WO2019213626A1 - In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells - Google Patents

In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells Download PDF

Info

Publication number
WO2019213626A1
WO2019213626A1 PCT/US2019/030748 US2019030748W WO2019213626A1 WO 2019213626 A1 WO2019213626 A1 WO 2019213626A1 US 2019030748 W US2019030748 W US 2019030748W WO 2019213626 A1 WO2019213626 A1 WO 2019213626A1
Authority
WO
WIPO (PCT)
Prior art keywords
muscle
virus
nuclease
cells
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/030748
Other languages
English (en)
French (fr)
Inventor
Amy J. WAGERS
Kexian ZHU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard University
Original Assignee
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harvard University filed Critical Harvard University
Priority to JP2021510297A priority Critical patent/JP7498499B2/ja
Priority to CA3099332A priority patent/CA3099332A1/en
Priority to CN201980042149.7A priority patent/CN112512595A/zh
Priority to AU2019262225A priority patent/AU2019262225B2/en
Priority to EP19796061.0A priority patent/EP3787692A4/en
Priority to US17/052,798 priority patent/US20210363546A1/en
Publication of WO2019213626A1 publication Critical patent/WO2019213626A1/en
Anticipated expiration legal-status Critical
Priority to JP2024085010A priority patent/JP2024100980A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14142Use of virus, viral particle or viral elements as a vector virus or viral particle as vehicle, e.g. encapsulating small organic molecule
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • Sequence-targeting nuclease such as CRISPR/Cas9 provide powerful tools to edit mammalian genomes by engaging cellular mechanisms of DNA double strand break (DSB) repair.
  • Non-homologous end joining (NHEJ) and homology-directed repair (HDR) are the major pathways used by cells to mend nuclease-generated DSBs and prevent genomic lesions and cell death. While NHEJ is active throughout the cell cycle, and in non-dividing cells, this error-prone pathway produces variable sequence outcomes due to highly unpredictable nucleotide insertions and deletions.
  • HDR offers more precise gene-editing outcomes, as well as the unique capacity to introduce entirely new sequence elements, but HDR is generally believed to be inefficient in post-mitotic organs and requires homologous DNA present on either endogenous chromosomes or exogenous templates. While recent studies have investigated the use of CRISPR-induced HDR in cultured cells, zygotes and with local delivery to specific tissues, the feasibility of achieving multi-organ HDR in vivo in postnatal mammals has not been tested. In addition, whether in vivo HDR targeting could be achieved in regenerative stem cells, providing a reservoir of edited cells to support ongoing tissue turnover and repair, has yet to be explored.
  • HDR homology directed repair
  • the invention described herein also provides the first demonstration of successful HDR-editing in tissue stem cells within their native niche, which will uniquely enable directed manipulation of stem cell genomes therapeutically and experimentally, without the need to isolate, expand or transplant these rare cells.
  • the ability to inscribe irreversible and potentially enduring precise genome modification in the neonatal mammalian heart and postnatal mammalian skeletal muscle satellite cells opens exciting new avenues for future therapeutic interventions for many currently intractable cardiac and muscle diseases, including for Duchenne Muscular Dystrophy (DMD).
  • DMD Duchenne Muscular Dystrophy
  • Some aspects of the invention are directed to a method of modifying the genome of a muscle precursor cell in vivo (e.g., in the muscle precursor niche) in a subject, comprising contacting the muscle cell with one or more viruses, wherein the one or more viruses transduce a nucleic acid sequence encoding a sequence-targeting nuclease in the muscle precursor cell and transduce a donor template in the muscle precursor cell, wherein the modification comprises the insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease and a donor template. In some embodiments, the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template. In some embodiments, the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence targeting nuclease, and a second virus which transduces a donor template and one or more gRNAs (e.g., one or two).
  • gRNAs e.g., one or two
  • the sequence-targeting nuclease is a Zinc- Finger Nuclease (ZFN), a Transcription activator-like effector nuclease (TALEN), a Cas nuclease (e.g., Cas9 nuclease), or a functional fragment thereof.
  • ZFN Zinc- Finger Nuclease
  • TALEN Transcription activator-like effector nuclease
  • Cas nuclease e.g., Cas9 nuclease
  • the nucleic acid sequence encoding a sequence targeting nuclease is transduced with a muscle precursor cell specific promoter, a constitutive promoter, or a ubiquitous promoter.
  • the nucleic acid sequence encoding a donor template and, optionally, one or more gRNAs is transduced with the U6 or Hl promoter.
  • the muscle precursor cell is a muscle stem cell.
  • At least 1% of muscle precursor cells in the subject are modified to comprise an insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template.
  • the modification is of one allele. In some embodiments, the modification is of both alleles.
  • the subject e.g., human or mouse
  • the subject is not an infant, or juvenile, or under 30 years of age.
  • the virus is AAV serotype 6, 8, 9, 10 or Anc80.
  • the virus is administered systemically to the subject or the virus is administered by intramuscular injection.
  • Some aspects of the disclosure are directed to a myofibre comprising nuclei (e.g., myonuclei) having genomes modified by the methods disclosed herein.
  • Some aspects of the disclosure are directed towards a method of modifying the genome of a cardiac cell in vivo in a subject, comprising contacting the cardiac cell with one or more viruses, wherein the one or more viruses transduce a nucleic acid sequence encoding a sequence-targeting nuclease in the cardiac cell, and transduce a donor template in the cardiac cell, wherein the modification comprises the insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template, and wherein the cardiac cell is a DNA synthesizing cardiac cell or a replicating cardiac cell.
  • the cardiac cell is selected from the group consisting of a mammalian postmitotic cardiomyocyte, a mammalian postmitotic cardiomyocyte capable of DNA synthesis without division/proliferation, a human postmitotic cardiomyocyte, a human postmitotic cardiomyocyte capable of DNA synthesis without division/proliferation, a cardiomyocyte precursor cell, a proliferating mesenchymal cardiac cell, a proliferating endothelial cardiac cell, and a cardiac progenitor cell.
  • the subject e.g., human or mouse
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence targeting nuclease and a donor template.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence targeting nuclease, and a second virus which transduces a donor template.
  • the one or more viruses comprises a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template and one or more gRNAs.
  • the sequence-targeting nuclease is a Zinc-Finger Nuclease (ZFN), a Transcription activator-like effector nuclease (TALEN), a Cas nuclease (e.g., Cas9 nuclease), or a functional fragment thereof.
  • the nucleic acid sequence encoding a sequence-targeting nuclease is transduced with a cardiac specific promoter, a ubiquitous promoter or a non-specific promoter.
  • the virus is AAV serotype 6, 8, 9, 10 or Anc80. In some embodiments, at least 1.6% of the cardiomyocytes in the subject are modified.
  • Some aspects of the disclosure are directed to a cardiac tissue comprising cardiac muscle cells modified by the methods disclosed herein.
  • Some aspects of the disclosure are directed to a method of targeting a specific striated muscle type for genomic modification in vivo in a subject via homology directed repair, comprising systemically administering with one or more viruses, wherein the one or more viruses transduce a nucleic acid sequence encoding a sequence-targeting nuclease in striated muscle cells and transduce a donor template in striated muscle cells, wherein the modification comprises the insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template, and wherein, due to the age of the subject, genomic modification preferentially occurs to at least one type of striated muscle.
  • the genomes of muscle cells are preferentially modified.
  • the genomes of cardiac cells e.g., proliferating or DNA synthesizing cardiac cells.
  • FIGS. 1A-1J illustrate a GFP/BFP colour switch reporter system that enables discrimination and tracking of NHEJ- and HDR-edited myoblasts.
  • FIG. 1A is a schematic of blue/green colour switch reporter for discriminating HDR vs. imprecise NHEJ. Imprecise NHEJ disrupts GFP fluorescence while HDR substitutions enable spectral shift from GFP to BFP and create a Btgl restriction site for RFLP analysis.
  • FIG. 1B shows AAV constructs used for transfection and virus production. ITR, inverted terminal repeat; U6, EG6 promoter; CMV, CMV promoter; NLS, nuclear localization signal; pA: polyA.
  • FIG. 1C provides an experimental design.
  • Skeletal muscle stem cells satellite cells
  • FIG. 1B Transfected cells were expanded in culture, then sorted based on blue or green fluorescence for intramuscular transplantation into pre-injured recipient mice.
  • FIGGS. lD,lE are representative flow cytometric analysis of myoblasts transfected with gRNA- BFPtemplate alone (FIG. 1D, control) or myoblasts transfected with SaCas9 and gRNA-BFP template (FIG. 1E, experimental).
  • FIGGS. lF,lG show frequency (%) of CRISPR-HDR edited BFP+ myoblasts (FIG. 1F) and CRISPR-NHEJ edited GFP-/BFP- myoblasts (FIG.
  • FIG. 1G shows edited BFP+ SMPs retain myogenic potential.
  • GFP+ and BFP+ skeletal muscle progenitors were isolated by FACS and the Tibialis anterior (TA) muscles of mdx mice were injected with GFP+ (bottom row) or CRISPR/Cas9-HDR-edited BFP+ (top row) stem cells. The TA was then examined by fluorescence detection of BFP or GFP. Scale bar, 50um. Green, GFP; Blue, BFP; Red, Wheat Germ Agglutinin (WGA);
  • FIG. II shows PCR amplification at GFP locus followed by Btgl digestion of FACS sorted transfected cells. Three distinct populations found: GFP+ SMPs (No editing), BFP+ SMPs (HDR), and GFP-/BFP- SMPs (NHEJ).
  • FIG. 1J shows sorted CRISPR/Cas9-HDR edited BFP+ SMPs retain BFP expression following expansion. BFP+ SMPs analyzed following two weeks of expansion.
  • FIGS. 2A-2G illustrate systemic AAV-CRISPR enables in vivo CRISPR- NHEJ and CRISPR-HDR in the liver, heart and skeletal muscle of three week old GFP / ⁇ rncix mice.
  • FIG. 2A shows the experimental design. Mdx mice carrying a single CAG-GFP allele were injected with A A Vs carrying GFPgRNA-BFP template only (control) or AAV- GFPgRNA-BFPtemplate plus AAV-SaCas9 (Dual CRISPR/Cas9 system). Organs were harvested 4 weeks later for fluorescence and genomic analyses.
  • FIG. 2B, 2D, 2F show representative fluorescence images for detection of CRISPR-NHEJ edited (GFP-/BFP-) and CRISPR-HDR edited (BFP+) cells in liver (FIG. 2B), heart (FIG. 2D), and tibialis anterior (skeletal muscle, FIG. 2F) after systemic co-injection of AAV-GFPgRNA-BFP template and AAV-SaCas9. Scale bars, 50um. Green, GFP; Blue, BFP; Red, Wheat Germ Agglutinin (WGA): White, TO-PRO-3. (FIGS.
  • FIG. 2C, 2E, 2G shows frequency (%) of BFP+ (HDR-edited, left plots) or GFP-/BFP- (NHEJ-edited, right plots) cells in liver (FIG. 2C), heart (FIG. 2E) or tibialis anterior (FIG. 2G).
  • NHEJ -editing could not be quantified for skeletal myofibres (i.e., myofibers) due to the high degree of multinucleation in this tissue, which prevents detection of green fluorescence loss unless nearly all myonuclei are targeted.
  • FIGS. 3A-3D show satellite ceils can be targeted in vivo via CRISPR-HDR and retain capacity to fuse and form myotubes in vitro
  • FIG. 3 A shows representative flow cytometric analysis of skeletal muscle satellite cells from juvenile rncix mice injected intravenously with vehicle or AAV-GFPgRNA-BFPtemplate alone as controls or with AAV- GFPgRN A-B FPtemplate and AAV-SaCas9 to enable CRISPR-NHEJ and CRISPR-HDR.
  • FIGGS. 3B, 3C show frequency (%) of CRISPR-HDR edited BFP+ satellite cells (FIG.
  • 3D shows representative fluoreseence detection of myotubes differentiated from FACS sorted in vivo AAV-HDR injected GFP+ (unedited), BFP+ (HDR) and GFP- /BFP- (NHEJ) satellite ceils.
  • Scale bar lOOum. Green, GFP; Blue, BFP; Red, myosin heavy chain (MHC); White TO-PRO-3.
  • FIGS. 4A-4F shows delivery of color conversion system via AAV8 in P3 mice reveals tissue-dependent times restrictions on in vivo CRISPR-HDR targeting.
  • FIG. 4A shows experimental design. P3 pups (wild-type and MDX) carrying a single CAG-GFP allele were injected with A A Vs carrying GFPgRNA-BFP template only (control) or AAV- GFPgRNA-BFP template plus A.AV-SaCas9. Organs were harvested 4 weeks later for fluorescence and genomic analyses.
  • FIGGS. 4B, 4D, 4F show representative fluorescence images for detection of CRISPR-NHEJ edited (GFP-/BFP-) and CRISPR-HDR edited (BFP+) ceils in liver (FIG. 4B), heart (FIG. 4D), and tibialis anterior muscle (FIG.
  • FIG. 4F show frequency (%) of GFP-/ BFP- (NHEJ) and BFP+ (HDR) cells in liver (FIG. 4C) and heart (FIG. 4E) of treated GFP ;mdx and wild-type (CAG-GFP) mice.
  • FIGS. 5A-5D illustrate in vitro testing of GFP/BFP colour switching reporter system components.
  • FIG. 5A show representative FACS plots showing that GFP and BFP can be distinguished by flow cytometry mdx TTFs (no fluorescent protein) were transfected with plasmids of either CAG-GFP or CAG-BFP and analysed by flow cytometry 3 days later.
  • FIG. 5B shows design of colour switching substitutions and GFPgRNAs. 2 base
  • substitutions cause spectral shift and create a Btgl site for restriction fragment length polymorphism (RFLP) analysis.
  • 3 SaCas9-compatible gRNAs targeting GFP near the substitution site were selected.
  • GFPgRNA2 cuts closest to the desired colour-determining bases and recognition by this gRNA is disabled by HDR substitutions, which protects the BFP template and genomic HDR product from further Cas9 targeting.
  • FIG. 5C show GFP disruption by GFPgRNAs.
  • GFP +l ,mdx TTFs were transfected with SaCas9 alone (control) or with SaCas9 plus one of the three gRNAs targeting GFP (see FIG. 5B). All three gRNAs disrupt GFP expression.
  • GFPgRNA2 was selected for use in subsequent experiments due to its proximity to the colour switching mutations.
  • GFPgRNA2 is referred to as GFPgRNA or gRNA in the main text.
  • SSC side scatter.
  • FIG. 5D shows GFP disruption and lack of BFP expression in myoblasts transfected with SaCas9 + GFPgRNA2, without BFP template.
  • GFP +l ,mdx myoblasts were transfected with lipofectamine only (lipo, control) or with SaCas9 + GFPgRNA2, in the absence of the BFP template, and analysed by flow' cytometry for GFP and BFP expression.
  • GFP-/BFP- CRISPR-NHEJ edited
  • BFP+ cells were present in cultures transfected with SaCas9 and gRNA, indicating that NHEJ alone is unable to induce green-to-blue spectral shift.
  • FIGS. 6A-6C illustrate differentiation and sequencing confirmation of ex vivo CRISPR-NHEJ and HDR edited myoblasts.
  • FIG. 6A shows representative fluorescence images of myotubes differentiated from FACS sorted GFP+ (unedited), BFP+ (CRISPR- HDR edited) and GFP-/BFP- (CRISPR-NHEJ edited) myoblasts transfected previously with SaCas9 and GFPgRNA-BFP template. Scale bar, lOOum. Green, GFP; Blue, BFP; Red, myosin heavy chain (MHC).
  • FIGS. 6A-6C illustrate differentiation and sequencing confirmation of ex vivo CRISPR-NHEJ and HDR edited myoblasts.
  • FIGS. 6A-6C illustrate differentiation and sequencing confirmation of ex vivo CRISPR-NHEJ and HDR edited myoblasts.
  • FIGS. 6A-6C illustrate differentiation and sequencing confirmation of ex vivo CRISPR-NHEJ and HDR edited myoblasts
  • FIG. 6B shows restriction fragment length polymorphism (RFLP) analysis of genomic PCR products from FACS sorted, culture expanded myoblasts. M, marker.
  • FIG. 6C shows Sanger sequencing of genomic amplicons, aligned to GFP and BFP reference sequences confirms HDR in sorted BFP+ cells and NHEJ in sorted GFP-/BFP- ce!ls.
  • FIG. 7 illustrates that systemic AAV-CRISPR enables in vivo CRISPR-NHEJ and CRISPR-HDR editing in myofihres of the tibialis anterior muscle of juvenile mdx animals.
  • FIGS. 8A-8B illustrate confirmation of CRISPR-NHEJ and HDR editing of skeletal muscle satellite ceils in vivo by re-sorting of GFP+, GFP- /BFP- and BFP+ cells.
  • FIG. 8A shows representative flow cytometric data showing analysis of GFP and BFP expression by skeletal muscle satellite cells isolated from juvenile mdx mice previously injected intravenously with vehicle AAV-GFPgRNA-BFPtemplate alone as control or AAV- GFPgRN A - B FPtemplate and A.AV-SaCas9. Sort gates used for isolation of GFP-f (unedited), GFP-/BFP- (NHEJ-edited), and BFP+ (HDR-edited) cells are indicated. Sorted populations were expanded separately in culture for 2 weeks and then harvested for re-analysis (shown in FIG. 8B).
  • FIG. SB shows representative flow cytometric analysis of GFP and BFP expression in culture expanded GFP-/BFP-, GFP+ and BFP+ cells previously sorted from AAV-HDR injected mice.
  • FIGS. 9A-9B illustrates that systemic AAV-CRISPR enables in vivo CRISPR- NHEJ and CRISPR-HDR editing in neonatal C57BL/6J animals.
  • FIGS. 10A-10C illustrate Genomic PCR and Next- Generation Sequencing validation of in vivo CRISPR-NHEJ and CRISPR-HDR editing.
  • FIG. 10A shows schematics of the GFP/BFP genomic transgene loci and primers used for genomic PCR. Forward primer binds upstream of GFP/BFP start site on the genomic sequence, but not template DNA, and reverse primer binds downstrea of Cas9 cutting site and colour switching substitutions. This primer pair amplifies the genomic transgene locus, but not the template sequence (due to absence of forward primer binding sequences in the template).
  • FIGS. 10A-10C illustrate Genomic PCR and Next- Generation Sequencing validation of in vivo CRISPR-NHEJ and CRISPR-HDR editing.
  • FIG. 10A shows schematics of the GFP/BFP genomic transgene loci and primers used for genomic PCR. Forward primer binds upstream of GFP/BFP start site on the genomic sequence, but not template DNA, and reverse
  • IOC show's read counts and allele frequencies (# unedited, HDR-edited, or NHEJ-edited reads/total reads mapped to the GFP/BFP sequence) of HDR- and NHEJ-edited alleles detected in satellite cells sorted from P2I GFP + ' ;mi/x mice administered AAV-HDR or AAV-control in vivo.
  • BFP and GFP7BFF cells were sorted from AAV-SaCas9 and AAV-gRNA-BFPtemplate injected experimental mice (AAV-HDR), and GFP + cells were sorted from AAV-gRNA-BFPtemplate injected control mice (AAV-control).
  • FIGS. 11A-11C illustrate that satellite cells in neonatal skeletal muscles are infrequently targeted with systemic AAV-CRISPR-HDR.
  • FIG. 11 A shows representative flow cytometric analysis of skeletal muscle satellite cells isolated from neonatal (P3) mdx and C57BL/6 mice 4 weeks after in traperitoneal injection with AAV-GFPgRNA-BFPtemplate alone as control or with AAV- GFPgRNA-BFPtemplate and AAV-SaCas9 to enable
  • FIG. 12 show's CRISPR-mediated editing results in a decrease of GFP fluorescence intensity in GFP mice in liver, heart, and tibialis anterior in mice treated at 3 days old (P3) or 21 days old (P21).
  • FIG. 14 show's Subiaminar mononuclear cells in HDR-edited muscle are BFP+. Satellite cells are defined as subiaminar mononuclear cells.
  • Some aspects of the disclosure are directed to a method of modifying the genome of a muscle precursor cell in vivo in a subject, comprising contacting the muscle cell with one or more viruses, wherein the one or more viruses transduce a nucleic acid sequence encoding a sequence-targeting nuclease in the muscle precursor cell, and transduce a donor template in the muscle precursor cell, wherein the modification comprises the insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template (e.g., via homologous recombination with the donor sequence).
  • Homologous recombination (HR) mediated repair uses homologous donor DNA as a template to repair a double stranded DNA break. If the sequence of the donor DNA differs from the genomic sequence, this process leads to the introduction of sequence changes into the genome.
  • HR homologous recombination
  • HDR homology-directed repair
  • the phase "modification of the genome” as used herein encompasses the addition of a regulatory sequence or a nucleotide sequence encoding a gene product via homologous recombination (i.e., insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template).
  • the modification comprises replacement of a genomic region associated with a disease or condition (e.g., a genetic mutation) with a non-pathological genomic region via homologous recombination.
  • the modification comprises replacement of a genomic region comprising a mutation with a wild-type or non-mutated genomic region.
  • the mutation comprises a substitution or deletion mutation.
  • the modification comprises insertion of a nucleotide sequence in the genome corresponding to a deleted portion of a deletion mutation via homologous recombination. In some embodiments, the modification of the genome comprises insertion and/or replacement of a genomic sequence via homologous recombination that modulates the expression, activity or stability of a gene product. In some embodiments, the modification of the genome comprises modification of both alleles of the subject. In some embodiments, the
  • modification of the genome comprises modification of one allele of the subject.
  • genome modification comprises modification of one or more genes associated with biological processes.
  • biological processes comprise epigenetic regulation or proteostasis (e.g., autophagy, ubiquitin-proteasome, heat shock response, anti-oxidant response, unfolded protein response).
  • a“subject” means a human or animal (e.g., a primate).
  • the animal is a vertebrate such as a primate, rodent, domestic animal or game animal.
  • Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus.
  • Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters.
  • Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon.
  • Patient or subject includes any subset of the foregoing, e.g., all of the above, but excluding one or more groups or species such as humans, primates or rodents.
  • the subject is a mammal, e.g., a primate, e.g., a human.
  • the terms,“patient”,“individual” and“subject” are used interchangeably herein.
  • the subject is a mammal.
  • the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples.
  • a subject can be male or female.
  • a “subject” may be any vertebrate organism in various embodiments.
  • a subject may be individual to whom an agent is administered, e.g., for experimental, diagnostic, and/or therapeutic purposes or from whom a sample is obtained or on whom a procedure is performed.
  • a human subject is between newborn and 6 months old. In some embodiments, a human subject is between 6 and 24 months old. In some embodiments, a human subject is between 2 and 6, 6 and 12, or 12 and 18 years old. In some embodiments a human subject is between 18 and 30, 30 and 50, 50 and 80, or greater than 80 years old. In some embodiments, the subject is at least about 5, 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, or 90 years of age.
  • the subject is less than about 5, 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, or 90 years of age. In some embodiments, a subject is an adult. For purposes hereof a human at least 18 years of age is considered an adult. In some
  • the subject is a juvenile (e.g., less than about 18, 12 or 6 years of age for a human subject). In some embodiments, the subject is not a juvenile (e.g., less than about 18, 12 or 6 years of age for a human subject). In some embodiments a subject is an embryo. In some embodiments a subject is a fetus. In certain embodiments an agent is administered to a pregnant female in order to treat or cause a biological effect on an embryo or fetus in utero.
  • the subject has a disease or condition involving muscle tissue.
  • the subject has, or has been diagnosed with a muscular dystrophy.
  • the muscular dystrophy is selected from myotonic muscular dystrophy, Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, and Emery- Dreifuss muscular dystrophy.
  • the muscular dystrophy is Becker muscular dystrophy or Duchenne muscular dystrophy.
  • the methods disclosed herein are used to treat a disease or condition of the subject.
  • contacting a cell with one or more viruses can comprise administration of the virus systemically (e.g., intravenously) or locally (e.g., intramuscular injection) into the subject.
  • routes of administration may be selected (e.g., oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, and other parental routes).
  • the method of contacting is not limited and may be any suitable method available in the art.
  • virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 15 GC (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
  • the dose of replication- defective virus in the formulation is 1.0 x 10 9 GC, 5.0 X 10 9 GC, 1.0 X 10 10 GC, 5.0 X 10 10 GC, 1.0 X 10 11 GC, 5.0 X 10 11 GC, 1.0 X 10 12 GC, 5.0 X 10 12 GC, or 1.0 x 10 13 GC, 5.0 X 10 13 GC, 1.0 X 10 14 GC, 5.0 X 10 14 GC, or 1.0 x 10 15 GC.
  • the genomes of the muscle precursor cells or a subset thereof are modified.
  • at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more of the genome of the muscle precursor cells or a subset thereof are modified via homologous recombination (e.g., a genomic sequence is replaced or inserted via homologous recombination).
  • At least about 40% or more of the genome of the muscle precursor cells or a subset thereof are modified via homologous recombination (e.g., a genomic sequence is replaced or inserted via homologous recombination).
  • at least 1% of muscle precursor cells in the subject are modified to comprise an insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template.
  • At least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more of muscle precursor cells in the subject are modified to comprise an insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template.
  • the modification comprises a modification of at least one allele. In some embodiments, the modification comprises modification of both alleles.
  • Suitable viruses for use in the methods disclosed throughout the specification include, e.g., adenoviruses, adeno-associated viruses, retroviruses (e.g., lentiviruses), vaccinia virus and other poxviruses, herpesviruses (e.g., herpes simplex virus), and others.
  • the virus may or may not contain sufficient viral genetic information for production of infectious virus when introduced into host cells, i.e., viral vectors may be replication-competent or replication-defective.
  • the virus is adeno-associated virus.
  • Adeno-associated virus is a small (20 nm) replication-defective, nonenveloped virus.
  • the AAV genome a single-stranded DNA (ssDNA) about 4.7 kilobase long.
  • the genome comprises inverted terminal repeats (ITRs) at both ends of the DNA strand, and two open reading frames (ORFs): rep and cap.
  • ITRs inverted terminal repeats
  • ORFs open reading frames
  • the integrative capacity may be eliminated by removing at least part of the rep ORF from the vector resulting in vectors that remain episomal and provide sustained expression at least in non-dividing cells.
  • AAV as a gene transfer vector, a nucleic acid comprising a nucleic acid sequence encoding a desired protein or RNA, e.g., encoding a polypeptide or RNA that inhibits ATPIF1 , operably linked to a promoter, is inserted between the inverted terminal repeats (ITR) of the AAV genome.
  • ITR inverted terminal repeats
  • Adeno-associated viruses (AAV) and their use as vectors, e.g., for gene therapy, are also discussed in Snyder, RO and
  • the AAV is AAV serotype 6, 8, 9, 10 or Anc80 (disclosed in WO2015054653, incorporated herein by reference).
  • the AAV serotype is AAV serotype 2. Any AAV serotype, or modified AAV serotype, may be used as appropriate and is not limited.
  • AAV rhlO
  • Still other AAV sources may include, e.g., AAV9 [see, e.g., US 7,906,111; US 2011-0236353- Al], and/or hu37 [see, e.g., US 7,906,111; US 2011-0236353-A1], AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, [see, e.g., US Patent 7790449; US Patent 7282199] and others.
  • a recombinant AAV vector may comprise, packaged within an AAV capsid, a nucleic acid molecule containing a 5 ' AAV ITR, the expression cassettes described herein and a 3' AAV ITR.
  • an expression cassette may contain regulatory elements for an open reading frame(s) within each expression cassette and the nucleic acid molecule may optionally contain additional regulatory elements.
  • the AAV vector may contain a full-length AAV 5' inverted terminal repeat (ITR) and a full-length 3 ' ITR.
  • ITR inverted terminal repeat
  • AITR A shortened version of the 5' ITR, termed AITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted.
  • sc refers to self-complementary.
  • Self-complementary AAV refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double- stranded DNA template.
  • dsDNA double stranded DNA
  • scAAV complementary recombinant adeno-associated virus
  • the ITRs are selected from a source which differs from the AAV source of the capsid.
  • AAV2 ITRs may be selected for use with an AAV capsid having a particular efficiency for a selected cellular receptor, target tissue or viral target.
  • the ITR sequences from AAV2, or the deleted version thereof (AITR) are used for convenience and to accelerate regulatory approval.
  • ITRs from other AAV sources may be selected.
  • the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped.
  • other sources of AAV ITRs may be utilized.
  • a single- stranded AAV viral vector may be used.
  • Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., US Patent 7790449; US Patent 7282199; WO 2003/042397; WO 2005/033321, WO
  • a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap.
  • a packaging cell line that stably supplies rep and cap is transfected (transiently or stably) with a construct encoding the transgene flanked by ITRs.
  • AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus.
  • helper functions i.e., adenovirus El, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase
  • the helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscriptional level.
  • the transgene flanked by ITRs and rep/cap genes are introduced into insect cells by infection with baculovirus-based vectors.
  • baculovirus-based vectors For reviews on these production systems, see generally, e.g., Zhang et al, 2009, "Adenovirus- adeno-associated virus hybrid for large- scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of which is incorporated herein by reference in its entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514;
  • viral vectors may be used, including integrating viruses, e.g., herpesvirus or lentivirus, although other viruses may be selected.
  • viruses e.g., herpesvirus or lentivirus
  • a "replication-defective virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
  • the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production.
  • the one or more viruses may contain a promoter capable of directing expression (e.g., expression of a sequence-targeting nuclease, donor template, and/or one or more gRNAs) in mammalian cells, such as a suitable viral promoter, e.g., from a
  • CMV cytomegalovirus
  • retrovirus simian virus
  • papilloma virus herpes virus or other virus that infects mammalian cells
  • a mammalian promoter from, e.g., a gene such as EFlalpha, ubiquitin (e.g., ubiquitin B or C), globin, actin, phosphoglycerate kinase (PGK), etc., or a composite promoter such as a CAG promoter (combination of the CMV early enhancer element and chicken beta- actin promoter).
  • a human promoter may be used.
  • the promoter is selected from a CMV promoter, U6 promoter, an Hl promoter, a constitutive promoter, and a ubiquitous promoter.
  • the promoter directs expression in a particular cell type. For example, a muscle precursor cell specific promoter.
  • tissue specific promoter can be obtained by a person of ordinary skill in the art from the tissue specific promoters set forth in "TiProD: Tissue specific promoter Database” available on the world-wide web at tiprod.bioinf.med.uni-goettingen.de/.
  • sequence-targeting nucleases that can be used in the methods disclosed herein are not limited and may be any sequence-targeting nucleases disclosed herein.
  • the sequence-targeting nuclease is a Zinc-Finger Nuclease (ZFN), a Transcription activator-like effector nuclease (TAFEN), a Cas nuclease (e.g., Cas9 nuclease), or a functional fragment or functional variant thereof.
  • ZFN Zinc-Finger Nuclease
  • TAFEN Transcription activator-like effector nuclease
  • Cas nuclease e.g., Cas9 nuclease
  • functional fragment or functional variant thereof e.g., Cas9 nuclease
  • sequence-targeting nucleases i.e., targetable nucleases, site specific nucleases
  • ZFNs zinc finger nucleases
  • TAFENs transcription activator- like effector nucleases
  • RGNs RNA-guided nucleases
  • Cas proteins of the CRISPR/Cas Type II system and engineered meganucleases.
  • ZFNs and TAFENs comprise the nuclease domain of the restriction enzyme Fokl (or an engineered variant thereof) fused to a site-specific DNA binding domain (DBD) that is appropriately designed to target the protein to a selected DNA sequence.
  • DBD site-specific DNA binding domain
  • the DNA binding domain comprises a zinc finger DBD.
  • the site-specific DBD is designed based on the DNA recognition code employed by transcription activator- like effectors (TALEs), a family of site-specific DNA binding proteins found in plant-pathogenic bacteria such as Xanthomonas species.
  • TALEs transcription activator- like effectors
  • the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Type II system is a bacterial adaptive immune system that has been modified for use as an RNA-guided endonuclease technology for genome engineering.
  • the bacterial system comprises two endogenous bacterial RNAs called crRNA and tracrRNA and a CRISPR- associated (Cas) nuclease, e.g., Cas9.
  • the tracrRNA has partial complementarity to the crRNA and forms a complex with it.
  • the Cas protein is guided to the target sequence by the crRNA/tracrRNA complex, which forms a RNA/DNA hybrid between the crRNA sequence and the complementary sequence in the target.
  • the crRNA and tracrRNA components are often combined into a single chimeric guide RNA (sgRNA or gRNA) in which the targeting specificity of the crRNA and the properties of the tracrRNA are combined into a single transcript that localizes the Cas protein to the target sequence so that the Cas protein can cleave the DNA.
  • the sgRNA often comprises an approximately 20 nucleotide guide sequence complementary or homologous to the desired target sequence followed by about 80 nt of hybrid crRNA/tracrRNA.
  • the guide RNA need not be perfectly complementary or homologous to the target sequence. For example, in some embodiments it may have one or two mismatches.
  • the genomic sequence which the gRNA hybridizes is typically flanked on one side by a Protospacer Adjacent Motif (PAM) sequence although one of ordinary skill in the art appreciates that certain Cas proteins may have a relaxed requirement for a PAM sequence.
  • the PAM sequence is present in the genomic DNA but not in the sgRNA sequence.
  • the Cas protein will be directed to any DNA sequence with the correct target sequence and PAM sequence.
  • the PAM sequence varies depending on the species of bacteria from which the Cas protein was derived. Specific examples of Cas proteins include Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 and Cas 10.
  • the site specific nuclease comprises a Cas9 protein.
  • Cas9 from Streptococcus pyogenes may be used.
  • the PAM sequences for these Cas9 proteins are NGG, NNNNGATT,
  • the Cas9 is from
  • Staphylococcus aureus saCas9
  • site-specific nucleases A number of engineered variants of the site-specific nucleases have been developed and may be used in certain embodiments.
  • engineered variants of Cas9 and Fokl are known in the art.
  • a biologically active fragment or variant can be used.
  • Other variations include the use of hybrid site specific nucleases.
  • CRISPR RNA-guided Fokl nucleases (RFNs) the Fokl nuclease domain is fused to the amino-terminal end of a catalytically inactive Cas9 protein (dCas9) protein.
  • RFNs act as dimers and utilize two guide RNAs (Tsai, QS, et ah, Nat Biotechnol. 2014; 32(6): 569- 576).
  • Site-specific nucleases that produce a single-stranded DNA break are also of use for genome editing.
  • Such nucleases sometimes termed “nickases” can be generated by introducing a mutation (e.g., an alanine substitution) at key catalytic residues in one of the two nuclease domains of a site specific nuclease that comprises two nuclease domains (such as ZFNs, TALENs, and Cas proteins).
  • nick can stimulate HDR at low efficiency in some cell types.
  • Two nickases, targeted to a pair of sequences that are near each other and on opposite strands can create a single- stranded break on each strand (“double nicking”), effectively generating a DSB, which can optionally be repaired by HDR using a donor DNA template (Ran, F. A. et al. Cell 154, 1380-1389 (2013).
  • the Cas protein is a SpCas9 variant.
  • the SpCas9 variant is a R661A/Q695A/Q926A triple variant or a N497A/R661A/Q695A/ Q926A quadruple variant.
  • the Cas protein is C2cl, a class 2 type V-B CRISPR-Cas protein.
  • the Cas protein is one described in US 20160319260“Engineered CRISPR-Cas9 nucleases with Altered PAM Specificity” incorporated herein by reference.
  • the nucleic acid encoding the sequence-targeting nuclease should be sufficiently short to be included in the virus (e.g., AAV). In some embodiments, the nucleic acid encoding the sequence-targeting nuclease is less than 4.4. kb. [0057] In some embodiments, the sequence-targeting nuclease has at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% polypeptide sequence identity to a naturally occurring targetable nuclease.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease and a donor template. In some embodiments, the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, a donor template and one or more (e.g, one, two, three, four, etc.) gRNAs.
  • a person of ordinary skill in the art can select a suitable virus capable of packaging the required nucleotide sequences.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template and one or more (e.g, one, two, three, four, etc.) gRNAs.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template and two gRNAs.
  • the ratio of the first virus to the second virus is about 1:3 to about 1:100, inclusive of intervening ratios.
  • the ratio of the first virus to the second virus may be about 1:5 to about 1:50, or about 1:10, or about 1:20. Although not as preferred, the ratio may be 1:1 or there may be more second virus.
  • the method comprises delivery of one or more components (e.g., nucleic acid encoding a sequence-targeting nuclease, a donor template, one or more gRNAs (e.g., two gRNAs)) mediated by non-viral constructs, e.g. , "naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various delivery compositions and nanoparticles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and/or cholesterol- based - nucleic acid conjugates, and other constructs such as are described herein.
  • non-viral constructs e.g., "naked DNA”, "naked plasmid DNA", RNA, and mRNA
  • delivery compositions and nanoparticles including, e.g., micelles, liposomes, cationic lipid - nucleic acid composition
  • the muscle precursor cell having its genome modified by the methods disclosed herein is a muscle stem cell (e.g., adult muscle stem cell).
  • the muscle precursor cell is not limited. In some embodiments, at least 1% of muscle precursor cells (e.g., muscle stem cells) in the subject are modified to comprise an insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template. In other embodiments of the invention, the methods disclosed herein comprise modification of myofibre cells. In some embodiments, both muscle precursor cells and myofibre cells have their genomes modified. In some embodiments, the genomes of myofibre cells are not, or are not substantially, modified.
  • Some aspects of the invention are directed to methods of making myofibres with modified genomes by modifying the genomes of muscle precursor cells (e.g., satellite cells) by the methods disclosed herein.
  • the modified myofibres comprise one or more modified muscle precursor cell nuclei.
  • the myofibres comprise at least one, two, three, four, five, ten, twenty, fifty, seventy-five, one hundred, two hundred, two hundred fifty, three hundred, four hundred or more modified nuclei.
  • At least about 1%, 2%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, 51%, 60%, 70%, 90%, 95%, or 99% of the nuclei of a myofibre have genomes modified by the methods disclosed herein. In some embodiments, at least about 1%, 2%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, 51%, 60%, 70%, 90%, 95%, or 99% of the myofibres of the subject have genomes modified by the methods disclosed herein. In some embodiments, the subject having myofibres modified by the methods disclosed herein has been diagnosed with a muscular dystrophy. In some embodiments, the subject has a muscular dystrophy.
  • the muscular dystrophy is selected from myotonic muscular dystrophy, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, and Emery-Dreifuss muscular dystrophy.
  • the muscular dystrophy is Becker muscular dystrophy or Duchenne muscular dystrophy.
  • the methods disclosed herein further comprise assessing the fate or function of muscle progenitor cells or myofibres with genomes modified by the methods disclosed herein.
  • Some aspects of the disclosure are directed to methods of modifying the genome of a cardiac cell in vivo in a subject, comprising contacting the cardiac cell with one or more viruses, wherein the one or more viruses transduce a nucleic acid sequence encoding a sequence-targeting nuclease in the cardiac cell, and transduce a donor template in the cardiac cell, wherein the modification comprises the insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template (e.g, homologous
  • the cardiac cell is a DNA synthesizing cardiac cell or a replicating cardiac cell.
  • the subject is not limited and may be any subject as described herein.
  • the subject has a cardiac disease or condition.
  • the cardiac disease or condition is associated with a genetic mutation.
  • the cardiac disease or condition can be ameliorated or treated by correcting a genetic mutation.
  • the cardiac disease or condition can be ameliorated or treated by insertion of a genetic sequence into the genomes of cardiac cells.
  • the likelihood of a cardiac disease or condition can be reduced or prevented by correction of a genetic mutation.
  • the likelihood of a cardiac disease or condition can be reduced or prevented by insertion of a genetic sequence into the genomes of cardiac cells.
  • the subject is an infant, or juvenile, or under 30 years of age. In some embodiments, the subject is not an infant, or juvenile, or under 30 years of age.
  • the cardiac cell is selected from the group consisting of a mammalian postmitotic cardiomyocyte, a mammalian postmitotic cardiomyocyte capable of DNA synthesis without division/proliferation, a human postmitotic cardiomyocyte, a human postmitotic cardiomyocyte capable of DNA synthesis without division/proliferation, a cardiomyocyte precursor cell, a proliferating mesenchymal cardiac cell, a proliferating endothelial cardiac cell, and a cardiac progenitor cell.
  • the sequence-targeting nuclease is not limited and may be any sequence targeting nuclease described herein. In some embodiments, the sequence-targeting nuclease is Cas9 or a functional fragment or functional variant thereof.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease and a donor template. In some embodiments, the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, a donor template and one or more (e.g, one, two, three, four, etc.) gRNAs.
  • a person of ordinary skill in the art can select a suitable virus capable of packaging the required nucleotide sequences.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template and one or more (e.g, one, two, three, four, etc.) gRNAs.
  • the ratio of the first virus to the second virus is about 1:3 to about 1:100, inclusive of intervening ratios.
  • the ratio of the first virus to the second virus may be about 1 5 to about 1:50, or about 1:10, or about 1:20. Although not as preferred, the ratio may be 1:1 or there may be more second virus.
  • the method comprises delivery of one or more components (e.g., nucleic acid encoding a sequence-targeting nuclease, a donor template, one or more gRNAs) mediated by non-viral constructs, e.g. , "naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various delivery compositions and nanoparticles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and/or cholesterol- based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol. Pharmaceutics, 201 1, 8 (3), pp 774-787; web publication: March 21, 2011 ; WO2013/182683, WO
  • the one or more viruses may contain a promoter capable of directing expression (e.g., expression of a sequence-targeting nuclease, donor template, one or more gRNA) in mammalian cells, such as a suitable viral promoter as described herein.
  • a human promoter may be used.
  • the promoter is selected from a CMV promoter, U6 promoter, an Hl promoter, a constitutive promoter, and a ubiquitous promoter.
  • the promoter directs expression in a particular cell type.
  • the promoter is a cardiac specific promoter (e.g., a mammalian postmitotic cardiomyocyte specific promoter, a mammalian postmitotic cardiomyocyte capable of DNA synthesis without division/proliferation specific promoter, a human postmitotic cardiomyocyte specific promoter, a human postmitotic cardiomyocyte capable of DNA synthesis without division/proliferation specific promoter, a cardiomyocyte precursor cell specific promoter, a proliferating mesenchymal cardiac cell specific promoter, a proliferating endothelial cardiac cell specific promoter, or a cardiac progenitor cell specific promoter, or a promoter specific to one or more of these listed subtypes).
  • a cardiac specific promoter e.g., a mammalian postmitotic cardiomyocyte specific promoter, a mammalian postmitotic cardiomyocyte capable of DNA synthesis without division/proliferation specific promoter, a human postmitotic cardiomyocyte specific promoter, a human postmitotic cardiomyocyte capable of DNA
  • the nucleic acid sequence encoding a sequence-targeting nuclease is transduced with a cardiac specific promoter, a ubiquitous promoter or a non-specific promoter.
  • the one or more viruses used are not limited and may be any suitable virus or virus disclosed herein.
  • the virus is AAV serotype 6, 8, 9, 10 or Anc80.
  • virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC (genomic copies, also referred to herein as viral genomes (vg)) to about 1.0 x 10 15 GC (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
  • 1.0 x 10 9 GC genomic copies, also referred to herein as viral genomes (vg)
  • vg viral genomes
  • the dose of replication-defective virus in the formulation is 1.0 x 10 9 GC, 5.0 X 10 9 GC, 1.0 X 10 10 GC, 5.0 X 10 10 GC, 1.0 X 10 11 GC, 5.0 X 10 11 GC, 1.0 X 10 12 GC, 5.0 X 10 12 GC, or 1.0 x 10 13 GC, 5.0 X 10 13 GC, 1.0 X 10 14 GC, 5.0 X 10 14 GC, or 1.0 x 10 15 GC.
  • the genomes of the cardiac cells of the subject are modified.
  • at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more of the genome of the cardiac cells are modified via homologous recombination (e.g., a genomic sequence is replaced or inserted via homologous recombination).
  • at least 1%, 1.6%, 2% of cardiac cells in the subject are modified to comprise an insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template.
  • the modification comprises a modification of at least one allele. In some embodiments, the modification comprises modification of both alleles.
  • cardiac tissue comprising cardiac cells with genomes modified by methods disclosed herein.
  • the cardiac tissue comprises progeny cells of cardiac cells modified by the methods disclosed herein.
  • at least about 1%, 2%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, 51%, 60%, 70%, 90%, 95%, 99% of the muscle cells of the cardiac tissue have been modified or are progeny of cells that have been modified by the methods disclosed herein.
  • the subject having cardiac tissue modified by the methods disclosed herein has been diagnosed with a cardiac disease or condition.
  • the cardiac condition is damaged cardiac muscle (e.g. cardiac muscle damaged followed myocardial infarction).
  • the cardiac disease is myocardial infarction, ischemic heart disease, dilated cardiomyopathy, heart failure (e.g., congestive heart failure), ischemic cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, alcoholic cardiomyopathy, viral cardiomyopathy, tachycardia-mediated cardiomyopathy, stress- induced cardiomyopathy, amyloid cardiomyopathy, arrhythmogenic right ventricular dysplasia, left ventricular noncompaction, endocardial fibroelastosis, aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, mitral prolapse, pulmonary stenosis, pulmonary stenosis, pulmonary regurgitation, tricuspid stenosis, tricuspid regurgitation, congenital disorder, genetic disorder, or a combination thereof.
  • the methods disclosed herein can be utilized to promote cardiac muscle regeneration in a subject in need thereof.
  • the methods disclosed herein further comprise assessing the fate or function of cardiac cells with genome modification.
  • Some aspects of the disclosure are directed to methods of targeting a specific striated muscle type for genomic modification in vivo in a subject via homology directed repair, comprising systemically administering with one or more viruses, wherein the one or more viruses transduce a nucleic acid sequence encoding a sequence-targeting nuclease in striated muscle cells, and transduce a donor template in striated muscle cells, wherein the modification comprises the insertion of a nucleotide sequence corresponding to a nucleotide sequence of the donor template, and wherein, due to the age of the subject, genomic modification preferentially occurs to at least one type of striated muscle.
  • the genomes of muscle precursor cells are identical to [0078] in some embodiments.
  • the genomes of cardiac cells are identical to each other preferentially modified.
  • the genomes of cardiac cells are identical to each other.
  • the subject is not limited and may be any subject as described herein.
  • the subject has a muscle or cardiac disease or condition.
  • sequence-targeting nuclease is not limited and may be any sequence targeting nuclease described herein. In some embodiments, the sequence-targeting nuclease is Cas9 or a functional fragment or functional variant thereof.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease and a donor template. In some embodiments, the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, a donor template and one or more (e.g, one, two, three, four, etc.) gRNAs.
  • a person of ordinary skill in the art can select a suitable virus capable of packaging the required nucleotide sequences.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template.
  • the one or more viruses comprise a first virus which transduces a nucleic acid sequence encoding a sequence-targeting nuclease, and a second virus which transduces a donor template and one or more (e.g, one, two, three, four, etc.) gRNAs.
  • the ratio of the first virus to the second virus is about 1:3 to about 1:100, inclusive of intervening ratios.
  • the ratio of the first virus to the second virus may be about 1 5 to about 1:50, or about 1:10, or about 1:20. Although not as preferred, the ratio may be 1:1 or there may be more second virus.
  • the method comprises delivery of one or more components (e.g., nucleic acid encoding a sequence-targeting nuclease, a donor template, one or more gRNAs) mediated by non-viral constructs, e.g. , "naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various delivery compositions and nanoparticles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and/or cholesterol- based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol. Pharmaceutics, 201 1, 8 (3), pp 774-787; web publication: March 21, 2011 ; WO2013/182683, WO
  • the one or more viruses may contain a promoter capable of directing expression (e.g., expression of a sequence-targeting nuclease, donor template, one or more gRNA) in mammalian cells, such as a suitable viral promoter as described herein.
  • a human promoter may be used.
  • the promoter is selected from a CMV promoter, U6 promoter, an Hl promoter, a constitutive promoter, and a ubiquitous promoter.
  • the promoter directs expression in a particular cell type.
  • the nucleic acid sequence encoding a sequence-targeting nuclease is transduced with a ubiquitous promoter or a non-specific promoter.
  • the one or more viruses used are not limited and may be any suitable virus or virus disclosed herein.
  • the virus is AAV serotype 6, 8, 9, 10 or Anc80.
  • virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 15 GC (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
  • the dose of replication- defective virus in the formulation is 1.0 x 10 9 GC, 5.0 X 10 9 GC, 1.0 X 10 10 GC, 5.0 X 10 10 GC, 1.0 X 10 11 GC, 5.0 X 10 11 GC, 1.0 X 10 12 GC, 5.0 X 10 12 GC, or 1.0 x 10 13 GC, 5.0 X 10 13 GC, 1.0 X 10 14 GC, 5.0 X 10 14 GC, or 1.0 x 10 15 GC.
  • a striated muscle cell type e.g., cardiac muscle, muscle progenitor cell, myofibre
  • the genomes of a striated muscle cell type are modified.
  • at least about 0.1%, 0.5%, 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more of the genomes of a striated muscle cell type are modified via homologous
  • recombination e.g., a genomic sequence is replaced or inserted via homologous
  • a striated muscle cell type e.g., cardiac muscle, muscle progenitor cell, myofibre, etc.
  • the modification comprises a modification of at least one allele. In some embodiments, the modification comprises modification of both alleles.
  • a human subject is between 6 and 24 months old. In some embodiments, a human subject is between 2 and 6, 6 and 12, or 12 and 18 years old. In some embodiments a human subject is between 18 and 30, 30 and 50, 50 and 80, or greater than 80 years old. In some embodiments, the subject is at least about 5, 10, 20, 30, 40, 50,
  • a subject is an adult. For purposes hereof a human at least 18 years of age is considered an adult.
  • the subject is a juvenile (e.g., less than about 18, 12 or 6 years of age for a human subject). In some embodiments, the subject is not a juvenile (e.g., less than about 18, 12 or 6 years of age for a human subject). In some embodiments, the subject is less than 1 year of age. In some embodiments, the subject is more than 1 year of age and less than 6 years of age.
  • the subject is more than 6 years of age and less than 12 years of age. In some embodiments, the subject is more than 12 years of age and less than 18 years of age. In some embodiments, the subject is more than 18 years of age and less than 24 years of age. In some embodiments, the subject is more than 18 years of age. In some embodiments, the subject is post-puberty. In some embodiments, the subject is pre puberty. In some embodiments, the subject is undergoing puberty. In some embodiments a subject is an embryo. In some embodiments a subject is a fetus. In certain embodiments an agent is administered to a pregnant female in order to treat or cause a biological effect on an embryo or fetus in utero.
  • the methods disclosed herein further comprise assessing the fate or function of striated muscle cells with genome modification.
  • “decrease,”“reduce,”“reduced,”“reduction,”“decrease,” and “'inhibit” are all used herein generally to mean a decrease by a statistically significant amount relative to a reference.
  • “reduce,”“reduction” or“decrease” or“inhibit” typically means a decrease by at least 10% as compared to a reference level and can include, for example, a decrease by at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , up to and including, for example, the complete absence of the given entity or parameter as compared to the reference level, or any decrease between 10-99% as compared to the absence of a given
  • the terms“increased,”“increase” or“enhance” or“activate” are all used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms“increased”,“increase” or“enhance” or“activate” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or more as compared to a reference level.
  • compositions, methods, and respective component(s) thereof are used in reference to compositions, methods, and respective component(s) thereof, that are essential to the method or composition, yet open to the inclusion of unspecified elements, whether essential or not.
  • the term“consisting essentially of’ refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment.
  • protein and“polypeptide” refer to a polymer of protein amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function.
  • modified amino acids e.g., phosphorylated, glycated, glycosylated, etc.
  • amino acid analogs regardless of its size or function.
  • Protein and polypeptide are often used in reference to relatively large polypeptides, whereas the term“peptide” is often used in reference to small polypeptides, but usage of these terms in the art overlaps.
  • the terms“protein” and “polypeptide” are used interchangeably herein when refining to a gene product and fragments thereof.
  • exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.
  • nucleic acid or“nucleic acid sequence” refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof.
  • the nucleic acid can be either single- stranded or double-stranded.
  • a single-stranded nucleic acid can be one strand nucleic acid of a denatured double stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double stranded DNA.
  • the template nucleic acid is DNA.
  • the template is RNA.
  • Suitable nucleic acid molecules are DNA, including genomic DNA or cDNA.
  • RNA RNA
  • the nucleic acid molecule can be naturally occurring, as in genomic DNA, or it may be synthetic, i.e., prepared based upon human action, or may be a combination of the two.
  • the nucleic acid molecule can also have certain modification such as 2'-deoxy, 2'-deoxy-2'fluoro, 2'-0-methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0- DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), 2'-0-dimethylaminoethyloxyethyl (2'-0- DMAEOE), or 2'-0— N-methylacetamido (2'-0-NMA), cholesterol addition, and
  • “treat,”“treatment,”“treating,” or“amelioration” when used in reference to a disease, disorder or medical condition refer to therapeutic treatments for a condition, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a symptom or condition.
  • the term“treating” includes reducing or alleviating at least one adverse effect or symptom of a condition.
  • Treatment is generally “effective” if one or more symptoms or clinical markers are reduced.
  • treatment is“effective” if the progression of a condition is reduced or halted.
  • treatment includes not just the improvement of symptoms or markers, but also a cessation or at least slowing of progress or worsening of symptoms that would be expected in the absence of treatment.
  • Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of the deficit, stabilized (i.e., not worsening) state as compared to that expected in the absence of treatment.
  • the efficacy of a given treatment for a disorder or disease can be determined by the skilled clinician. However, a treatment is considered“effective treatment,” as the term is used herein, if any one or all of the signs or symptoms of a disorder are altered in a beneficial manner, other clinically accepted symptoms are improved or ameliorated, e.g., by at least 10% following treatment with an agent or composition as described herein. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and/or described herein.
  • the invention includes embodiments that relate analogously to any intervening value or range defined by any two values in the series, and that the lowest value may be taken as a minimum and the greatest value may be taken as a maximum.
  • Numerical values include values expressed as percentages. For any embodiment of the invention in which a numerical value is prefaced by“about” or“approximately”, the invention includes an embodiment in which the exact value is recited. For any embodiment of the invention in which a numerical value is not prefaced by“about” or“approximately”, the invention includes an embodiment in which the value is prefaced by“about” or“approximately”.
  • FIG. 1A In order to sensitively detect in vivo gene editing events by CRISPR/Cas9, a fluorescent protein-based reporter system (FIG. 1A) using a transgenic mouse line that ubiquitously expresses strong enhanced green fluorescent protein (GFP) signal was developed.
  • a blue fluorescent protein (BFP) sequence was designed based on published BFP variants 9 11 to carry a minimal 2-base substitution (C197G and T199C) compared to the GFP sequence. This simple modification allows for easy discrimination of the two fluorescent proteins by fluorescence-activated cell sorting (FACS) (FIGS. 5A-5D).
  • FACS fluorescence-activated cell sorting
  • the same 2-base substitutions also create a Btgl site for restriction fragment length polymorphism (RFLP) analysis.
  • RFLP restriction fragment length polymorphism
  • a single guide RNA (sgRNA) targeting the substitution sites in GFP was designed to be compatible with Cas9 protein from Staphylococcus aureus (SaCas9), and tested in tail tip fibroblasts (TTFs) from GFP +/ mdx mice for efficient disruption of GFP signal (FIGS. 5B, 5C).
  • This gRNA was inserted into a vector with AAV backbone, together with a promoter-less BFP template lacking Kozak or start ATG sequences, for use in HDR experiments (FIG. IB).
  • This colour-switch system was used to test the capacity of CRISPR/Cas9 to instigate HDR in a regenerative stem cell population. Satellite cells from skeletal muscle of GFP +/ ;mdx mice were isolated and, after ex vivo expansion 12 ’ 13 , transfected with dual vectors consisting of AAV-SaCas9 and AAV-GFPgRNA-BFPtemplate (FIGS. IB, 1C). This dual vector system was adopted as the ultimate aim was to deliver CRISPR/Cas9 and template in vivo and the limited cargo capacity of AAVs, -4.5 - 4.7 kb, prevented inclusion of all components in a single vector.
  • Flow cytometry was then used to discriminate NHEJ and HDR events in the transfected cell population with single cell resolution.
  • the experimental group transfected with dual vectors, included cells exhibiting loss of green fluorescence (GFP-), indicative of imprecise NHEJ-mediated disruption of GFP reading frame, as well as cells exhibiting loss of GFP and gain of BFP signal (BFP+), indicative of HDR (FIGS. 1D- 1G).
  • GFP-/BFP- and BFP+ cells were absent from control transfections, in which cells received AAV-GFPgRNA-BFPtemplate alone (FIGS. 1D-1G).
  • CRISPR-NHEJ GFP-/BFP-
  • CRISPR-HDR BFP+ myoblasts fused to form myosin heavy chain-positive myotubes
  • FIG. 6A sorted BFP+ myoblasts contributed to in vivo muscle repair by giving rise to blue muscle fibres (FIG. 1H).
  • AAVs were generated using the aforementioned vectors and packaged with serotype 8, which has high liver, heart and skeletal muscle tropism 14 .
  • CRISPR-HDR vectors were injected intravenously to juvenile (P21) male GFP +/ ;mdx mice
  • FIG. 2A Control mice (AAV-control) received 1 x 10 13 viral genomes (vg) per mouse of AAV-GFPgRNA-BFPtemplate alone, while experimental mice (AAV-HDR) received 1 x 10 13 vg of AAV-GFPgRNA-BFPtemplate plus 5 x 10 12 vg of AAV-SaCas9. Mice were euthanized 3 weeks post-injection for analysis (FIG. 2A). Wide-spread loss of GFP signal and acquisition of BFP signal in the livers of all experimental mice injected with AAV-HDR, but not in AAV-control injected animals were detected (FIG. 2B).
  • Skeletal muscle is a largely post-mitotic tissue, composed primarily of multinucleated muscle fibres formed by fusion of myogenic precursors derived from satellite cells.
  • AAV-CRIS PR- mediated NHEJ in muscle to correct the Dmd reading frame and recover Dystrophin expression and function in dystrophic mdx mice by deleting or skipping Dmd exon 23 16 18 .
  • prior attempts 19 at AAV-CRISPR- mediated HDR in muscle produced negligible editing (only 0.18% alleles edited), possibly due to the use of a muscle-restricted promoter (CK8), which limits Cas9 expression to mature myofibres.
  • AAV-HDR vectors to GFP +/ ;mdx or GFP +/ ;C51 B L/6J (male and female) mice at P3, by intraperitoneal injection (FIG. 4A).
  • AAV-control animals received 3 x 10 vg/mouse of AAV-gRNA-template alone and experimental mice (AAV- HDR) received the same dose of AAV-gRNA-template together with 1 x 10 vg/mouse AAV-SaCas9. Similar percentages of BFP+ and GFP-/BFP- liver cells were detected regardless of genetic background (FIG. 4B and FIG. 9A).
  • the frequencies of BFP+ hepatocytes were comparable between the P3 and P21 experiments (average of -10% BFP+ hepatocytes; FIG. 2C and FIG. 4C).
  • the frequency of NHEJ-edited liver cells was reduced in neonatally injected mice (on average, -28% of hepatocytes, FIG. 4C), possibly reflecting the more vigorous proliferation rate of early neonatal hepatocytes, which may lead to more rapid dilutional loss of the non-integrating AAV episomes 26 .
  • the inventors have surprisingly and unexpectedly found that postnatal cardiac muscle, skeletal muscle, and muscle stem cells undergo templated HDR at different developmental time points in mice, using a GFP-BFP colour- switching reporter system that enables in vivo tracking of genome-editing outcomes at the single cell level.
  • Systemic delivery of CRISPR-Cas9 editing components via adeno-associated virus (AAV-CRISPR) confirmed efficient NHEJ and HDR in liver, consistent with previous reports (Yang, Y. et al. Nat Biotechnol 34, 334-338 (2016); Yin, H. et al. Nat Biotechnol 34, 328-333 (2016)).
  • HDR-edited muscle stem cells and myofibres were detected in mice injected with AAV-CRISPR at post-natal day 21 (P21), but not at P3, while HDR-edited cardiac cells were detected in P3-injected, but rarely in P2l-injected, animals.
  • Our results reveal the possibility of sequence-directed, systemically disseminated, in vivo AAV-CRIS PR-mediated HDR in striated muscle and muscle stem cells at discrete postnatal time points, providing new opportunities for therapeutics development.
  • mice [0121] Hemizygous GFP transgenic mice, carrying a single trangenic allele, were generated by crossing CAG-GFP mice 8 with either C57BL/6J or C57 B L/ 1 OScS n-Dind mdx li ( mdx ) (Jackson Labs). Postnatal day 3 (P3) GFP +/ mdx and GFP +/ C57BL/6J pups (both male and female) were used for neonatal intraperitoneal (IP) injections and 3 week old male GFP +/ mdx mice were used for juvenile intravenous (retro-orbital) injections. Mice were maintained at the Harvard Biological Research Infrastructure according to animal care and experimental protocols approved by the Harvard University Institutional Animal Care and Use Committee (IACUC).
  • IACUC Institutional Animal Care and Use Committee
  • AAVs were produced and titered by the Gene Transfer Vector Core (GTVC) at the Grousbeck Gene Therapy Center at the Schepens Eye Research Institute and
  • HEK293 cells were transfected with rep2-cap8 packaging construct, an adenoviral helper function plasmid, and the ITR flanked transgene construct.
  • control mice received 3 x 10 viral genome (vg) of AAV-GFPgRNA-BFPtemplate alone, and experimental mice received 3 x 10 vg of AAV-GFPgRNA-BFPtemplate plus 1 x 10 vg of AAV-SaCas9.
  • Virus was diluted in 75 pL of vehicle (PBS with 35mM NaCl) for each injection. Mice were euthanized for analysis 4 weeks post injection.
  • control mice received 1 x 10 vg of AAV-GFPgRNA-BFPtemplate alone, and experimental mice received 1 x 10 vg of AAV-GFPgRNA-BFPtemplate plus 5 x 10 vg of AAV-SaCas9.
  • Virus was diluted in 312pL of vehicle (PBS with 35mM NaCl) for each injection. Mice were euthanized for analysis 3 weeks post injection.
  • AAV-SaCas9 plasmid was previously described 16 .
  • AAV-GFPgRNA- BFPtemplate plasmid was generated by Gibson assembly of the pZac2.1 AAV vector with three inserts. The vector was double digested by Hindlll-HF and Notl-HF (NEB). Insert piece 1 (U6-GFPgRNA) was PCR amplified from a plasmid containing U6-GFPgRNA.
  • Insert 2 (BFP) was PCR amplified from a BFP sequence synthesized as a gBlock (IDT).
  • Insert 3 (polyA) was PCR amplified from genomic DNA of the CAG-GFP transgenic animal. Two base substitutions on the BFP template enable the color switch (from green to blue fluorescence) and generate a restriction fragment length polymorphism (RFLP) detectable by Btgl restriction enzyme.
  • RFLP restriction fragment length polymorphism
  • Satellite cells for ex vivo gene editing were isolated as previously described .
  • triceps, abdominal and hind limb muscles from half of the body were harvested and minced using scissors, then subjected to two rounds of digestion with 0.2% Collagenase type II and 0.05% Dispase in DMEM (GIBCO) at 37°C (for 15 min, then 10 min).
  • Enzymes were inactivated by addition of FBS, and cells were centrifuged and filtered through 70um strainers before staining for 30 min with an antibody cocktail containing APC-Cy7-CD45 (Biolegend, 1:200), APC-Cy7-CDl lb (Biolegend,
  • GFP+, BFP+, and GFP-/BFP- satellite cells were expanded on collagen type I (lug/mL, Sigma) and laminin (lOug/mL, Invitrogen) coated plates in Growth Media (F10, 20% horse serum, 1% Pen Strep, and 1% Glutamax (Gibco)), supplemented daily with 5 ng/mL bFGF (Sigma).
  • Growth Media F10, 20% horse serum, 1% Pen Strep, and 1% Glutamax (Gibco)
  • DNA was isolated from subset of the expanded cells was harvested using QuickExtract (Lucigen) and used for genomic PCR and subsequent RFLP and sequencing analysis.
  • Myogenic differentiation was initiated by switching to Differentiation Media (DMEM, 2% horse serum, 1% Pen Strep, 1% Glutamax (Gibco)) for 3-4 days. Cells were fixed by 4% PFA for 20 minutes for imaging.
  • DMEM Differentiation Media
  • Satellite cells isolated from male mdx;GFP +/ animals were expanded in culture in Growth Media with daily bFGF supplementation for 2-3 weeks and then re-plated onto 24 well plates coated with collagen (lug/mL) and laminin (lOug/mL) at 20,000 cells per well.
  • Myoblasts were transfected on day 2 using Lipofectamine 3000 (Invitrogen) per manufacturer’s instructions with AAV-GFPgRNA-BFPtemp plasmid alone for control group or AAV-GFPgRNA-BFPtemp and AAV-SaCas9 plasmids at 5: 1 ratio for experimental group (3 independent transfections per group).
  • BFP + and GFP + cells were sorted using a FACS Aria II 5 days after transfection and resorted after an additional 2 weeks expansion in vitro to confirm fluorescence. Re-sorted cells were then used for in vitro differentiation and in vivo transplantation assays.
  • GFPgRNA2 (no BFP template) at 1: 1 ratio, as described above.
  • TTFs tail tip fibroblasts
  • Genomic DNA from tissues, satellite cells and expanded myoblasts was extracted using QuickExtract DNA Extraction Solution (Epicentre/Lucigen) per manufacture protocol. 1 -2pL of QuickExtracted solutions was used per 25 pL PCR reaction by Q5 Hot Start polymerase (NEB). Forward primer GTGCTGTCTCATCATTTTGGC (SEQ ID NO: 21) (binds upstream of GFP/BFP start site) and Reverse primer
  • TCGTGCTGCTTCATGTGGTC (SEQ ID NO: 22) (binds downstream of Cas9 cutting site and color switching substitutions) were used to amplify the genomic transgene locus, but not template sequence.
  • PCR products were purified using QIAquick PCR Purification Kit (Qiagen) and digested with Btgl (NEB), or mock digested with water, before gel electrophoresis on E-Gel EX 2% Agarose Gels (Invitrogen). [0137] Sanger sequencing and Next-Generation Sequencing
  • NGS results were analyzed using CRISPResso program after demultiplexing. Representative NGS sequences are shown.
  • Tissues were dissected and immediately fixed in 4% PFA for 90 min. at room temperature and then washed with PBS and transferred to 30% sucrose for overnight incubation at 4°C. Submersed tissues were then embedded in O.C.T. compound (Tissue-Tek) and frozen in isopentane in a liquid nitrogen bath. Tissues were sectioned using Microm HM550 (Thermo Scientific) and stained with Alexa Fluor 555-Wheat Germ Agglutinin and TO-PRO-3 Iodide (Life Technologies) according to manufacturer’s instructions. Numbers of BFP + , GFP (also BFP ) and total cells were quantified manually by ImageJ. For liver and heart, three representative fields with -200-350 cells per field were counted for each tissue. For P2l-injected TA sections, images of stitched fields (25 of 20x images) were counted with more than 1000 cells per image.
  • FIGS. 1F-1G Unpaired two-tailed t test was performed for FIGS 1F-1G.
  • One-way ANOVA with Tukey's multiple comparisons test was performed for FIGS. 3B-3C and FIGS. 11B-11C.
  • Exact p values and degrees of freedom (DF) can be found in corresponding figure legends.
  • Hinderer C. et al. Severe Toxicity in Nonhuman Primates and Piglets Following High-Dose Intravenous Administration of an Adeno-Associated Virus Vector Expressing Human SMN. Human gene therapy , doi:l0.l089/hum.20l8.0l5 (2016).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2019/030748 2018-05-03 2019-05-03 In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells Ceased WO2019213626A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2021510297A JP7498499B2 (ja) 2018-05-03 2019-05-03 心臓、骨格筋、及び筋幹細胞におけるインビボ相同組換え修復
CA3099332A CA3099332A1 (en) 2018-05-03 2019-05-03 In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells
CN201980042149.7A CN112512595A (zh) 2018-05-03 2019-05-03 心脏、骨骼肌和肌肉干细胞中的体内同源性定向修复
AU2019262225A AU2019262225B2 (en) 2018-05-03 2019-05-03 In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells
EP19796061.0A EP3787692A4 (en) 2018-05-03 2019-05-03 IN VIVO HOMOLOGY-DIRECTED REPAIR IN HEART, SKELETAL MUSCLE, AND MUSCLE STEM CELLS
US17/052,798 US20210363546A1 (en) 2018-05-03 2019-05-03 In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells
JP2024085010A JP2024100980A (ja) 2018-05-03 2024-05-24 心臓、骨格筋、及び筋幹細胞におけるインビボ相同組換え修復

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862666685P 2018-05-03 2018-05-03
US62/666,685 2018-05-03

Publications (1)

Publication Number Publication Date
WO2019213626A1 true WO2019213626A1 (en) 2019-11-07

Family

ID=68386147

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/030748 Ceased WO2019213626A1 (en) 2018-05-03 2019-05-03 In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells

Country Status (7)

Country Link
US (1) US20210363546A1 (enExample)
EP (1) EP3787692A4 (enExample)
JP (2) JP7498499B2 (enExample)
CN (1) CN112512595A (enExample)
AU (1) AU2019262225B2 (enExample)
CA (1) CA3099332A1 (enExample)
WO (1) WO2019213626A1 (enExample)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2023515709A (ja) * 2020-04-27 2023-04-13 デューク ユニバーシティ 筋肉特異的プロモーターをコードするaavベクターを使用するインビボでの衛星細胞の遺伝子編集
US12215366B2 (en) 2015-02-09 2025-02-04 Duke University Compositions and methods for epigenome editing
US12214054B2 (en) 2015-11-30 2025-02-04 Duke University Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use
US12215345B2 (en) 2013-03-19 2025-02-04 Duke University Compositions and methods for the induction and tuning of gene expression
US12214056B2 (en) 2016-07-19 2025-02-04 Duke University Therapeutic applications of CPF1-based genome editing
US12428631B2 (en) 2016-04-13 2025-09-30 Duke University CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use
US12486519B2 (en) 2018-08-18 2025-12-02 President And Fellows Of Harvard College In situ gene editing
US12509492B2 (en) 2018-01-19 2025-12-30 Duke University Genome engineering with CRISPR-Cas systems in eukaryotes

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115181722B (zh) * 2022-08-30 2024-06-11 江苏农牧科技职业学院 一种鹅骨骼肌卫星细胞的体外分离和培养方法
WO2024229028A2 (en) * 2023-05-01 2024-11-07 University Of Washington Novel regulatory cassettes for specific expression of genes in muscle stem cells
WO2025260086A1 (en) * 2024-06-14 2025-12-18 President And Fellows Of Harvard College In vivo site-specific base editing

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170152528A1 (en) * 2012-12-12 2017-06-01 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
WO2018058064A1 (en) * 2016-09-23 2018-03-29 Casebia Therapeutics Limited Liability Partnership Compositions and methods for gene editing

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106714845A (zh) * 2014-08-11 2017-05-24 得克萨斯州大学系统董事会 通过crispr/cas9介导的基因编辑预防肌营养不良
US20170362635A1 (en) * 2016-06-20 2017-12-21 University Of Washington Muscle-specific crispr/cas9 editing of genes
EP4321623A3 (en) * 2016-07-15 2024-05-15 Salk Institute for Biological Studies Methods and compositions for genome editing in non-dividing cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170152528A1 (en) * 2012-12-12 2017-06-01 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
WO2018058064A1 (en) * 2016-09-23 2018-03-29 Casebia Therapeutics Limited Liability Partnership Compositions and methods for gene editing

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12215345B2 (en) 2013-03-19 2025-02-04 Duke University Compositions and methods for the induction and tuning of gene expression
US12215366B2 (en) 2015-02-09 2025-02-04 Duke University Compositions and methods for epigenome editing
US12214054B2 (en) 2015-11-30 2025-02-04 Duke University Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use
US12428631B2 (en) 2016-04-13 2025-09-30 Duke University CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use
US12214056B2 (en) 2016-07-19 2025-02-04 Duke University Therapeutic applications of CPF1-based genome editing
US12509492B2 (en) 2018-01-19 2025-12-30 Duke University Genome engineering with CRISPR-Cas systems in eukaryotes
US12486519B2 (en) 2018-08-18 2025-12-02 President And Fellows Of Harvard College In situ gene editing
JP2023515709A (ja) * 2020-04-27 2023-04-13 デューク ユニバーシティ 筋肉特異的プロモーターをコードするaavベクターを使用するインビボでの衛星細胞の遺伝子編集
EP4125349A4 (en) * 2020-04-27 2024-07-10 Duke University GENE EDITING OF SATELLITE CELLS IN VIVO USING AAV VECTORS ENCODING MUSCLE-SPECIFIC PROMOTERS

Also Published As

Publication number Publication date
US20210363546A1 (en) 2021-11-25
AU2019262225A1 (en) 2021-01-07
JP7498499B2 (ja) 2024-06-12
JP2024100980A (ja) 2024-07-26
EP3787692A4 (en) 2022-03-23
CN112512595A (zh) 2021-03-16
EP3787692A1 (en) 2021-03-10
JP2021522858A (ja) 2021-09-02
AU2019262225B2 (en) 2025-08-21
CA3099332A1 (en) 2019-11-07

Similar Documents

Publication Publication Date Title
AU2019262225B2 (en) In vivo homology directed repair in heart, skeletal muscle, and muscle stem cells
CN114174520B (zh) 用于选择性基因调节的组合物和方法
KR102526711B1 (ko) 고효율 게놈 편집을 위한 아데노-관련 바이러스 벡터 변이체 및 이의 방법
WO2022087321A1 (en) Dual aav vector-mediated deletion of large mutational hotspot for treatment of duchenne muscular dystrophy
JP2023515710A (ja) CRISPR媒介式エクソン欠失用の最適なgRNA対を発見するためのハイスループットスクリーニング法
WO2021108363A1 (en) Crispr/cas-mediated upregulation of humanized ttr allele
CN111718420A (zh) 一种用于基因治疗的融合蛋白及其应用
Sii-Felice et al. Innovative Therapies for Hemoglobin Disorders: K. Sii-Felice et al.
US20230272428A1 (en) Methods and compositions for correction of dmd mutations
US20250304955A1 (en) Compositions and methods for myosin heavy chain base editing
CN117561331A (zh) 用于产生经基因修饰的原代细胞的方法和组合物
US20250361505A1 (en) Compositions for and methods of gene editing
US12486519B2 (en) In situ gene editing
CN105358690B (zh) 启动子组合物
Wong Utilization of CRISPR/Cas9-mediated gene editing for correction of deletion mutations in DMD
Zhu In Vivo Gene Editing of Muscles and Muscle Stem Cells Using AAV-CRISPR
WO2026005012A1 (ja) インビトロ及びインビボのゲノム編集における相同組換えの効率を高める方法
KR20240027748A (ko) Rbm20 돌연변이의 게놈 편집
KR20250141243A (ko) 데그론 융합 단백질 및 그의 생산 및 사용 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19796061

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3099332

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021510297

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019262225

Country of ref document: AU

Date of ref document: 20190503

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019796061

Country of ref document: EP

Effective date: 20201203