WO2019208724A1

WO2019208724A1 - Method for screening membrane proteins for specific compound and method for producing specific compound

Info

Publication number: WO2019208724A1
Application number: PCT/JP2019/017768
Authority: WO
Inventors: 圭七谷; 敬悦阿部; 尚弘新谷; 裕米山; 真由美中山
Original assignee: 国立大学法人東北大学
Priority date: 2018-04-27
Filing date: 2019-04-25
Publication date: 2019-10-31
Also published as: JPWO2019208724A1

Abstract

Provided is a novel method that, with relatively little effort and without requiring radioactive compounds, can be used to exhaustively screen various target substances and various membrane proteins. Provided is a method for resolving bottleneck problems relating to substance production by microorganisms in which, due to insufficient capability or inability to discharge a substance outside a cell, productivity of the substance decreases, production is not possible, or the like. This method for producing a specific compound includes a step in which a microorganism is cultured that incorporates a gene coding a fusion partner and a gene coding a membrane protein relating to transport of the prescribed compound so that these genes express.

Description

Method for screening membrane protein for predetermined compound and method for producing predetermined compound

[Cross-reference of related applications]
This application claims priority based on Japanese Patent Application No. 2018-087700 filed on Apr. 27, 2018, the entire disclosure of which is incorporated herein by reference. The present invention relates to a method for screening a membrane protein for a predetermined compound and a method for producing the predetermined compound.

In general, substance production using microorganisms has many advantages in terms of productivity, cost, etc., compared to chemical synthesis and the like, and is used in various fields. Typically, a substrate taken in from the environment is metabolized in the cells of the microorganism to become a metabolite, discharged out of the cell, and the discharged metabolite is recovered. Here, a transporter (importer) that takes up a substrate into a cell, a transporter (exporter) that discharges a metabolite to the outside of the cell, and when the target compound is a high molecular compound such as a polysaccharide, The biosynthetic enzymes that are simultaneously responsible for the discharge of the product are important. Specifically, for example, in the case of production of primary metabolites, it is normal that the microorganism already has an exporter of a predetermined compound and an importer of a substrate. When the intracellular concentration of the metabolite increases as a result of strengthening, feedback inhibition is applied, and the excretion and transport of the product can be the limiting step (Non-patent Document 1). In addition, in the case of production of secondary metabolites, new compounds, etc., if the microorganism to be used does not have a transporter in the first place, the substrate is not taken up or the metabolite is continuously produced without being discharged outside the cell. Problems such as being unable to do so may occur. The present inventors have called the problem that the productivity of the substance is lowered or cannot be produced due to insufficient or impossible ability of the substance to be discharged out of the cell as the discharge bottleneck. Discharge bottlenecks can be said to be a potential issue in the technological development for the production of new substances that are expected to be industrially produced using the current microorganisms or industrially produced using microorganisms. Therefore, it is very useful to design a substance production system to specify what kind of protein is a transporter for a given compound that can be a substrate or a metabolite.

Conventionally, genetic methods (e.g., search for C. glutamicum glutamate excretion transporter using dipeptide resistance complementary gene), biochemical methods (e.g., aspartate transporter using transport activity measurement by liposome reconstitution method) However, the genetic method described above requires the creation of strains lacking various genes, and at the same time, it is difficult to search for multiple types of transporters. There were problems such as being. In addition, the biochemical methods described above are difficult to purify and reconstitute the transporter, require radioactive isotopes, and are difficult to obtain. In particular, the exhaust transporter (exporter) is taken up and transported. Compared to the body (importer), the Km value for the substrate is very large, making it difficult to search.

In addition, it is important to express membrane proteins such as importers, exporters, and biosynthetic enzymes on the cell membrane while maintaining their functions, but it is difficult to stably express membrane proteins on the cell membrane. It has been difficult to stably express the membrane protein and improve the production efficiency.

An object of the present invention is to provide a novel method for solving the bottleneck in substance production using microorganisms. Another object of the present invention is to provide a novel method capable of comprehensively screening for various target substances and various membrane transporter candidate proteins by a method that requires relatively little labor and does not require a radioactive compound.

The present inventors use, in a substance production method or a screening method, a microorganism in which a gene encoding a fusion partner and a membrane protein involved in transport of the predetermined compound or a gene encoding a candidate protein thereof are expressed. It has been found that the above problems can be solved. The present invention is based on the above new findings.

Accordingly, the present invention provides the following sections:
Item 1. A method for producing a predetermined compound, comprising:
Culturing a microorganism incorporating a gene in which a gene encoding a fusion partner and a gene encoding a membrane protein involved in transport of the predetermined compound are linked so as to be expressed by translation of polycistronic mRNA,
The linked genes are linked such that a part of the nucleotides constituting the stop codon of the gene encoding the fusion partner is part of the start codon of the gene encoding the membrane protein involved in the transport of the predetermined compound A method, which is a genetically generated gene.

Item 2. Item 2. The method according to Item 1, further comprising the step of recovering the predetermined compound from the culture solution obtained in the step of culturing the microorganism.

Item 3. Item 3. The method according to

Item

1 or 2, wherein the microorganism is a bacterium.

Item 4. The method according to any one of claims 1 to 3, wherein a gene encoding a tRNA corresponding to a rare codon of the microorganism is further incorporated into the microorganism.

Item 5. Item 5. The method according to any one of Items 1 to 4, wherein the membrane protein is an exporter protein, an importer protein, a synthase protein, or a protein that is a component of a protein secretion apparatus.

Item 6. A method for screening a membrane protein for a predetermined compound, comprising the following steps (1) to (4):
(1) A gene that encodes a fusion partner and a gene that encodes a membrane protein candidate so as to be expressed by translation of polycistronic mRNA, wherein a stop codon of the gene encoding the fusion partner is selected A step of creating a library of microorganisms incorporating a gene linked so that a part of the nucleotides constituting it is part of the start codon of the gene encoding the membrane protein,
(2) a step of culturing the microorganism (3) a step of identifying a culture solution or a supernatant thereof in which a variation is observed in the amount of the predetermined compound compared to before the culture,
(4) A step of specifying that the membrane protein candidate incorporated and expressed in the microorganism from which the specified culture solution or supernatant is obtained is a membrane protein having the ability to transport the predetermined compound inside and outside the membrane.

Item 7. Item 101. The method according to Item 6 to 96, wherein the membrane protein is an exporter protein, an importer protein, a synthetic concept protein, or a protein that is a protein secretion apparatus.

Item 8. Item 8. The method according to Item 6 or 7, wherein the microorganism is a bacterium.

Item 9. Item 9. The method according to any one of Items 6 to 8, wherein a gene encoding a tRNA corresponding to a rare codon of the microorganism is further incorporated into the microorganism.

The present invention can provide a new method for solving the above discharge bottleneck. According to the present invention, it is possible to provide a novel method capable of comprehensively screening various target substances and various membrane transporter candidate proteins with a relatively small effort and a method that does not require a radioactive compound. .

The outline of the plasmid described in Example 1 is shown. The result of Example 1 is shown. The result of Example 2 is shown. The result of Example 3 is shown. The result of Example 3 is shown. The result of Example 4 is shown. The result of Example 5 is shown. The result of Example 6 is shown.

In the present invention, unless otherwise specified, the term “gene” refers not only to a structural gene defining a primary structure such as a protein, tRNA, or rRNA, but also to a nucleic acid having a specific regulatory function such as a promoter or an operator. Regions are also included. Therefore, in the present invention, “gene” refers to a regulatory region, a coding region, an exon, and an intron without distinction unless otherwise specified. The “structural gene” also includes silent DNA in which the original DNA sequence has been subjected to silent mutation. In the present invention, nucleic acid molecules such as siRNA that interfere with gene expression are also included in the “gene”.

In the present specification, “nucleic acid” is synonymous with nucleotide, oligonucleotide, and polynucleotide, and may be any of DNA, RNA, and DNA-RNA hybrids. Further, these may be double-stranded or single-stranded, and in the case of a nucleic acid molecule having a certain sequence, a nucleic acid molecule having a complementary sequence (or nucleotide, oligonucleotide) unless otherwise specified. And polynucleotide) are also meant to be inclusive. These nucleic acid molecules may be circular or linear, and may be synthetic or biological.

In the present invention, the terms “protein” and “peptide” are used to include oligopeptides and polypeptides unless otherwise specified. In the present specification, “protein” and “peptide” include both a protein modified with a sugar chain and an unmodified protein unless otherwise specified. The same applies to proteins that are not specified as proteins.

In the present specification, unless otherwise specified, “membrane protein” is used in the meaning of including a protein that is expressed in a form localized in the cell membrane and has the ability to transport a predetermined compound into and out of the cell. Membrane transporter protein involved in the transport of a given compound inside and outside the cell, a synthase protein that is localized in the cell membrane and is not only produced by catalysis of the given compound but also involved in the transport inside and outside the cell, or a protein that functions in the cell membrane It is assumed to include a complex composed of a plurality of proteins called secretory devices involved in the transport of proteins inside and outside the cell. The membrane transporter protein further includes an exporter protein and an importer protein.

Method for Screening Membrane Protein The present invention provides a method for screening a membrane protein for a predetermined compound, comprising the following steps (1) to (4):
(1) A gene that encodes a fusion partner and a gene that encodes a membrane protein candidate so as to be expressed by translation of polycistronic mRNA, wherein a stop codon of the gene encoding the fusion partner is selected A step of creating a library of microorganisms incorporating a gene linked so that a part of the constituting nucleotides becomes part of the start codon of the gene encoding the membrane protein candidate,
(2) a step of culturing the microorganism (3) a step of identifying a culture solution or a supernatant thereof in which a variation is observed in the amount of the predetermined compound compared to before the culture,
(4) A step of specifying that the membrane protein candidate incorporated and expressed in the microorganism from which the specified culture solution or supernatant is obtained is a protein having the ability to transport the predetermined compound inside or outside the membrane.

The “predetermined compound” that is the subject of the present invention is not particularly limited. For example, a substance (https://energy.gov) that is expected to be industrially produced by microorganisms published by the United States Department of Energy (DOE). / eere / bioenergy) and other substances that have been industrially produced by microorganisms as summarized in Non-Patent Documents 4 to 8, including low molecular weight compounds, high molecular weight compounds, and other useful substances. A wide variety. Typically, the predetermined compound is an organic compound. Specific examples of the predetermined compound include low molecular weight compounds such as amino acids, organic acids, nucleic acids, carbohydrates (saccharides such as monosaccharides and disaccharides), vitamins, alcohols, etc .; antibiotics , Polysaccharides, polypeptides, polyphenols, and high molecular compounds such as enzymes and proteins. In addition to the above, useful substances include physiologically active substances and various substances of secondary metabolites.

On the other hand, no membrane protein is assumed as the “predetermined compound” that is the subject of the present invention. The “predetermined compound” that is the subject of the present invention is a substance that is transported into and out of the cells of the microorganism via the membrane protein.

When the membrane protein is an exporter protein, the “predetermined compound” that is the subject of the present invention is not only a compound that can grow a microorganism used in the host in the presence of the compound, but also into a microorganism cell used in the host. Compounds that have an action of inhibiting the growth by accumulation can also be mentioned. For example, when the host is E. coli, it is known to inhibit the growth of E. coli such as monoalanine (L-alanine), non-ribosomal peptide, terpenoid. In the present invention, a substance can also be a “predetermined compound”.

Process (1)
The screening method of the present invention is a gene in which a gene encoding a fusion partner and a gene encoding a membrane protein candidate are linked so as to be expressed by translation of polycistronic mRNA, and the gene encoding the fusion partner And a step of preparing a library of microorganisms incorporating a gene linked so that a part of the nucleotides constituting the stop codon is part of the start codon of the gene encoding the membrane protein candidate. In this step, an operation for introducing a gene encoding a fusion partner and a gene encoding a membrane protein candidate into a microorganism is performed on the genes encoding various membrane protein candidates, and a plurality of types of recombinant microorganisms are produced. Can do.

In the present invention, the fusion partner is a protein that binds to the N-terminal side of the protein to be expressed, and exhibits effects such as stabilizing the mRNA of the membrane protein and improving the expression level of the membrane protein on the cell membrane (non- Patent Document 3) is also used when purifying a protein to be expressed. Typical examples include mstX and ybeL. Non-Patent Document 3 describes that fusion partners mstX and ybeL were linked to membrane proteins such as ProW, MscL, LacY and GltP and expressed in vivo. However, in Non-Patent Document 3, whether or not a sufficient amount of protein having a preserved structure can be obtained in the structural biology of membrane proteins is still set as a major bottleneck. This document only discloses the results of confirming the expression level of the expression of the membrane protein produced using the fusion partner and evaluating the function in the cell-free evaluation system. When further seeking the quality / quantitative improvement of membrane proteins in the structural biology, the focus of discussion is on which fusion partner to choose and the structure of the gene, ybeL being preferred over mstX Only disclose the conclusion. In addition, it is stated that when Y4PCRGPCR is expressed, although any quality / quantitative improvement can be confirmed compared to when the fusion partner is not used, it is still insufficient. The membrane protein expressed using a fusion partner functions in vivo (cells), the ability to easily search for a substrate without purifying the expressed membrane protein, and the expressed membrane protein is a useful substance for metabolism There is no disclosure regarding the results of a study on whether or not it will function in cooperation with the system and contribute to the efficiency of substance production. In the present invention, mstX means a polypeptide having the amino acid sequence shown in Genbank accession No. YP_003097778.1 or the amino acid sequence and 70% or more (preferably 80% or more, more preferably 85% or more, more preferably 90%). % Or more, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more) polypeptide having an amino acid sequence (typically a functional equivalent to the above polypeptide) Indicates. In the present invention, ybeL is a polypeptide having the amino acid sequence represented by GenbankGenaccession No.NP_415176.1 or the amino acid sequence and 70% or more (preferably 80% or more, more preferably 85% or more, more preferably Is a polypeptide having an amino acid sequence having an identity of 90% or more, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more (typically functional equivalent to the above polypeptide) Thing).

A method for obtaining a gene encoding a membrane protein is not particularly limited. For example, as in the examples described later, a membrane transporter candidate protein is obtained by PCR using a genomic DNA of a predetermined microorganism as a template and using appropriate primers. It can be obtained by amplifying the encoded gene. There is no particular limitation as to which microorganism is used as the membrane protein, and examples thereof include microorganisms described later as “microorganisms into which genes are introduced”. The microorganism originally having the membrane protein and the microorganism into which the gene for the membrane protein is introduced may be of different types or the same type.

The microorganism into which these genes are introduced is not particularly limited, but prokaryotes are preferred among eukaryotes and prokaryotes in the present invention. Examples of prokaryotes include bacteria (eubacteria) such as Escherichia coli, actinomycetes (genus Corynebacterium, Streptomyces, Propionibacterium, etc.), lactic acid bacteria (genus Lactobacillus, Streptococcus, etc.), Bacillus subtilis (genus Bacillus, etc.), E. coli and actinomycetes are preferred. Examples of the genus Corynebacterium include Corynebacterium glutamicum, Corymebacterium ammoniagenes, Corynebacterium lactofermentum, Corynebacterium efficiens, and the like.

In the present invention, a gene encoding a fusion partner and a gene encoding the membrane protein candidate are incorporated into the microorganism as a linked gene so as to be expressed by translation of polycistronic mRNA, and It is further preferred that the gene is linked such that a part of the nucleotide constituting the stop codon of the gene encoding the fusion partner becomes a part of the start codon of the gene encoding the membrane protein candidate. Due to such characteristics, according to the present invention, a new function can be brought about qualitatively or quantitatively to a membrane protein candidate. For example, when the gene encoding the fusion partner and the gene encoding the membrane protein candidate are combined in the above-described embodiment, the ability to transport a substance not known about the membrane protein candidate can be obtained. Therefore, in the method for screening a membrane protein candidate for a predetermined compound according to the present invention, the above characteristics are very important. As a method for introducing a gene encoding a fusion partner and a gene encoding a membrane protein candidate into the microorganism, the gene encoding the fusion partner and the gene encoding the membrane protein candidate are combined in the above manner as the genes to be introduced. The method can be carried out according to a method known per se, except that the above gene is used. For example, it can be performed by constructing a vector incorporating a hereditary gene encoding a fusion partner and a gene encoding a membrane protein candidate and incubating the microorganism in the presence of the vector. It is also preferable that a gene encoding a fusion partner and a gene encoding a membrane protein candidate involved in the transport of the predetermined compound are incorporated into the microorganism as a linked gene so as to be expressed as a fusion protein. The microorganism typically has the ability to produce a predetermined compound. A gene expressing a predetermined compound may be further introduced into the microorganism. The microorganism (preferably Escherichia coli) further incorporates a gene encoding a tRNA corresponding to the rare codon of the microorganism. When expressed as a compound, it is preferable from the viewpoint of expanding the tRNA repertoire.

Process (2)
The present invention includes a step of culturing a microorganism into which a gene encoding a fusion partner and a gene encoding a membrane protein candidate obtained by the step (1) are incorporated.

The medium used in the step is not particularly limited, and a medium that can be used for culturing the microorganism can be widely used. For example, LB medium, M9 medium, MRS medium, Marz medium, bouillon medium and the like can be mentioned. Glucose, starch, soluble starch, waste molasses, corn steep liquor and the like may be added to the medium as a carbon source. When the membrane protein candidate is an importer candidate protein, a predetermined compound may be added to the medium in advance. The culture temperature is not particularly limited, and can be appropriately set within a range of 20 to 45 ° C, more preferably 25 to 37 ° C. The culture time is not particularly limited, but can be appropriately set within a range of, for example, 12 to 72 hours, more preferably 24 to 48 hours. The culture may be stationary culture or shaking culture, but shaking culture is preferred.

Process (3) (4)
The present invention includes a step of identifying a culture solution or a supernatant thereof in which a variation is observed in the amount of the predetermined compound as compared with that before culturing. This step can be performed by measuring the amount of a predetermined compound in the culture solution or its supernatant before and after the above (2) culturing step and comparing them. When a change is observed in the amount of the predetermined compound after the step (2) before the culturing step, the membrane protein candidate can be identified as the membrane transporter of the predetermined compound. That is, when a gene encoding a desired membrane protein candidate is incorporated into the microorganism, the membrane protein candidate is configured to penetrate the cell membrane of the cell in combination with the action of the fusion partner. When the candidate is an importer protein, the amount of the predetermined compound in the culture supernatant is decreased. On the other hand, when the membrane protein candidate is the exporter protein, the amount of the predetermined compound in the culture supernatant is considered to increase. .

The present invention relates to a method for producing a predetermined compound, comprising:
A microorganism in which a gene encoding a fusion partner and a gene encoding a membrane protein involved in transport of the predetermined compound are linked so that they are expressed by translation of polycistronic mRNA is cultured. Including steps,
The linked gene is linked so that a part of the nucleotide constituting the stop codon of the gene encoding the fusion partner becomes a part of the start codon of the gene encoding the transporter protein of the predetermined compound A method is provided that is a gene.

Details of the “microorganism integrated so as to express the gene encoding the fusion partner and the gene encoding the membrane protein involved in the transport of the predetermined compound” used in the present embodiment, specifically, the fusion partner Definitions, examples of predetermined compounds, microorganisms, and the like are as described in “ Membrane protein screening method ”. In addition, matters relating to the gene, such as a method for obtaining a gene encoding a membrane protein and a method for introducing the gene, are as described above for the “gene encoding a membrane transporter candidate protein”. Further, the culture medium, the kind of additive, the culture temperature, the time, etc. in the culture process are as described above.

The method of the present invention may further include a step of recovering a predetermined compound from the culture solution obtained in the above culturing step. The method for recovering the predetermined compound from the culture medium is not particularly limited, and a method known per se (centrifugation, recrystallization, distillation method, solvent extraction method, chromatography, etc.) can be appropriately used.

<Details of experimental method>
(1) Construction of vector plasmid for high expression of membrane protein (common to all examples)
(1) -1. Construction of pTrc99A_mstX_C8_His Plasmid vector pTrc99A (Pharmacia Biotech) was cleaved with restriction enzymes XbaI and HindIII, and XbaI and HindIII recognition sequences were 5 ′ and 3 ′ ends in an oligo DNA having a linker and TEV protease recognition sequence and His-tag. A sequence added to each (CTAGAGGTGGCGGTGGCGGTGGCGGTGGCGAAAACCTGTACTTCCAGGGTCACCACCACCACCACCATCATCATtaaTAGCT) was inserted by ligation (pTrc99A_C8_His). This sequence was obtained by consigning synthesis to Hokkaido System Science Co., Ltd.

Next, pTrc99A_C8_His was cleaved with restriction enzymes NcoI and KpnI, and the cloned mstX gene was inserted by ligation. After culturing Bacillus subtilis using LB medium, the mstX gene fragment was extracted by extracting genomic DNA from B. subtilis using NucleoSpin Tissue (Takara) according to the attached protocol. B. It was obtained by amplifying by PCR using subtilis genomic DNA as a template and using forward primer: AGGAAACAGACcatgttttgtacattttttgaaaaacatcaccgg and reverse primer: CTAGAGGATCCCCGGGTACCACTCATtctttttttctccttcttcagatactg as primers. Using the In-Fusion HD Cloning Kit (Takara) according to the attached protocol, the mstX gene fragment was treated with NcoI and KpnI and then ligated to pTrc99A_C8_His (pTrc99A_mstX_C8_His).

(1) -2. Preparation of pTrc99A_ybeL_C8_His pTrc99A_C8_His is the example (1) -1. The same procedure was used. The ybeL gene fragment was prepared in Example (1) -1. It was obtained by PCR amplification using E. coli genomic DNA obtained in the same procedure as a template using forward primer (AGGAAACAGACcatgaacaaggttgctcaatattaccg) and reverse primer (CTAGAGGATCCCCGGGTACCACTCATaccacttctccgctgtgataaac) as primers. The obtained amplified fragments were obtained in Example (1) -2. Ligated to pTrc99A_C8_His by the same procedure as above to obtain pTrc99A_ybeL_C8_His.

(2) Example 1. Transporter search 1 (coryne)
(2) -1. Corynebacterium glutamicum (Corynebacterium glutamicum) is cultured using a medium for preparing a coryneform membrane transporter library (polypeptone 2 g, yeast extract 0.4 g, MgSO4 7H2O 0.2 g / 200 ml). Genomic DNA was extracted using NucleoSpin Tissue (Takara) according to the attached protocol. Using the extracted genomic DNA as a template, each of the three transporter genes was amplified by PCR using the primers shown in Table 1. pTrc99A_mstX_C8_His was treated with restriction enzymes KpnI and XbaI, and each transporter gene was ligated using In-Fusion HD Cloning Kit (Takara) according to the attached protocol to construct a plasmid vector for expression of each membrane transporter. At this time, as shown in FIG. 1, the stop codon of the mstX gene and the start codon of each transporter gene share a part of each other.

(2) -2. E. coli for transporter expression transformation E. coli C43 (DE3) strain (Lucigen) suitable for expression of toxic protein transformed with plasmid pRARE (Merck) supplemented with tRNA corresponding to rare codons of E. coli (C43 ( Example strains were obtained using DE3) Rosetta strain) as the expression host of the plasmid vector for membrane transporter expression obtained in (2) -1. Further, as a control, pTrc99A_mstX_C8_His not ligated with a membrane transporter gene was introduced into the expression host to obtain a control strain.

Example strains and control strains were precultured at 30 ° C. for 24 hours using LB medium to obtain a precultured solution. Antibiotic ampicillin (100 μg / ml) and chloramphenicol (30 μg / ml) were added to 50 ml M9 minimal medium, and 500 μl of the preculture was added, followed by shaking culture at 37 ° C. When OD660 reached approximately 0.5, IPTG was added so that the final concentration was 1 mM, followed by shaking culture at 37 ° C. for 24 hours. After culturing for 24 hours, centrifugation was performed at 9,000 rpm for 15 min to obtain Example strain culture supernatant and control strain culture supernatant.

(2) -3. The pre-culture solution, the culture supernatant of Example strain and the culture supernatant of the control strain in MS analysis (2) -2 of the culture solution were filtered using a 0.22 μm filter. MS analysis of components contained in each filtrate was outsourced to Shimadzu Corporation.

(2) -4. Results are shown in FIG. It was found that the culture supernatant of Example strain 1 contained lysine, ornithine and proline much more than the preculture and control culture supernatants (FIGS. 2A to 2C). The gene ligated to the plasmid vector introduced into Example strain 1 was the LysE gene, and LysE was known to function not only as an original lysine transporter but also as an ornithine transporter. However, in FIGS. 2A and 2B, the ability of LysE to transport lysine and ornithine was confirmed, indicating that the membrane transporter searching method of the present invention is highly accurate and useful. On the other hand, surprisingly, since the transport ability of proline, which was not known so far in LysE, was confirmed (FIG. 2C), the novel membrane transporter of the present invention and its usefulness as a method for searching for its function were shown. It was.

Further, although the function of the transporter gene introduced into Example strain 4 was not clarified, it was shown by the present invention that it is a glycine-specific membrane transporter (FIG. 2D). Furthermore, the valine transporter exists in various ways regardless of its transport ability, and in particular, the transporter whose function was unknown in the past expressed in Example strain 14 was identified as the valine transporter having the highest transport ability. (FIG. 2E). These results also showed the usefulness as a method for searching for a membrane transporter of the present invention.

(3) Example 2. Transporter Search 2 (Alanine Transporter)
The present invention can be a search method specialized in searching for a membrane transporter of a specific substance by selecting an expression host, and this example is an example. In this example, Escherichia coli MLA301ΔygaW strain (Hori et al (2011) Appl Environ Microbiol 77: 4027-4034) was used as an expression host. The Escherichia coli MLA301ΔygaW strain is an alanine-requiring strain because it lacks the intracellular alanine metabolism system, and when cultured in the presence of dialanine (L-alanine-L-alanine), monoalanine (L A strain of E. coli that overaccumulates alanine and also inhibits growth. In other words, using Escherichia coli MLA301ΔygaW strain as an expression host and introducing a membrane transporter expression plasmid vector and culturing in the presence of dialanine, growth inhibition of the introduced strain was reduced and growth of the cells (increase in the number of cells) was observed. In this case, the introduced strain expresses an alanine excretion transporter, and a new alanine transporter can be searched and specified.

(3) -1. Preparation of plasmid vector for expression of membrane transporter (3) A total of three transporter gene amplification products obtained using the primers shown in Table 2 in addition to the three transporter gene amplification products obtained in (2) -1. Six types of Corynebacterium glutamicum transporter gene libraries were ligated into pTrc99A_mstX_C8_His. The specific method of ligation was performed in the same procedure as in Example (2) -1.

(3) -2. Transformation of Escherichia coli for Membrane Protein Expression Escherichia coli MLA301ΔygaW was used as an expression host for the plasmid vector for membrane protein expression obtained in (3) -1. As a control, pTrc99A_mstX_C8_His not ligated with a transporter gene library was introduced into the expression host to obtain a control strain.

The Escherichia coli MLA301ΔygaW strain and control strain transformed with a membrane protein expression plasmid vector were pre-cultured using LB medium at 30 ° C. for 20 hours to obtain a preculture solution. Subsequently, the cultured cells were centrifuged at 7,500 rpm (KUBOTA 3700) for 1 minute at 4 ° C. to collect the whole amount. The supernatant after collection was removed, and a minimal medium (Glucose 220 mM, MgSO 4 17 mM, (NH 4) 2 SO 4 7.5 mM, K 2 SO 4 7 mM, NaCl 22 mM, Sodium phosphate (pH 7.0), D-Ala 50 μg / ml, Asp- The suspension was suspended in K (pH 7.0) 50 mM) and centrifuged at 7,500 rpm (KUBOTA 3700) for 1 minute (bacterial cell washing). After washing twice, the absorbance when suspended for the third time is measured, and O.O. D. After adding so that 660 = 0.002, it was cultured at 25 ° C. (main culture). The culture solution was sampled over time, and the absorbance at 660 nm (OD 660) was measured. As needed, 0.5 mM Ala-Ala, 30 μg / ml Carbenicillin, 30 μg / ml Spectamycin was added to the LB medium and the minimal medium.

(3) -3. Results are shown in FIG. The control strain and the transporter CT035-introduced strain did not grow, and growth inhibition due to an increase in intracellular monoalanine was observed. On the other hand, each of the introduced strains of CT005 and 032 showed an increase in the number of cells with the culturing time, and these were identified as alanine excretion transporters. The novel membrane transporter of the present invention and its usefulness as a method for searching for its function were shown.

(4) Example 3 Productivity increase 1
In Example 1, the transporter identified as the valine transporter was subjected to verification for increased productivity using the present invention. C43 (DE3) Rosetta strain (Example strain) introduced with the pTrc99A_mstX_C8_His plasmid vector containing the transporter gene, C43 (DE3) Rosetta strain (Comparative Example strain) introduced with the pTrc99A_C8_His plasmid vector containing the transporter gene, Example 1 The culture supernatant was filtered using a 0.22 μm filter. For analysis of amino acids in each culture supernatant, the filtrate was mixed with an equal volume of matrix (5 mg / mL CHCA (solvent is 70% acetonitrile, 0.1% TFA)) for ionization, and TOF / TOF ^™ The sample was subjected to 5800 (manufactured by SCIEX) and detected according to the attached protocol. Proline was used as an internal standard, and the peak of valine was confirmed using a sample (FIG. 4B, Val (Std.)), And the peak intensity of valine in each filtrate was compared.

The results are shown in FIG. FIG. 4A is a blank of minimal medium only. In FIGS. 4B to F, proline (final concentration of 100 μM) was added as an internal standard, and the peak of valine in the standard was confirmed (FIG. 4B: Std.). Culture supernatant obtained by culturing in medium (FIG. 4C), culture supernatant obtained by culturing C43 (DE3) Rosetta strain only introduced with pTrc99A_mstX_C8_His plasmid vector in minimal medium (FIG. 4D), and minimal comparative strain The TOF / MS data of the culture supernatant (FIG. 4E) obtained by culturing in a medium and the culture supernatant (FIG. 4F) obtained by culturing Example strains in a minimal medium are shown. When the amount of valine produced in each of the Example strain and Comparative Example strain was compared with the signal ratio derived from the internal standard proline, the Example strain increased remarkably (about 4 times) (FIG. 5). From this, it was demonstrated that the production method of the substance of the present invention is expected to increase the production amount of the predetermined substance.

(5) Example 4 Productivity increase 2
About CT005 specified in Example 2, the alanine production increase ability using this invention was verified.

E. coli C43 (DE3) strain (Example strain) introduced with the plasmid vector for ligation of CT005 obtained in Example 2 and the plasmid vector for expression of the membrane transporter without ligation of CT005 were introduced. Escherichia coli C43 (DE3) strain (comparative example strain) was obtained and cultured with shaking in an LB liquid medium (30 μg / ml Carbenicillin) at 30 ° C. for 24 hours. Add 0.5 ml of the preculture to 50 ml of minimal medium (Glucose 220 mM, MgSO 4 17 mM, (NH 4) 2 SO 4 7.5 mM, K 2 SO 4 7 mM, NaCl 22 mM, Sodium phosphate (pH 7.0)), shake at 37 ° C. Cultured at last. O. D. 660 = 0.5-0.6, 22 mM D-glucose, 30 μg / ml Carbenicillin, 1 mM Pyridoxal-5′-phosphate, 0.2 mM IPTG, and 0-50 mM Asp-K pH as required 7.0 was added and cultured with shaking at 37 ° C. for 12 hours. Amino acids contained in the culture supernatant after collection were derivatized using o-phthalaldehyde, and HPLC (LC-10A, Shimadzu, Japan) equipped with a cation exchange column (Shim-pack AMINO NA, Shimadzu, Japan). ). 30 μg / ml Carbenicillin was added to the LB medium and minimal medium as needed.

The results are shown in FIG. As the culture time elapses, the difference in the amount of alanine produced in the culture supernatant of each of the example strain and the comparative strain increased, and if each strain was continuously cultured, the production amount difference was expected to increase. At 12 hours after the cultivation, the production amount of the Example strain was 1.5 times that of the Comparative strain. From this, it was proved that the production amount of the predetermined substance can be expected by the production method of the substance of the present invention.

(6) Example 5 Comparison of Productivity The productivity of a given compound according to the present invention was verified. In Example 5, the Example strain 14 in Example 1 was used as the Example strain. In Example 5, two types of comparative strains were prepared. As shown in FIG. 7, Comparative strain 1 replaces the termination codon part of the fusion partner gene and the start codon part of the NCgl2232 gene with a codon encoding another amino acid, and is linked as a gene encoding a fusion protein of the fusion partner and NCgl2232. Comparative strain 2 was obtained by linking the fusion partner gene and NCgl2232 gene so that they were expressed by different open reading frames (hereinafter referred to as a single cistron gene). Using.

Comparative strains

1 and 2 were the same as in the method described in (2) -1, except that the following primer set was used for pTrc99A_mstX_C8_His described in (1) -1 above, and a fusion protein gene and a single cistron gene amplification product And a ligated plasmid vector was obtained by gene transfer using E. coli as described in the same method as in (2) -2.
FW (fusion protein gene): GAAAAAGAGGGACAACAGGTGCTCATG (Translational fusion)
FW (single cistron gene): GAAAAAGAGTGAGTGGATGCAACAGGTGCTCATG (: Individual)
RV (common to Example strain and Comparative strain): CACCGCCACCTCTAGAAGATCCAAAGATAATGGAGACCGC (RV of Example strain 14 in Table 1).
Example strain 14, two types of comparative strains and the control strain described in (2) -2 were both cultured under the same conditions as in (2) -2, and the same as described in (4) The amino acid was detected by this method. However, proline (final concentration 1 mM) was used as an internal standard, and the peak of valine was confirmed using a standard (FIG. 7, upper left, Val (Std.)), And the peak intensity of valine in each filtrate was compared ( FIG. 7).

(6) -1. Results are shown in FIG. As a result of analysis by TOF-MS, the culture supernatant of Example strain 14 contains valine, the amount of which is compared with the amount in the preculture solution, the culture supernatant of the two comparative strains, and the control culture supernatant. It was found that the number was significantly higher (FIG. 7). From the above, it was shown that the productivity of the predetermined compound according to the present invention is remarkably high and beneficial, taking the productivity of valine as an example.

(7) Example 6
An amplification product was obtained using each of the following primer sets, using the genomic DNA of Corynebacterium glutamicum extracted as described in (2) -1 as a template. Example strains 55 and 68 were obtained by introducing each amplified product into a plasmid vector ligated to pTrc99A_mstX_C8_His by the method described in (2) -1, using E. coli described in (2) -2 as a host. It was.
FW-55: GAAAAAGAATGAGTGGTACCAGCGAACAACTTCAGGGTG
RV-55: CACCGCCACCTCTAGACTGAGCCGCGAGTTGG
FW-68: GAAAAAGAATGAGTGGTACCACCACAACTGATCACTCCAC
RV-68: CACCGCCACCTCTAGAGACCTCTCGGAGGTCG
Example strains 55 and 68 and the control strain described in (2) -2 were all cultured as described in (2) -2 and filtered using a 0.22 μm filter.

GC-MS
10 μL of 2-isopropylmalic acid aqueous solution (0.5 mg / mL) as an internal standard was added to 50 μL of the above filtrate, and 250 μL of water: methanol: chloroform = 1: 2.5: 1 solution was added and stirred. Shake for 30 minutes at ° C. Centrifugation was performed at 16,000 G for 3 minutes, 225 μL of the supernatant was collected, 200 μL of ultrapure water was added, stirred, and centrifuged again at 16,000 G for 3 minutes to recover 250 μL of the supernatant.
After treating with a concentration centrifuge for 25 minutes to vaporize methanol in the solution, it was dried with a centrifugal evaporator.
To the dried sample, 80 μL of methoxyamine hydrochloride pyridine solution (20 mg / mL) was added, shaken at 30 ° C. for 90 minutes, and then 40 μL of N-methyl N trimethylsilyl trifluoroacetamide (MSTFA) was added, followed by 30 ° C. at 30 ° C. Shake for minutes. The solution was centrifuged at 16,000 G for 3 minutes to precipitate the residue in the solution, and 100 μL of the supernatant was collected in a GC-MS vial to obtain a GC-MS sample. The analysis was performed using the following equipment and method to compare the peak intensities of the compounds contained in each filtrate:
Equipment used <br/> Gas chromatograph mass spectrometer: GCMS-TQ8040
Analysis method <br/> Shimadzu Corporation OA_TMS_DB537min_V3_Scan: 37 minutes method, splitless (7) -1. Results are shown in FIG. It was found that the culture supernatant of Example strain 55 contained 3-α-mannobiose much more than the preculture and control culture supernatants (FIG. 8A). The gene introduced into Example strain 55 was annotated (function estimation) as a protein involved in shikimate transport on the genome of Corynebacterium glutamicum, but according to the present invention, this was expressed as 3-α-mannobiose. It was identified as a transporter, and the utility of the screening method of the present invention was shown. Further, it was confirmed that the productivity of 3-α-mannobiose was improved by culturing a microorganism in which the same gene was expressed by the method of the present invention, and the usefulness of the method for producing a predetermined substance of the present invention was demonstrated. It was.

Similarly, as shown in FIG. 8B, it was found that the culture supernatant of Example strain 68 contained much lactic acid as compared with the preculture solution and the control culture supernatant. The transporter gene introduced into Example strain 68 was annotated (function estimation) as a protein involved in metabolite transport on the genome of Corynebacterium glutamicum, but according to the present invention, it excretes lactic acid. It was identified as a transporter, and the usefulness of the screening method of the present invention was shown. Further, as shown in FIG. 8B, it was confirmed that lactic acid productivity was improved by culturing a microorganism in which the same gene was expressed by the method of the present invention, and the usefulness of the method for producing a predetermined substance of the present invention was confirmed. It has been shown.

Claims

A method for producing a predetermined compound, comprising:
Culturing a microorganism incorporating a gene in which a gene encoding a fusion partner and a gene encoding a membrane protein involved in transport of the predetermined compound are linked so as to be expressed by translation of polycistronic mRNA,
The linked genes are linked such that a part of the nucleotides constituting the stop codon of the gene encoding the fusion partner is part of the start codon of the gene encoding the membrane protein involved in the transport of the predetermined compound A method, which is a genetically generated gene.
The method according to claim 1, further comprising a step of recovering the predetermined compound from a culture solution obtained in the step of culturing the microorganism.
2. The method according to claim 1, wherein the microorganism is a bacterium.
The method according to claim 1, wherein a gene encoding a tRNA corresponding to a rare codon of the microorganism is further incorporated into the microorganism.
The method according to claim 1, wherein the membrane protein is an exporter protein, an importer protein, a synthase protein, or a protein that is a component of a protein secretion apparatus.
A method for screening a membrane protein for a predetermined compound, comprising the following steps (1) to (4):
(1) A gene in which a gene encoding a fusion partner and a gene encoding a membrane protein candidate are linked so as to be expressed by translation of polycistronic mRNA, and constitutes a stop codon of the gene encoding the fusion partner Creating a library of microorganisms incorporating a gene linked so that a part of the nucleotide to be a part of the start codon of the gene encoding the membrane protein candidate,
(2) a step of culturing the microorganism (3) a step of identifying a culture solution or a supernatant thereof in which a variation is observed in the amount of the predetermined compound compared to before the culture,
(4) A step of specifying that the membrane protein candidate incorporated and expressed in the microorganism from which the specified culture solution or supernatant is obtained is a membrane protein having the ability to transport the predetermined compound inside and outside the membrane.
The method according to claim 6, wherein the membrane protein is an exporter protein, an importer protein, a synthetic concept protein, or a protein that is a protein secretion apparatus.
The method according to claim 6, wherein the microorganism is a bacterium.
The method according to claim 6, wherein a gene encoding a tRNA corresponding to a rare codon of the microorganism is further incorporated into the microorganism.