JP2022109064A - Method for producing nucleobases, organic acids and/or polyamines - Google Patents

Abstract

To provide novel methods for suppressing excretion bottlenecks in the production of nucleic acids, organic acids and/or polyamines using microorganisms.SOLUTION: Provided is a method for producing at least one selected from the group consisting of nucleic acids, organic acids and polyamines, which comprises culturing a microorganism expressing LysE.SELECTED DRAWING: None

Description

The present invention relates to a method for producing nucleobases, organic acids and/or polyamines.

Substance production using microorganisms generally has many advantages in terms of productivity, cost, etc., compared to chemical synthesis and the like, and is used in various fields. Typically, substrates taken in from the environment are metabolized in the cells of microorganisms to become metabolites, excreted outside the cells, and the excreted metabolites are recovered. Transporters (exporters) that excrete metabolites out of cells are important for such substance production. Specifically, for example, in the case of the production of primary metabolites, etc., the exporter of the target compound may already be present in the microorganism. When the concentration in the body rises, feedback inhibition occurs, and the efflux transport of the product may become a rate-limiting step (Non-Patent Document 1). In addition, in the case of the production of secondary metabolites or new compounds, if the microorganism used does not have a transporter in the first place, the metabolite will not be excreted out of the cell and continuous production will not be possible. obtain. The problem that the productivity of the substance is reduced or cannot be produced due to the insufficient or inability to export the substance to the outside of the cell is called an excretion bottleneck. It can be said that the emission bottleneck is a potential problem in the technical development for the industrial production of substances using current microorganisms or the production of new substances expected to be industrially produced using microorganisms.

WO2019/208724 pamphlet

Appl Microbiol Biotecnol (2015) 99:9381-9393 Vrljic et al (1996) Mol Microbiol 22, 815-826, Lubitz et al (2016) Appl Micorbiol Biotechnol 100, 8465-8474 J Mol Biol. 2015 Feb 27;427(4):943-54

An object of the present invention is to provide a novel method for suppressing an excretion bottleneck when producing nucleobases, organic acids and/or polyamines using microorganisms.

Under such circumstances, the present inventors have extensively studied a wide variety of membrane transporter candidate proteins, and found that LysE, which is a membrane transporter of ricin, unexpectedly contains compounds other than amino acids, such as nucleobases, organic acids, and It was found to have the ability to transport polyamines. The present invention is based on such new findings. Accordingly, the present invention provides the following terms:
Section 1. A method for producing at least one selected from the group consisting of nucleic acid bases, organic acids and polyamines, comprising the step of culturing a LysE-expressing microorganism.

Section 2. Item 2. The method according to Item 1, wherein the LysE-expressing microorganism is a microorganism introduced with a nucleic acid encoding LysE.

Item 3. Item 3. The method according to Item 1 or 2, further comprising a step of recovering at least one selected from the group consisting of nucleic acid bases, polyamines and organic acids from the supernatant of the culture medium obtained in the culturing step.

Section 4. Item 4. The method according to any one of Items 1 to 3, wherein the nucleobase is a pyrimidine compound.

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to provide a novel method for suppressing the excretion bottleneck during the production of nucleobases, organic acids and/or polyamines using microorganisms.

2 shows the results of MS analysis of the preculture solution, the culture supernatant of the example strain, and the culture supernatant of the control strain in Examples of the present application. 2 shows the results of MS analysis of the preculture solution, the culture supernatant of the example strain, and the culture supernatant of the control strain in Examples of the present application.

In the present invention, unless otherwise specified, the term "gene" includes not only structural genes that define the primary structure of proteins, tRNAs, rRNAs, etc., but also nucleic acids having specific regulatory functions such as promoters and operators. Regions are also included. Therefore, in the present invention, the term "gene" refers to regulatory regions, coding regions, exons, and introns without distinction, unless otherwise specified. "Structural gene" also includes silent DNA in which silent mutations have been made to the original DNA sequence. In the present invention, "gene" also includes nucleic acid molecules such as siRNA that interfere with gene expression.

As used herein, "nucleic acid" is synonymous with nucleotide, oligonucleotide and polynucleotide, and may be DNA, RNA or DNA-RNA hybrid. In addition, these may be double-stranded or single-stranded, and when referring to a nucleic acid molecule having a certain sequence, unless otherwise specified, a nucleic acid molecule (or nucleotide, oligonucleotide) having a sequence complementary thereto and polynucleotides) are also meant inclusively. In addition, these nucleic acid molecules may be circular or linear, and may be of synthetic or biological origin.

In the present invention, the term "nucleobase" means a base that constitutes a nucleotide. "Nucleobase" includes pyrimidine base, purine base and the like. In the present invention, the term "nucleobase" also includes compounds with structures similar to nucleic acid bases, such as mercaptopurine, 8-azaguanine, hypoxanthine, and caffeine.

In the present invention, the terms "protein (protein)" and "peptide" are used to include oligopeptides and polypeptides, unless otherwise specified. In addition, as used herein, "protein" and "peptide" include both proteins modified with sugar chains and the like and unmodified proteins, unless otherwise specified. This also applies to proteins that are not specified as proteins.

Method for Producing Nucleobase, Organic Acid and/or Polyamine The present invention provides a method for producing at least one selected from the group consisting of nucleobase, organic acid and polyamine, comprising the step of culturing a microorganism expressing LysE. do.

Nucleic acids include ribonucleotides such as AMP, ADP, ATP, GMP, GDP, GTP, UMP, UDP, UTP, CMP, CDP, and CTP; Deoxyribonucleotides such as dCMP, dCDP and dCTP are included.

Nucleic acid bases include pyrimidine bases such as cytosine, uracil and thymine; purine bases such as adenine and guanine; xanthine, hypoxanthine and purine; more preferred. In the present invention, the term "organic acid" refers to an organic compound exhibiting acidity, other than an amino acid. As such an organic acid, one having a carboxyl group is preferable. More specific examples include glutaric acid, phenylacetic acid, hydroxyphenylacetic acid, lauric acid, octanoic acid, aconitic acid, ketoisovaleric acid, hydroxypropionic acid, succinic acid, citric acid, oxalic acid, glutaric acid, Phenylacetic acid, hydroxyphenylacetic acid and the like are preferred. Polyamines include, for example, putrescine, cadaverine, spermine, spermidine, agmatine and the like, with putrescine and the like being preferred. Although the molecular weight of these substances is not particularly limited, it is preferably 80-200, more preferably 110-150.

The nucleic acids, organic acids and polyamines produced by the present invention are not only those that allow the host microorganism to grow in the presence of these compounds, but also those that inhibit the growth of the host microorganism by accumulating in the cells. Compounds with action may also be mentioned. In order to examine the composition of the membrane proteins and the like that constitute the LysE-expressing microorganism itself, the method of decomposing the cell membrane of the microorganism and analyzing the decomposition products is a typical method of the present invention, “from nucleobases, organic acids and polyamines. It does not fall under "a method of producing at least one selected from the group consisting of

Culturing Step The present invention includes a step of culturing a microorganism expressing LysE.

In the present invention, LysE is a polypeptide having the amino acid sequence shown in European Nucleotide Archive CAA65324.2 (amino acid sequence listed as P94633 in database UniProtKB) or 70% or more (preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more) of a polypeptide (typically indicates functional equivalents of the above polypeptides). In addition, as a nucleic acid encoding LysE, for example, a polypeptide having a nucleotide sequence shown at the position of 1016 to 1726 bases of European Nucleotide Archive X96471, or 70% or more (preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more).

A microorganism that expresses LysE in the present invention may be a microorganism originally having the ability to express LysE (a microorganism into which a nucleic acid encoding LysE has not been introduced), but in a preferred embodiment, a nucleic acid encoding LysE is introduced. microorganisms can be used. Examples of microorganisms capable of expressing LysE include Escherichia coli and coryneform bacteria.

Although the method for obtaining the nucleic acid encoding LysE is not particularly limited, for example, as in Examples described later, the genomic DNA of a given microorganism is used as a template and PCR is performed using appropriate primers to amplify the nucleic acid encoding LysE. can be obtained by There are no particular restrictions on which microorganism the membrane LysE is derived from, but examples thereof include the microorganisms described below as the “microorganism into which the gene is introduced”. The microorganism originally having LysE and the microorganism into which the nucleic acid of LysE is introduced may be of the same species or of different species.

Microorganisms into which a nucleic acid encoding LysE is introduced are not particularly limited, but in the present invention, among eukaryotes and prokaryotes, prokaryotes are preferred. Examples of prokaryotes include bacteria (eubacteria) such as Escherichia coli, actinomycetes (genus Corynebacterium, Streptomyces, Propionibacterium, etc.), lactic acid bacteria (genus Lactobacillus, Streptococcus, etc.), and Bacillus subtilis (genus Bacillus, etc.). Escherichia coli, actinomycetes, etc. are preferred. The Corynebacterium genus includes Corynebacterium glutamicum, Corymebacterium ammoniagenes, Corynebacterium lactofermentum, Corynebacterium efficiens, and the like. The above microorganisms typically have the ability to produce nucleobases, organic acids and/or polyamines. Genes that express nucleobases, organic acids and/or polyamines may be further introduced into the above microorganisms. A method known per se can be used to introduce a gene encoding LysE into the microorganism. For example, it can be carried out by constructing a vector incorporating a nucleic acid encoding LysE and incubating the microorganism in the presence of the vector.

In the present invention, a gene encoding LysE and a gene encoding a fusion partner may be incorporated into the host microorganism so that these genes are expressed. In this embodiment, the fusion partner is a protein that binds to the N-terminal side of the protein to be expressed (LysE in the present invention), and stabilizes the mRNA of the membrane protein and improves the expression level of the membrane protein on the cell membrane. (Non-Patent Document 4), and is also used when purifying proteins to be expressed. Typical examples include mstX and ybeL. In the present invention, mstX refers to a polypeptide having the amino acid sequence shown in Genbank Accession No.YP_003097778.1 or 70% or more (preferably 80% or more, more preferably 85% or more, more preferably 90% of the amino acid sequence). %, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more) (typically functional equivalents of the above polypeptides) indicate. In the present invention, ybeL is a polypeptide having the amino acid sequence shown in Genbank Accession No. NP_415176.1 or 70% or more (preferably 80% or more, more preferably 85% or more, more preferably 85% or more of the amino acid sequence). is 90% or more, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more). object).

In this embodiment, a gene encoding a fusion partner and a gene encoding LysE are integrated into the microorganism as linked genes so that they are expressed by translation of polycistronic mRNA, and the fusion partner It is further preferable that the gene is ligated so that part of the nucleotides constituting the stop codon of the gene encoding is part of the start codon of the gene encoding LysE. For example, it can be carried out by constructing a vector incorporating a gene encoding a fusion partner and a gene encoding LysE, and incubating the microorganism in the presence of the vector. It is also preferable that the fusion partner-encoding gene and the LysE-encoding gene are integrated into the microorganism as linked genes so that they are expressed as a fusion protein. In particular, when a compound derived from a microorganism taxonomically different from the microorganism (preferably Escherichia coli) is expressed as the desired nucleobase, organic acid and/or polyamine, a tRNA corresponding to the rare codon of the microorganism is expressed. From the viewpoint of expansion of the tRNA repertoire, it is preferable that the gene that does this is further incorporated into the microorganism.

The medium used in the step of culturing the LysE-expressing microorganism is not particularly limited, and a wide range of media that can be used for culturing the above microorganism can be used. Examples thereof include LB medium, M9 medium, MRS medium, Maltz medium, bouillon medium and the like. Glucose, starch, soluble starch, blackstrap molasses, corn steep liquor, etc. may be added to the medium as a carbon source. The culture temperature is not particularly limited, and can be appropriately set within the range of 20 to 45°C, more preferably 25 to 37°C. The culture time is also not particularly limited, but can be appropriately set, for example, in the range of 12 to 72 hours, more preferably 24 to 48 hours. The culture may be static culture or shaking culture, but shaking culture is preferred. By performing the culture, the desired nucleic acid base, organic acid and / or polyamine is produced in the microorganism, and the produced nucleic acid base, organic acid and / or polyamine is excreted outside the cell by LysE, so feedback inhibition Emission bottlenecks due to

Recovery Step The method of the present invention may further comprise a step of recovering the target nucleic acid base, organic acid and/or polyamine from the culture solution obtained in the culture step. Methods for recovering nucleic acid bases, organic acids and/or polyamines from the culture medium are not particularly limited, and methods known per se (centrifugation, recrystallization, distillation, solvent extraction, chromatography, etc.) may be used as appropriate. can be done. In the method of the present invention, the nucleic acid base, organic acid and/or polyamine of interest are extracellularly secreted, so that these substances can be recovered relatively easily without disrupting the microorganism.

Other Embodiments The present invention is not limited to the embodiments described above. It also provides a way to improve In the present embodiment, "improving the excretion ability" means improving the excretion ability of nucleobases, organic acids and/or polyamines compared to a microorganism into which a nucleic acid encoding LysE has not been introduced. Nucleic acid base, organic acid and/or polyamine excretion ability can be measured, for example, by the method described in Examples below.

Methods for introducing "LysE", "nucleic acid encoding LysE", "nucleic acid encoding LysE" into microorganisms, details of microorganisms into which nucleic acids are introduced, specifically, definition of fusion partner, nucleobase, organic Examples of acids and/or polyamines, microorganisms, etc. are as described in "Method for Producing Nucleobase, Organic Acid and/or Polyamine".

Specific embodiments of the present invention are illustrated in detail in the following examples, but the present invention is not limited to the following examples.

<Details of the experimental method>
(1) Construction of vector plasmid for high expression of membrane proteins (common to all examples)
(1)-1. Preparation of pTrc99A_mstX_C8_His Plasmid vector pTrc99A (Pharmacia Biotech) was cleaved with restriction enzymes XbaI and HindIII, and XbaI and HindIII recognition sequences were added to oligo DNA having a linker, TEV protease recognition sequence, and His-tag at the 5' end and 3' end. (CTAGAGGTGGCGGTGGCGGTGGCGGTGGCGAAAACCTGTACTTCCAGGGTCACCACCACCACCACCATCATCATtaaTAGCT) was inserted by ligation (pTrc99A_C8_His). This sequence was obtained by consigning synthesis to Hokkaido System Science Co., Ltd.

Next, pTrc99A_C8_His was cleaved with restriction enzymes NcoI and KpnI, and the cloned mstX gene was inserted by ligation. The mstX gene fragment was obtained by culturing Bacillus subtilis using LB medium and then using NucleoSpin Tissue (Takara) according to the attached protocol to extract genomic DNA from Bacillus subtilis (B. subtilis). B. It was obtained by PCR amplification using subtilis genomic DNA as a template, forward primer: AGGAAACAGACcatgtttttgtacattttttgaaaaacatcaccgg, and reverse primer: CTAGAGGATCCCCGGGTACCACTCATtctttttctccttcttcagatactg as primers. Using In-Fusion HD Cloning Kit (Takara) according to the attached protocol, the mstX gene fragment was treated with NcoI and KpnI and then ligated to pTrc99A_C8_His (pTrc99A_mstX_C8_His).

(2) Example 1. Search for transporters (Corynebacterium glutamicum)
(2)-1. Corynebacterium glutamicum was cultured using a culture medium (polypeptone 2 g, yeast extract 0.4 g, MgSO4 7H2O 0.2 g/200 ml) to prepare a corynebacterium transporter library. Genomic DNA was extracted using NucleoSpin Tissue (Takara) according to the attached protocol. Using the extracted genomic DNA as a template, a forward primer (gaaaaagaATGAGTGGTACCGTGATCATGGAAATCTTCATTACAGG) and a reverse primer (CACCGCCACCTCTAGAACCCATCAACATCAGTTTGATGG) were used as primers to amplify by PCR. pTrc99A_mstX_C8_His was treated with restriction enzymes KpnI and XbaI, and LysE (NCgl1214) gene was ligated using In-Fusion HD Cloning Kit (Takara) according to the attached protocol to construct a LysE expression plasmid vector.

(2)-2. Transformation of Escherichia coli for transporter expression E. coli C43 (DE3) strain (Lucigen) suitable for expression of toxic proteins was transformed with plasmid pRARE (Merck) supplementing tRNA corresponding to E. coli rare codons (C43 (DE3)). DE3) Rosetta strain) was used as an expression host for the membrane transporter-expressing plasmid vector obtained in (2)-1 to obtain an example strain. As a control, pTrc99A_mstX_C8_His not ligated with the membrane transporter gene was introduced into the expression host to obtain a control strain.

Example strains and control strains were precultured in LB medium at 30° C. for 24 hours to obtain preculture solutions. Antibiotics ampicillin (100 µg/ml) and chloramphenicol (30 µg/ml) were added to 50 ml M9 minimal medium, 500 µl of the preculture solution was added, and cultured with shaking at 37°C. When the OD660 reached approximately 0.5, IPTG was added to a final concentration of 1 mM, followed by shaking culture at 37°C for 24 hours. After culturing for 24 hours, the cells were centrifuged at 9,000 rpm for 15 min to obtain the Example strain culture supernatant and the Control strain culture supernatant.

(2)-3. The pre-culture solution, the Example strain culture supernatant and the Control strain culture supernatant in MS analysis (2)-2 of the culture solution were filtered using a 0.22 μm filter. MS analysis of components contained in each filtrate was outsourced to Shimadzu Corporation. In this test, the analysis of the results of MS analysis was performed over a wide range without limiting the molecular weight range.

(2)-4. The results are shown in Figures 1 and 2. Polyamines (putrescine, cadaverine), nucleobases (cytosine, uracil), and organic acids (phenylacetic acid, hydroxyphenylacetic acid, aconitic acid, lauric acid) in the culture supernatant of the example strain were higher than those in the preculture medium and the control culture supernatant. It turned out to be very included. LysE was known to function as a transporter of original lysine and ornithine. It was shown that the use of microorganisms into which a nucleic acid has been introduced is useful as a method for producing these polyamines, nucleic acid bases, and organic acids.

Claims (4)

A method for producing at least one selected from the group consisting of nucleic acid bases, organic acids and polyamines, comprising the step of culturing a LysE-expressing microorganism. 2. The method of claim 1, wherein the LysE-expressing microorganism is a microorganism introduced with a nucleic acid encoding LysE. 3. The method according to claim 1, further comprising the step of recovering at least one selected from the group consisting of nucleic acid bases, polyamines and organic acids from the supernatant of the culture medium obtained in the culturing step. The method of any one of claims 1-3, wherein the nucleobase is a pyrimidine compound.

Images