WO2019207167A1 - Thérapie de déficiences en sulfatase - Google Patents

Thérapie de déficiences en sulfatase Download PDF

Info

Publication number
WO2019207167A1
WO2019207167A1 PCT/EP2019/060980 EP2019060980W WO2019207167A1 WO 2019207167 A1 WO2019207167 A1 WO 2019207167A1 EP 2019060980 W EP2019060980 W EP 2019060980W WO 2019207167 A1 WO2019207167 A1 WO 2019207167A1
Authority
WO
WIPO (PCT)
Prior art keywords
sulfatase
human
vector
sgsh
nucleotide sequence
Prior art date
Application number
PCT/EP2019/060980
Other languages
English (en)
Inventor
Andrea Ballabio
Nicolina Cristina SORRENTINO
Alessandro FRALDI
Original Assignee
Fondazione Telethon
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fondazione Telethon filed Critical Fondazione Telethon
Publication of WO2019207167A1 publication Critical patent/WO2019207167A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0051—Oxidoreductases (1.) acting on a sulfur group of donors (1.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y108/00—Oxidoreductases acting on sulfur groups as donors (1.8)
    • C12Y108/03—Oxidoreductases acting on sulfur groups as donors (1.8) with oxygen as acceptor (1.8.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/06—Sulfuric ester hydrolases (3.1.6)
    • C12Y301/06001—Arylsulfatase (3.1.6.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/06—Sulfuric ester hydrolases (3.1.6)
    • C12Y301/06004—N-Acetylgalactosamine-6-sulfatase (3.1.6.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y310/00—Hydrolases acting on sulfur-nitrogen bonds (3.10)
    • C12Y310/01—Hydrolases acting on sulfur-nitrogen bonds (3.10) acting on sulfur-nitrogen bonds (3.10.1)
    • C12Y310/01001—N-Sulfoglucosamine sulfohydrolase (3.10.1.1)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/036—Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to improved gene therapy to treat sulfatase deficiencies, preferably via co-delivery of Sulfatase enzymes and SUMF1 protein.
  • Sulfatases are hydrolases that cleave sulfate esters from a wide range of substrates, including glycosaminoglycans, sulfolipids, and steroid sulfates ("The sulfatase gene family". Parenti, G, Meroni, G, and Ballabio, A.Curr. Opin. Genet. Dev. 1997; 7: 386-391; "Multiple sulfatase deficiency and the nature of the sulfatase family" .Hopwood, J.J and Ballabio, A.) [1].
  • At least eight inherited metabolic disorders in humans are caused by sulfatase deficiencies, resulting in impaired desulfation of sulfatase natural substrates.
  • sulfatase deficiencies resulting in impaired desulfation of sulfatase natural substrates.
  • sulfated substrates accumulate in the cells and tissues of patients, resulting in Lysosomal Storage Disorders (LSD) with consequences depending on the type and tissue distribution of the stored material.
  • LSD Lysosomal Storage Disorders
  • sulfatases include MLD (metachromatic leukodystrophy), which is characterized by the storage of sulfolipids in the central and peripheral nervous systems, and five different types of Mucopolysaccharidoses (MPSs types II, IMA, MID, IVA and VI), which are due to the accumulation of Glycosaminoglycans (GAGs) in several tissues and organs[2].
  • MLD metalchromatic leukodystrophy
  • MLD Mucopolysaccharidoses
  • IMA IMA
  • MID MID
  • IVA Mucopolysaccharidoses
  • Active sulfatases contain a unique FGIy (formylglycine) catalytic residue which derived from a post-translational modification of a cysteine precursor.
  • SUMF1 sulfatase-modifying factor 1
  • MSD multiple sulfatase deficiency
  • SUMF1 has been shown to have an enhancing effect on sulfatase activity when co-expressed with sulfatase genes in COS-7 cells as well as co-delivered with a sulfatase cDNA via AAV (adeno-associated virus) and LV (lentivirus) vectors in cells from individuals affected by diseases owing to sulfatase deficiencies or from murine models of the same diseases.
  • AAV adeno-associated virus
  • LV lentivirus
  • Mucopolysaccharidosis type IMA is one of the most common and severe forms of neurodegenerative lysosomal storage disorders (LSDs) [10, 11]. It is caused by inherited defect of the sulfamidase (SGSH), a soluble lysosomal enzyme belonging to the family of sulfatases [12] and leads to the accumulation of heparan sulfate in cell, particularly within the central nervous system (CNS). Presently, there are no treatments available to treat the CNS in M PS-111 A patients. Gene delivery aimed at correcting defective hydrolytic lysosomal defects represent the most promising replacement strategy for the CNS treatment of M PS-111 A as well as other MPSs with similar causes due to its potential for a one-time treatment [13].
  • SGSH sulfamidase
  • CNS central nervous system
  • adeno-associated viral (AAV) vectors are most commonly utilized for in vivo gene transfer because they are safe, provide significantly long transgene expression and may be generated with variable serotypes allowing efficient delivery of therapeutic genes to different target tissues [14, 15].
  • AAV adeno-associated viral
  • several therapeutic approaches have been designed and developed based on AAV-mediated gene delivery of SGSH using different route of administrations to reach the CNS [4, 5, 16-19]. Although all these approaches have demonstrated potential benefits in preclinical animal models, the effective therapeutic application of these protocols in the clinical management of MPS-IIIA patients is challenging because of the difficulty in achieving widespread distribution of the corrective enzyme in the CNS and in maintaining therapeutic threshold levels of them in targeted cells [20].
  • Enhancing the therapeutic potential of sulfamidase, along with developing tools for efficient and safe CNS targeting, may represent a novel area of intervention to improve CNS therapy in MPS- IMA patients.
  • Administration of AAVs by the cerebrospinal fluid (CSF) route of injection provides very limited access to visceral organs while at the same time allowing the circulating virus to access a large CNS surface area, a condition that could reduce cytotoxic effects of whole body exposure and may potentially limit the amount of viral vector required to efficiently transduce CNS cells [23].
  • serotype 9 has been shown to have a broad tropism, including neurons and astrocytes, when delivered either via CSF or through intravenous injection due to its capability to cross the blood-brain barrier (BBB) [24, 25].
  • BBB blood-brain barrier
  • the inventors have previously demonstrated that AAV9 outperforms all other AAV serotypes tested in CNS transduction efficiency when administered via CSF even in large animal models [6]. Lysosomal hydrolases, including SGSH can be secreted and taken up by surrounding cells [26]. Such cross-correction capability makes gene replacement protocols potentially more effective since transduced cells (factory cells) may also correct non-transduce cells.
  • a potentiated SGSH expression cassette was generated by combining enhanced secretion efficiency of SGSH with improved SUMFl-mediated enzyme activation capacity and its therapeutic potential was explored upon intra-CSF AAV9-mediated gene delivery.
  • the present results demonstrate that by using this strategy it is possible to achieve a superior SGSH CNS bio- distribution in a large animal model (wild type pigs) and to fully rescue the CNS phenotype in a mouse model of sulfatase deficiency, as M PS-111 A.
  • the present inventors have surprisingly obtained increased enzymatic activity and CNS distribution of the sulfamidase gene through intra-cerebral spinal fluid (CSF) administration of a highly secreted version of the sulfamidase gene (eg a sulfamidase modified to include the IDS signal peptide, IDSsp) via AAV-mediated delivery and co-delivery of said modified SGSH and SUMFlproteins.
  • CSF intra-cerebral spinal fluid
  • the inventors approach was to focus on gene transfer approaches to treat the CNS in LSDs with minimal invasiveness and high CNS targeting efficiency.
  • cells expressing non-modified SGSH, or expressing modified SGSH, or expressing SUMF1 or expressing both non-modified SGSH and SUMF1 there was a striking improvement in SGSH activity by supplying exogenous modified SGSH together with SUMF1 as a bicistronic construct expressing the two proteins.
  • the construct IDSsp-SGSH-SUMFl has the highest expression levels in pigs. Further the construct IDSsp-SGSH displays less enzymatic activity than the IDSsp-SGSH-SUMFl construct and the SGSH activity induced by the SGSH-SUMF construct is lower than the one induced by the IDSsp-SGSH-SUMFl construct.
  • the vector is structurally different than prior vectors in that it incorporates both the modified SGSH and SUMF1 genes in a single expression cassette under the control of a single promoter.
  • the two genes are co-delivered as one vector, rather than as single gene vectors.
  • the bicistronic vector is superior either to modified SGSH alone, or to a combination of single gene vectors for modified SGSH and SUMF1.
  • the present vector would be used to deliver the modified SGSH and SUMF1 genes to human brain so as to increase SGSH brain distribution and SGSH activity for the treatment of CNS pathology in sulfatase deficiency. While a preferred embodiment of the present invention involves co-delivery of a modified sulfatase, preferably SGSH, and SUMF1 to the brain via an adeno-associated viral vector, it is also anticipated that other delivery mechanisms, including retro viral, adeno viral, herpes simplex viral, cytomegaloviral, could also be used.
  • Methods for formulating pharmaceutical compositions or carriers for the bicistronic constructs or vectors disclosed herein are well known in the art (e.g. U.S. Pat. Nos.
  • Non-viral delivery vehicles could be used as well, including approaches that utilize liposomes, polylysine carrier complexes, or naked DNA (1992, Proc. Natl. Acad. Sci. USA 89:6099-6103; Zhu et al., Systemic gene expression after intravenous DNA delivery into adult mice, (1993) Science 261:209-211; Yoshimura et al., (1992) Nucleic Acids Research 20: 3233-3240).
  • Methods for combination therapy involving chemotherapy and gene therapy are well known (e.g. U.S. Pat. Nos. 6,054,467; 5,747,469).
  • the inventors have used the cytomegalovirus promoterto achieve expression of modified SGSH and SUMF1, but other ubiquitous promoters could be used as well, including the Rous Sarcoma Virus promoter, and SV40 promoter, CAG promoter (hybrid of the chicken b-actin promoter and CMV enhancer), as well as glial cell specific promoters, for example GFAP (Glial fibrillar Acid promoter).
  • the vector could be used in combination with already existing therapies for sulfatase deficiencies, including enzyme replacement therapy and small molecule therapy, wherein small molecules include molecular tweezers such as those described in PCT Publication No: W02010102248.
  • the present invention would also include variants of modified SGSH and SUMF1 (such as mutated or truncated forms of these enzyme activators) that retain the SGSH activity of wild-type SGSH or that retain the sulfatase-modifying activity of SUMF1, eg variants and/or fragments retaining activity, eg functional variants and/or functional fragments thereof.
  • a fundamental aspect of the present invention is the co-delivery of two factors within one vector, a sulfatase gene product and a SUMF1 gene product. Conveniently, co-delivery may be obtained via expression of a bi-cistronic construct encoding the two gene products with an IRES element inserted between the two.
  • the sequence encoding the sulfatase gene is placed upstream (eg 5') to the SUMF1 coding sequence, since the coding sequence following the promoter is expressed at a higher rate compared to the second sequence.
  • the construct is composed of: promoter- sp-Sulfatase- IRES-SUMF1.
  • the two factors may be expressed from one construct via 2A-peptide-mediated cleavage, eg P2a multi-gene expression system, as described in Wang et al., Scientific Reports volume5, Article number: 16273 (2015). It is anticipated that all types of human sulfatase deficiencies, irrespective of their endogenous sulfatase and SUMF1 status, would be amenable to this approach. Preferred embodiments would be the treatment of M PS-111 A via co-delivery of modified SGSH and SUMF1.
  • the present invention relates to novel viral vectors comprising a construct encoding for a partially modified sulfatase, preferably a sulfamidase, whose signal peptide is substituted with an exogenous signal peptide; preferably the IDS (Iduronate 2-Sulfatase) signal peptide (IDSsp- Sgsh), alternatively, the hAAT signal peptide may be used as described in WO2012085622; the construct is a bicistronic construct further encoding SUMF1.
  • the bicistronic construct is obtained via insertion of an IRES element between the two coding sequences.
  • the construct is a multigene construct encoding the sulfamidase and SUMF1 as a multi-gene expression system.
  • the viral vector is an AAV9 or AAV1.
  • the viral vector is administered by intra-CSF delivery.
  • the present inventors obtained a novel therapeutic tool which is an improvement over prior therapeutics, able to increase the enzymatic activity and the CNS distribution of the SGSH enzyme in an MPS-IIIA mouse model.
  • the advantages of the constructs of the invention are improved biodistribution of therapeutic gene to the CNS.
  • the construct of the invention can be used at lower doses since it has a lower toxicity.
  • intra-CNS particularly intra-CSF
  • administration of a sulfatase gene improves sulfatase secretion derived from IDS signal peptide, combined to co expression with SUMF1 gene product which improves activation of the sulfamidase enzyme.
  • the strategy of the present invention is based on the construction of a chimeric sulfatase, in particular a sulfamidase (the sulfatase enzyme which is deficient in MPS-IIIA), optimized with an amino-acid sequence to the N -terminus of the protein which confers to the modified sulfamidase the capability to be highly secreted.
  • the signal peptide of the human lduronate-2-sulfatase (IDS) gene is fused to the human sulfatase derived amino acid sequence deprived of its signal peptide, as reported in Sorrentino et al. (EMBO Mol Med (2013) 5, 675-690 and in WO2012085622).
  • Said chimeric sulfamidase is optionally co-expressed with the SUMF 1 (sulfatase-modifying factor 1) protein, which is an essential factor for sulfatase activities.
  • SUMF 1 sulfatase-modifying factor 1
  • Sulfatase deficiencies of the present invention include sulfatase deficiencies with a neurological involvement, eg MLD (metachromatic leukodystrophy), MSD, and MPS (mucopolysaccharidosis) II, 111 A, HID, IVA. Sulfatase deficiencies of the present invention may not include MSD.
  • Said sulfatase deficiencies are due to deficiency of the following factors: MLD (metachromatic leukodystrophy) due to the deficiency of arylsulfatase A (ARSA NC_000022.11,; 607574), galactosamine (N-acetyl)-6-sulfatase (GALNS NC_000016.10, 611458) for MPS IVA and glucosamine (N-acetyl)-6-sulfatase (GNS NC_000012.12; 252940) for MPS HID, iduronate 2- sulfatase (IDS;OMIM ref.300823), for MPS II, MPS IMA (SGSH, 605270).
  • MLD metalchromatic leukodystrophy
  • GALNS NC_000016.10, 611458 galactosamine
  • GALNS NC_000016.10, 611458 galactosamine
  • the present invention provides sulfatase and SUMF1 expressed from the same construct, wherein the sulfatase has an exogenous signal peptide with an increased secretion efficiency compared to the native protein.
  • the present invention in particular provides a nucleotide sequence encoding a modified sulfatase and sulfatase-modifying factor 1 (SUMF1), said modified sulfatase comprising in the N-terminal-C-terminal sequence order: a) an amino acid sequence of an exogenous signal peptide, preferably the signal peptide of the human lduronate-2-sulfatase (IDS) or the hAAT signal peptide, and b) an amino acid sequence of a human sulfatase said human sulfatase being deprived of its signal peptide, wherein said nucleotide sequence optionally comprises a sequence of an IRES element between the sequence encoding for said modified sulfatase and said sulfatase-modifying factor 1 (SUMF1).
  • SUMF1 modified sulfatase and sulfatase-modifying factor 1
  • the signal peptide of the human lduronate-2-sulfatase is preferably characterized by the sequence MPPPRTGRGLLWLGLVLSSVCVALG (SEQ ID NO: 14).
  • the signal peptide of hAAT is preferably characterized by the sequence MPSSVSWGILLLAGLCCLVPVSLA (SEQ ID NO: 15).
  • the sulfatase-modifying factor 1 consists of SEQ ID No 13 or a functional fragment thereof or a functional variant thereof, more preferably said functional variant has at least 75%, 80%, 85%, 90%, 95% or 99% identity to SEQ ID No. 13 and functions as a sulfatase- modifying factor.
  • said functional fragment is at least 374 amino acid long a nd functions as a sulfatase-modifying factor.
  • the expression "functions as a sulfatase-modifying factor” indicates that its function consists in the post-translational activation of all sulfatases in the endoplasmic reticulum.
  • the product of SUM F1 gene oxidises a cysteine residue located within a consensus CxPxR sequence shared by all sulfatases to generate a formylglycine. This cysteine oxidation is absolutely required by sulfatases to exert their enzymatic activity.
  • the human sulfatase is selected from the group consisting of: human N- sulfoglucosamine sulfohydrolase (SGSH), human arylsulfatase A (ARSA), human arylsulfatase B (ARSB), human arylsulfatase D (ARSD human arylsulfatase G (ARSG), human galactosa mine (N- acetyl)-6-sulfate sulfatase (GALNS), human glucosamine (N-acetyl)-6-sulfatase (GNS), human steroid sulfatase (microsomal), isozyme S (STS), human sulfatase 1 (SULF1), human sulfatase 2 (SULF2), human sulfatase modifying factor 2 (SU MF2) or a functional fragment thereof or a functional variant thereof, preferably the human sulfoglu
  • the human sulfatase is the human sulfamidase (SGSH) or a functional fragment thereof or a functional variant thereof.
  • SGSH human sulfamidase
  • the human sulfatase is not SUM F1.
  • the natural signal peptide is underlined above.
  • the modified sulfamidase has at least 75%, 80%, 85%, 90%, 95% or 99% identity to SEQ. I D No. 12 and functions with improved sulfamidase activity (e.g. measured by enzymatic activity assay) and/or secretion (e.g. the modified version of sgsh show an increased secretion efficiency respect to the native version of sulfamidase).
  • nucleotide sequence has at least 75 % ,80%, 85%, 90%, 95%, 99% identity to SEQ. ID No. 4.
  • the present invention provides a vector comprising the nucleic acid as defined above.
  • the vector is a viral vector.
  • the viral vector is a lentiviral vector, an adeno- associated virus vector, an adenoviral vector, a retroviral vector, a polio viral vector, a murine Maloney-based viral vector, an alpha viral vector, a pox viral vector, a herpes viral vector, a vaccinia viral vector, a baculoviral vector, or a parvoviral vector.
  • the adeno- associated virus is AAV9, AAV1, AAVSH19, AAV2/7, AAVPHP.B.
  • the invention also provides the nucleotide sequence as defined above or the vector as defined above in combination with a carrier, preferably the carrier is a lipid or a polypeptide, preferably a liposome, a polylysine carrier complex.
  • a carrier preferably the carrier is a lipid or a polypeptide, preferably a liposome, a polylysine carrier complex.
  • the invention further provides the nucleic acid as defined above or the vector as defined above for medical use, preferably for gene therapy.
  • the invention further provides the nucleic acid as defined above or the vector as defined above for use in the treatment of a sulfatase deficiency with a neurological involvement, preferably of a lysosomal sulfatase deficiency.
  • the sulfatase deficiency is selected from the group consisting of: metachromatic leukodystrophy (MLD), mucopolysaccharidosis MPS type IMA, mucopolysaccharidosis MPS type MID, mucopolysaccharidosis MPS type IVA, mucopolysaccharidosis MPS type II, preferably the sulfatase deficiency is MPS type IMA.
  • MLD metachromatic leukodystrophy
  • MPS type IMA mucopolysaccharidosis MPS type IMA
  • mucopolysaccharidosis MPS type MID mucopolysaccharidosis MPS type IVA
  • mucopolysaccharidosis MPS type II preferably the sulfatase deficiency is MPS type IMA.
  • the vector as defined above is administered at a dose of from 0,5 x 10 12 - 1 x 10 13 GC/kg, preferably 1 x 10 12 GC/kg to 10 x 10 12 GC/kg, more preferably 4.5 xlO 12 GC/Kg.
  • the invention also provides the nucleic acid or the vector for use as defined above in combination with a further therapeutic agent, preferably the further therapeutic agent is selected from the group consisting of: enzyme replacement therapy and small molecule therapy.
  • Small molecule therapy of particular interest for the present invention is therapy based on molecular tweezers, compounds described for instance in PCT Publication No: W02010102248.
  • Particularly preferred molecular tweezers are of general formulas
  • XI and X2 are both 0; A alone, or A combined with XI, forms a substituent selected from the group consisting of phosphate, hydrogen phosphate, alkylphosphonate, arylphosphonate, alkylphosphamide, arylphosphamide, sulfate, hydrogen sulfate, alkylcarboxylate, and .
  • g alone, or B combined with X2 forms a substituent selected from the group consisting of phosphate, hydrogen phosphate, alkylphosphonate, arylphosphonate, alkylphosphamide, arylphosphamide, sulfate, hydrogen sulfate, alkylcarboxylate and .
  • eac h 0 f Rl, R2, R3, and R4 is, independently, selected from the group consisting of H, Cl, Br, I, OR, NR2, N02, C02H, and C02R5, wherein R5 is alkyl, aryl or H, or Rl and R2 combine to form an aliphatic or aromatic ring, and/or R3 and R4 combine to form an aliphatic or aromatic ring.
  • Preferred molecular tweezers are (TW1/CLR01), of formula:
  • the invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising the nucleic acid as defined above or the nucleotide sequence as defined above or the vector as defined above and pharmaceutically acceptable diluents and/or excipients and/or carriers.
  • composition further comprising a therapeutic agent, preferably the therapeutic agent is selected from the group consisting of: enzyme replacement therapy and small molecule therapy.
  • the pharmaceutical composition is administered through a route selected from the group consisting of: intra cerebral spinal fluid (CSF), intrathecal, parenteral, intralesional, intraperitoneal, intramuscular, intratumoral, subcutaneous, intraventricular, intra cisterna magna, lumbar, intracranial, intraspinal, intravenous, topical, nasal, oral, ocular, or any combination thereof.
  • CSF cerebral spinal fluid
  • the present invention also provides a nucleotide sequence encoding for a modified sulfatase, said modified sulfatase comprising in the N-terminal-C-terminal sequence order: a) an amino acid sequence of an exogenous signal peptide, preferably the signal peptide of the human lduronate-2-sulfatase (IDS) or the hAAT signal peptide, and b) an amino acid sequence a human sulfatase said human sulfatase being deprived of its signal peptide for medical use, wherein said nucleotide sequence is administered intra-CSF.
  • an exogenous signal peptide preferably the signal peptide of the human lduronate-2-sulfatase (IDS) or the hAAT signal peptide
  • IDDS human lduronate-2-sulfatase
  • hAAT signal peptide hAAT signal peptide
  • the human sulfatase is selected from the group consisting of: human N- sulfoglucosamine sulfohydrolase (SGSH), human arylsulfatase A (ARSA), human arylsulfatase B (ARSB), human arylsulfatase D (ARSD), human arylsulfatase E (chondrodysplasia punctata 1) (ARSE), human arylsulfatase F (ARSF), human arylsulfatase G (ARSG), human arylsulfatase family, member H (ARSH), human arylsulfatase family, member I (ARSI), human arylsulfatase family, member J (ARSJ), human arylsulfatase family, member K (ARSK), human galactosamine (N-acetyl)-6-sulfate sulfatase (GALNS), human SGSH),
  • the human sulfatase is the human sulfamidase.
  • the modified sulfamidase has at least 75%, 80%, 85%, 90%, 95% or 99% identity to SEQ ID No. 12.
  • nucleotide sequence has at least 75 % ,80%, 85%, 90%, 95%, 99% identity to SEQ. ID No. 1.
  • the present invention also provides a vector comprising the above nucleic acid or nucleotide sequence for medical use, wherein said vector is administered intra-CSF.
  • the vector is a viral vector
  • the viral vector is a lentiviral vector, an adeno- associated virus vector, an adenoviral vector, a retroviral vector, a polio viral vector, a murine Maloney-based viral vector, an alpha viral vector, a pox viral vector, a herpes viral vector, a vaccinia viral vector, a baculoviral vector, or a parvoviral vector
  • the adeno- associated virus is AAV9, AAV1, AAVSH19, AAVPHP.B.
  • nucleotide sequence is inserted in a vector, preferably a viral vector, still preferably an adeno-associated vector.
  • a vector is administered intra-CSF.
  • medical use is for the treatment of the treatment of a sulfatase deficiency with neurological impairment, preferably of a lysosomal sulfatase deficiency.
  • the sulfatase deficiency is selected from the group consisting of: metachromatic leukodystrophy (MLD), mucopolysaccharidosis MPS type II, mucopolysaccharidosis MPS type IMA, mucopolysaccharidosis MPS type MID, mucopolysaccharidosis MPS type IVA, preferably the sulfatase deficiency is MPS type MIA.
  • MLD metachromatic leukodystrophy
  • MPS type II mucopolysaccharidosis MPS type II
  • mucopolysaccharidosis MPS type IMA mucopolysaccharidosis MPS type MID
  • mucopolysaccharidosis MPS type IVA mucopolysaccharidosis MPS type IVA
  • Sulfatases (EC 3.1.6. )-are enzymes of the esterase class that catalyze the hydrolysis of sulfate esters. These may be found on a range of substrates, including steroids, carbohydrates and proteins. Sulfate esters may be formed from various alcohols and amines. In the latter case the resultant N-sulfates can also be termed sulfamates.
  • human sulfatase refers to a well-defined class of enzymes. Sulfatases are a conserved gene family having the following defined functional representatives in the human genome assembly of April 2003:
  • ARSA Homo sapiens arylsulfatase A
  • transcript variant 2 mRNA.
  • ARSB Homo sapiens arylsulfatase B (ARSB), transcript variant 1, mRNA. (J05225)
  • ARSD Homo sapiens arylsulfatase D (ARSD), mRNA.
  • ARSG Homo sapiens arylsulfatase G (ARSG), transcript variant 1, mRNA.
  • GALNS Homo sapiens galactosamine (N-acetyl)-6-sulfate sulfatase (GALNS), mRNA.
  • GNS Homo sapiens glucosamine (N-acetyl)-6-sulfatase (GNS), mRNA. (NM_002076.4)
  • IDS Homo sapiens iduronate 2-sulfatase (IDS), transcript variant 1, mRNA. (NG_011900).
  • SGSH Homo sapiens N-sulfoglucosamine sulfohydrolase (SGSH), mRNA. (U30894)
  • SULF1 Homo sapiens sulfatase 1 (SULF1), transcript variant 4, mRNA.
  • SULF1 Homo sapiens sulfatase 1 (SULF1), transcript variant 4, mRNA.
  • SULF2 Homo sapiens sulfatase 2 (SULF2), transcript variant 1, mRNA.
  • SUMF1 Homo sapiens sulfatase modifying factor 1 (SUMF1), transcript variant 1, mRNA. (AB448737)
  • SUMF2 Homo sapiens sulfatase modifying factor 2 (SUMF2), transcript variant 5, mRNA.
  • arylsulfatase A EC 3.1.6.8 (ASA), a lysosomal enzyme which hydrolyzes cerebroside sulfate;
  • arylsulfatase B EC 3.1.6.12 (ASB) which hydrolyzes the sulfate ester group from N- acetylgalactosamine 4-sulfate residues of dermatan sulfate;
  • arylsulfatase C (ASD) and E (ASE); steryl-sulfatase EC 3.1.6.2 (STS), a membrane bound enzyme which hydrolyzes 3-beta-hydroxy steroid sulfates;
  • iduronate 2-sulfatase EC 3.1.6.13 IDS
  • a lysosomal enzyme that hydrolyzes the 2-sulfate groups from iduronic acids in dermatan sulfate and heparan sulfate;
  • N-acetylgalactosamine-6-sulfatase EC 3.1.6.4, which hydrolyzes the 6-sulfate groups of the N-acetyl-D-galactosamine of chondroitin sulfate and D-galactose 6-sulfate units of keratan sulfate;
  • N-sulfoglucosamine sulfohydrolase EC 3.10.1.1 the lysosomal enzyme that hydrolyses N- sulfo-D-glucosamine into glucosamine and sulfate;
  • glucosamine-6-sulfatase EC 3.1.6.14 (G6S), which hydrolyzes the N-acetyl-D-glucosamine 6-sulfate units of heparan sulfate and keratan sulfate;
  • N-sulfoglucosamine sulfohydrolase EC 3.10.1.1 the lysosomal enzyme that hydrolyses N- sulfo-D-glucosamine into glucosamine and sulfate;
  • Sulfatase deficiencies of the present invention include sulfatase deficiencies with a neurological involvement, eg MLD (metachromatic leukodystrophy), MSD (Multiple Sulfatase Deficiency), MPS (mucopolysaccharidosis) II, IMA, MID, IVA.
  • MLD metal-chromatic leukodystrophy
  • MSD Multiple Sulfatase Deficiency
  • MPS micopolysaccharidosis II
  • IMA Multiple Sulfatase Deficiency
  • MPS micopolysaccharidosis type 111 A
  • SGSH sulfamidase
  • heparan sulfates an enzyme involved in the stepwise degradation of large macromolecules called heparan sulfates.
  • FIG. 1 Sulfamidase activity in cultured glial cells.
  • Cultured glia cells derived from C57BL/6 mice were transfected with SGSH, AATsp-SGSH, IDSspSGSH constructs. Both cells and 24 h conditioned media were collected and assayed for sulphamidase activity. The secretion efficiency has been indicated as percentage of the SGSH activity in the medium/ activity in the pellet and the medium.
  • FIG. 1 Sulfamidase specific activity in the CNS of pigs injected with AAV9 vectors carrying different SGSH expression cassettes
  • A WT pigs at P60 of age were injected via cisterna magna with 4.5X1012 GC/Kg of AAV9 encoding different human SGSH expression cassettes under the CMV promoter: SGSH WT, IDSspSGSH (SGSH bearing the alternative IDS signal peptide), SGSH- IRES-SUMF1 (bicistronic cassette encoding both SGSH and SUMF1 proteins), IDSspSGSH-IRES- SUMF1 (bicistronic cassette encoding both IDSspSGSH and SUMF1 proteins).
  • FIG. 3 Sulfamidase activity in MPS-IIIA mice injected with AAV9 vectors carrying different SGSH expression cassettes
  • P60 MPS-IIIA mice were intra-CSF injected (via lateral ventricle administration: ICV) with 4.5x1012 GC/Kg of AAV9 encoding under the CMV promoter the following expression cassettes: GFP, SGSH WT, IDSspSGSH, or IDSspSGSH-IRES-SUMFl.
  • the brain and the first region of the spinal cord of treated mice was divided in five slices (A-E) covering the main representative area of the CNS (A: olfactory bulb and prefrontal cortex, B: frontal cortex, lateral septum and basal ganglia regions, C: parietal cortex, hippocampus, striatum, thalamus, D: occipital cortex, pons, hippocampus; E: cerebellum, medulla oblongata, cervical region of spinal cord).
  • A olfactory bulb and prefrontal cortex
  • B frontal cortex, lateral septum and basal ganglia regions
  • C parietal cortex, hippocampus, striatum, thalamus
  • D occipital cortex, pons, hippocampus
  • E cerebellum, medulla oblongata, cervical region of spinal cord.
  • FIG. 4 CNS transduction in M PS-111 A mice injected with AAV9 bearing IDSspSGSH-IRES-SUMFl transgene (A) P60 M PS-111 A mice were ICV injected with 4.5x1012 GC/Kg of AAV9 encoding either IDSspSGSH and SUMF1 or GFP.
  • Five different slices covering the main CNS regions (A-E; as described in the figure 3) were collected at both 1-month (ETP) and 7-months (LTP) after injection. Sulfamidase activity was measured in these areas and expressed as percentage of the activity found in age-matched WT untreated mice. N 6-7 animals for each group. Data represent mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
  • FIG. 5 Sulfamidase protein quantitation in the brain of M PS-111 A mice injected with AAV9 bearing the IDSspSGSH-IRES-SUMFl transgene.
  • Sulfamidase protein was immuno-quantified by ELISA and expressed as ng of SGSH/mg protein in the five CNS slices (A-E; as described in the supplementary figure 1) of the indicated experimental groups of mice at ETP and LTP.
  • FIG. 6 Rescue of storage pathology, inflammation and memory impairment in MPS-IIIA mice injected with AAV9 encoding IDSspSGSH-IRES-SUMFl.
  • D Neuroinflammation was evaluated at LTP in M PS-111 A mice injected with AAV9 encoding IDSspSGSH-IRES-SUMFl by immunostaining with anti-GFAP (astrogliosis) in paraffin sections from frontal cortex, parietal cortex and lateral septum. Age-matched WT and M PS-11 IA mice injected with AAV9 encoding GFP were used as controls.
  • FIG. 7 Liver transduction in MPS-IIIA mice injected with AAV9 bearing IDSspSGSH-IRES- SUMFl transgene.
  • FIG. 8 Assessment of exploratory activity in M PS-I I IA mice injected with AAV9 bea ring I DSspSGSH-I RES-SUM Fl transgene.
  • M PS-I IIA mice and relative controls (WT) were tested at 6 and 9 months of age in the open field test.
  • I DSsp human iduronate-2-sulfatase signal peptide
  • Reverse Bglll SGSH G AAG AT CTT C ACAG CT C ATTGTG (SEQ I D NO: 18)
  • the PCR product was digested with Notl/Bglll restriction enzymes and cloned into the pAAV2.1- CMV-GFP by replacing the GFP protein.
  • the IDSspSGSH cassette to use for the production of the IDSspSGSH-IRES-SUMFl cassette was amplified from the p3xFLAG-CMV-IDSspSGSH by the following oligos:
  • Reverse Xbal SGSH TG CTCT AG AT C ACAG CT CATTGTG (SEQ ID NO: 20)
  • the PCR product was digested with Notl/Xbal restriction enzymes and cloned into the pAAV2.1- CMV-SGSH-IRES-SUMF1, already developed in Fraldi el al paper [4], by replacing the SGSH protein.
  • the resulting plasmids were used to generate the correspondent AAV serotype 9 (AAV2/8) viral vectors according to the protocols established by AAV Vector Core of TIGEM institute.
  • rAAV administration and CNS samples collection was carried out according to the Sorrentino el al. paper [6].
  • the dorsal area of the neck was trimmed and surgically prepared, and the puncture of the cisterna magna was performed.
  • One ml of CSF was collected before the injection in order to analyze it as a preinjection physiological standard.
  • the dose of 4,5 x 10 12 GC/Kg of viral vector in a volume range from 1.5 to 2.8 ml was injected slowly to avoid a sudden increase in intracranial pressure.
  • Piglets were then placed in Trendelenburg position for 2 minutes in order to help the injected compound to spread toward the more rostral parts of the CNS. Animals were then monitored until complete recovery.
  • mice Homozygous mutant (sgsh-/-; phenotypically M PS-111 A affected) and WT C57BL/6 mice were used [7], [4], [9]. After being collected, the brain samples were harvested and stored frozen until use. To collect brain, mice were perfused with PBS (pH 7.4), and to prepare brain samples for Sulphamidase assays standard capillary depletion protocols were used according to the Fraldi et al. protocols as published [4]. Experiments were conducted in accordance with the guidelines of the Animal Care and Use Committee of Cardarelli Hospital in Naples and authorized by the Italian Ministry of Health. In detail, M PS-111 A mice at 2 months of age were anesthetized with ketamine/medetomidine. The AAV vectors were injected with a dosage of 5.4X10 12 GC/Kg bilaterally into the lateral ventricles.
  • mice Mice were anesthetized by were anesthetized by i.p. injection of ketamine (100 mg/kg) and xylazine (10 mg/kg) and placed on a stereotaxic instrument with a motorized stereotaxic injector. A midline incision was made to expose the bregma. A hole in the skull was made by a drill (anteroposterior +2.18 mm, mediolateral 0,6 mm, dorsoventral -1.7 mm). rAAV9 vectors 5.4 x 1012 GC/Kg were injected in a volume of 10 ul into the lateral ventricles at a rate of 1 mI/min. After allowing the needle to remain in place for 5 min, the needle was slowly raised at a rate of 0.1 cm/min.
  • Pigs Animals were euthanized 1 month after injection with a single bolus (0.3 ml/kg) of Tanax and total body perfusion with Dulbecco's phosphate-buffered saline was started. After median sternotomy, the right atrium was opened and the left ventricle was infused with 500 ml of warm Dulbecco's phosphate-buffered saline (+38 °C) and 1,000 ml of cold Dulbecco's phosphate- buffered saline (+4 °C); blood ejected from the right atrium was drained using a surgical aspirator. As far as CNS samples, collected tissues were the whole brain and cervical region of spinal cord.
  • mice were euthanized at 1, 6 and 7 months by injection with ketamine and xylazine before blood and CSF collection. CSF was collected by glass capillary inserted into the cisterna magna. For tissue collection, mice were intraca rdially perfused with PBS (pH 7,4) and brains were removed, divided into halves and fixed for further analysis.
  • the right half was sliced in five slices (A-E) and frozen in liquid nitrogen, the left half was sliced in two coronally anterior and posterior parts fixed in 4% (w/v) paraformaldehyde in PBS and embedded in paraffin.
  • a coronally slice derived from left half of brain was fixed in 4% paraformaldehyde, 25% glutaraldehyde in phosphate buffer for plastic embedding.
  • the left lateral lobe of the liver from the mice were fixed in 4% (w/v) paraformaldehyde in PBS and embedded in paraffin, and the right medial lobe of the liver of the mice was frozen in liquid nitrogen.
  • SGSH activity Twenty main regions covering the entire CNS of injected pigs were dissected and homogenized with Tissue Lyser using 10 volumes of H20 mQ (700 mI). In mice 5 different slices covering the entire brain and liver samples were homogenized separately with Tissue Lyser using 8 volumes of H20 mQ. The SGSH activity was assayed by a 4-methylumbelliferone-derived fluorogenic substrate (4- MU; Moscerdam Substrates), following established protocols [5].
  • the plate was then incubated with the HRP substrate, TMB peroxidase substrate (Bio-Rad, Hercules, California, USA #1721066) for 30 min at 37°C.
  • This enzyme-substrate reaction was stopped using a stop buffer (2N of H2S04) and the absorbance of each well was measured at the absorbance wavelength of 450 nm (Lml) with a reference wavelength of 655 nm (Lm2) using a microplate reader (GloMax ® -Multi+ Detection System, Promega, Madison, Wisconsin, USA).
  • the concentrations of HNS in samples were calculated using the HNS calibration curve in the same plate.
  • Genomic DNA was extracted from mouse brain samples using a DNeasy Blood and Tissue Extraction kit (Qjagen, Valencia, CA). DNA concentration was determined by using a Nanodrop.
  • Real-time PCR was performed on 100 ng of genomic DNA using a LightCycler SYBR green I system (Roche, Almere, The Netherlands). Amplification was run on a LightCycler 96 device (Roche) with standard cycles.
  • the primers forward SGSH (5' CATCCACTTTGCCTTTCTCTCCA 3', SEQ ID No.: 21) and reverse SGSH (5' T CAAAG CCTCCGT CAT CCG C 3', SEQ ID No.: 22) were used.
  • a standard curve was generated, using the corresponding AAV vector plasmid pAAV2.1CMV-IDSspSGSH- IRES-SUMF1.
  • Brain samples and liver samples were lysed in water by Tissue Lyser equipment. The lysates were then digested with proteinase K and extracts were clarified by centrifugation and filtration. GAG levels in brain extracts were determined using Blyscan sulfated glycosaminoglycan kit (Biocolor, Carrickfergus, UK) with chondroitin 4-sulfate as the standard.
  • Immunohistochemical experiments were performed in 5micron paraffin sections with BondRX Stainer following the standard protocol.
  • the primary antibodies used were mouse anti-Human SGSH (Shire 2C7) 1:25 for immunofluorescence and 1:500 for IHC, rabbit anti-LAMPl (ab24170 Abeam), rabbit anti-GFAP (ab7260Abcam), rabbit anti-NeuN (abl77487).
  • 5-micron paraffin- embedded tissue sections were incubated overnight at 4°C with rabbit anti-GFAP (Z0334; Dako Cytomation).
  • the detection system including secondary antibodies used for immunohistochemistry was Bond Polymer refine kit (Leica, DS9800) for the visualization of SGSH and LAMP1 signals.
  • the secondary antibody used for the detection of GFAP and IBAI signal was biotinylated universal antibody of Vectastain ABC kit (Vector Laboratories, Burlingame, CA, USA).
  • the GFAP and IBAI stained slides were scanned with Hamamatsu Nanozoomer 2.0-RS scanner and viewed with NDP.view2. Total number of GFAP and IBAI positive signals were counted using the cell-counter program (ImageJ software) with a fixed threshold.
  • Behavioral tests were carried out in a behavioral testing room maintained under constant light, temperature, and humidity. The mice were tested during daylight hours (between 9am and 6pm). Before testing, animals were habituated to the testing room for at least 30 min. The same groups of animals were tested at 6 and 9 months of age. The inventors performed the open field which in previous studies they have found to be impaired in adult M PS-11 IA mice. Additionally, the inventors tested them in the contextual fear conditioning task, which allows to evaluate animal ability to learn and remember a Pavlovian association between a mild food-shock and a specific context.
  • Open field task was performed as previously described [5]. Mice were placed in the middle of a Plexiglas arena with a masonite base (43 x 32 x 40 cm). Animals were left free to explore the device for 10 min. The distance travelled (m), the immobility time (s) and line crossing, were recorded using a video camera (Panasonic WV-BP330) hanging over the arena that was connected to a video-tracking system (Any-Maze, Stoelting, USA).
  • Contextual fear conditioning Each mouse was trained in a conditioning chamber (30 cm x 24 cm x 21 cm; Ugo Basile) that had a removable grid floor and waste pan.
  • the grid floor contained 36 stainless steel rods (3-mm diameter) spaced 8 mm center to center.
  • the shock intensity was 0.5 mA with a duration of 2 sec and it was presented for three times and was associated to a context.
  • mice were tested without foot- shock but with the same context. Freezing behavior was defined as complete lack of movement, except for respiration and scored with a video-tracking system (ANY-MAZE, Stoelting, USA).
  • Example 1 IN VITRO study - Testing of IDSspSGSH cassette in glia cells
  • the inventors transfected primary cultured glia derived from C57BL/6 mice with a vector expressing the IDSspSGSH cDNA of SEQ. ID No. 1 (pAAV2.1-CMV-IDSspSGSH, SEQ. ID No.7) and compared it to two other constructs: one bearing the unmodified version of SGSH of SEQ SEQ ID No. 2 (pAAV2.1-CMV-SGSH, SEQ ID No. 5) and a construct carrying the human a-antitrypsin (hAATAATspSGSH cDNA of SEQ ID No.
  • the secretion experiment was started one day after transfection, by adding the conditioned media to the primary transfected glia cells. 24h after secretion, the enzymatic activity in both the pellet and the medium of glia cells was evaluated, demonstrating that the IDS sp replacement strongly increased the secretion rate of ISDsp-modified sulfamidase compared to wild-type sulfamidase (Fig.l). The secretion efficiency has been indicated as percentage of the SGSH activity in the medium/ activity in the pellet and the medium.
  • the IDSspSGSH construct showed increased enzymatic activity in the medium associated with improved secretion efficiency in glia cells transfected with the IDSspSGSH compared to cells transfected with the other constructs, demonstrating the capability of the IDSspSGSH protein to be functional and highly secreted in the highly relevant in vitro model of primary glia cells.
  • Example 2 Usage of a SGSH expression cassette with enhanced enzyme secretion and activation improved enzyme bio-distribution in the CNS of pigs upon intra-CSF AAV9- mediated gene delivery
  • the inventors generated a bi-cistronic SGSH expression cassette containing a chimeric SGSH bearing the iduronate sulfatase signal peptide (IDSsp) and the gene encoding SUMF1 (IDSspSGSH-IRES-SUMFl).
  • IDSspSGSH-IRES-SUMFl the gene encoding SUMF1
  • WT pigs were intra CSF injected via the cisterna magna with 4.5xl0 12 GC/Kg of AAV9 encoding IDSspSGSH-IRES-SUMFl under the CMV promoter.
  • AAV9-SGSH WT SGSH
  • IDSsp-modified SGSH AAV9-IDSspSGSH
  • bicistronic cassette containing SUMF1 WT SGSH
  • Example 3 AAV9-mediated intra-CSF delivery of IDSspSGSH-IRES-SUMFl resulted in a strong and sustained SGSH activity in the brain of Sgsh -/- mice
  • the inventors then performed an efficacy study in a larger cohort of M PS-111 A mice in which AAV9 encoding IDSspSGSH-IRES-SUMFl was delivered by ICV. Following one month (early time point; ETP) or seven months (late time point; LTP) after injection the enzyme biodistribution and the pathological phenotype were analysed. Consistently with previous results (Figure 3) a significant increase of SGSH activity in the brain of injected animals with peaks of 35% of WT levels was observed at ETP (Figure 4A). Importantly, such increased activity was sustained at LTP (25% of WT levels) ( Figure 4A).
  • Example 4 Rescue of storage pathology, lysosomal enlargement and neuroinflammation in MPS-IIIA mice treated with AAV9-IDSspSGSH-IRES-SUMFl
  • Example 5 Treatment with IDSspSGSH-IRES-SUMFl prevents the memory deficits occurring in the late stage of MPS-IIIA pathology
  • the inventors next validated the impact of the ICV AAV9-mediated delivery of IDSspSGSH-IRES- SUMFl on behavioural deficits that manifest in 6 and 9 months MPS-IIIA mice. Based on previous studies, the inventors evaluated exploratory behaviour in the open field. At 6 months, MPS-IIIA male mice show a mild difference in the distance travelled, immobile time and line crossing, in the very first minutes of open field testing, as compared to WT animals ( Figure 8C). This tendency was not evident at 9 months, likely due to the test-retest effects observed also in control animals [27], which did not allow to properly evaluate the rescuing efficacy of IDSspSGSH-IRES- SUMF1 ( Figure 8A-8C).
  • the inventors tested the animals in a memory task that is extensively used to test contextual memory depending on the functional integrity of the medial temporal lobe, namely the fear contextual conditioning test [28]. Using this task, the inventors identified, for the first time in MPS-IIIA mice, an age-dependent long term memory impairment: 6 months-old MPS-IIIA mice show normal freezing time when they are exposed to a mild foot shock during training, as compared to control animals; similarly, exposure to the context (24 hr after training) paired with the mild foot shock is sufficient to elicit freezing as well as in control mice (Figure 6E). This suggests that at this stage MPS-IIIA mice can form emotional contextual memories as well as WT animals.
  • the inventors developed and tested an intra-CSF AAV-mediated gene transfer approach for the MPS- MIA based on intrathecal delivery of AAV9 encoding a modified SGSH expression cassette with enhanced therapeutic potential.
  • Such expression cassette contained an SGSH bearing the signal peptide of IDS, which confer to the engineered enzyme the capability to be secreted at higher efficiency compared to WT enzyme.
  • modification resulted in improved bio-distribution of the enzyme in the CNS of both small (MPS-IIIA mice) and large (WT pigs) animal models.
  • an important additional feature of the SGSH expression cassette used in the present strategy is the insertion of the cDNA codifying for SUMF1, the enzyme responsible for the post- translational activation of sulfatases.
  • Such modification synergistically acts together with enhanced secretion to further improve enzyme CNS bio-distribution upon intra-CSF AAV9- mediated gene delivery.
  • the inventors demonstrated that the modified SGSH expression cassette they developed is therapeutically effective, being able to efficiently rescue CNS and somatic storage pathology and improve memory impairment.
  • Intra-CSF AAV9-mediated gene delivery using WT SGSH has previously been successfully tested in different preclinical animal models using vector doses similar to those used in the present approach (i.e. ⁇ 4-5 xlO 12 GC/Kg) [16].
  • the authors also showed that reducing AAV9 vector dosage in MPS-IIIA mice below 4-5 xlO 12 GC/Kg led to inefficient enzyme biodistribution, thus resulting in only mild neuropathology improvement.
  • Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nature biotechnology. 2009;27(l):59-65.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention concerne une thérapie génique améliorée pour traiter des déficiences en sulfatase, de préférence par co-administration d'enzymes sulfatase et de protéine SUMF1.
PCT/EP2019/060980 2018-04-27 2019-04-29 Thérapie de déficiences en sulfatase WO2019207167A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP18169924 2018-04-27
EP18169924.0 2018-04-27

Publications (1)

Publication Number Publication Date
WO2019207167A1 true WO2019207167A1 (fr) 2019-10-31

Family

ID=62089674

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/060980 WO2019207167A1 (fr) 2018-04-27 2019-04-29 Thérapie de déficiences en sulfatase

Country Status (1)

Country Link
WO (1) WO2019207167A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022122883A1 (fr) * 2020-12-09 2022-06-16 Genethon Variants de lipase acide lysosomale et leurs utilisations
WO2023240220A1 (fr) * 2022-06-09 2023-12-14 The University Of North Carolina At Chapel Hill Vecteurs aav-sgsh pour le traitement de la mucopolysaccharidose iiia

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5747469A (en) 1991-03-06 1998-05-05 Board Of Regents, The University Of Texas System Methods and compositions comprising DNA damaging agents and p53
US6054467A (en) 1996-07-05 2000-04-25 Sidney Kimmel Cancer Center Down-regulation of DNA repair to enhance sensitivity to P53-mediated apoptosis
WO2010102248A2 (fr) 2009-03-05 2010-09-10 The Regents Of The University Of California Pince moléculaire pour le traitement d'amyloses
WO2012085622A1 (fr) 2010-12-22 2012-06-28 Fondazione Telethon Stratégies thérapeutiques pour traiter une pathologie du snc dans des mucopolysaccharidoses
WO2016007909A2 (fr) * 2014-07-11 2016-01-14 Biostrategies LC Matériaux et procédés pour traiter des troubles associés aux enzymes sulfatases

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5747469A (en) 1991-03-06 1998-05-05 Board Of Regents, The University Of Texas System Methods and compositions comprising DNA damaging agents and p53
US6054467A (en) 1996-07-05 2000-04-25 Sidney Kimmel Cancer Center Down-regulation of DNA repair to enhance sensitivity to P53-mediated apoptosis
WO2010102248A2 (fr) 2009-03-05 2010-09-10 The Regents Of The University Of California Pince moléculaire pour le traitement d'amyloses
WO2012085622A1 (fr) 2010-12-22 2012-06-28 Fondazione Telethon Stratégies thérapeutiques pour traiter une pathologie du snc dans des mucopolysaccharidoses
WO2016007909A2 (fr) * 2014-07-11 2016-01-14 Biostrategies LC Matériaux et procédés pour traiter des troubles associés aux enzymes sulfatases

Non-Patent Citations (38)

* Cited by examiner, † Cited by third party
Title
"A Comprehensive Map of CNS Transduction by Eight Recombinant Adeno-associated Virus Serotypes Upon Cerebrospinal Fluid Administration in Pigs", MOL THER., vol. 24, no. 2, 2016, pages 276 - 86
"A highly secreted sulphamidase engineered to cross the blood-brain barrier corrects brain lesions of mice with mucopolysaccharidoses type IIIA", EMBO MOL MED., vol. 5, no. 5, 2013, pages 675 - 90
"Functional correction of CNS lesions in an MPS-IIIA mouse model by intracerebral AAV-mediated delivery of sulfamidase and SUMF1 genes", HUM MOL GENET., vol. 16, no. 22, 2007, pages 2693 - 702
1992, PROC. NATL. ACAD. SCI. USA, vol. 89, pages 6099 - 6103
BHATTACHARYYA R; GLIDDON B; BECCARI T; HOPWOOD JJ; STANLEY P.: "A novel missense mutation in lysosomal sulfamidase is the basis of MPS III A in a spontaneous mouse mutant", GLYCOBIOLOGY, vol. 11, no. 1, 2001, pages 99 - 103
BHAUMIK M; MULLER VJ; ROZAKLIS T; JOHNSON L; DOBRENIS K; BHATTACHARYYA R ET AL.: "A mouse model for mucopolysaccharidosis type III A (Sanfilippo syndrome", GLYCOBIOLOGY, vol. 9, no. 12, 1999, pages 1389 - 96
CARMINE SPAMPANATO ET AL: "Efficacy of a Combined Intracerebral and Systemic Gene Delivery Approach for the Treatment of a Severe Lysosomal Storage Disorder", MOLECULAR THERAPY, vol. 19, no. 5, 1 May 2011 (2011-05-01), GB, pages 860 - 869, XP055600204, ISSN: 1525-0016, DOI: 10.1038/mt.2010.299 *
CHEN Y; ZHENG S; TECEDOR L; DAVIDSON BL: "Overcoming Limitations Inherent in Sulfamidase to Improve Mucopolysaccharidosis IIIA Gene Therapy", MOL THER., vol. 26, no. 4, 2018, pages 1118 - 26, XP055549748, DOI: doi:10.1016/j.ymthe.2018.01.010
COSMA MP; PEPE S; ANNUNZIATA I; NEWBOLD RF; GROMPE M; PARENTI G ET AL.: "The multiple sulfatase deficiency gene encodes an essential and limiting factor for the activity of sulfatases", CELL, vol. 113, no. 4, 2003, pages 445 - 56, XP001155603, DOI: doi:10.1016/S0092-8674(03)00348-9
D'AMELIO M; CAVALLUCCI V; MIDDEI S; MARCHETTI C; PACIONI S; FERRI A ET AL.: "Caspase-3 triggers early synaptic dysfunction in a mouse model of Alzheimer's disease", NAT NEUROSCI., vol. 14, no. l, 2011, pages 69 - 76
DIEZ-ROUX G; BALLABIO A: "Sulfatases and human disease", ANNU REV GENOMICS HUM GENET., vol. 6, 2005, pages 355 - 79
FEDERICI T; TAUB JS; BAUM GR; GRAY SJ; GRIEGER JC; MATTHEWS KA ET AL.: "Robust spinal motor neuron transduction following intrathecal delivery of AAV9 in pigs", GENE THERAPY, vol. 19, no. 8, 2012, pages 852 - 9
FOUST KD; NURRE E; MONTGOMERY CL; HERNANDEZ A; CHAN CM; KASPAR BK: "Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes", NATURE BIOTECHNOLOGY, vol. 27, no. 1, 2009, pages 59 - 65, XP055023143, DOI: doi:10.1038/nbt.1515
FRALDI A ET AL: "SUMF1 enhances sulfatase activities in vivo in five sulfatase deficiencies", BIOCHEMICAL JOURNAL, PUBLISHED BY PORTLAND PRESS ON BEHALF OF THE BIOCHEMICAL SOCIETY, vol. 403, no. 2, 15 April 2007 (2007-04-15), pages 305 - 312, XP002601852, ISSN: 0264-6021, [retrieved on 20070108], DOI: 10.1042/BJ20061783 *
FRALDI A; BIFFI A; LOMBARDI A; VISIGALLI I; PEPE S; SETTEMBRE C ET AL.: "SUMF1 enhances sulfatase activities in vivo in five sulfatase deficiencies", BIOCHEM J., vol. 403, no. 2, 2007, pages 305 - 12, XP002601852, DOI: doi:10.1042/BJ20061783
FRALDI A; SERAFINI M; SORRENTINO NC; GENTNER B; AIUTI A; BERNARDO ME: "Gene therapy for mucopolysaccharidoses: in vivo and ex vivo approaches", ITAL J PEDIATR, vol. 44, no. 2, 2018, pages 130
FU H; CATALDI MP; WARE TA; ZARASPE K; MEADOWS AS; MURREY DA ET AL.: "Functional correction of neurological and somatic disorders at later stages of disease in MPS IIIA mice by systemic scAAV9-hSGSH gene delivery", MOL THER METHODS CLIN DEV., vol. 3, 2016, pages 16036
HAURIGOT V; MARCO S; RIBERA A; GARCIA M; RUZO A; VILLACAMPA P ET AL.: "Whole body correction of mucopolysaccharidosis IIIA by intracerebrospinal fluid gene therapy", THE JOURNAL OF CLINICAL INVESTIGATION, 2013
HINDERER C; KATZ N; BUZA EL; DYER C; GOODE T; BELL P ET AL.: "Severe Toxicity in Nonhuman Primates and Piglets Following High-Dose Intravenous Administration of an Adeno-Associated Virus Vector Expressing Human SMN", HUM GENE THER., vol. 29, no. 3, 2018, pages 285 - 98, XP055532829, DOI: doi:10.1089/hum.2018.015
HOPWOOD, J.J; BALLABIO, A., MULTIPLE SULFATASE DEFICIENCY AND THE NATURE OF THE SULFATASE FAMILY
LAU AA; CRAWLEY AC; HOPWOOD JJ; HEMSLEY KM: "Open field locomotor activity and anxiety-related behaviors in mucopolysaccharidosis type IIIA mice", BEHAV BRAIN RES., vol. 191, no. 1, 2008, pages 130 - 6, XP022665578, DOI: doi:10.1016/j.bbr.2008.03.024
LEHTINEN MK; BJORNSSON CS; DYMECKI SM; GILBERTSON RJ; HOLTZMAN DM; MONUKI ES: "The choroid plexus and cerebrospinal fluid: emerging roles in development, disease, and therapy", J NEUROSCI., vol. 33, no. 45, 2013, pages 17553 - 9
MINGOZZI F; HIGH KA.: "Therapeutic in vivo gene transfer for genetic disease using AAV: progress and challenges", NAT REV GENET., vol. 12, no. 5, 2011, pages 341 - 55, XP055155351, DOI: doi:10.1038/nrg2988
NEUFELD EF.: "The biochemical basis for mucopolysaccharidoses and mucolipidoses", PROG MED GENET., vol. 10, 1974, pages 81 - 101
NEUFELD EF; CANTZ MJ: "Corrective factors for inborn errors of mucopolysaccharide metabolism", ANN N Y ACAD SCI., vol. 179, 1971, pages 580 - 7
NEUFELD EF; MUENZER J.: "The Metabolic and Molecular Basis of Inherited Disease", 2001, MCGRAW-HILL, article "The mucopolysaccharidoses", pages: 3421 - 52
NICOLINA CRISTINA SORRENTINO ET AL: "A highly secreted sulphamidase engineered to cross the blood-brain barrier corrects brain lesions of mice with mucopolysaccharidoses type IIIA", EMBO MOLECULAR MEDICINE, vol. 5, no. 5, 9 April 2013 (2013-04-09), Weinheim, pages 675 - 690, XP055290687, ISSN: 1757-4676, DOI: 10.1002/emmm.201202083 *
PARENTI, G; MERONI, G; BALLABIO, A: "The sulfatase gene family", CURR. OPIN. GENET. DEV., vol. 7, 1997, pages 386 - 391, XP002223582, DOI: doi:10.1016/S0959-437X(97)80153-0
ROMAGNOLI N; VENTRELLA D; GIUNTI M; DONDI F; SORRENTINO NC; FRALDI A ET AL.: "Access to cerebrospinal fluid in piglets via the cisterna magna: optimization and description of the technique", LABORATORY ANIMALS, vol. 48, no. 4, 2014, pages 345 - 8
SIMONATO M; BENNETT J; BOULIS NM; CASTRO MG; FINK DJ; GOINS WF ET AL.: "Progress in gene therapy for neurological disorders", NATURE REVIEWS NEUROLOGY, vol. 9, no. 5, 2013, pages 277 - 91, XP055161287, DOI: doi:10.1038/nrneurol.2013.56
SORRENTINO ET AL., EMBO MOL MED, vol. 5, 2013, pages 675 - 690
SORRENTINO NC; FRALDI A: "Brain Targeting in MPS-IIIA", PEDIATR ENDOCRINOL REV., vol. 13, no. 1, 2016, pages 630 - 8
TARDIEU M; ZERAH M; HUSSON B; BOURNONVILLE S; DEIVA K; ADAMSBAUM C ET AL.: "Intracerebral administration of adeno-associated viral vector serotype rh.10 carrying human SGSH and SUMF1 cDNAs in children with mucopolysaccharidosis type IIIA disease: results of a phase / trial", HUMAN GENE THERAPY, vol. 25, no. 6, 2014, pages 506 - 16, XP055467864, DOI: doi:10.1089/hum.2013.238
VALSTAR MJ; NEIJS S; BRUGGENWIRTH HT; OLMER R; RUIJTER GJ; WEVERS RA ET AL.: "Mucopolysaccharidosis type IIIA: clinical spectrum and genotype-phenotype correlations", ANN NEUROL., vol. 68, no. 6, 2010, pages 876 - 87
WANG ET AL., SCIENTIFIC REPORTS, vol. 5, 2015
WINNER LK; BEARD H; HASSIOTIS S; LAU AA; LUCK AJ; HOPWOOD JJ ET AL.: "A Preclinical Study Evaluating AAVrhlO-Based Gene Therapy for Sanfilippo Syndrome", HUM GENE THER., vol. 27, no. 5, 2016, pages 363 - 75
YOSHIMURA ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, 1992, pages 3233 - 3240
ZHU ET AL.: "Systemic gene expression after intravenous DNA delivery into adult mice", SCIENCE, vol. 261, 1993, pages 209 - 211, XP001068973, DOI: doi:10.1126/science.7687073

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022122883A1 (fr) * 2020-12-09 2022-06-16 Genethon Variants de lipase acide lysosomale et leurs utilisations
WO2023240220A1 (fr) * 2022-06-09 2023-12-14 The University Of North Carolina At Chapel Hill Vecteurs aav-sgsh pour le traitement de la mucopolysaccharidose iiia

Similar Documents

Publication Publication Date Title
Haurigot et al. Whole body correction of mucopolysaccharidosis IIIA by intracerebrospinal fluid gene therapy
CA2988201C (fr) Vecteurs derives de virus adeno-associes pour le traitement de mucopolysaccharidoses
EP3402533B1 (fr) Méthodes et compositions pour le traitement d'une maladie neurologique
AU2017333336B2 (en) Adenoassociated virus vectors for the treatment of mucopolysaccharidoses
Ribera et al. Biochemical, histological and functional correction of mucopolysaccharidosis type IIIB by intra-cerebrospinal fluid gene therapy
Roca et al. Disease correction by AAV-mediated gene therapy in a new mouse model of mucopolysaccharidosis type IIID
EP4124658A2 (fr) Traitement de la sclérose latérale amyotrophique (sla)
Feltri et al. Mechanisms of demyelination and neurodegeneration in globoid cell leukodystrophy
CA3115944A1 (fr) Compositions de polypeptides stabilisees par une liaison disulfure et procedes d'utilisation
McIntyre et al. Correction of murine mucopolysaccharidosis type IIIA central nervous system pathology by intracerebroventricular lentiviral‐mediated gene delivery
Sorrentino et al. Enhancing the therapeutic potential of sulfamidase for the treatment of mucopolysaccharidosis IIIA
WO2019207167A1 (fr) Thérapie de déficiences en sulfatase
US20220025461A1 (en) Methods of detecting, preventing, reversing, and treating neurological diseases
Gray et al. An improved adeno-associated virus vector for neurological correction of the mouse model of mucopolysaccharidosis IIIA
JP2022538497A (ja) ライソゾーム蓄積症を処置するためのベクター組成物およびそれを使用する方法
US20180087041A1 (en) Tagged form of mut enzyme, genetic constructs incorporating it, and its use in gene thereapy
RU2769577C1 (ru) Препарат для лечения метахроматической лейкодистрофии и способ ее лечения
WO2024052413A1 (fr) Vecteurs de beta-hexosaminidase
TW202132566A (zh) 用於治療或預防溶體貯積病之鋅指核酸酶變異體
TW202111126A (zh) 用於治療聖菲利柏氏病及其他病症之組合物及方法
CN115820740A (zh) 用于治疗ⅱ型粘多糖贮积症的重组腺相关病毒载体及其应用
Bosch Merino Intrathecal administration of AAVrh10 coding for β‐glucuronidase corrects biochemical and histological hallmarks of mucopolysaccharidosis type VII mice and improves behavior and survival
Zhang et al. 867. Correction of Glycogen Storage Disease Type II by Intramuscular Administration of an Adeno-Associated Virus 6 (AAV2/6) Vector Containing a Muscle-Specific Promoter
Osborn Gene therapy strategies for targeting the treatment refractory sites in Hurler syndrome
Chang et al. Therapeutic Strategies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19720131

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19720131

Country of ref document: EP

Kind code of ref document: A1