CN112695138A

CN112695138A - Triple PCR detection primer for avian leukosis virus A/B/J subgroup and application thereof

Info

Publication number: CN112695138A
Application number: CN202110114063.XA
Authority: CN
Inventors: 张喜懿; 温贵兰; 陈广存; 张小波
Original assignee: Guizhou University
Current assignee: Guizhou University
Priority date: 2021-01-27
Filing date: 2021-01-27
Publication date: 2021-04-23

Abstract

The invention discloses triple PCR detection primers for avian leukosis virus subgroup A/B/J, which comprise primers for detecting avian leukosis virus A, B and subgroup J respectively. The invention also discloses application of the triple PCR detection primers of avian leukosis virus subgroup A/B/J in avian leukosis virus detection. The triple PCR method established by the invention can simultaneously detect three subgroups ALV A and B, J, the clinical test detection result of the method is consistent with the single RT-PCR detection result, and the method has the advantages of simple operation, cost saving, high specificity and good stability, and can provide important technical support for clinically and rapidly identifying the subgroups ALV A and B, J.

Description

Triple PCR detection primer for avian leukosis virus A/B/J subgroup and application thereof

Technical Field

The invention relates to triple PCR detection primers for avian leukosis virus A/B/J subgroup and application thereof, belonging to the technical field of avian leukosis virus A/B/J subgroup detection.

Background

Avian Leukemia (AL) is a type of neoplastic disease mainly composed of lymphomas, myelomas, and hemangiomas, which are caused by Avian Leukemia Virus (ALV) of α -retrovirus genus, family retroviridae. The ALV genome mainly comprises gag, pol and env 3 genes, wherein the gag and pol genes are relatively conserved, the env genes including gp85 have large variation, and the ALV can be divided into A-K11 subgroups according to the difference of the sequence of the gp85 gene of the virus envelope protein. Of the 11 subgroups, A, B, C, D, J and K6 are exogenous viruses, which can cause infected chickens to have obvious clinical symptoms, so that the organism generates tumors, the production performance is reduced, and even the chickens die. Of these, subgroups A, B and J are the dominant species of virus currently causing diseases in the chicken flocks, and are more common in poultry farms.

In recent years, the incidence of avian leukemia has increased due to the lack of effective vaccines and drugs, causing significant losses to the poultry industry. At present, the ALV is clinically detected mainly by methods such as virus isolation and identification, Polymerase Chain Reaction (PCR), enzyme-linked immunosorbent assay (ELISA), indirect immunofluorescence assay (IFA), real-time fluorescent quantitative PCR, RT-LAMP and the like, but the method has the disadvantages of complex operation, time and labor waste, poor sensitivity and easy generation of false positive, and the method is difficult to rapidly carry out early diagnosis.

Disclosure of Invention

Based on the above, the invention provides triple PCR detection primers for avian leukosis virus A/B/J subgroup and application thereof, so as to solve the technical problems of complex operation, time and labor waste, poor sensitivity and easy generation of false positive in the existing avian leukosis virus A/B/J subgroup detection technology.

The technical scheme of the invention is as follows: triple PCR detection primers for avian leukosis virus subgroup A/B/J, wherein the detection primers comprise primers for detecting avian leukosis virus A, B and subgroup J respectively,

the detection primers of the avian leukemia virus subgroup A are as follows:

the upstream primer F1: AGCCGGGGAACCTTTGGATTACAT

The downstream primer R1: TCCGCAACACCCACTGACATTACC

The detection primers of the avian leukemia virus subgroup B are as follows:

the upstream primer F2: TCCTGGCGGCCCTGAGAACA

The downstream primer R2: CCGCAACATCCGCTGACATTACC

The avian leukemia virus subgroup J detection primers are as follows:

the upstream primer F3: ATAAGACGGGCCGAACAGATTTTT

The downstream primer R3: CGCCCCACCAGTCCCATTA, respectively;

the primers are shown in SEQ ID NO.1, 2, 3, 4, 5 and 6.

The invention also provides application of the triple PCR detection primer of avian leukosis virus A/B/J subgroup in avian leukosis virus detection.

Optionally, the application includes the following steps:

(1) separating virus and extracting genome;

(2) performing multiplex PCR reaction;

(3) and (6) judging a result.

Optionally, the reaction conditions for performing the amplification reaction by PCR are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 45s, and extension at 72 deg.C for 2min for 35 cycles; further extension was carried out at 72 ℃ for 10 min.

Optionally, the concentration of the detection primer of the avian leukosis virus subgroup A is 0.6 mu mol/L, the concentration of the detection primer of the avian leukosis virus subgroup B is 0.3 mu mol/L, and the concentration of the detection primer of the avian leukosis virus subgroup J is 0.5 mu mol/L.

Optionally, the result determination method is as follows: if 761bp segments are amplified, judging that the avian leukosis virus subgroup A exists; if the 579bp fragment is amplified, judging that the avian leukemia virus subgroup B exists; if the 353bp fragment is amplified, the avian leukemia virus subgroup J is judged to exist.

The invention adopts the multiple PCR detection technology which is developed on the basis of the common PCR technology, multiple PCR can add a plurality of pairs of primers in the same system, can simultaneously amplify a plurality of target genes, has the advantages of the traditional method, can simultaneously detect a plurality of pathogens on the same sample, and can achieve the aim of synchronous diagnosis.

The invention has the beneficial effects that: the triple PCR method established by the invention can simultaneously detect three subgroups ALV A and B, J, the clinical test detection result of the method is consistent with the single RT-PCR detection result, and the method has the advantages of simple operation, cost saving, high specificity and good stability, and can provide important technical support for clinically and rapidly identifying the subgroups ALV A and B, J.

According to the invention, 3 pairs of specific primers are designed and synthesized according to gp85 genes of ALV A and B, J subgroup prototype strains, the expected amplified fragments are 761bp, 579bp and 353bp respectively, the length difference of each fragment is more than 150bp, and the resolution on agarose gel electrophoresis can be improved. In addition, the invention continuously optimizes the parameters of the multiplex PCR reaction, and finally determines the optimal annealing temperature to be 58 ℃; the optimal primer concentration combination is ALV A0.6 mu mol/L, ALV B0.3 mu mol/L and ALV J0.5 mu mol/L; the lowest detected amounts of ALV A and B, J subset plasmids were 11.7pg, 1.17pg and 11.7fg, respectively.

Drawings

In FIG. 1, from left to right, ALV A (A), B (B), J (C) single RT-PCR results are shown, wherein M DL5000 DNA Marker, 1 corresponds to ALV A and B, J positive disease material; -a negative control;

FIG. 2 shows the result of PCR identification of the ALV A clone bacteria, in which M DL2000 DNA Marker is shown; 1-4ALV A clone bacterial liquid;

FIG. 3 shows the result of PCR identification of ALV B clone bacterial liquid, in which M DL2000 DNA Marker is shown; 1-5ALV B clone bacterial liquid;

FIG. 4 shows the results of PCR identification of the ALV J clone bacterial liquid, in which M DL2000 DNA Marke, 1-5ALV J clone bacterial liquid;

FIG. 5 shows the result of annealing temperature optimization, in which M DL5000 DNA Marker; the annealing temperature of 1-7 is 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃, 60 ℃ and 61 ℃ in sequence;

FIG. 6 shows the results of primer concentration optimization, in which M DL5000 DNA Marker, 1-7 correspond to different primer concentration combinations in Table 2, respectively;

FIG. 7 shows the results of specificity tests, in which M DL5000 DNA Marker, 1ALV A + B + J; 2ALV A; 3ALV B; 4ALV J; -a negative control; 5 IBDV; 6 NDV; 7 AIV; 8 MDV; 9 FAdv;

FIG. 8 shows the results of sensitivity tests, in which M DL5000 DNA Marker, 1ALV A/B/J plasmid 117 ng; 11.7ng of 2ALV A/B/J plasmid; 1.17ng of 3ALV A/B/J plasmid; 4ALV A/B/J plasmid 117 pg; 11.7pg of the 5ALV A/B/J plasmid; 6ALV A/B/J plasmid 1.17 pg; 7ALV A/B/J plasmid 117 fg; 8ALV A/B/J plasmid 11.7 fg; -a negative control;

FIG. 9 shows the results of a reproducibility test, in which M DL5000 DNA Marker, 1ALV A + B + J; 2ALV A + B; 3ALV B + J; 4ALV A + J; 5ALV A; 6ALV B; 7ALV J;

FIG. 10 shows the result of single-plex RT-PCR of subgroup A of suspected AL nucleic acids, in which M DL2000 DNA Marker, 1-5 are 5 suspected AL pathogenic nucleic acids, respectively; + a positive control; -a negative control;

FIG. 11 shows the result of single-plex RT-PCR of subgroup B of suspected AL nucleic acids, in which M DL2000 DNA Marker, 1-5 are 5 suspected AL pathogenic nucleic acids, respectively; + a positive control; -a negative control;

FIG. 12 shows the single RT-PCR results of suspected AL nucleic acid subgroup J, in which M DL2000 DNA Marker, 1-5 are 5 suspected AL pathogenic nucleic acids, respectively; + a positive control; -a negative control;

FIG. 13 shows the triple RT-PCR results of suspected AL nucleic acid subgroup A/B/J, in which M DL2000 DNA Marker, 1-5 are 5 suspected AL nucleic acids, respectively; + a positive control; negative control.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

1 materials and methods

1.1 sources of disease and Strain

ALV A and B, J subgroup positive samples and Infectious Bursal Disease Virus (IBDV), Marek's Disease Virus (MDV) and avian adenovirus (FAdv) are stored in the preventive veterinary medicine laboratory of Guizhou university; 5 suspected AL disease materials used in clinical tests are sourced from a certain farm in Tian river pool of Guizhou province; avian Influenza Virus (AIV) and Newcastle Disease Virus (NDV) are positive samples in universal RT-PCR detection kits for AIV and NDV (genealogical henne biotechnology).

1.2 Primary reagents

The virus genome RNA extraction kit is purchased from Tiangen Biotechnology (Beijing) Co., Ltd; HiFi-Script cDNA first strand synthesis kit, 2 × Es Taq DNA Mix purchased from Kangkang is century Biotechnology Co., Ltd; the plasmid miniprep kit was purchased from Tiangen Biochemical technology (Beijing) Ltd; an agarose gel DNA recovery kit, a pMD19-T vector and a DL5000 DNA Marker are purchased from Takara bioengineering (Dalian) Co., Ltd; coli DH 5. alpha. competent cells were purchased from Biyuntian.

1.3 detection primers

3 pairs of specific primers were designed by referring to gp85 gene of ALV A, B, J subgroup prototype strain in GenBank database, and the information of the primers is shown in Table 1.

TABLE 1 primer information

The primers are respectively shown in SEQ ID NO.1, 2, 3, 4, 5 and 6

1.4 Positive sample preparation

1.4.1 multiplex RT-PCR detection and product identification

Total RNA was extracted according to the viral genome RNA extraction kit, and reverse-transcribed into cDNA which was stored in a freezer at-20 ℃. Separately, the reverse transcribed cDNA was used as a template for single PCR amplification. The total volume was 50 μ L: 2.5 μ L of each of the upstream and downstream primers, 25 μ L of 2 XEs Taq DNA Mix, 5 μ L of template nucleic acid, and 15 μ L of ddH2O 15. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 1min, annealing at 59 deg.C for 45s, and extension at 72 deg.C for 2min for 35 cycles; further extension was carried out at 72 ℃ for 10 min. After the reaction is finished, detecting the RT-PCR product by adopting 1 percent agarose gel electrophoresis, and taking the target gene adhesive tape to send the sequencing to the company of bioengineering (Shanghai) GmbH.

1.4.2 construction of recombinant plasmids

Recovering a target fragment from the glue, connecting the target fragment to a pMD-19T vector, selecting a single bacterial colony to be cultured in an LB liquid culture medium containing Amp overnight for 12h, taking a clone bacterial liquid to perform PCR identification, carrying out sequencing on a reaction system and a procedure which are the same as 1.4.1 by a biological engineering (Shanghai) corporation, extracting a plasmid of bacterial liquid with correct sequencing, and diluting the concentration of the plasmid to the same order of magnitude.

1.5 establishment of multiplex PCR method and Condition optimization

1.5.1 annealing temperature optimization

The ALV A and B, J three-subgroup plasmid concentration is 117 ng/. mu.L after being diluted to the same equivalent, and the annealing temperature is optimized by taking the concentration as a template. The reaction system is 50 μ L: 2 XEs Taq DNA Mix 25. mu.L, three primer pairs each having a final concentration of 0.4. mu. mol/L, mixed template 3. mu.L, ddH₂O16 mu L; the annealing temperature was set to 7 gradients, 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃, 60 ℃ and 61 ℃, respectively, in order to select the optimal annealing temperature for multiplex PCR.

1.5.2 primer concentration optimization

The reaction system is 50 μ L: 2 XEs Taq DNA Mix 25. mu.L, Mix template 3. mu.L, set 7 different primer concentration combinations to optimize the primer concentration of multiplex PCR, ddH₂The amount of O varied with the amount of primer, and the primer concentration combinations are shown in Table 2.

TABLE 2 primer concentration combinations

1.5.3 specificity test

Detecting ALV A + B + J mixed plasmid template, ALV A, ALV B, ALV J, IBDV, NDV, AIV, MDV and FAdv nucleic acid template by an optimized multiplex PCR method, and identifying the specificity of the method.

1.5.4 susceptibility test

The 3 plasmid templates extracted at 1.4.2 are respectively diluted by 10 times gradient, and are respectively 1 × 100 and 1 × 10¹、1×10²、1×10³、1×10⁴、1×10⁵、1×10⁶、1×10⁷8 dilutions, each dilution taking 1 μ L plasmid respectively and mixing uniformly as a multiplex PCR template, and amplifying by using optimized multiplex PCR to detect the sensitivity of the method.

1.5.5 repeatability test

And (3) carrying out repeated tests on the plasmid samples of ALV A + B + J, ALV A + B, ALV B + J, ALV A, ALV B and ALV J by applying the established multiplex PCR method so as to identify the repeatability of the method.

1.6 preliminary application of multiplex PCR method

Extracting 5 parts of total RNA of suspected AL pathological materials according to a virus genome RNA extraction kit, reversely transcribing the total RNA into cDNA, and storing the cDNA in a refrigerator at the temperature of 20 ℃ below zero. And respectively taking the reverse transcribed cDNA as a template to carry out single-fold and multiple RT-PCR amplification, and verifying the positive coincidence rate of the multiple PCR detection method established by the invention. The reaction system and procedure of the single RT-PCR are the same as those of 1.4.1, and the optimized reaction system and procedure of the multiple RT-PCR are used.

2 results

2.1 Single plex RT-PCR detection

The single RT-PCR result of the positive pathological material shows that specific amplification bands (figure 1A, B, C) appear in 3 subgroups, and the sequencing result shows that the ALV A is 761bp long, the ALV B is 579bp long, and the ALV J is 353bp long, and the ALV J is consistent with the size of an expected amplification fragment. The sequencing result BLAST comparison analysis shows that the homology between the gene and the reference gene is more than 98%.

2.2 construction of recombinant plasmids

The PCR identification results of the clone bacteria liquid of ALV A and B, J are shown in FIGS. 2-4, and specific amplification bands appear in the three subgroups, and the sizes of the specific amplification bands are consistent with those of expected amplification fragments.

2.3 annealing temperature optimization

The optimized result is shown in FIG. 5, which shows that the 3 subgroups of bands are more specific and uniform at an annealing temperature of 58 ℃, and thus, the optimal annealing temperature can be determined to be 58 ℃.

2.4 primer concentration optimization

The test is provided with 7 groups of different primer concentration combinations for optimization, the result is shown in figure 6, and the optimal primer concentration combinations are ALV A0.6 mu mol/L, ALV B0.3 mu mol/L and ALV J0.5 mu mol/L.

2.5 specificity test

The multiplex PCR method established by the invention has specific amplification on ALV A + B + J mixed plasmid templates, ALV A, ALV B and ALV J plasmid templates, and has no specific amplification on IBDV, NDV, AIV, MDV and FAdv, which indicates that the multiplex PCR method has better specificity (figure 7).

2.6 sensitivity test

Under the optimized multiplex PCR conditions, the minimum detection amount of the ALV A subgroup plasmid, the minimum detection amount of the ALV B subgroup plasmid and the ALV J subgroup plasmid by the multiplex PCR are respectively 11.7pg, 1.17pg and 11.7fg (figure 8).

2.7 repeatability test

The results of the repetitive experiments show that the plasmid templates of ALV A + B + J, ALV A + B, ALV B + J, ALV A, ALV B and ALV J can amplify target bands with the same size as expected, which indicates that the multiplex PCR method of the invention has good repeatability (FIG. 9).

2.8 preliminary application of multiplex PCR method

The results of the single-fold and multiple RT-PCR of 5 suspected AL pathological materials are respectively shown in FIGS. 10-13, and as can be seen from FIGS. 10-12, only J subgroup of the single-fold RT-PCR shows a specific amplification band, the size of the specific amplification band is consistent with that of the expected amplification fragment, and the positive rate of the J subgroup is 100% (5/5); as can be seen from FIG. 13, only the J subgroup of the triple RT-PCR shows a specific amplification band, the size of the triple RT-PCR is consistent with that of the expected amplification fragment, the positive rate is 100% (5/5), and the triple RT-PCR result is consistent with that of the single ALV J subgroup, so that the ALV A and B, J subgroup triple detection method established by the invention is proved to have certain clinical practicability.

Nucleotide sequence table:

SEQUENCE LISTING

sequence listing

<110> Guizhou university

<120> triple PCR detection primer for avian leukosis virus A/B/J subgroup and application thereof

<160> 6

<210> 1

<211> DNA

<212> 24

<213> Artificial sequence

<400> 1

AGCCGGGGAA CCTTTGGATT ACAT 24

<210> 2

<211> DNA

<212> 466

<213> Artificial sequence

<400>2

TCCGCAACAC CCACTGACAT TACC 24

<210> 3

<211> DNA

<212> 20

<213> Artificial sequence

<400>3

TCCTGGCGGC CCTGAGAACA 20

<210> 4

<211> DNA

<212> 23

<213> Artificial sequence

<400>4

CCGCAACATC CGCTGACATT ACC 23

<210>5

<211> DNA

<212> 24

<213> Artificial sequence

<400>5

ATAAGACGGG CCGAACAGAT TTTT 24

<210>6

<211> DNA

<212> 19

<213> Artificial sequence

<400>6

CGCCCCACCA GTCCCATTA 19

Claims

1. Triple PCR detection primers for avian leukosis virus subgroup A/B/J are characterized by comprising primers for detecting avian leukosis virus A, B and subgroup J respectively, wherein the primer for detecting avian leukosis virus subgroup A is as follows:

the upstream primer F1: AGCCGGGGAACCTTTGGATTACAT

The downstream primer R1: TCCGCAACACCCACTGACATTACC

The detection primers of the avian leukemia virus subgroup B are as follows:

the upstream primer F2: TCCTGGCGGCCCTGAGAACA

The downstream primer R2: CCGCAACATCCGCTGACATTACC

The avian leukemia virus subgroup J detection primers are as follows:

the upstream primer F3: ATAAGACGGGCCGAACAGATTTTT

The downstream primer R3: CGCCCCACCAGTCCCATTA, respectively;

the primers are shown in SEQ ID NO.1, 2, 3, 4, 5 and 6.

2. The avian leukosis virus A/B/J subgroup triple PCR detection primer as claimed in claim 1, and its application in avian leukosis virus detection.

3. Use according to claim 2, characterized in that it comprises the following steps:

(1) separating virus and extracting genome;

(2) performing multiplex PCR reaction;

(3) and (6) judging a result.

4. The use according to claim 3, wherein the PCR is carried out under the following conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 45s, and extension at 72 deg.C for 2min for 35 cycles; further extension was carried out at 72 ℃ for 10 min.

5. The use according to claim 3, wherein the concentration of primers for detection of avian leukosis virus subgroup A is 0.6 μmol/L, the concentration of primers for detection of avian leukosis virus subgroup B is 0.3 μmol/L, and the concentration of primers for detection of avian leukosis virus subgroup J is 0.5 μmol/L.

6. The application of claim 3, wherein the result determination means is: if 761bp segments are amplified, judging that the avian leukosis virus subgroup A exists; if the 579bp fragment is amplified, judging that the avian leukemia virus subgroup B exists; if the 353bp fragment is amplified, the avian leukemia virus subgroup J is judged to exist.