WO2001005988A1

WO2001005988A1 - Live recombinant vaccine against avian leukosis virus using a marek's disease virus (mdv) virus as vector

Info

Publication number: WO2001005988A1
Application number: PCT/EP2000/007469
Authority: WO
Inventors: Michel Joseph Marie Bublot; Jill Taylor; Aly Fadly; Eugene Smith
Original assignee: Merial Select, Inc; Agricultural Research Service
Priority date: 1999-07-16
Filing date: 2000-07-17
Publication date: 2001-01-25
Also published as: AU6698900A

Abstract

Disclosed and claimed are recombinants or vectors including at least one nucleotide sequence encoding an immunogen or epitope or epitopic region thereof of avian leukosis virus of subgroup J, such as a recombinant MDV; for instance, a recombinant HVT. The recombinant or vector can express the immunogen, epitope or epitopic region; and, the immunogen can be the Env glycoprotein (gp85 and gp37) and/or the gag/pol proteins. The nucleotide sequence can be in the BamHI I or M fragment of the HVT genome; for instance in one of intergenic zones 1, 2, and 3 or in ORF UL55 or in ORF UL43. The nucleotide sequence can be under the control of a promoter such as a CMV-IE promoter. The recombinant can include at least one additional nucleotide sequence coding for an immunogen or epitope or epitopic region thereof of another avian leukosis of subgroup J and/or another avian pathogen. The recombinant can also include a nucleotide sequence encoding an immunomodulator such as an avian cytokine. Immunogenic, immunological or vaccine compositions containing inventive recombinants, as well as methods for immunizing fowl or for inducing an immunological response in birds, are also disclosed and claimed; and, kits for preparing such compositions are also envisioned.

Description

LIVE RECOMBINANT VACCINE AGAINST AVIAN LEUKOSIS VIRUS USING A MAREK'S DISEASE VIRUS (MDV) VIRUS AS VECTOR

FTFTD OF THE INVENTION The present invention relates to a vector formed by a non- virulent, for example attenuated, MDV virus, for instance of serotype 2, or preferably serotype 3 termed HVT (herpes virus of turkey), which vector comprises, in order to be able to express.them in vivo, one or more nucleotide sequences from avian leukosis virus subgroup J which encode an antigenic polypeptide, more preferably the complete Env glycoprotein and/or the Gag/Pol proteins. Another subject of the invention is an immunogenic composition and a vaccine against avian leukosis virus subgroup J which comprises this recombinant vector, and an immunization or vaccination method for birds.

Various documents are cited in the following text, and various documents are referenced or cited in documents cited in the following text There is no admission that any of these documents are indeed prior aπ as to the present invention. All documents cited herein and all documents referenced or cited in documents cited herein are hereby incorporated herein by reference. BACKGROUND OF THE INVENTION

The avian leukosis viruses (ALV) are retroviruses which lead to economically detrimental diseases causing myeioid myelocyte leukoses (myelocytomatoses), nephromas and other rapidly growing tumours in the infected birds.

Extensive polymorphism exists amongst the ALV viruses, which ailows these viruses to be classified into several subgroups.

The antigenic variations between the ALV viruses of the different subgroups are located in the Env glycoproteins. The precursor of the Env glycoprotein has a molecular mass of approximately 112 kDa, undergoes a maturation process which comprises glycosylation and cleavage into two fragments of 85 kDa and 37 kDa. In the Env glycoprotein, these two fragments are bonded to each other by disulphide bridges; these two fragments are termed SU subunit (85 kDa surface glycoprotein, or gp85) and TM subunit (37 kDa transmembrane glycoprotein, or gp37) (Hunter, in Retroviruses, ed. J, M. Coffin, S. H. Hugues and H. Varmus, Cold Spring Harbor Laboratory Press, N.Y.). Most of these antigenic variations are located in the central region of the sequence encoding glycoprotein gp85, of which involvement in the recognition of host ceU receptors is known and which is the target of neutralizing antibodies. (Bai et al., J. Virol. 1995, 69, 779-784); Venugopal et al, J. Gen. Virol. 1998, 79, 757-766; Bova et al, J. Virol. 1988, 62, 75-83; Bova et al, Virology 1986, 152, 343-354; Valsesia-Wittmann et al, J. Virol. 1994, 68, 4609-4619). . ^•

In fact, there are 10 subgroups of ALV viruses.

The ALV viruses isolated in chickens are classified into five subgroups which are identified by A to E. The viruses of subgroups A and B are exogenous pathogenic agen_ts which are encountered very frequently on the soil (Calnek, Avian Disease 1968, 12, 104-11 1; Okazaki e^l al, Avian Disease 1982, 26, 553-559), those of subgroups C and D are rarer exogenous pathogenic agen^ts (Morgan, Proc. Soα Exp. Biol. Med. 1973-, 144, 1-4: Sandelin & Estola, Avian Pat ol. 1974, 3, 159-168), and those of subgroup E comprise the ubiquitous endogenous leukosis viruses, which are weakly pathogenic (Smith, in Avian Leukosis 1987, 101-120, edited by G. F. De Boer Boston; Martinus Nijhoff).

Those ALV viruses which are classified into the other subgroups (identified as F to I) were isolated from other bird species such as pheasants, partridges, quails (Hanafusa et al, Proc. Nat. Acad. Sci. USA 1976, 73, 1333-1337; Troesch & Vogt, Virology 1985, 143, 595-602). The ALV viruses of subgroup J are exogenous pathogens which have recen_tly been isolated from broiler chickens. They are the cause of a large number of leukoses in these animals. Nucleotide sequence analyses of a large number of ALV- J strains have demonstrated _that the sequence encoding glycoprotein gp85 only shows a homology of 40% with those encoding the gp85 glycoproteins of the ALV viruses of subgroups A to E, while the latter show a homology of 85% when compared with each other (Bai et al, J. Gen. Virol. 1995, 76, 181-187; Benson et al, J. Virol. 1998, 72, 10157-10164; Smith et al, J. Gen. Virol. 1999, 80, 261-268). The ALV viruses exist all around the world and a large number of rearing establishments are affected. These viruses are transmitted not only vertically from the female to the egg, but also horizontally from one individual to another.

The eradication of this disease only seems possible with the aid of an effective vaccine against the horizontal transmission of this virus.

Certain recombinant vaccines have already been proposed for vaccinating poultry against avian leukosis virus.

These recombinant bird vaccines comprise heterologous genes, in particular, the gene encoding the complete Env glycoprotein (gp85 and gp37) of Rous-associated virus 1 or RAV-1, which is an avian leukosis virus of subgroup A, inserted into a vector prepared from an avian erythroblastosis virus, or AEV, the Env glycoprotein expressed by the host cell subsequently being produced by this cell (Chebloune et al, 1991, J. Virol, 65, 5374-5380). A recombinant fowlpox virus which expresses the gene encoding the complete Env glycoprotein (gp85 and gp37) of Schmidt-Ruppin avian sarcoma virus (ALV of subgroup A) has also been proposed (Nazerian and Yanagida, 1995, Avian Disease 39, 514-520). hen used for vaccination purposes, these recombinant viruses induce protection against a homologous infection caused by viruses of the same subgroup as the virus from which the inserts are derived. However, these recombinant viruses induce only partial protection (40%) against heterologous infection, caused by viruses which belong to a different subgroup. The recombinant viruses which have already been proposed can therefore not be used for vaccinating chickens against diseases caused by ALV-J viruses.

Like with many retroviruses, the viral populations amongst one and the same subgroup are not homogeneous, and different ALV-J virus strains exist.

Thus, antibodies against strain HPRS-103 of the ALV-J virus (Payne et al, J. Gen. Virol. 1991, 72,^' 801-807) do not allow neutralization of strain Hc-1 (Benson et al, J. Virol. 1998, 72, 10301-10304), just like the neutralization of 10 to 12 other recent soil isolates of the ALV-J virus. The choice of strain is fundamental for preparing a vaccine capable of protecting chickens against the highest possible number of ALV-J virus strains. Strains and genes which are termed immunologically dominant must preferably be used.

The traditional eradication methods which have been developed for controlling the ALV-A and ALV-B viruses, in particular the recombinant bird vaccines described above cannot be applied directly and simply to the control of the ALV-J virus.

Prior to the present invention, the only means of controlling the ALV-J virus was to diagnose its presence in chicken rearing establishments and to eliminate the affected chickens. This approach has failed on a number of occasions due to the speed at which the disease spreads horizontally from undetected carriers. OBJECTS AND SUMMARY OF THE INVENTION

It was an object to provide the protection of the bird population against ALV-J viruses and to control the diseases caused by these viruses by means of a recombinant vaccine.

Another object of the invention is to provide a vector^", advantageously a recombinant viral vector, preferably a recombinant viral vector suitable for use in birds, comprising and expressing at least one heterologous nucleotide sequence encoding at least one ALV-J immunogen, advantageously, from a dominant strain, that is to say one which is capable of developing neutralizing antibodies which have a neutralizing potential against the original strain and against other ALV-J strains.

Another object of the invention is to provide such a viral vector which expresses a sequence of such a dominant strain so as to induce at least partial protection against other ALV-J virus strains.

Yet another object of the invention is to provide such a vector, e.g., viral vector, which allows at least partial immunization against other ALV subgroups.

The applicant has successfully inserted a heterologous nucleotide sequence encoding an ALV-J immunogen into a viral vector of persistent viraemia and successfully expressed .this immunogen in vivo. An embodiment of the present invention is thus a vector prepared from a non-virulent MDV virus, for example of serotype 2 or 3, preferably serotype 3 or HVT, in which there is inserted at least one heterologous sequence encoding an immunogen (selected in preferably from the Env glycoprotein and/or the Gag/Pol proteins) of the avian leukosis virus of subgroup J, more preferably the sequence encoding the complete Env glycoprotein (gp85 and/or gp37) or the sequences encoding the complete Env glycoprotein and the Gag/Pol proteins. The invention is interned to cover also by equivalence and comprehends the use of immunologically active fragmen^ts of Env, e.g. gp85 or gp37, and/or of gag/pol, e.g. gag orpol (and, from documents cited herein, no undue experimentation is required to determine an epitope or epitopic region of Env, gag or pol; see, e.g., USSNs 08/675,556 and 08/675,566). It must be noted that the sequences encoding the Gag and Pol proteins are located within the same reading frame in the avian leukosis virus genome.

The virus used as vector is preferably the HVT virus, advantageously strain FC126. The nucleotide sequence encoding the complete Env glycoprotein is preferably obtained from the ALV-J virus strain He- 1 (which sequence has been deposited at the GenB ank database_, under reference number AF097731 - SJ. Benson et al, J. Virol. 1998, 72, 10157-10164). The Env sequence of this strain Hc-1 is the preferred base unit for realizing a vector for _the purposes of immunizing or vaccinating bird species against ALV-J.

Other strains are R5-4 (S.J. Benson et al, J. Virol. 1998, 72, 10157-10164), HPRS-103 and XI, X2, X3, X4, X5, X6, XI, X8, X9, XI 0, XI 1, X12 according to Veπugopal et al, J. Gen. Virol. 1998, 79 757-766.

Preference is given to adding the nucleotide sequence encoding the Gag/Pol proteins which originate from the same strain or from^'a^" different strain, indeed from several strains, in such a way as to increase the immune response, against the same and/or other strains of the ALV-J virus.

The nucleotide sequence encoding the Gag/Pol proteins has been amplified by PCR after allowing reverse transcriptase to act on the RNA extracted from viral particles (supernatant of cells infected with strain Hc-1 of the ALV-J virus) and then cloned. The Gag/Pol proteins are proteins which are relatively well conserved between one ALV-subgroup and another. The entire nucleotide sequence of strain HPRS-103 of the ALV-J virus has been published and deposited at the GenBank database under reference number Z46390. In accordance with the invention, a plurality of nucleotide sequences encoding complete

Env glycoproteins which originate from different ALV-J strains may also bέ inserted into the vector.

In two preferred embodiments of the invention, the insertion into HVT is performed either into the BamHI I fragment(FR-A-2 728 795 or corresponding Australian application No. AU-A-40715/95 or corresponding allowed US application Serial Number 578,096 filed 26

December 1995, all incorporated herein by reference), or into the BamHI M fragment (see, e.g., U.S. Patent No. 5,733,554, incorporated herein by reference).

The BamHI I restriction fragment of HVT comprises a plurality of open reading frames (ORFs) and three intergenic regions and, by way of insertion region according to the invention, a plurality of preferred insertion zones, that is to say the three intergenic regions 1, 2 and 3, which are the most preferred, and ORF UL55.

The BamHI M restriction fragment of HVT comprises ORF UL43 (US-A-5,733,554), which is also a preferred insertion site for the expression cassettes.

The term insertion into the insertion region is to be understood an insertion with total or partial deletion or without deletion. However, it is preferred in the case of the intergenic zones to have an insertion without deletion or with deletion of some bases.

This construction is noteworthy because the MDV vector, e.g. HVT, leads to systemic infection and persistent viraemia. Continuous expression of the heterologous nucleotide sequence inserted into this vector induces a strong, rapid and durable immune response which can overcome any immune tolerances which may be present. The vector according to the present invention can be used for in ovo vaccinations of poultry, such as chickens, and thus allows an effective control of avian leukoses, such as those caused by the viruses of subgroup ALV-J. The replication of the MDV vector, e.g. HVT, is not affected by the presence of antibodies of maternal origin and allows early protection (in ovo vaccination). The MDV vector, e.g. the recombinant HVT, allows the simultaneous induction of a humoral immune response and a cellular immune response. An MDV vector, e.g. HVT vector, which incorporates and expresses only the complete

Env glycoprotein of the avian leukosis virus (HVT-Env) will not induce the production of antibodies against the Gag/Pol proteins of the avian leukosis virus in the vaccinated animal; this characteristic can thus be used for developing methods for differentiating between animals which are infected with the pathogenic avian leukosis virus (presence of antibodies against the Gag/Pol proteins) and the animals which have been vaccinated with this HVT-Env vector (absence of antibodies against the Gag/Pol proteins).

Naturally, it is possible, within the scope of the present invention, to insert more than one heteroloεous nucleotide sequence into the same recombinant viral vector, for instance, heterologous sequences originating from the same ALV-J virus, from the ALV-J viruses of different viral strains, from different ALV subgroups, from different viruses, such as, for example and in a non-limiting manner, the virus of Newcastle disease (NDV), the virus of Gumboro disease (TBDV), the virus of infectious bronchitis (LBV), or of other pathogens such as, for example, Escherichia coli, Mycoplasma, Haemophilus, Paste rella, etc.

The heterologous sequences which can be inserted are sequences which encode immunogens or immunologically active immunogen fragments, e.g. epitopes, such as genes or gene fragments (e.g. epitopes) encoding immunogens of bird pathogens. Sequences encoding rmmunomodulators, such as bird cytokines, for instance, those from chickens such as interleukin 1 (TL-1), 2 (IL-2), 6 (IL-6), 8 (IL-8), 15 (IL-Ϊ5), gam a-interferon or cMGF (chicken myelomonocyτic growth factor), may also be inserted. A plurality of multiple insertion strategies have been tested, for example, the use of a double expression cassette in the opposite orientation, or the use of a double expression cassette having the same orientation, or else a multiple expression cassette with an "IRES" (Internal Ribosome Entry Site) element located between each insert (Patent EP-A1-0803573).

The heterologous sequence or sequences are inserted under the control of transcription regulator signals or signals, such as a promoter or promoters, preferably provided at the time of insertion. However, expressing these heterologous sequences under the control of signal(s) or promoter(s) intrinsic to the herpes virus, which acts as a vector, is not excluded by the present invention.

Among the promoters which can be used, preference is given to using strong promoters such as the 1.8 RNA promoter of Marek's disease virus, the gB protein promoter of Marek's disease virus, the early cytomegalovirus promoter, or CMV-IE (Cytomegalovirus Immediate

Early), in particular of human origin (hCMV-IE), from rats, from guinea pigs or preferably from mice (mCMV-IE), or the SV40 virus early promoter (Simian Virus 40). A subfragment of these promoters which retains the same promoter activity comes within the scope of the present invention, for example the truncated CMV-IE promoters in accordance with WO-A-98/00166. Another object of the present invention are immunogenic or immunological compositions or preparations and vaccines comprising the recombinant virus according to the invention in a vehicle or excipient which is acceptable for veterinary purposes and, if appropriate, an adjuvant. Another object of the present invention are multivalent immunogenic or immunological compositions or preparations and vaccines comprising a herpes virus vector according to the invention having at least one insert encoding an ALV-J virus immunogen and at least one insert encoding an immunogen or an immunologically active immunogen fragment which originates from another bird pathogen.

Another object of the present invention is a multivalent vaccine or immunological or immunogenic formulation comprising, as a mixture or to' be mixed, at least two bird vaccines of which one is the recombinant live vaccine according to the invention. Another object of the present invention is a method of vaccinating or inducing an immunological response in birds such as chickens against the diseases caused by the ALV viruses or caused by the ALV viruses and by one or more other bird pathogens.

A further object of the present invention to provide a method of vaccinating or inducing an immunological response in birds or chickens against diseases caused by the ALV-J viruses or caused by the ALV-J viruses and by one or more other bird pathogens.

Tnese methods comprise, administering a recombinant live vaccine, a multivalent vaccine or a multivalent vaccine formulation according to the invention.

In an aspect, the invention relates to the in-ovo vaccination or immunization of or administration to embryos, such as embryos which are approximately 17-18 days old; or one or more days old chicks, and/or adults, advantageously by the intramuscular or subcutaneous route. These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description. BRIEF DESCRIPTION OF THE FIGURES

The following Detailed Description, given by way of example, and not intended to limit the invention to specific embodiments described, may be understood in conjunction with the accompanying Figures, incorporated herein by reference, in which: Figure 1 shows the restriction map of plasmid Pcd046;

Figure 2 shows the restriction map of plasmid Pmawl24: b F iigguurree J 3 shows the restriction map of plasmid Pjt033; Figure 4 shows the restriction map of plasmid Pjt036; Figure 5 shows the restriction map of plasmid Pjt031 ; Figure 6 shows the restriction map of plasmid Pjt034; Figure 7 shows the restriction map of plasmid Pjt035;

J Fb iigguurree a 8 shows the restriction map of plasmid Pjt037; Figure 9 shows the restriction map of plasmid Pjt039;

Figure 10 shows the restriction map of plasmid Pjt040; Figure 11 shows the restriction map of plasmid Pjt032; Figure 12 shows the restriction map of plasmid Pjt041 ; and, Figure 13 shows the restriction map of plasmid Pjt042. DETAILED DESCRIPTION The invention provides an expression vector prepared from a non- irulent virus of

Marek's disease, comprising a heterologous nucleotide sequence encoding and expressing an immunogen or an epitope or epitopic region of an immunogen of avian leukosis virus of subgroup J. Thus, the invention provides a recombinant non-virulent Marek's disease virus comprising a heterologous nucleic acid molecule encoding an immunogen or an epitope or an epitopic region of avian leukosis virus of subgroup J, wherein the immunogen or epitope or epitopic region thereof is expressed by the Marek's dieasε virus.

The virus of Marek's disease can be the herpes virus of turkey (HVT). The heterologous nucleotide sequence or nucleic acid molecule can encode the complete Env glycoprotein (gp85 and gp37) of an avian leukosis virus of subgroup J and/or the gag pol proteins of an avian leukosis virus of subgroup J: or an^' epitope or epitopic region of the Env glycoprotein and/or of the gag/pol proteins. For instance, the vector or recombinant Marek's disease virus can comprise a first heterologous nucleotide sequence or nucleic acid molecule encoding the complete Env glycoprotein (gp85 and gp37) of an avian leukosis virus of subgroup J or an epitope or epitopic region thereof and a second nucleotide sequence or nucleic acid molecule encoding the gag/pol proteins of an avian leukosis virus of subgroup J or an epitope or epitopic regions thereof. The vector or recombinant Marek's disease virus (MDV) can comprises a first heterologous nucleotide sequence or nucleic acid molecule encoding an immugen or an epitope or epitopic region of an immunogen of a first avian leukosis virus of subgroup J and a second heterologous nucleotide sequence or nucleic acid molecule encoding an immugen or an epitope or an epitopic region of an immunogen of a second avian leukosis virus of subgroup J. For instance, the vector or recombinant MDV can comprise a first heterologous nucleotide sequence or nucleic acid molecule encoding the complete Env glycoprotein (gp85 and gp37) of a first avian leukosis virus of subgroup J or an epitope or epitopic region thereof and/or the gag/pol proteins or an epitope or epitopic region thereof of a first avian leukosis virus of subgroup J and a second heterologous nucleotide sequence or nucleic acid molecule encoding the complete Env glycoprotein (gp85 and gp37) of a second avian leukosis virus of subgroup J or an epitope or epitopic region thereof and/or the gag/pol proteins or an epitope or epitopic region thereof of a second avian leukosis virus of subgroup J; e.g., a recombinant MDV comprising a first heterologous nucleic acid molecule encoding the complete Env glycoprotein (gp85 and gp87) of a first avian leukosis virus of subgroup J or an epitope or epitopic region thereof and a second heterologous nucleic acid molecule encoding the complete Env glycoprotein (gp85 and gp87) of a second avian leukosis virus of subgroup J or an epitope or epitopic region thereof.

The heterologous nucleotide sequence or nucleic acid molecule can be in the BamHI I fragment of the HVT genome and/or in the BamHI M fragment of the HVT genome; for instance, in one of the intergenic zones 1, 2 and 3 or in the ORF UL55 of the BamHI I fragment and/or in the ORF UL43 of the BamHI M fragment. In the inventive vector or recombinant MDV, the heterologous sequence is advantageously under the control of a promoter selected from the group consisting of the 1.8 RNA promoter of the virus of Marek's disease, the protein gB promoter of the virus of Marek's disease, the early cytomegalovirus promoter (e.g., CMV-IE promoter such as HCMV-IE or MCMV-IE), the SV40 promoter, and subfragments of these promoters which retain a promoter activity; for instance, the mouse early cytomegalovirus promoter (e.g., mCMV-IE promoter) or one of its subfragments which retains a promoter activity (see, e.g., .Fischer, U.S. applications Serial Nos. 08/675,556 and 08/675,566, both filed July 3, 1996, and U.S. Patents Nos. 4,963,481, 4,968,615 and 5,168,062; and, see also the Fischer applications with respect to methods for determining an epitope or epitopic region). The inventive vector or recombinant non- virulent MDV can comprise a first heterologous nucleotide sequence or nucleic acid molecule encoding an immunogen or epitope or epitopic region thereof of avian leukosis virus of subgroup J and a second nucleotide sequence or nucleic

π acid molecule encoding an immunogen or epitope or epitopic region thereof of a bird pathogen other than avian leukosis virus subgroup J, wherein the first and second nucleotide sequences or nucleic acid molecules are expressed by the vector or recombinant MDV. The second nucleotide sequence or nucleic acid molecule can be heterologous to MDV, e.g., encoding an immunogen or epitope or. epitopic region thereof of a bird pathogen selected from the group consisting of Newcastle disease virus, Gumboro disease virus, infectious bronchitis virus, Escherichia coli, Mycoplasma, Haemophilus, Pasteurella.

The inventive vector or recombinant MDV can additionally comprise a nucleotide sequence or nucleic acid molecule which encodes an immunomodulator; for instance, an avian ^' cytokine.

The invention also comprehends an immunogenic, immunological or vaccine preparation, advantageously for birds, which comprises an inventive vector or recombinant MDV and a pharmaceutically acceptable excipient. An immunological composition elicits an immunological response - local or systemic. The response can, but need not be, protective. An immunogenic composition hkewise elicits a local or systemic immunological response which can, but need not be, protective. A vaccine composition elicits a local or systemic protective response. Accordingly, the terms "immunological composition" and "immunogenic composition" include a "vaccine composition" (as the two former terms can be protective compositions). Immunogenic, immunological or vaccine compositions can contain excipients, vehicles and the like which are customary in the veterinary arts; and, the skilled artisan can select a suitable excipient or vehicle without any undue experimentation from this disclosure, the documents cited herein and documents referenced or cited in documents cited herein and the knowledge in the art. Also, immunogenic, immunological or vaccine compositions can optionally contain an adjuvant - a substance that increases the immunogenicity of the expressed immunogen or epitopic region or fragment thereof. Such adjuvants are also customary in the veterinary arts; and, the skilled artisan can select a suitable adjuvant or adjuvants without any undue experimentation from this disclosure, the documents cited herein and documents referenced or cited in documents cited herein and the knowledge in the art.

The invention yet further comprehends a multivalent vaccine, immunogenic, or immunological composition which comprises, as a mixture or to be mixed, at least two vaccine, immunogenic or immunological compositions, wherein at least one of which is an inventive vaccine, immunological or immunogenic composition (advantageously at least one of which is also a vaccine, immunogenic or immunological composition against another avian pathogen).

The invention still further provides a method of immunizing birds against diseases caused by avian leukosis viruses of subgroup J or a method for inducing an immunolgical response in a bird against an avian leukosis virus of subgroup J, which method comprises administering to the birds or bird an inventive vector or an inventive vaccine, immunogenic or immunological composition. The adminis^tration of the vector or of the vaccine, immunogenic or immunological composition can be carried out by a route selected from the intramuscular and _the subcutaneous routes for chicks and for adults; or, the administering can be to embryos in ovo. ^τhe vaccine, immunogenic or immunological compositions or preparations and the recombinants according to the invention are preferably presented at 10³ to 10⁶ PFU/dose.

Furthermore, since the invention comprehends a multivalent vaccine, immunogenic, or immunological composition which comprises to be mixed, at least two vaccine, immunogenic or immunological compositions, wherein at least one of which is an inventive vaccine_, immunological or immunogenic composition, the invention also involves ki_ts. That is. the invention comprehends a kit for preparing a vaccine composition comprising an inventive recombinant in one container and excipients, vehicle and the like (e.g., optional adjuvant) in a second container, wherein the first and second^' containers can be separately packaged_, or packaged together as a unit: and, optionally including instructions for admixing and/or administration. Alternatively or additionally, the invention comprehends a kit for preparing a multivalent vaccine, immunological or immunogenic composition comprising an inventive vaccine, immunological or immunogenic composition (comprising an inventive recombinan_t or vector) in at least one first container and at least one second vaccine, immunological or immunogenic composition in at least one second container. The first and second containers can be separately packaged or packaged together as a unit; and, the kit can also optionally include instructions for adrrixing and/or administration.

Also, instead of or in addition to emplo ing a recombinant or vector that expresses the immunogen or epitope or epitopic region thereof, inventive compositions and methods can employ ^the immunogen or epitope or epitopic region thereof isolated from in vitro expression thereof; advantageously by in vitro expression thereof by a vector or recombinant such as an inventive vector or recombinant That is, the invention can comprehend products expressed by inventive recombinants or vec^tors. These products, in addition to being useful for eliciting an immunological or pro^tective response, can be used by themselves in test ki_ts or diagnostic applications; e.g., to elic^it antibodies such as monoclonal antibodies, useful in immunoassays, tests or kits or in diagnostic applications.

Fur^ther, an inventive composition can comprise the in vitro expressed immunogen or epitope or epi^topic region thereof, either alone, or in combination wi_th an inventive vec_tor or recombinan^t, or in combination with another immunogen or epitope or epitopic region thereof of an avian pa^thogen and or in combination with a vector or recombinant expressing such another immunogen or epi^topic region or epitope thereof. The amount of in vivo expressed immunogen or epi^topic region or epitope thereof present in such a composition is advantageously analogous to the amoun^t ob^tained from when an inventive vector or recombinant is presen_ted in vivo at 10³ to 10⁶ PFU/dose; and thus, no undue experimentation is needed to prepare composi_tions containing an in vi^tro expressed immunogen or epitope or epitopic region thereof. And, the invention likewise also comprehends methods for eliciting an immunological or protective response comprising administering compositions containing an in vivo expressed immunogen or epitope or epitopic region thereof.

Fur^ther still, the mvention comprehends a kit for preparing a vaccine composition comprising an in vivo expressed immunogen or epitope or epitopic region thereof, e.g., from in vitro expression by an inventive recombinant or vector, in one container and excipients, vehicle and the like (e.g., optional adjuvant) in a second container, wherein the first and second containers can be separately packaged or packaged together as a unit; and, optionally including instructions for admixing and/or administration. ^■ Without wishing to necessarily be bound by any one particular theory, it is believed _that the Hc-1 strain can be dominant and that by using an immunogen therefrom or an epitope or epitopic region thereof, e.g., by having a recombinant or vector express in vivo an immunogen or an epitope or epitopic region thereof from the Hc-1 strain or by administering an in vivo expressed immunogen or an epitope or epitopic region thereof from the Hc-1 strain, that cross- protection can be obtained. Thus, the invention can provide cross-protection: and, the invention comprehends vectors, recombinants, compositions and methods for eUciting cross-protection. The invention will be further described in greater detail with reference to embodiments given by way of example in a non-limiting manner by the following non-limiting Examples.

SEQUENCES SEQ ID sequence listing for the constructions according to the present invention SEQ ID NO. 1 oligonucleotide TAY205

SEQ LO NO. 2 oligonucleotide TAY206

SEQ ED NO. 3 oligonucleotide TAY207

SEQ LO NO. 4 oligonucleotide TAY208 SEQ DD NO. 5 oligonucleotide TAY209

SEQ ID NO. 6 oligonucleotide TAY210

EXAMPLES All the plasmid constructions were carried out using the standard techniques of molecular biology described by Sambrook J. et al (Molecular Cloning: A Laboratory Manual, 2^nd Edition, Cold Spring Harbor Laboratory, .Cold Spring Harbor, New York, 1989). All the restriction fragments used for the present invention as well as the various fragments for polymerase chain amplification (= PCA or PCR) were Isolated and purified using the "Geneciean®" (BIOIOI Inc. La Jolla, CA) kit.

The virus used as parent virus is strain FC126 of turkey herpes virus (HVT), which has been isolated by Dr Witter, Regional Poultry Research Laboratory (USDA, East Lansing, Michigan) in a flock of 23-week-old turkeys (Witter R.L. et al, Am. J. Vet. Res. 1970. 31, 525- 538). The culture conditions of this virus are as described elsewhere (U.S-A-5 266 489). Example 1: DNA preparation from the ALV-J virus

Primary chicken embryo fibroblasts of "line 0" (Astrin S.M. et al, Nature 1979, 282, 339-341) were infected either with strain Hc-1 of the ALV-J virus (Benson S. et al, J. Virol. 1998, 72, 10301-10304) or with strain HPRS-103 (Payne L. et al., 3. Gen. Virol, 1991, 72, 801-807). After 7 days' culture at ÷37°C, the culture medium was discarded and the infected cells were harvested by scraping. The total DNA of the infected cells was extracted by the technique described by R Morgan et al (Avian Diseases, 1990, 34, 345-351) and was used for chain polymerase amplification reactions (CPA or PCR). Example 2: Preparation of genomic DNA of the HVT virus for transfection experiments The viral DNA used for the transfection experiments was prepared by the method described by R. Morgan et al (Avian Diseases, 1990, 34, 345-351) from a secondary Chicken Embryo Fibroblasts CEF infected with strain FC126 of the HVT virus.

Example 3: Construction of donor plasmid pMAW124, and isolation of the recombinant virus vHVT021

A PCR was performed using the following oligonucleotides: TAY205 (25 mer) (SEQ ID NO. 1)

5'GATCCATGGAAGCGGTCATAAAGGC3' and TAY206 (29 mer) (SEQ ID NO. 2) 5 CGACCTACAGCTGCTCCCTAATTCTATG3 ' and the complementary genomic DNA of the ALV-J virus strain Hc-1 (Benson S. et al, J. Virol, 1998, 72, 10301-10304), prepared as in Example 1, in order to produce a PCR fragment of 1716 base pairs (bp) containing the env gene. This fragment was made "blunt-ended" by treatment wi^th Klenow polymerase (fragment A). Plasmid pEL091 (see Example 9 of Patent Application FR-A1 -2728795) was digested with Notl in order to isolate the 6579 bp Notl-Notl fragment, following agarose gel electrophoresis. This fragment was subsequently ligated with itself to εive plasmid pCD046 (Figure 1). Plasmid pCD046 was subsequently digested with Notl, then made "blunt-ended" with trea^tment with Klenow polymerase and then dephosphorylated (fragment B). Fragmen^ts A and B were then ligated together to give the 8300 bp plasmid pMAWl24-(Figure 2). The sequence of the ALV-J gene env which had been cloned into this plasmid was established. It was found to be identical to the sequence of the env gene of ALV-J strain Hc-1, which is deposited at the GenBank sequence database (reference No. AF097731).

Plasmid pMAW124 allows the mCMV-IE/ALV-J env expression cassette to be inserted into the intergenic site 1 of the HVT virus.

A co-transfection which has been carried out as described in Example 8 of Application FR-A1-2728795 using plasmid pMAW124 (made linear with Xmnl) and genomic DNA from the HVT virus has led to the isolation and purification of the recombinant virus vHVT021. Example 4: Construction of the donor plasmids pJT035 and pJT037

The gag^/pol gene of the ALV-J virus was obtained by a PCR reaction with _the following oligo-nucleotides: TAY207 (52 mer) (SEQ ID NO. 3) 5'GACGTAGGATCGATGCGGCCGCACCATGGAAGCCGTCATAAAGGTGATTTC G3' and TAY208 (52 mer) (SEQ ID NO. 4)

5'CGGTCGAAGGGCCCGCGGCCGCCTATAAATTTGTCAAGCGGAGCCCTAGGC C3' and the complementary genomic DNA of the ALV-J virus strain HPRS-103, prepared as in

Example 1, to produce a 2.0 kbp PCR fragment. This fragment was cloned directly into the vector pCR2.1 TA (Cat # K2000-01, InVitrogen Carlsbad, CA 92008) to give plasmid pJT033 (6043 bp) (Figure 3). The sequence of the gag/pol gene cloned into this plasmid was established. This sequence is identical to the sequence deposited at the GenBank database under the reference number Z46390. Plasmid pJT033 was digested with Notl to isolate the 2118 bp Notl-Notl fragment containing the gag/pol gene (fragment A). Plasmid pEL091 (see Example 3) was digested with Notl to isolate the 6.6 kbp Notl-Notl fragment, following agarose gel electrophoresis. This fragment was made "blunt-ended" by treatment with Klenow polymerase (fragment B). Fragments A and B were then ligated together to give plasmid pJT036 (8693 bp)

(Figure 4).

Plasmid pCD046 (Example 3) was digested with Pad and EcoRI to isolate the 5480 bp PacI-EcoRI fragment after agarose gel electrophoresis. This fragment was treated with Klenow polymerase to make it "blunt-ended" and was then ligated with itself to give plasmid pJT031 (5480 bp) (Figure 5). This plasmid contains a short version of the mCMV-IE promoter, which has a deletion of 1099 bp compared with the normal size of the mCMV-IE promoter cloned into plasmid pCD046. This short version contains 315 bp, which control transcription of the downstream genes.

Plasmid pJT031 (above) was digested with Notl and made "blunt-ended" by treatment wi_th Klenow polymerase (= fragment C). Fragments A and C were then ligated together to give plasmid pJT034 (7597 bp) (Figure 6). To obtain a donor plasmid which contains each of the two genes (env and gag/pol) under the control of the "short" mCMV-IE promoter, plasmid pMAW124 (Example 3) was digested with Pad and partially digested with BamHI to isolate the 2044 bp PacI-BamHI fragment (env gene linked to the short version of the mCMV-IE promoter). This fragment was made "blunt-ended" by treatment with Klenow polymerase (= fragment D). Plasmid pJT034 (above) was digested with Sail and then made "blunt-ended" by treatment with Klenow polymerase (= fragment E). Fragments D and E were then ligated together to give plasmid pJT035 (9647 bp), which contains the insert short mCMV-IE/ALV-J env in the correct orientation (Figure 7). This plasmid allows the insertion of short mCMV-IE/ ALV-J env and short mCMV-IE/ALV-J gagpol into the intergenic region 1 of the HVT virus. To obtain a donor plasmid which contains each of the two genes (env and gag/pol) under the control of the normal-sized mCMV-IE promoter, plasmid pMAW124 (Example 3) was digested with BamHI to isolate the 3131 bp BamHI-BamHI fragment. This fragment was made "blunt-ended" by treatment with Klenow polymerase (= fragment F). Plasmid pJT036 (above) was digested with Sail and then made "blunt-ended" by treatment with Klenow polymerase (= fragment G). Fragments F and G were then ligated together to give plasmid pJT037 (11835 bp), which contains the insert mCMV-IE/ALV-J env in the correct orientation (Figure 8). This plasmid permits the cassettes mCMV-IE/ALV-J env and mCMV-IE/ALV-J gag/pol to be inserted into the intergenic region 1 of the HVT virus. 0 Example 5: Construction of donor plasmids pJT041 and pJT042

Plasmid pJT033 (Example 4) was digested with Apal and Clal to isolate the 2132 bp Apal-Clal fragment. This fragment was ligated with vector pBS-SK+(Cat#212205 Stratagene Inc. La Jolla CA 92037), which had previously been digested with Apal and Clal, to give plasmid pJT039 (5068 bp) (Figure 9). The SV40 promoter was obtained by a PCR reaction 5 carried out with the following oligόnucleotides: TAY209 (41 mer) (SEQ ID NO. 5):

5'GACTGCAGACTAGTGCTGTGGAATGTGTGTCAGTTAGGGTG3' and TAY210 (48 mer) (SEQ ID NO. 6):

5'GTCAGCGCATCGATAGCTTTTTGCAAAAGCCTAGGCCTCCAAAAA GC3' 0 and the matrix of plasmid pSV^β (Cat # 6178-1 Clontech, Palo Alto, CA 94303) to produce a 360 bp PCR fragment. This fragment was digested with Spel and Clal and ligated with plasmid pJT039 (above) which had previously been digested with Spel and Clal, to give plasmid pJT040 (5377 bp) (Figure 10).

To construct a plasmid which contains a double expression cassette for the env and gag/pol genes, plasmid pJT040 was digested with Xb^'al and Asp7181 to isolate the 2494 bp Xbal-A≤p7181 fragment which contains the SV40 promoter linked to the gag/pol gene. This fragment was made "blunt-ended" by treatment with Klenow polymerase (= fragment A). Plasmid pMAW124 (Example 3) was digested with Pad and EcoRI to isolate the 7201 bp PacI-EcoRI fragment after agarose gel electrophoresis. This fragment was made "blunt- ended" by treatment with Klenow polymerase and then ligated with itself to give plasmid pJT032 (7201 bp) (Figure 11). Plasmid pJT032 (above) was digested with Kspl and made "blunt-ended" by treatment with Klenow polymerase (= fragment D). Fragments A and D were ligated together to give plasmid pJT041 (9701 bp) (Figure 12). This plasmid contains the env gene under the control of the "short" mCMV-TE promoter and the gag/pol gene under the control of the SV40 promoter, in the correct orientation. Plasmid pMAW124 (Example 4) was digested with Kspl and made "blunt-ended" by treatment with Klenow polymerase (fragment E). Fragments A and E were ligated toge_ther to give plasmid pJT042 (10,800 bp) (Figure 13). This plasmid contains the env gene under _the control of the normal-sized mCMV-IE promoter and the gag/pol gene under the control of the SV40 promoter, in the correct orientation. Example 6: Construction of the donor plasmids pJTOSl and pJT052

Plasmid pMAW124 (Example 3) was digested with EcoRI and Sail to isolate the 3354 bp EcoRI-Sall fragment after agarose gel electrophoresis (which contains the expression cassette long (normal sized) mCMV-r£ promoter/ ALV-J eπv-polyA). This fragment was made "blunt- ended" by treatment with Klenow polymerase (= fragment A). Plasmid pEL078 (Example 6 of the Application FR-A1-2728795) was digested with

EcoRI, made "blunt-ended" by treatment with Klenow polymerase and dephosphorylated (= fragment B).

Plasmid pEL066 (Example 7 of the Application FR-A1 -2728795) was digested with Hindiπ, made "blunt-ended" by treatment with Klenow polymerase, and dephosphorylated (= fragment C). Fragments A and B were ligated together to give plasmid pJT051 (7940 bp). This plasmid allows the expression cassette mCMV-IE/ALV-J env to be inserted into the intergenic region 2 of the HVT virus.

Fragments A and C were ligated together to give plasmid pJT052 (8140 bp). This plasmid allows the expression cassette mCMV-IE/ALV-J env to be inserted into the intergenic region 3 of the HVT virus. Example 7: Construction of the donor plasmids pJT053 and pJT054

Plasmid pMA 124 (Example 3) was digested with EcoRI and with Sail to isolate the 3354 bp EcoRI-Sall fragment after agarose gel electrophoresis (fragment A). Plasmid pJT036 ^' (Example 4) was digested with Sail and partially digested with EcoRI to isolate the 3747 bp EcoRJ-Sall fragment after agarose gel electrophoresis (fragment B).

Plasmid pEL078 (Example 6 of the Application FR-A1-2728795) was digested with EcoRI and dephosphorylated (= fragment C).

Fragments A, B and C were then ligated together to give plasmid pJT053 (1 1,690 bp). Tnis plasmid allows the double expression cassette mCMV -TE/env and mCMV -ΪE/gag/pol to be inserted into the intergenic region 2 of the HVT virus.

Plasmid pEL066 (Example 7 of the Application FR-A1 -2728795) was digested wi_th EcoRI and dephosphorylated (= fragment D).

Fragments A, B and D were then ligated together to give plasmid pJT054 (11,890 bp). This plasmid allows the insertion of the double expression cassette CMV-JEJenv and mCMV-IE/gag/pol into the intergenic region 3 of the HVT virus. Example 8: Construction of the donor plasmids pJTu55 and pJT05ό

Plasmid pJT053 (Example 7) was digested with Pad to isolate the 4700 bp Pad-Pad fragment. This fragment was made "blunt-ended" by treatment with Klenow polymerase (= fragment A). Plasmid pEL078 (Example 6. of the Application FR-A1 -2728795) was digested with EcoRI, made "blunt-ended" by treatment with Klenow polymerase, and dephosphorylated (= fragment B).

Plasmid pEL066 (Example 7 of the Application FR-A1 -2728795) was digested with EcoRI, made "blunt-ended" by treatment with Klenow polymerase, and dephosphorylated (= fragment C).

Fragments A and B were ligated together to give plasmid pJT055 (9290 bp). This plasmid dlows the double expression cassette short mCMV-IE/ALV-J env and short mCMV-IE/ALV-J gag/pol to be inserted into the intergenic region 2 of the HVT virus. Fragments A and C were ligated together to give plasmid pJT056 (9490 bp). This plasmid dlows the double expression cassette short mCMV-IE/ALV-J env and short mCMV-IE/ALV-J gag/pol to be inserted into the intergenic region 3 of the HVT virus. Example 9: Construction of the donor plasmid pJT05"-

Plasmid pMAW124 (Example 3) was digested with EcoRI and with Sail to isolate the 3354 bp EcoRI-Sall fragment, after agarose gel electrophoresis (fragment A).

Plasmid pEL043 (Example 9 of the Patent US-A-5733554) was digested with EcoRI_. and Sail to isolate the 4670 bp EcoRI-Sdl fragment after agarose gel electrophoresis (fragment B).

Fragments A and B were ligated together to give plasmid pJT057 (8020 bp). This plasmid dlows the expression cassette mCMV-IE/ALV-J env to be inserted into the UL43 site of the HVT virus.

Example 10: Construction of the donor plasmid pJT058

Plasmid pJT053 (Example 7) was digested with EcoRI to isolate the 7100 bp EcoRI- EcoRI fragment (fragment A).

Plasmid pEL043 (Example 9 of the Patent US-A-5733554) was digested with EcoRI and Sail to isolate the 4670 bp EcoRI-Sdl fragment after agarose gel electrophoresis. This fragment was made "blunt-ended" by treatment with Klenow polymerase, and dephosphorylated (fragment B). Fragments A and B were ligated together to give plasmid pJT058 (11,770 bp). This plasmid dlows the double expression cassette mCMV-IE/ALV-J e/nVmCMV-IE/ALV-J gag/pol to be inserted into the UL43 site of the HVT virus. Example 11: Construction of the donor plasmid pJT052 Plasmid pJT053 (Example 7) was digested with Pad to isolate the 4700 bp Pad-Pad fragment This fragment was made "blunt-ended" by treatment with Klenow polymerase (fragment A).

Plasmid pEL043 (Example 9 of the Patent US-A-5733554) was digested with EcoRI and Sail to isolate the 4670 bp EcoRI-Sdl fragment, after agarose gel electrophoresis. This fragment was made "blunt-ended" by treatment with Klenow polymerase, and dephosphorylated (fragment B).

Fragments A and B were ligated together to give plasmid pJT059 (9370 bp). This plasmid dlows the double expression cassette short mCMV-IE/ALV-J env/short mCMV-D≡/ALV-J gag/pol to be inserted into the UL43 site of the HVT virus. Example 12: Isolation of the recombinant viruses vHVT030 and vHVT031

Co-transfections with the plasmids of Example 4 and the genomic DNA of the HVT virus are carried out as described in Example 8 of the Application FR-A1-2728795.

Co-transfection with plasmid pJT035 (made linear with Xmnl) allowed the virus vHVT030 to be generated. Co-transfection with plasmid pJT037 (made linear with Xnml) dlowed the virus vHVT031 to be generated. Example 13: Isolation of the recombinant viruses vHVT032 and vHVT033

Co-transfections with the plasmids of Example 5 and the genomic DNA of the HVT virus are carried out as described in Example 8 of the Application FR-A1-2728795. Co-transfection with plasmid p JT041 (made linear with Xmnl) dlowed the virus vHVT032 to be generated. Co-transfection with plasmid. pJT042 (made linear with Xmnl) allowed the virus vHVT033 to be generated.

Example 14: Preparation of vaccines according to the invention

The recombinant viruses according to the invention are amplified in roller flasks by successive passages in secondary chicken embryo fibroblast culture. In general, 3 to 4 passages are required to obtain one batch of vaccine. The virus is harvested when the cytopathogenic effect is complete and frozen immediately in the presence of a cryopreservative, in particular chosen from the various 7% strength dimethyl sulphoxide (DMSO) compositions avdlable. The virus can dso be lyophilized. In this case, the harvested virus is divided between flasks in the presence of a lyophilization substrate, in particular SPGA (EP-B 1-0008255), so as to have a find titre of between 10³ and 10⁶ pfu per dose.

The vaccines according to the invention can be administered to chickens by _the subcutaneous or intra-mus lar route. These vaccines can dso -be administered in ovo to embryos, such as 18-day-old embryos. * * *

Naturdly, the inven^tion defined by the appended claims is not limited to the particular embodiments given in the description hereinabove, but encompasses variants which are within the scope and spirit of the present invention.

Claims

WHAT IS CLAIMED IS:

1. Expression vector prepared from a non- virulent virus of Marek's disease, comprising a heterologous nucleotide sequence encoding and expressing an immunogen of avian leukosis virus of subgroup J.

2. Vector according to Claim 1 , in which the virus of Marek's disease is the herpes virus of turkey HVT.

3. Vector according to Cldm 1, which comprises a heterologous nucleotide sequence encoding the complete Env glycoprotein (gp85 and gp37) of an avian leukosis virus of subgroup

J.

4. Vector according to Claim 1 , which comprises a heterologous nucleotide sequence encoding the gag/pol proteins of an avian leukosis virus of subgroup J.

5. Vector according to Claim 3, which comprises a second heterologous nucleotide sequence, which sequence encodes the gag/pol proteins of an- ALV-J virus of avian leukosis of subgroup J.

6: Vector according to Claim 3, which comprises another heterologous nucleotide sequence which encodes the complete Env glycoprotein (gp85 and gp37) of another avian leukosis virus of subgroup J.

7. Vector according to Claim 2, in which insertion is made in the BamHI I fragment of the HVT genome.

8. Vector according to Claim 2, in which insertion is made in the BamHI M fragment of the HVT genome.

9. Vector according to Cldm 7, in which the insertion is made in one of the intergenic zones 1, 2 and 3 or in the ORF UL55 of the BamHI I fragment.

10. Vector according to Claim 8, in which the insertion is made in the ORF UL43 of the , BamHI M fragment.

11. Vector according to Claim 1 , in which the heterologous sequence is under the control of a promoter selected from the group consisting of the 1.8 RNA promoter of the virus of Marek's disease, the protein gB promoter of the virus of Marek's disease, the early cytomegdo virus promoter, the SV40 promoter, and the subfragments of these promoters which retdn a promoter activity.

12. Vector according to Claim 11 , in which the promoter is the mouse early cytomegdovirus promoter or one of its subfragments which retains a promoter activity.

13. Vector according to Cldm 1 , in which a heterologous nucleotide sequence encodin_g and expressing an immunogen of avian leukosis virus of subgroup J and an insert encoding and expressing an immunogen of a bird pathogen other than avian leukosis virus subgroup J is inserted.

14. Vector according to Claim 13, which comprises an insert encoding or expressing an immunogen of a bird pathogen selected from the group consisting of Newcastle disease virus, Gumboro disease virus, infectious bronchitis virus, Escherichia coli, Mycoplasma, Haemophilus, Pa∑teurella.

15. Vector according to Claim 1 , which additiondly comprises a sequence which encodes an immunomoddator.

16. Vector according to Claim 15, wherein the immunomoddator is an avian cytokin.

17. Immunogemc preparation for birds, which comprises a vector according to any one of Claims 1 to 16 and a pharmaceutically acceptable excipient.

18. Live recombinant vaccine for birds, which comprises a vector according to any one of Claims 1 to 16 and a pharmaceutically acceptable excipient.

19. Multivalent vaccine which comprises, as a mixture or to be mixed, two vaccines one of which is the recombinant live vaccine as defined in Claim 18.

20. Method of immunizing birds against diseases caused by avian leukosis viruses of subgroup J, which method comprises the administration of a preparation according to Claim 17.

21. Method of immunizing birds against diseases caused by avian leukosis viruses of subgroup J, which method comprises the administration of the recombinant live vaccine according to Claim 18 or of the mdtivdent vaccine according to Claim 19.

22. Immunization method according to Claim 21, in which administration is carried out by a route selected from the intramuscular and the subcutaneous routes for chicks and for adults.

23. Immunization method according to Claim 21 , which consists in vaccinating embryos in ovo.