' end sequences of the amplification products are completely identical to the ends of the linearized cloning vector, respectively. .

The following reaction system was prepared, gently mixed by blowing, centrifuged briefly, and placed in a PCR machine for reaction.

reaction system:

Reagent	Volume (μL)
ddH 2 O	32.5
5×PS Buffer	10
dNTP Mix (2.5mM each)	4
Upstream amplification primer (10μM)	1
Downstream amplification primer (10μM)	1

Template 1 (10ng/μL)	1
PrimeSTAR HS DNA polymerase	0.5
Total	50

Primer sequence:

Cas13a-F:

Cas13a-R:

Reaction conditions:

The PCR product was 3501 bp, and the target fragment was sequenced: correct.

3. The reaction system is prepared by linearizing the vector and the amplification product of the target gene, and performing a recombination reaction to achieve in vitro cyclization of the linearized vector and the target gene fragment.

The following reaction system was prepared in an ice water bath. Mix gently with a pipette and briefly centrifuge to avoid bubbles. The reaction was carried out at 37 ° C for 30 min, and then immediately after being cooled in an ice water bath for 5 min.

4. The recombinant product was directly transformed, and the monoclonal on the plate was picked for PCR identification, and the positive clone was sequenced and analyzed.

10 μL of the exchange reaction product was added to 100 μL of competent cells, and the mixture was lightly bombarded and placed on ice for 30 min. Heat shock at 42 ° C for 90 s, incubate for 2 min in an ice water bath. 500 μL of LB medium was added and shaken at 37 ° C for 1 h. Appropriate amount of bacterial solution was evenly spread on a plate containing the corresponding antibiotic, and cultured in an inverted incubator for 12-16 hours.

5. Expand the culture and extract the correct cloning liquid to obtain high-purity plasmid for downstream virus packaging.

The correctly sequenced bacterial solution was transferred to 10 ml of LB liquid medium containing the corresponding antibiotics, cultured at 37 ° C overnight, and the plasmid was extracted with the endotoxin-free endotoxin plasmid and the medium was extracted, and the qualified plasmid was extracted downstream. Amplification.

The detailed steps are as follows:

(1) collecting the culture solution of the overnight culture in a labeled 5 ml centrifuge tube, 12000 rpm, and centrifuging for 2 min to collect the bacteria;

(2) Discard the supernatant, add 250 μl of cell resuspension, and shake well to make the bacteria block evenly suspended;

(3) Add 250 μl of cell lysate, add 10 μl of proteinase K, invert 5-6 times, mix gently; let stand for 1-2 min, causing the cell to be cleaved and clarified;

(4) Add 350 μl of neutralizing solution, mix upside down, completely precipitate the protein, and let stand for 5 min in an ice bath;

(5) Centrifuge at 10,000 rpm for 10 min, discard the protein, and collect the supernatant in another clean and sterile 1.5 ml EP tube;

(6) Centrifuge at 12000 rpm for 5 min, prepare a labeled recovery column, transfer the supernatant to a recovery column, centrifuge at 12000 rpm for 1 min, and discard the lower layer waste liquid;

(7) Add 600 μl of the pre-configured rinse solution, centrifuge at 12000 rpm for 1 min, discard the lower layer waste liquid, repeat once, and vacate for 1 min at 12000 rpm to further remove the residual rinse liquid;

(8) Transfer the recovery column to a new 1.5ml EP tube in a clean bench, let stand for 10-20min, and dry naturally;

(9) Add 95 μl Nuclease-Free Water to the recovery column, let stand for 2 min, centrifuge at 12000 rpm for 2 min, collect samples for numbering, electrophoresis, determine concentration, and conduct quality inspection.

6. Plasmid transfection and lentiviral harvesting

(1) 24 hours before transfection, 293T cells in logarithmic growth phase were digested with trypsin, adjusted to a cell density of about 5×10 ⁶ cells/15 ml in a medium containing 10% serum, and re-inoculated into a 10 cm cell culture dish at 37 ° C. Culture in a 5% CO ₂ incubator. It can be used for transfection when the cell density reaches 70%-80%;

(2) 2 hours before transfection, replaced with serum-free medium;

(3) Adding each prepared DNA solution (GV vector plasmid 20 μg, pHelper 1.0 vector plasmid 15 μg, pHelper 2.0 vector plasmid 10 μg) to a sterilized centrifuge tube, and mixing uniformly with lipo3000 transfection reagent to adjust the total volume to 1 ml. Incubate for 5 min at room temperature;

(4) The mixture was slowly added dropwise to the culture medium of 293T cells, mixed, and cultured in a 37 ° C, 5% CO ₂ cell incubator;

Note: The addition process must be uniform, and do not blow the cells as much as possible.

(5) After 6 hours of culture, discard the medium containing the transfection mixture, wash it once with 10 ml of PBS solution, gently shake the culture dish to wash the residual transfection mixture and discard;

(6) Slowly add 20 ml of cell culture medium containing 10% serum, and continue to culture for 48-72 h at 37 ° C in a 5% CO 2 incubator.

7. Lentivirus concentration and purification

(1) According to the state of the cells, the supernatant of 293T cells collected 48 hours after transfection (calculated as 0h after transfection) was collected;

(2) centrifugation at 4000 g for 10 min at 4 ° C to remove cell debris;

(3) filtering the supernatant in a 40 ml ultracentrifuge tube with a 0.45 μm filter;

(4) separately sample the sample, and place the ultracentrifuge tube with the virus supernatant into the Beckman ultracentrifuge one by one, set the centrifugal parameter to 25000 rpm, the centrifugation time is 2 h, and the centrifugation temperature is controlled at 4 ° C;

(5) After the end of centrifugation, discard the supernatant, try to remove the liquid remaining on the tube wall, add the virus preservation solution (can be replaced by PBS or cell culture medium), and gently resuspend it by repeated blowing;

Note: There will be some loss of virus recovery in this step, as far as possible to avoid long-term exposure of the virus to room temperature.

(6) After being fully dissolved, centrifuge at 10,000 rpm at high speed, and after centrifugation for 5 minutes, take the supernatant and dispense as required;

(7) Prepare samples to be tested.

Expression detection of Cas13a virus in eukaryotic cells

Target cells: 293T (purchased from ATCC)

Medium: DMEM medium (containing 10% fetal bovine serum)

Antibody information:

Primary antibody: FLAG, Sigma, F1804, 1:3000

Secondary antibody: Mouse, santa-cruz, sc-2005, 1:4000

Western Blot experimental process:

After the cells were ready, the medium was discarded, and the cells were washed 3 times with pre-cooled 4 ° C PBS, and the PBS was discarded and the dishes were placed on ice. The RIPA cell lysate was mixed with PMSF at 100:1 and pre-cooled on ice. Add 10 μl of lysate to a 10 cm dish, scrape the cells, transfer the cells and lysate to a 1.5 ml EP tube, and lyse on ice for 30 min. Centrifuge at 12000 rpm for 15 min at 4 °C. Move the supernatant to another 1.5m lEP tube.

BCA protein concentration assay: A standard curve was prepared according to the BCA kit instructions. BCA and CuCl2 were uniformly mixed at 50:1, and 200 μl of the mixed BCA solution was added to each of the auxiliary wells. The collected proteins were diluted to 1/10 with PBS, and 20 μl was added to each of the sub-wells. The protein and BCA were mixed uniformly and placed in a 37 ° C incubator for 30 min, and the microplate reader was used to measure the absorbance at 562 nm. The protein concentration was calculated using a standard curve.

The remaining protein supernatant was added to the protein loading buffer, boiled at 100 ° C for 10 min, and stored at -20 ° C.

Polyacrylamide gel electrophoresis: The 10% polyacrylamide gel formulation is as follows:

20-40 μg of protein was added to each well, and electrophoresed at 80 V for 40 min, and then changed to 150 V to the loading buffer to the bottom of the gel. The electrophoresis was terminated, and the protein was transferred to a PVDF membrane, and the membrane was transferred at 100 V for about 60 min. The PVDF membrane was blocked with 5% BSA for 1 h, and the primary antibody was blocked overnight (anti-Flag antibody (CST, 1:1000 dilution). The PVDF membrane was rewarmed at room temperature for 1 h, the antibody was discarded, and PBST was washed 3 times for 10 min each time. The anti-mouse or anti-rabbit secondary antibody against horseradish catalase was incubated for 1 h at room temperature and washed again with PBST for 3 min each time for 10 min. Immunoassay using G:BOX F3 gel imaging system (Syngene, UK) .

The results are shown in Fig. 1, 1#: WB standard-SURVIVIN-3FLAG-GFP (molecular size: 48KD); 2#: 293T cells in the control group; 3#: samples transfected with 293T for the target gene plasmid.

By Western Blot, a characteristic band near 129KD was observed, which was consistent with the target gene fusion protein. The results showed that the virus detected the target band with FLAG antibody and over-expressed successfully.

Second, the CRISPR-Cas13a system is capable of triggering random shear in glioma U87 cells.

U87-Cas13a overexpressing cells were constructed by lentiviral overexpression. The purified Cas13a lentivirus (titer 2E+8/TU/ml) was added dropwise to U87 cells at a dose of 1 ul/ml. After 48 hours, the cells were screened with puromycin at a working concentration of 2 ug/ml. One week after screening, U87-Cas13a overexpressing cells were obtained. EGFP-PEST is a rapidly degrading EGFP protein that is very convenient for detecting changes in RNA levels in cells. The EGFP-PEST fluorescent virus (purchased from the Jikai gene) was transfected into U87-Cas13a cells to obtain U87-Cas13a-EGFP cells. The transfection method was the same as the Cas13a lentivirus transfection process.

Designing crRNA sequences for EGFP

crRNA-EGFP: CCACCCUGACCUACGGCGUGCAGUGCUUC

The crRNA-EGFP was transfected into U87 cells using lipo3000 (purchased from Infinera), and the transfection dose of crRNA was 300 ng/ml. The transfection method was carried out according to the lipo3000 instructions. The cells were fixed at 0h, 2h, 4h, and 8h, respectively, and the changes of EGFP fluorescence levels were observed under confocal microscopy. The results of immunofluorescence showed that the CRISPR-Cas13a system was able to effectively attenuate EGFP expression in U87 cells (as shown in Figure 2).

Further, RNA of U87-Cas13a-EGFP cells transfected with crRNA-EGFP was extracted at different time points, and real-time quantitative PCR was used for detection (Real Time PCR), and the results of qRT-PCR according to GAPDH showed that 2h and At 4h, the expression of EGFP mRNA was significantly lower than that of the control group, while at 8h, the expression of EGFP began to increase (as shown in Figure 3).

Looking at the original data of Real Time PCR, it was found that from the 4th hour, the number of GAPDH cycles gradually increased under the condition that the initial RNA reverse transcription amount was consistent, indicating that GAPDH lost the function of the housekeeping gene (see Table 1).

Table 1. List of ct values for EGFP and GAPDH in Real Time PCR experiments

It is concluded that GAPDH may have degradation due to the CRISPR-Cas13a system over time. To verify this inference, two unrelated genes were detected, and the ct values of L3MBTL1 and HOTAIR were changed at different time points. It was found that at 4h and 8h, the ct values of both genes increased, which was consistent with the change of GAPDH (see Table 2).

Table 2: Number of cycles of the L3MBTL1 and HOTAIR genes in the Real Time experiment

To further validate the random splicing effect of CRISPR-Cas13a system in U87 cells, total RNA-transfected U87-Cas13a-EGFP cells were extracted at 0h, 0.5h, 1h, 2h, 4h and 8h. RNA was detected by denaturing gel electrophoresis. As shown in Fig. 4, the ribosomal 28S and 18S subunits were degraded at 4h and 8h. This direct evidence illustrates the existence of random shear effects in eukaryotic cells and also opens the door to the application of random shear effects.

The CRISPR-Cas13a system is capable of triggering apoptosis in EGFRvIII-specific cells.

Overexpression of EGFR and activation of downstream signaling pathways are common in many cancers. The type III mutation of EGFR (EGFRvIII) is a specific mutant form in glioma. EGFRvIII is a mutant in which wild type EGFR lacks exons 2 to 7 and is directly linked to exon 1 and exon 8. EGFRvIII is capable of sustained activation, and glioma cells overexpressing EGFRvIII are highly malignant. The present invention contemplates the use of the CRISPR-Cas13a system to clear EGFRvIII positive glioma cells. To this end, five crRNAs were designed for the EGFRvIII-specific exon No. 1 and exon 8 junctions.

crRNA-EGFRvIII-1 (crRNA1): CUGGAGGAAAAGAAAGGUAAUUAUGUGGU

crRNA-EGFRvIII-2 (crRNA2): GGAGGAAAAGAAAGGUAAUUAUGUGGUGA

crRNA-EGFRvIII-3 (crRNA3): GAGGAAAAGAAAGGUAAUUAUGUGGUGAC

crRNA-EGFRvIII-4 (crRNA4): AAGAAAGGUAAUUAUGUGGUGACAGAUCA

crRNA-EGFRvIII-5 (crRNA5): AGAAAGGUAAUUAUGUGGUGACAGAUCAC

The EGFRvIII virus (purchased from the Jikai gene) was transfected into U87-Cas13a cells to obtain U87-Cas13a-EGFRvIII cells. Using lipo3000, crRNA1~5 were transfected into cells, and RNA was extracted at 4h and 8h, and the ct value of Real Time PCR was read. The results showed that treatment with crRNA2 increased the number of cycles of EGFRvIII and GAPDH (see Table 3).

Table 3. Number of cycles of EGFRvIII and GAPDH genes in the Real Time experiment

To further verify the random shear effect of the CRISPR-Cas13a system in gliomas, U87-Cas13a-EGFRvIII cells were divided into three groups, one group transfected with crRNA2, one group transfected with crRNA5, and the control group with single transfection reagent lipo3000. After 4 h of treatment, cells were harvested for single cell sequencing. In the case of the same number of cells, the control group built 6763 cells, the crRNA5 group built 6240 cells, and the crRNA2 group only collected 2504 cells, and the number of RNAs in these cells was much smaller than that. The control group and the crRNA5 group (Fig. 5).

Further, U87-Cas13a-EGFRvIII cells were pretreated with lipo3000, crRNA2 and crRNA5 for 4 hours, and 500,000 cells were injected intracranially into mouse brain to establish a mouse glioma model. The results of small animal imaging showed that the crRNA2 treatment group effectively inhibited the tumor formation rate and tumor size of the mice. The experimental results show that (as shown in Figure 6), the CRISPR-Cas13 system can trigger random shear effects in eukaryotic tumor systems and inhibit and kill tumors.

The present invention further validates the random scission effect of CRISPR/Cas13a in other tumor cells, namely LN229 cell line (human glioma cell) GL261 (mouse glioma cell line) and ACHN (human kidney cancer cell line). . Cas13a and EGFRvIII were overexpressed in these three cells in a manner consistent with the steps in U87. The expression changes of EGFRvIII, GAPDH and Cas13a in these cells after transfection of crRNA2 were verified by Real Time PCR. Using the expression level of 0h as a standard, it was found that regardless of the target gene EGFRvIII or the non-specific genes GAPDH and Cas13a, the expression levels decreased significantly at 4h and 8h, indicating that non-specific shear effects also exist in LN229, GL261 and ACHN cells ( Figure 7).

Claims (18)

1. Application of crRNA-mediated CRISPR/Cas13a gene editing system in tumor cells.
2. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 1 in tumor cells, characterized in that the CRISPR/Cas13a gene editing system inhibits or kills tumors by triggering random shear effects in tumor cells cell.
3. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to any one of claims 1 to 2 in a tumor cell, characterized in that the tumor cell is a glioma cell line or a glioma mutant cell. Or human kidney cancer cell line.
4. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 3 in a tumor cell, characterized in that the glioma cell is a human U87 cell, a human LN229 cell line or a mouse GL261 cell line; The glioma mutant cell is U87 EGFR VIII cell; the human renal cancer cell line is a human ACHN cell line.
5. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to any one of claims 1 to 4 in a tumor cell, characterized in that the expression vector of the Cas13a gene in a tumor cell is a plasmid expression vector or a virus. Expression vector.
6. The crRNA-mediated CRISPR/Cas13a gene editing system according to claim 5, wherein the plasmid expression vector is a prokaryotic and eukaryotic plasmid expression vector; the viral expression vector is an adenovirus Vector or lentiviral vector.
7. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to any one of claims 5-6 in tumor cells, characterized in that the plasmid expression vector is pcDNA3.1 and the viral expression vector is GV341.
8. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 4 in tumor cells, characterized in that the sequence of the crRNA in U87-Cas13a-EGFP cells is SEQ ID NO.
9. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 4 in tumor cells, characterized in that the sequence of the crRNA in U87-Cas13a-EGFR VIII cells is SEQ ID NO.
10. Application of crRNA-mediated CRISPR/Cas13a gene editing system in the treatment of tumor diseases.
11. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 10 for treating a tumor-like disease, characterized in that the CRISPR/Cas13a gene editing system inhibits random shear effect in tumor cells or Kill tumor cells.
12. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to any one of claims 10-11 for treating a tumor-like disease, characterized in that the tumor cell is a glioma cell line or a glioma mutation Type cell or human kidney cancer cell line.
13. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 12 for treating a tumor-like disease, characterized in that the glioma cell is a human U87 cell, a human LN229 cell line or a mouse GL261 cell line. The glioma mutant cell is U87 EGFR VIII cell; the human renal cancer cell line is a human ACHN cell line.
14. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to any one of claims 10 to 13 for treating a tumor-like disease, characterized in that the expression vector of the Cas13a gene in a tumor cell is a plasmid expression vector. Or a viral expression vector.
15. The crRNA-mediated CRISPR/Cas13a gene editing system according to claim 14, wherein the plasmid expression vector is a prokaryotic and eukaryotic plasmid expression vector; and the viral expression vector is Adenoviral vector or lentiviral vector.
16. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claims 14-15 for the treatment of tumor-like diseases, characterized in that the plasmid expression vector is pcDNA3.1 and the viral expression vector is GV341.
17. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 13 for treating a tumor-like disease, characterized in that the sequence of the crRNA in U87-Cas13a-EGFP cells is SEQ ID NO.
18. The use of the crRNA-mediated CRISPR/Cas13a gene editing system according to claim 13 for the treatment of a tumor-like disease, characterized in that the sequence of the crRNA in the U87-Cas13a-EGFR VIII cell is SEQ ID NO.

Images