WO2019205057A1

WO2019205057A1 - Promoter and application thereof

Info

Publication number: WO2019205057A1
Application number: PCT/CN2018/084642
Authority: WO
Inventors: 梁兴祥; 苏建华; 王美玲; 姚永超; 秦莉; 陈小平
Original assignee: 广州中科蓝华生物科技有限公司
Priority date: 2018-04-26
Filing date: 2018-04-26
Publication date: 2019-10-31
Also published as: CN109312345A; CN109312345B

Abstract

Provided are a promoter and an application thereof for expressing an exogenous gene of plasmodium. The promoter is selected from: (1) DNA or a fragment thereof comprising a nucleotide sequence represented by SEQ ID NO. 1 and showing promoter activity in a stable phase specificity manner in plasmodium; or (2) DNA or a fragment thereof having homology of 90% or more, preferably 95% or more, with the nucleotide sequence represented by SEQ ID NO. 1 and showing promoter activity in the stable phase specificity manner in plasmodium. By synthesizing the sequence represented by NT1-9 (SEQ ID NO.1), it is found that the nucleotide sequence having the NT1-9 sequence as the core has transcriptional activity and can be applied to different scenarios.

Description

A promoter and its application

Technical field

The invention relates to the field of genetic engineering technology, in particular to a promoter and an application thereof, in particular to a promoter and an application thereof for expressing a foreign gene of Plasmodium.

Background technique

Protein expression is the basic process in living cells, and all the information needed for protein expression is provided by a single nucleic acid. The nucleic acid contains not only information on the amino acid sequence of the protein, but also provides regulatory information such as ribosome binding sites, transcription initiation and termination signals, splicing signals, enhancer elements, and the like, including promoter/promoter sequences.

A promoter is a DNA sequence that RNA polymerase recognizes, binds, and initiates transcription. It contains a conserved sequence required for RNA polymerase specific binding and transcription initiation, and the promoter itself is not transcribed. Under the premise of the same transcription efficiency, the shorter the promoter, the more favorable the application of the promoter, and the shorter promoter can reduce the burden of constructing the expression vector.

At present, there are few promoters that can be used for Plasmodium berghei. The commonly used Plasmodium berghei promoter has only pbeeflaa, which cannot meet the needs of gene editing and multi-gene expression in Plasmodium berghei.

Summary of the invention

In view of the deficiencies and practical needs of the prior art, the present invention provides a promoter and its application, and finds a series of promoters for Plasmodium, which are suitable for different situations and can significantly improve transcription efficiency.

To this end, the present invention employs the following technical solutions:

In one aspect, the invention provides a promoter characterized in that:

(1) DNA or a fragment thereof comprising the nucleotide sequence shown in SEQ ID NO. 1 and exhibiting promoter activity in a stable phase-specific manner in Plasmodium; or

(2) DNA having a homologity of 90% or more, preferably 95% or more with the nucleotide sequence shown in SEQ ID NO. 1, and exhibiting promoter activity in a stable phase-specific manner in Plasmodium.

In the present invention, the inventors have found that NT1 (nucleoside transporter 1 PBANKA_1360100) is an important nucleoside transporter on Plasmodium berghei, and has the function of transporting purine nucleosides and purine bases into the membrane of Plasmodium. The sequence upstream of the NT1 gene of Plasmodium berghei was analyzed for transcription initiation site, and it was predicted that there was a dense transcription initiation site at 2000 bp upstream of the NT1 gene.

In order to study the transcriptional activity sequence of the NT1 promoter, the inventors truncated the 2000 bp sequence upstream of the NT1 gene to different lengths and compared the transcription efficiency with the commonly used Plasmodium berghei promoter pbeeflaa, using the foreign protein GFP and NanoLuc as a foreign source. Comparing the proteins, it was found that a series of promoters having the nucleotide sequence of SEQ ID NO. 1 (NT1-9) as a core have transcriptional activity.

The nucleotide sequence shown in SEQ ID NO. 1 is as follows: AATTTGTTAAAAATTATTTAAAACATTTAAAAAAACTATAGCA TCTATTATTAAATATATTT CCCAAATATTATTTGAGAAAAAATATAAACA TTTTGCGAATTTTAATATATTTATTTAATTATTTTTTTCTATTTTTCCATAATAAGTCAAGATGAGTAAAATTAAAGAGTCATCTAGTGGTATATTAGGTGCTTCT, wherein the underlined portion is indicated as the predicted transcription start site.

According to the present invention, the inventors have found that a promoter having 90% or more, preferably 95% or more homology with the nucleotide sequence shown in SEQ ID NO. 1 can also exhibit a promoter in a stable phase-specific manner in Plasmodium. The sub-active DNA or a fragment thereof may be, for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9%.

According to the present invention, the inventors have found that the eight sequences extending in the core sequence shown by SEQ ID NO. 1 also have the activity of transcribed Plasmodium proteins, and the lengths are different, and can be used in different occasions. The nucleotide sequence of the promoter is shown in SEQ ID NO. 2-9, and the specific sequence is as follows:

The nucleotide sequence shown in SEQ ID NO. 2 (NT1-1):

The nucleotide sequence shown in SEQ ID NO. 3 (NT1-2):

The nucleotide sequence shown in SEQ ID NO. 4 (NT1-3):

The nucleotide sequence shown in SEQ ID NO. 5 (NT1-4):

The nucleotide sequence shown in SEQ ID NO. 6 (NT1-5):

The nucleotide sequence shown in SEQ ID NO. 7 (NT1-6):

The nucleotide sequence shown in SEQ ID NO. 8 (NT1-7):

The nucleotide sequence shown in SEQ ID NO. 9 (NT1-8):

The inventors found through verification that NT1-1, NT1-4, NT1-6, and NT1-9 have significant transcriptional activity, and NT1-1 has the strongest transcriptional activity, and the nucleotide sequence of the NT1-6 promoter is 399 bp in length. Only 70% of the pbeeflaa promoter is present, and the shorter the promoter, the better the promoter application and the burden on the vector.

In a second aspect, the invention provides a recombinant vector comprising the promoter of the first aspect.

According to the present invention, when the promoter is placed upstream of the foreign gene, the foreign gene can be expressed in a stable phase-specific manner.

According to the invention, the vector is a plasmid vector, a phage vector or a viral vector, or a combination of at least two, preferably a plasmid vector, preferably a pl0017 vector and/or a pl0018 vector.

In a third aspect, the invention provides a host cell comprising the recombinant vector of the second aspect.

In a fourth aspect, the invention provides a method of producing a protein comprising the steps of culturing a host cell as described in the third aspect, collecting protein from the culture produced.

In a fifth aspect, the present invention provides the promoter of the first aspect or the recombinant vector of the second aspect for expression of a foreign gene of Plasmodium.

According to the present invention, the Plasmodium falciparum is any one or a combination of at least two of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium falciparum, Plasmodium falciparum or Plasmodium. For Plasmodium berghei.

In the present invention, some terms are explained as follows:

Promoter activity means that when a construct obtained by placing a gene downstream of a promoter to enable expression of the gene is introduced into a host, the promoter has an expression product of the gene produced in or outside the host Ability and function.

A stationary phase-specific promoter indicates a promoter that is known to be transcribed only during the stationary phase after the logarithmic growth phase. A stationary phase-specific promoter can express a gene placed downstream of the promoter only during the stationary phase, in the absence of an inducer.

Compared with the prior art, the present invention has the following beneficial effects:

(1) The present inventors have discovered that the nucleotide sequence having the NT1-9 sequence as a core has transcriptional activity by synthesizing the NT1-9 sequence, and can be applied to different applications;

(2) The present invention verified that the NT1-1 promoter has the highest transcription efficiency, 1.3-1.7 times that of the commonly used promoter pbeeflaa, and the transcription efficiency of the NT1-6 promoter is slightly lower, only 60% of the commonly used promoter pbeeflaa, but Its length is only 399bp, which is shorter than pbeeflaa, which can save the constructed carrier space and improve the efficiency of gene editing.

DRAWINGS

1 is a schematic diagram showing the construction of a transcriptional verification vector for NT1 promoters of different lengths according to the present invention;

Figure 2 is a schematic diagram of NT1 promoters of different lengths;

Figure 3 is a fluorescence microscope to detect the GFP fluorescence of the strain, wherein BF is the bright field result, and the result is FL fluorescent lamp;

Figure 4 is a fluorescence microscope to detect the fluorescence of different NT1 promoter plasmids, in which BF is a bright field, FL fluorescent light results;

Figure 5 is a result of detecting a rotifer strain by a fluorescence microscope, wherein BF is a bright field, and the result is FL fluorescent lamp;

Figure 6 is a rendering diagram of the NT1 promoter at different positions;

Figure 7 is a schematic diagram of constructing a promoter comparison vector;

Figure 8 is a result of detecting a rotifer strain by a fluorescence microscope, wherein BF is a bright field, and the result is FL fluorescent lamp;

Figure 9 is a result of flow cytometry detection of GFP, wherein Figure 9 (A) is the NT1-9 promoter, Figure 9 (B) is the NT1-6 promoter, and Figure 9 (C) is the NT1-1 promoter. Figure 9 (D) is a promoterless, Figure 9 (E) is the pbeeflaa promoter, GFP channel is GFP fluorescence, Cyto61 labeled Plasmodium nucleus;

Figure 10 is the average fluorescence of GFP with different promoter strains at the same copy number;

Figure 11 shows the results of NanoLuc activity with different promoter strains at equal copy number.

detailed description

The technical solutions of the present invention will be further described with reference to the accompanying drawings and the embodiments of the present invention, but the present invention is not limited to the scope of the embodiments.

Example 1 demonstrates the effectiveness of different lengths of the NT1 promoter

The 2271 bp upstream of the NT1 gene of Plasmodium berghei was analyzed using http://www.fruitfly.org/seq_tools/promoter.html, and a large number of transcription initiation sites were predicted at 2000 bp upstream of the NT1 gene, including 1427-1757 bp. The predicted transcription initiation site is the most dense, and truncation at different positions of different lengths around the 2000 bp sequence upstream of the NT1 gene, and the transcription efficiency is compared with the commonly used Plasmodium berghei promoter pbeeflaa. The constructed vector is shown in Figure 1-2. Replace the truncated NT1 promoters of different lengths, including NT1-1, NT1-2, NT1-3, NT1-4, NT1-5, NT1-6, by the EcoRV and BamHI restriction sites on the pl0017 vector. NT1-7, NT1-8 and NT1-9, the primers specifically amplifying these promoters are shown in Table 1:

Table 1

The promoters of different lengths were obtained by PCR using the above primers, and the pl0017 backbone was ligated, and the transformed E. coli was correctly sequenced and electroporated with Plasmodium berghei. After electroporation, Balb/c mice were inoculated and screened with pyrimethamine. The smears of mice inoculated with different NT1 promoters were observed for GFP fluorescence. The results are shown in Figure 3-5. The sub-expression of GFP results is shown in Figure 6.

As can be seen from Figure 3-5, only NT1-1, NT1-4, NT1-6, and NT1-9 have obvious GFP fluorescence, and other NT1 promoters cannot express GFP fluorescence; as can be seen from Figure 6, all can The NT1 promoter expressing GFP fluorescence is a promoter truncated to the NT1 gene upstream of the NT1 gene, and the GFP fluorescence intensity expressed by NT1-1≈NT1-4>NT1-6>NT1-9>NT1-7≈NT1 -8>NT1-5>NT1-2≈NT1-3, another transcriptionally active promoter contains the NT1-9 sequence, and NT1-9 contains the predicted transcription start site TCTATTATTAAATATATTTCCCAAATATTATTTGAGAAAAAATATAAAACA, thus determining NT1-9 as NT1 The core sequence of the promoter, NT1-1, NT1-4, NT1-6 with NT1-9 as the core has obvious transcriptional activity.

Example 2 Different NT1 promoters were compared with the control pbeeflaa promoter to express GFP fluorescence

Using the pl0018 vector as a backbone, the control promoter pbeeflaa and the compared NT1 promoters NT1-1, NT1-6 and NT1-9 were ligated to the GFPm3-EAAAK3-NanoLuc-V5 fragment, respectively, and the backbone was finally inserted to form a complete The vector, the terminator sequence is the original sequence on the pl0018 backbone, and the schematic diagram of the constructed vector is shown in Figure 7. The nucleotide sequence of the specific GFPm3-EAAAK3-NanoLuc-V5 fragment is shown in SEQ ID NO. 28, as follows:

Using the primers of Table 2 for amplification and construction, the GFPm3-EAAAK3-NanoLuc-V5 fragment amplification primers are shown in SEQ ID NO. 29-30, and the three NT1 promoters are amplified using the Plasmodium berghei genome as a template. That is, NT1-1, NT1-6, NT1-9, amplify the pbeeflaa promoter as a comparison. Since it is constructed on pl0018, it contains the promoter itself, and only the reverse primer is required for ligation of GFPm3. The specific sequence is as follows:

Table 2

The above promoter was obtained by PCR, and the pl0018 backbone and GFPm3-EAAAK3-NanoLuc-V5 were ligated. After transforming E. coli, the correct plasmid was electroporated into Plasmodium berghei, and the electrophoresis of Plasmodium berghei was subjected to pyrimethamine screening. The electroporated strain was subjected to fluorescence microscopy. The results are shown in Fig. 8. Flow cytometry was used to detect the fluorescence of GFP and Cyto61 under 488 nm and 640 nm lasers. The results are shown in Fig. 9(A)-Fig. 9(E). Show.

As can be seen from Fig. 8, no significant fluorescence was observed in the GFP expressed by the NT1-9 promoter, and the transcriptional effect of the promoter was considered to be poor. Fluorescence microscopy showed that the promoter expressed GFP fluorescence intensity NT1-1>pbeeflaa>NT1-6; from Fig. 9(A)-Fig. 9(E), the order of fluorescence intensity of different promoter expressions was: NT1-1 >pbeef1aa>NT1-6>NT1-9>P.bANKA-WT(blank); NT1-9 group did not express fluorescence, while NT1-1 had the strongest fluorescence intensity, much higher than other groups of GFP fluorescence, NT1-6 The GFP fluorescence intensity expressed by the group and the pbeeflaa group was close.

Effect of copy number of Example 3 on the expression of foreign genes in Plasmodium

Since the fluorescence intensity is affected by the transcription efficiency of the promoter and by the copy number of the foreign gene in the Plasmodium, this example uses the copy number identification of the several strains, and the internal reference uses GAPDH to obtain the primer of the GAPDH standard. As shown in SEQ ID NO. 38-39, the primers for obtaining the GFPm3 standard are shown in SEQ ID NO. 40-41, and the specific sequences are shown in Table 3:

table 3

The specific steps are as follows:

1 standard preparation

GFPm3 standard preparation: firstly absorb 1.3μl of GFPm3 original concentration template, add to 98.7μl of deionized water, which is a standard concentration of 5ng/μl, and then gradually dilute to obtain a concentration of 5.0, 5.0×10 ^- Standards of ¹ , 5.0 × 10 ^-2 , 5.0 × 10 ^-3 , 5.0 × 10 ^-4 , 5.0 × 10 ^-5 and 5.0 × 10 ^-6 ng / μl.

Preparation of GAPDH standard: firstly absorb 2 μl of the original concentration of GAPDH template, add 98 μl of deionized water to a standard concentration of 5 ng / μl, and then gradually dilute to obtain a concentration of 5.0, 5.0 * 10-1, Standards of 5.0*10-2, 5.0*10-3, 5.0*10-4, 5.0*10-5 and 5.0*10-6 ng/μl.

2 Fluorescent quantitative PCR system is prepared as follows:

Note: 4 replicates for each concentration standard, 3 replicates for the sample to be tested, positive control and negative control

3 fluorescence quantitative PCR program setting

Analysis by real-time PCR data revealed that the GFPm3 standard curve Ct=-4.6881gX ₀ +10.369 R ² =0.994 GAPDH standard curve Ct=-3.8791gX ₀ +4.589 R ² =0.998.

Analysis by real-time PCR data showed that the GFPm3 standard curve C _t =-4.6881gX ₀ +10.369 R ² =0.994; GAPDH standard curve C _t =-3.8791gX ₀ +4.589 R ² =0.998;

The results of the average fluorescence intensity of GFPm3 of each promoter at the same copy number in combination with the previous GFP data are shown in Table 4 and Figure 10:

Table 4

As can be seen from Table 4 and Figure 10, under the same copy number, the transcriptional GFP effect was NT1-1>pbeeflaa>NT1-6, and the NT1-1 promoter had the strongest transcriptional GFP activity, which was 1.3 times that of the pbeeflaa promoter. The NT1-6 promoter has a general effect of 0.6 times the pbeeflaa conversion efficiency, but the sequence length is 70% of the pbeeflaa, which is suitable for the vector with the requirement of the insert length, while the NT1-9 has only the transcriptional effect of the individual malaria parasite. Most Plasmodium does not express GFP fluorescence and is not suitable for use as a promoter.

Example 4 Comparison of Expression of NanoLuc Activity by Different NT1 Promoters and Control Pbeeflaa Promoter

In order to verify the difference in expression of foreign proteins by different promoters, this example detects the activity of NanoLuc expressed by different promoters, and calculates P.bANKA-WT(blank), NT1-1, NT1-6, NT1-9 and pbeeflaa. The infection rate was further stained with P.bANKA-WT (blank) and mice with different promoters NT1-1, NT1-6, NT1-9 and pbeeflaa strains, and stained with Giemsa dye solution. The infection rate was counted and the red blood cells of the five mice with different promoter Plasmodium were counted. And use Promega for 5 strains.

The Luciferase Assay System kit performs NanoLuc activity assays. The obtained NanoLuc luminescence intensity was divided by the number of Plasmodium (number of Plasmodium = red blood cell concentration × infection rate) to obtain NanoLuc activity of the average Plasmodium. Since NanoLuc was connected in series with GFP, NanoLuc was consistent with the copy number of GFP, and the equivalent copy number was calculated. The results of NanoLuc activity are shown in Table 5 and Figure 11:

table 5

As can be seen from Table 5 and Figure 11, the results of NanoLuc detection are consistent with the results of flow detection of GFP. The order of luminescence intensity of NanoLuc is: NT1-1>pbeeflaa>NT1-6>NT1-9>P.bANKA-WT(blank) NanoLuc was most potent in expression of the NT1-1 promoter, which was 1.7-fold higher than the pbeeflaa promoter. The NT1-6 promoter was slightly lower than the NanoLuc activity expressed by the pbeeflaa promoter, 0.6-fold higher than pbeeflaa, and the NT1-9 promoter was expressed. The NanoLuc activity is essentially zero.

In summary, the promoters NT1-1 and NT1-6 derived from NT1-9 have transcriptional activity, and NT1-1 has the strongest transcriptional effect, 1.3-1.7 times that of the commonly used promoter pbeeflaa, and NT1. The transcription efficiency of -6 is 60% of pbeeflaa, but the sequence length is 70% of pbeeflaa, which is suitable for vector construction where the length of the insert is relatively strict.

The Applicant declares that the present invention is described by the above-described embodiments, but the present invention is not limited to the above detailed methods, that is, it does not mean that the present invention must be implemented by the above detailed methods. It should be apparent to those skilled in the art that any modifications of the present invention, equivalent substitution of the various materials of the products of the present invention, addition of auxiliary components, selection of specific means, and the like, are all within the scope of the present invention.

Claims

A promoter characterized in that:

(1) DNA or a fragment thereof comprising the nucleotide sequence shown in SEQ ID NO. 1 and exhibiting promoter activity in a stable phase-specific manner in Plasmodium; or

(2) DNA having a homologity of 90% or more, preferably 95% or more with the nucleotide sequence shown in SEQ ID NO. 1, and exhibiting promoter activity in a stable phase-specific manner in Plasmodium.
The Plasmodium promoter according to claim 1, wherein the nucleotide sequence of the promoter is as shown in SEQ ID NO. 2-8.
A recombinant vector comprising the promoter of claim 1 or 2.
The recombinant vector according to claim 3, wherein the promoter is capable of expressing the foreign gene in a stable phase-specific manner when placed upstream of the foreign gene.
The recombinant vector according to claim 3 or 4, wherein the vector is a plasmid vector, a phage vector or a viral vector, or a combination of at least two, preferably a plasmid vector, preferably a p10017 vector and / or p10018 vector.
A host cell comprising the recombinant vector of any one of claims 3-5.
A method of producing a protein, comprising the steps of culturing the host cell of claim 6 and collecting protein from the culture produced.
The promoter according to claim 1 or 2 or the recombinant vector according to any one of claims 3-5 for expression of a foreign gene of Plasmodium.
The use according to claim 8, wherein the Plasmodium is any one of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium vivax, Plasmodium falciparum or Plasmodium. Kind or a combination of at least two.
Use according to claim 8 or 9, characterized in that the Plasmodium is Plasmodium berghei.