WO2019204457A1 - Zinc finger protein compositions for modulation of huntingtin (htt) - Google Patents
Zinc finger protein compositions for modulation of huntingtin (htt) Download PDFInfo
- Publication number
- WO2019204457A1 WO2019204457A1 PCT/US2019/027891 US2019027891W WO2019204457A1 WO 2019204457 A1 WO2019204457 A1 WO 2019204457A1 US 2019027891 W US2019027891 W US 2019027891W WO 2019204457 A1 WO2019204457 A1 WO 2019204457A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- zfp
- htt
- seq
- allele
- cag
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
- C07K2319/81—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14171—Demonstrated in vivo effect
Definitions
- the present disclosure is in the field of diagnostics and therapeutics for
- Huntington’s Disease also known as Huntington’s Chorea
- Hie mean age of onset for this disease is age 35-44 years, although in about 10% of cases, onset occurs prior to age 21, and the average lifespan post-diagnosis of the disease is 15-18 years. Prevalence is about 3 to 7 among 100,000 people of western European descent.
- Huntington’s Disease is an example of a trinucleotide repeat expansion disorders were first characterized in the early 1990s (see Di Prospero and Fischbeck (2005) Nature Reviews Genetics 6:756-765).
- Trinucleotide repeats can be located m any part of the gene, including non- coding and coding gene regions. Repeats located within the coding regions typically involve either a repeated glutamine encoding triplet (CAG) or an alanine encoding triplet (CGA). Expanded repeat regions within non-coding sequences can lead to aberrant expression of the gene while expanded repeats within coding regions (also known as codon reiteration disorders) may cause mis-folding and protein aggregation.
- CAG repeated glutamine encoding triplet
- CGA alanine encoding triplet
- Alleles containing 36-39 repeats are considered incompletely penetrant, and those individuals harboring those alleles may or may not develop the disease (or may develop symptoms later in life) while alleles containing 40 repeats or more are considered completely penetrant. In fact, no asymptomatic persons containing HD alleles with 40 or more repeats have been reported. Those individuals with juvenile onset HD ( ⁇ 21 years of age) are often found to have 60 or more CAG repeats.
- HD can involve +1 and +2 frame shifts within the repeat sequences such that the region will encode a poly-serine polypeptide (encoded by AGC repeats the case of a + 1 frame shift) track rather than poly-glutamine (Davies and Rubinsztein (2006) Journal of Medical Genetics 43:893-896).
- the mutant Htt allele is usually inherited from one parent as a dominant trait. Any child bom of a HD patient has a 50% chance of developing the disease if the other parent was not afflicted with the disorder. In some cases, a parent may have an intermediate HD allele and be asymptomatic while, due to repeat expansion, the child manifests the disease. In addition, the HD allele can also display a phenomenon known as anticipation wherein increasing severity or decreasing age of onset is observed over several generations due to the unstable nature of the repeat region during spermatogenesis.
- GABA medium spiny gamma-aminobutyric acid
- Other brain areas greatly affected in people with Huntington’s disease include the substantia nigra, cortical layers 3, 5, and 6, the CA1 region of the hippocampus, the angular gyrus in the parietal lobe, Purkinje cells of the cerebellum, lateral tuberal nuclei of the hypothalamus, and the cen tromedialparafascicular complex of the thalamus (Walker (2007) Lancet 369:218-228).
- Htt human Htt protein
- BDNF brain-derived neurotrophic factor
- BDNF glial cell line-derived neurotrophic factor
- AAV adeno-associated viral
- RNA interference (RNAi) and antisense oligonucleotides (ASO) targeting HTT mRN A have shown efficacy in a variety of HD preclinical models (Boudreau et al.
- Diagnostic and treatment options for HD are currently very limited.
- altered (mutant) Htt (mHTT) levels are significantly associated with disease burden score, and soluble mHTT species increase in concentration with disease progression.
- low-abundance mHTT is difficult to quantify in the patient CNS, which limi ts both study of the role in the neuropathobiology of HD in vivo, and precludes the demonstration of target engagement by HTT-lowering drugs. See, e.g . Wild et al. (2014) J Neurol Neurosurg Psychiatry 85:e4.
- mice carrying caspase-6 resistant mutant Ht were found to maintain normal neuronal function and did not develop striatal neurodegeneration as compared to mice carr ing a non- caspase resistant mutant Htt allele (see Graham et al. (2006) Cell 125: 1179-1191 ).
- Molecules which target members of the apoptotic pathway have also been shown to have a slowing effect on symptomology.
- the compounds zVAD-fmk and minocycline, both of which inhibit caspase activity have been shown to slow disease manifestation in mice.
- the drag remacemide has also been used in small HD human trials because the compound was thought to prevent the binding of the mutant Htt to the NDMA receptor to prevent the exertion of toxic effec ts on the nerve cell .
- no statistically significant improvements were observed in neuron function in these trials.
- the Huntington Study Group conducted a randomized, double-blind study using Co-enzyme Q. Although a trend towards slower disease progression among patients that were treated with coenzyme Q10 was observed, there was no significant change in the rate of decline of total functional capacity. (Di Prospero and Fischbeck, ibid).
- Recombinant transcription factors comprising the DNA binding domains from zinc finger proteins (“ZFPs”) have the ability to regulate gene expression of endogenous genes, including Htt genes. See, e.g.. U.S. Patent Nos. 9,943,565; 9,499,597; 9,234,016; and 8,841,260 and U.S. Patent Publication Nos. 2015/0335708; 2017/0096460; and 20150255877. Clinical trials using these engineered transcription factors containing zinc finger proteins have shown that these novel transcription factors are capable of treating various conditions (see, e.g., Yu et al. (2006) FASEB J. 20:479-481).
- artificial nucleases comprising ZFPs have the ability to modify gene expression of endogenous genes via nuclease-mediated modification of the gene, including either homology directed repair (HDR), following non- homoiogous end joining (NHEJ) and/or by end capture during non-homologous end joining (NHEJ) driven processes.
- HDR homology directed repair
- NHEJ non- homoiogous end joining
- NHEJ non-homologous end joining
- compositions for diagnosing and/or treating Huntington’s Disease are methods and compositions for diagnosing and/or treating Huntington’s Disease.
- ZPT protein compositions that modulate Htt expression, including selective repression of a mutant Hit gene (mHtt) expression the toxic mutant HTT (mHTT) protein.
- the compositions and methods selectively repress >99% of HD-causing alleles over an 80-fold dose range, while preserving expression of >86% of wild type alleles found in the HD population.
- Expression of other CAG-containing genes is minimally affected, and artificial transcription factor repressors as described herein are active and well tolerated in HD neurons beyond 100 days in culture and at least 9 months or more in the mouse brain.
- ZFP genetic modulators for Htt genes are described.
- the genetic modulator comprises an artificial ZFP transcription factor or zinc finger nuclease (ZFN) and functional domain
- the zinc finger proteins have the recognition helices shown any of the appended Tables or Figures.
- the ZFP-TFs are formulated into a pharmaceutical composition, for example, for administration to a subject.
- the genetic modulators described herein are ZFP repressors (artificial transcription factors or nucleases that repress Htt expression). These ZFP repressors may bind to wild-type and/or mutant Htt alleles specifically. Certain repressors bind to both wild-type and mutant Htt genes: others bind to wild- type only and still others bind to mutant Htt genes only.
- the artificial transcription factors form a stable complex of multimers of a given size, and thus are capable of preferentially interacting with a CAG tract above a certain minimum size, wherein that minimum size is greater than the length of a wild-type CAG tract
- the ZFP genetic modulators as described herein preferentially modify expression of a mutant Htt allele.
- the ZFP genetic modulator e.g., repressor
- the ZFP genetic modulator binds specifically to mutant Htt alleles wherein the expanded tract encodes poly-glutamine
- the genetic modulator binds specifically to a mutant Htt allele wherein the expansion tract encodes poly-serine.
- the ZFP genetic modulator modulates both the wild type and mutant forms of the Ht allele.
- the ZFP genetic modulator modulates only tire wild type Htt allele.
- the ZFP genetic modulator modulates only the mutant form of
- repressing modulators comprising ZFPs as described herein are provided which preferentially bind to known SNPs associated with the expanded HD Htt alleles.
- the genetic repressors are specific for mutant Htt alleles which contain the SNP, allowing for specific repression of the mutant Htt allele.
- genetic modulators specifically activate the wild- type Htt allele by interacting with SNPs associated with wild-type alleles are
- the ZFP genetic modulators comprise at least one regulator ⁇ ' domain (or functional domain).
- the functional domain can be, for example, a transcriptional activation domain, a transcriptional repression domain and/or a nuclease (cleavage) domain.
- these artificial transcription factors can be used either to activate or to repress gene expression.
- a fusion molecule comprising a ZFP DNA -binding domain targeted to a mutant Htt as described herein fused to a transcriptional repression domain that can be used to down-regulate mutant Htt. expression is provided.
- an artificial transcription factor comprising a ZFP DNA-bmding
- the activity of the regulator ⁇ ' domain is regulated by an exogenous small molecule or ligand such that interaction with the cell’s transcription machinery will not take place0 in the absence of the exogenous ligand.
- the regulator ⁇ ' (functional) domain(s) may be operatively linked to or otherwise associated with any portion) s) of one or more of the ZFP DNA-binding domains, including between one or more zinc finger domains, exterior to one or more ZFPs and5 any combination thereof. Any of the fusion proteins described herein may be
- the genetic modulators described herein comprise artificial nucleases comprising an engineered ZFP protein as described herein and a cleavage (nuclease domain).
- These artificial zinc finger nucleases0 (ZFNs) can be utilized for targeting mutant Htt alleles in stem cells such as induced pluripotent stem cells (iPSC), human embryonic stem cells (hESC), mesenchymal stem cells (MSC) or neuronal stem cells wherein the activity of the nuclease fusion will result in an Htt allele containing a wild type number of CAG repeats.
- pharmaceutical compositions comprising the modified stem cells are provided for ex vivo administration to a subject.
- a polynucleotide encoding any of the ZFP DNA binding genetic modulators (or components thereof) described herein is provided.
- Such polynucleotides can be administered to a subject in which it is desirable to treat Huntington s Disease.
- the invention provides methods and
- the model systems comprise in vitro cell lines, while in other embodiments, the model systems comprise transgenic animals.
- the animal may be, for example, a rodent (e.g., rat, mouse), a primate ⁇ e.g . non human primate) or a rabbit.
- a gene delivery vector comprising any of polynucleotides encoding ZFP modulators as described herein is provided.
- the vector is an adenovirus vector (e.g., an Ad5/F35 vector), a lentivirai vector (LV) including integration competent or integration-defective lentivirai vectors, or an adenovirus associated viral vector (AAV).
- adenovirus vector e.g., an Ad5/F35 vector
- LV lentivirai vector
- AAV adenovirus associated viral vector
- Ad vectors LV or adenovirus associate viral vectors (AAV) comprising a sequence encoding at least one genetic modulator as described herein, optionally further encoding one or more donor sequences for targeted integration into a target gene following nuclease-mediated cleavage.
- Ad vector is a chimeric Ad vector, for example an Ad5/F35 vector.
- the lentivirai vector is an integrase-defective lentivirai vector (IDLV) or an integration competent lentivirai vector.
- IDLV integrase-defective lentivirai vector
- the vector is pseudo-typed with a VS V-G envelope, or with other envelopes.
- model systems are provided for Huntington’s disease wherein the target alleles (e.g.. mutant Hit) are tagged with expression markers.
- the mutant alleles e.g., mutant Htt
- the wild type allele e.g. wild-type Htt
- both wild type and mutant alleles are tagged with separate expression markers.
- the model systems comprise in vitro cell lines, while in other embodiments, the model systems comprise transgenic animals.
- compositions comprising one or more of the genetic modulators described herein are also provided.
- certain compositions include a nucleic acid comprising a sequence that encodes a ZFP-TF as described herein in combination with a pharmaceutically acceptable carrier or diluent such that upon administration to subject, the ZFP-TF is expressed and modulates Htt expression in the subject.
- the genetic modulators encoded are specific for a HD Htt allele.
- protein ZFP- TFs may also be used in conjunction with or as an alternative to the nucleic acids encoding genetic modulators as described herein.
- an isolated cell comprising any of the ZFP genetic modulators and/or compositions as described herein .
- compositions for treating and/or preventing Huntington’s Disease using the methods and compositions described herein.
- the methods involve compositions where the polynucleotides and/or proteins may be delivered using a viral vector, a non-viral vector (e.g., plasmid) and/or combinations thereof.
- the methods involve compositions comprising stem cell populations.
- FIG. 1 A is diagram of the structure and desired behavior of allele-specific repressors of HTT.
- a designed ZFP-KRAB protein engineered to bind within the poly-CAG tract with appropriate affinity and target spacing should exhibit highly selective repression of the expanded disease allele.
- ZFP-TFs are screened for differential repression of wild type ( ⁇ 22) and disease (>39) alleles in patient cell lines bearing downstream SNPs, w'hich enable independent quantitation of allele levels using SNP-specific qRT-PCR reagents targeting rs363099, rs362331 and rs3623Q7.
- Figure IB shows 1- and 2-finger units and 1- and 2-base-spanning linkers used for assembling candidate ZFPs Alternate shadings indicate alternative designs with distinct sets of DNA-eontacting residues and binding properties. See Table 1 for sequence details.
- Figure 1C shows ZFP-TF sense- (left) and antisense-strand (right) targeted designs screened for selective repression of mHTT 1- and 2-finger modules targeting ei ther strand of the poiy-CAG tract were linked together to generate 3, 4, 5 or 6 finger ZFPs using alternative linkers to enables skipping of 0, 1 or 2 bases between adjacent fingers.
- Targeted sequences are indicated by the DNA sequence at left, middle and right.
- Figure ID show's transcript levels for norma!
- Figure IE discloses SEQ ID Nos:81 and 82, respectively, in order of appearance.
- Figure IF shows selective downregulation of mHTT (upper band of top blot) protein by ZFP-A and ZFP-B as gauged by Western blot 72 hours after transfection of GM04723 fibroblasts with 100 ng or 30 ng of ZFP or control mRNA. Wild type HTT (lower band of top blot) is undiminished. Calnexin loading control (lower blot).
- Figures 1G ( Figures 1G ( Figure IG discloses SEQ ID Nos:81 and 82, respectively, in order of appearance), II ( Figure II discloses SEQ ID Nos:79 and 80, respectively, in order of appearance) and II ( Figure II discloses SEQ ID Nos: 83 and 84, respectively, in order of appearance) show ' dose response of allele-specific repression in patient GM04723 ( Figure G), GM02151 ( Figure I), or GM30259 ( Figure J) fibroblasts. qRT-PCR for total, WT and mutant HTT was performed on RNA isolated from patient fibroblasts transfected with ZFP mRNA across a 100,000-fold dose range (1,000-0.01 ng at -half-log dose steps).
- FIG. 1H are plots showing the frequency of CAG repeat lengths in HD population.
- Figure IK depicts the activity for ZFP 45249 in the GMG2151 and GM30259 fibroblasts where the data is shown in doublets, and the bar on the right side of each doublet represents Htt expression on the expanded allele while the bar on the left side of each doublet represents Htt expression on the wild type Htt allele.
- Figure IK discloses SEQ ID Nos:79, 80, 83 and 84, respectively, in order of appearance.
- Figures 2A through 2N depict allele-selective repression, specificity and phenotypic correction in HD neurons.
- Figure 2A shows an overview timeline of studies performed using NSCs derived from GENEA020 hESCs (CAG17/48, SEQ ID NOS 76/78).
- Figure 2B show's a dose response of allele-specific repression in HD
- Figure 2B discloses SEQ ID Nos:76 and 78, respectively, in order of appearance.
- Figure 2C depicts differentiated HD neurons that were infected with AAV6-ZFP or AAV 6-GFP ( lxl 0 5 vg/cell) for 21 days.
- Figure 2C discloses SE1Q ID Nos:76 and 78, respectively, in order of appearance.
- Figure 2D discloses SEQ ID Nos:76 and 78, respectively, in order of appearance.
- Figure 2E shows GFP-sorted NSCs from Figure 2D that were differentiated into neurons. Shown is qRT-PCR data at 25 days after initiation of neuron differentiation (103 days after ientivirai infection) as in
- Figure 2E discloses SEQ ID Nos:76 and 78, respectively, in order of appearance.
- Figure 2G depicts a Venn diagram of regulated genes in Figure 2F.
- Figure 2H show's an increase in intracellular levels of ATP in neurons treated with ZFP-B. Intracellular ATP levels in HD and normal neurons were measured 21 days after lenti viral infection of either ZFP-2A-GFP or CMV-GFP.
- Figure 21 demonstrates reduced apoptosis in neurons treated with ZFP-B. Apoptosis was assessed by TIJNEL staining of neurons infected with either lenti virus encoding ZFP-2A-GFP or CMV-GFP for five days followed by 48 hours of growth factor withdrawal.
- Figure 2J is an overview of HdhQSO mouse experiment.
- Figure 2L is a regression analysis of either Q50 or Q7 and ZFP-B mRNA levels assessed by qRT-PCR. All striatal subsections are included. 95% confidence band is shown.
- two ZFP-TFs were compared: ZFP-B, and ZFP-45249. Dots depict genes regulated >2 fold as compared to no ZFP-TF treatment.
- Figure 2N depicts repression of a mHtt allele and a wild type allele in GeneA020 neurons using ZFP-45249. Also shown is repression of CPEB1 and MBD5 for these same ZFPs (see Example 5).
- Figure 2N discloses SEQ ID Nos:76 and 78, respectively, in order of appearance.
- Figures 3A through 3G depict improvements in behavioral deficits and neuroprotection in R6/2 mice.
- Figure 3A is a timeline overview of behavioral and molecular endpoints assessed in wildtype and AAV-treated R6/2 mice.
- Figures 3C and 3D show the results from open field testing for rearing frequency (3C) or total distance traveled (3D) was performed at 4 (baseline), 6, 8, 10 and 12 weeks of age on wild-type (left), ZFP-B-treated R6/2 (middle), or GFP-treated (right) R6/2 mice.
- Figure 3G is a correlation between either mHtt, DARPP32, PDE10A, DRD1A or DRD2 levels and ZFP-B mRNA levels. All striatal subsections are included. The 95% confidence band is shown.
- Figures 4A through 4T show ZFP-driven repression of inHTT knock-in HD mouse models.
- Figures 4A and 4B depict mouse or mutant HTT mRNA (Figure 4A) or soluble protein (Figure 4B) levels in zQ175 neurons 10 days after infection with AAV2/1 +2 encoding ZFP-B or ADBD T2A GFP mRNA was assessed by qRT-PCR. Protein was assessed on Singulex (mouse HTT) or MSD (mHTT) platforms.
- Figure 4C is a timeline overview showing endpoints in zQ175
- Figure 4D shows representative images of mEM48 mimunostaining in heterozygous zQ175 striata injected with AAV2/1+2 encoding ZFP-B .T2A.GFP at 2 months of age and analyzed at 4 months of age by staining for mEM48, GFP, DARPP-32 and DAPI (color not shown but as follows: HTT inclusions (mEM48): yellow, GFP: green, DARPP-32: red, DAPI: blue). Expanded GFP+ and GFP- regions are shown at right.
- Figure 4H shows data as in 4D, except for using heterozygous mice that were injected with AAV2/1+2 encoding ZFP-B.T2A.GFP at 6 months of age and analyzed at 10 months of age.
- Figures 41 and 4J show's data as in 4E and 4F, except for the 6-10 month cohort treated with AAV2/1+2 ZFP-B.
- T2A.GFP, ADBD.T2A.GFP or GFP; n 5; mean ⁇ SD.
- Figure 4K is as in 4G except for the 6-10 month cohort treated with AAV2/1+2 ZFP-B.
- Figure 4M depicts DARPP32 levels in mouse striata injected with AAV2/1+2 ZFP-B. T2A.GFP, ADBD T2A GFP or GFP at 6 months of age and analyzed at 10 months of age; n 5: mean ⁇ SD.
- Figure 4N shows representative images of GFAP and IBA 1 immumostaining in heterozygous zQl 75 striata injected with AAV2/1+2 encoding ZFP-B.T2A .GFP at 6 months of age and analyzed at 10 months of age for GFP, DAPI, GFAP and IBA 1 (color not shown as follows: GFP: green, DAPI: blue, GFAP: red, IBA1 : yellow).
- Figure 4Q shows line scans of bAP-evoked Ca2+ images were taken at proximal and distal locations within the same dendrite and used to calculate the dendritic index.
- Figure 4R shows Ca2+ transients from mice injected with AAV2/9 encoding either ZFP ⁇ D.T2A.tdTomato (zQ175, left), ADBD.T2A.tdTomato zQ175 het (zQ175, middle), or ZFP- D.T2A.tdTomato (WT litterrnate, right) at 4 months and tested at 6 months.
- Figures 5A through 5F show restoration of imaging markers by ZFP expression in the striatum of Q175 het mice.
- FIG. 5G shows the % difference in BPND of [18FJMNI-659 in the injected vs. un-injected striatum of zQ175 mice treated with AAV2/TK2 ZFP encoding ZFP-D or GFP at 6.5/7M and 10M of age (n-33-41 mice/group/timepoint). The percent difference between the right and left striatum between the two treatment groups was compared by unpaired t-test.
- Figures 6A and 6B show validation of allele-specific qRT-PCR assays.
- Figure 6A shows results using plasmid templates that were prepared that correspond to the rs63G99T (099T) and rs363099C (099C) SNPs of HTT.
- the 099T SNP is in phase with WT HTT in GM02151 CAG18/45 (SEQ ID NOS 79/80) and GMQ4723 CAG15/67HD (SEQ ID NOS 81/82) fibroblasts, while 099C is in phase with mutant HTT in the same cells.
- the plasmids were then used to prepare reciprocal serial dilutions as shown.
- the 099C template was serially diluted two-fold from 5 fg to 0.156 fg in the presence of a fixed amount (1.25 fg) of the 099T template (099C:099T from 0.125: 1 to 4: 1); and the 099T template was serially diluted two-fold from 5 fg to 0.156 fg in the presence of a fixed amount (1.25 fg) of the 099C template (099TG99C from 0.125: 1 to 4: 1).
- Serial dilutions were assembled in the presence of a fixed amount of total cDNA prepared from a third patient fibroblast line from which HTT and rnHTT expression had been depleted (see Methods in Examples). In this line, HTT and mHTT wore also in phase with
- Plasmid levels were chosen so that the qRT-PCR signal from tire 1 : 1 plasmid ratio was approximately the same as that from the HTT and mHTT cDNA from the undepleted cells.
- the 099C-specific (right bars) and 099T-specific (left bars) qRT-PCR assays were performed for each of the dilution samples. Relative quantities are plotted as a fraction of the value obtained for the sample with 1 : 1 ratio of 099T and 099C template.
- Figure 6B show's results from the plasmid templates for rs36233 IT (33 IT, in phase with WT HTT in ND30259 CAG21/38 (SEQ ID NOS 83/84) HD fibroblasts) and rs362331C (331C, in phase with mHTT in ND30259 CAG21/38 (SEQ ID NOS 83/84) HD fibroblasts) were serially diluted into cDNA made from GM21756 fibroblasts (CAG15/70 (SEQ ID NOS 81/85)) that had been transfected with a bi -allelic ZFP repressor that represses both WT and mutant HTT by >90%.
- rs36233 IT 33 IT, in phase with WT HTT in ND30259 CAG21/38 (SEQ ID NOS 83/84) HD fibroblasts
- rs362331C 331C, in phase with mHTT in ND30259 CAG21/
- the 331C template was serially diluted two-fold from 2 fg to 0.0625 fg in the presence of a fixed amount (0.5 fg) of the 33 IT template; the 33 IT template was serially diluted two-fold from 2 fg to 0.0625 fg in the presence of a fixed amount (0.5 fg) of the 331 C template.
- Figure 7A and 7B show' dose-dependent ZFP protein expression over
- Figure 7 A show's HD fibroblasts (GM04723, CAG 15/67 (SEQ ID NOS 81/82)) that were transfected with ZFP mRNA at doses of 1000, 300, 100, 30 and 10 ng per 2x10 5 cells. Five hours after transfection, cells were harvested for ZFP Western blot using an anti-FLAG antibody (Sigma FI 804).
- Figure 7B shows ZFP and GAPDH protein levels that were quantified using an Odyssey CLx imager, ZFP/GAPDH ratios for each sample was scaled to that of the 1,000 ng ZFP-C sample, which was set to 1
- Figures 8A and 8B show testing of candidate ZFP designs in Hdh Q7/Q1 1 1 striatal cells.
- Figures 8A and 8B show a comparison allele-selectivity exhibited by candidate ZFP-TF designs in the screening system used for tins study (patient fibroblasts; CAG18/45 (SEQ ID NOS 79/80)) (Figure 8B) vs mouse cells used in a prior work (cells from the STHdhQl l l/HdhQ7 mouse model; CAG 4/111 (SEQ ID NOS 86/87)) ( Figure 8A).
- Figure 9 shows testing of CAG-targeted ZFPs from Garriga-Canut et al. (2012) P roc Natl Acad Sci USA 109(45):e3136-45 in HD fibroblasts and show's a comparison of allele-selective repression m patient fibroblasts (CAG 18/45 (SEQ ID NOS 79/80)) from a prior study (ZF6 and ZF1 !, see Garriga-Canut et al (2012) Proc Natl Acad Sci USA 109(45):e3136-45».
- Figures 10A through 10D show expression of NSC and neuronal markers in differentiated CAG 17/48 (SEQ ID NOS 76/78) hESCs.
- Figure 10A show's NSC-specific PAX6 (lighter shading) and Nestm (darker shading) expression as confirmed by !HC in NSCs differentiated from CAG17/48 (SEQ ID NOS 76/78)
- FIGS. 10B show ' s expression levels for a panel of pluripotency markers (OCT4, NANOG, and REX1) or NSC markers (PAX6, SOX1 and NES) were measured by qRT-PCR in ESCs or differentiated NSCs.
- Figure IOC shows neuron-specific bIII-tubulin expression (darker shading) was confirmed by IHC in differentiated CAG17/48 (SEQ ID NOS 76/78) neurons (DAPI, lighter shading).
- Figure 10D show's expression levels for a panel of neuronal markers (MAP2, GAD! and FOXG1) or NSC markers (PAX 6. SOX! and NES) that were measured by qRT-PCR from CAG 17/48 (SEQ ID NOS 76/78) NSCs or differentiated neurons.
- Figures 11A through HD show' ZFP specificity assessment in HD fibroblasts.
- Figure 11A show's fold change m gene expression with the mdicatd ZFP- TFs. Each dot represents the fold change in transcript level (x-axis) and p-value (y ⁇ axis) for a single gene m cells treated with the indicated ZFP compared to control- treated cells. Genes regulated >2 -fold with a p-value ⁇ 0.01 are shown.
- Figure 1 IB shows fold repression of the indicated gene.
- Figure 1 IB discloses SEQ ID Nos:79 and 80, respectively, in order of appearance.
- Figure 11C show ' s percent normalized expression of the indicated genes.
- Figure 1 I D depicts a V enn diagram of regulated genes in Figure 11C. See, Examples text for further description.
- Figures 12A and 12B are graphs showing confirmation of allele- selective FITT repression in samples used for microarray studies. Allele-specific qRT-PCR analysis was performed to confirm regulation of mHTT in RNA samples (6 biological replicates per treatment) that were subject to microarray analysis for GENEA020 neurons (shown in Figure 12A (SEQ ID Nos:76 and 78, respectively, in order of appearance); corresponding to Figures 2F and 2G) and GM02151 fibroblasts (show'll in Figure 12B (SEQ ID NOS 79 and 80, respectively, in order of appearance); corresponding to Figure 11 A). Allele specific qPCR was w'as analyzed as in Figure 2B (GENEA020 Neurons) and Figure II (GM0215 I fibroblasts).
- Figures 13A through 13C show R6/2 mouse study body weight and additional behavioral data for wild-type (‘R62 _WT”) subjects and subjects treated with GFP transgenes (“R62_Tg GFP”) or ZFP-TF 33074 (“R62_Tg 33074”).
- Figure 13 A are graphs depicting body weight at the indicated week. Separate graphs for gender combined, male and female subjects are shown.
- Figure 13B me graphs depicting fall times under the indicated conditions. Separate graphs for gender combined, male and female subjects are shown.
- Figure 13C are graphs depicting normalized ratio of forelimb grip strength: body weight at the indicated week. See, also, Examples text for further description.
- Figures 14A through 14C show' IHC analysis of zQ175 mice injected with AAV 1/2-hSYNl-GFP and AAVi/2-hSYNI-GFP. Representative images of mEM48 immunostaining in striata of heterozygous zQ175 mice injected with control constructs.
- Figure 14A shows results from subjects injected with AAV2/l+l-hSYNl- GFP at 2 months of age and analyzed at 4 months of age;
- Figure 14B show's results from subjects injected with AAV2/l+l-hSYNl-GFP at 6 months of age and analyzed at 10 months of age;
- Figure 14C shows results from subjects injected with AAV2/l-t-l-hSYNl-ADBD.T2A.GFP at 6 months of age and analyzed at 10 months of age. Color not shown as follows: Htt inclusions (mEM48): yellow 7 , GFP: green, DARPP-32: red, DAPI: blue.
- Figures 15A through 15G show neuroinflammation assessment in treated wild-type and zQ175 mice.
- Figure 15A shows results of immunostaining for the indicated molecules (GFP, DAP, GFAP, BA1).
- Figure 15B is a graph showing the ratio of bal cells to all cells at 2.-6 months in the subjects treated as indicated.
- Figure 15C is a graph showing the ratio of GFAP cells to all cells at 2-6 months in the subjects treated as indicated.
- Figure 15D is a graph showing GFAP F intensity m GFAP cells at 2-6 months in subjects treated as indicated.
- Figure 15E is a graph showing the ratio of bal cells to all cells at 6-12 months in the subjects treated as indicated.
- Figure 15F is a graph showing the ratio of GFAP cells to all cells at 6-12 months in the subjects treated as indicated.
- Figure 15G is a graph showing GFAP F intensity in GFAP cells at 6-12 months in subjects treated as indicated See, also, Examples text for further description.
- Figures 16A through 16E show molecular and histopathological bridging data for ZFP-D in zQ175 mice.
- Figure 16A shows normalized mRNA expression of wild-type and mutant Htt in neurons of subjects treated with ZFP-D or Mock.
- Figure 16B HTT protein expression of wild-type and mutant Htt under the indicated conditions.
- Figure 16C shows the density of perinuclear inclusions in the subjects treated as indicated at 2-6 months (left) or 6-12 months (right) after treatment.
- Figure 16C shows nuclear inclusions in ZFP+ and NueN+ neurons of the subjects treated as indicated at 2-6 months (left) or 6-12 months (right) after treatment.
- Figure 16D shows EM48 nuclear intensity in ZFP+ and NueN+ neurons of the subjects treated as indicated at 2-6 months (left) or 6-12 months (right) after treatment See, also, Examples text for further description.
- Figures 17A through T7F show analysis of CAG repeat content in the human and mouse genomes of genes with greater than or equal to 6 CAG repeates (“> CAGx6”).
- Figure 17A shows results of screening for 0 mismatches per 6 mer.
- Figure 17B shows results of screening for 0 mismatches within 1 kb of a transcription site site (TSS).
- Figure 17C shows results of screening for ⁇ 3 mismatches per 6mer.
- Figure 17D shows results for screening for ⁇ 3 mismatches within 1 kb of a TSS.
- Figure G7E shows a comparison of mouse and human of the top 100 genes with 0 mismatches (left) and top 100 genes with ⁇ 3 mismatches (right).
- Figure I7F shows a comparison of human and niyse of the top 100 genes with 0 mismatches (left) and top 100 genes with ⁇ 3 mismatches (right). See, also, Examples text for further description.
- compositions and methods for lowering levels of toxic mHTT protein levels in a subject using ZFP genetic modulators of mutant Htt alleles are disclosed herein.
- the genetic repressors described herein selectively repress >99% of HD- causing alleles over an 80-fold dose range, while preserving expression of >86% of wild type alleles found in the HD population.
- expression of other CAG-containing genes is minimally affected, and virally delivered repressors were active and well tolerated in HD neurons beyond 100 days in culture and at least 4 months in the mouse brain.
- the genetic repressors described herein result in molecular, histopatliological, e!ectrophysiological, and phenotypic correction of HD in multiple accepted animal models of the disease.
- CAG-targeted ZFP repressors described in this study have the potential to selectively down-regulate expression from the pathogenic allele in a large majority of HD patients.
- HTT has roles in a myriad of biological functions (Zuccato, ibid), including intracellular trafficking, energetics, transcriptional regulation and autophagy. In mice, Htt knockout is embryonic lethal (Duyao et al.
- RNA-targeted modalities have been investigated to selectively downregulate mHTT transcripts by degradation or translational inhibition.
- ASO- and RNAi-based strategies targeting single nucleotide polymorphisms (SNPs) linked to the m//7 / a!ieie (Pfister et al. (2009) Cur Biol !9(9):774-778; Lombardi et al. (2009) Exp Neurol 217:312-319; Carroll et al. (2011 ) Mol Ther. 19( 12):2178-85) have been shown to selectively lower mHTT in HD mouse models.
- ZFP-B allele-selective repressor as described herein
- e demonstrate robust in vivo repression of mHtt expression at time points between 7 weeks and 4 months in three different HD mouse models, w ith the resultant correction of molecular, histological, electrophysiological and phenotypic pathology.
- nucleic acid “nucleic acid,”“polynucleotide,” and“oligonucleotide” are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
- these terms are not to be construed as limiting with respect to the length of a polymer.
- the terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones).
- an analogue of a particular nucleotide has the same base-pairing specificity; i.e. , an analogue of A will base-pair with T.
- Tire term also applies to ammo acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally-occurring amino acids.
- Binding refers to a sequence-specific, non -covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), as long as the interaction as a whole is sequence-specific. Such interactions are generally characterized by a dissociation constant (K d ) of 10 6 M 1 or lower. “Affinity” refers to the strength of binding:
- A“zinc finger DNA binding protein” (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion.
- the term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
- Artificial nucleases and transcription factors can include a ZFP DNA-binding domain and a functional domain (nuclease domain for a ZFN or transcriptional regulatory ' domain for ZFP-TF).
- the term“zinc finger nuclease” includes one ZFN as well as a pair of ZFNs (including first and second ZFNs also known as left and right ZFNs) that dimerize to cleave the taiget gene.
- Zinc finger binding domains can be“engineered” to bind to a
- engineered DNA binding proteins are proteins that are non- naturally occurring .
- me thods for engineering DNA-binding proteins are design and selection.
- a designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Patent Nos.
- A“selected” zinc finger protein is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g. , U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,200,759; 8,586,526; and International Patent Publication Nos. WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878;
- TtAgo is a prokaryotic Argonaute protein thought to be involved in gene silencing. TtAgo is derived from the bacteria Tkermus therm ophilus . See, e.g.,
- A“TtAgo system” is all the components required including, for example, guide DNAs for cleavage by a TtAgo enzyme.
- “Recombination” refers to a process of exchange of genetic information between two polynucleotides, including but not limited to, donor capture by non-homologous end joining (NHEJ) and homologous recombination.
- “homologous recombination (HR)” refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells via homology -directed repair mechanisms. This process requires nucleotide sequence homology, uses a“donor” molecule to template repair of a“target” molecule (i.e., the one that experienced the double-strand break), and is variously known as“non-crossover gene conversion” or“short tract gene
- such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or“synthesis-dependent strand annealing,” in which the donor is used to resynthesize genetic information that will become part of the target, and/or related processes.
- Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.
- one or more targeted nucleases as described herein create a double-stranded break (DSB) in tire target sequence (e.g, cellular chromatin) at a predetermined site.
- DSB double-stranded break
- the DSB may result in deletions and/or insertions by homology-directed repair or by non-homology-directed repair mechanisms.
- Deletions may include any number of base pairs.
- insertions m ay include any number of base pairs including, for example, integration of a
- donor polynucleotide optionally having homology to the nucleotide sequence in the region of the break.
- the donor sequence may be physically integrated or, alternatively, the donor polynucleotide is used as a template for repair of the break via h omologous recombination, resulti ng in the introduction of all or part of the nucleotide sequence as in the donor into the cellular chromatin.
- a first sequence in cellular chromatin can be altered and, in certain embodiments, can be converted into a sequence present m a donor polynucleotide.
- the use of the terms “replace” or“replacement” can he understood to represent replacement of one nucleotide sequence by another, (/. e. , replacement of a sequence in the informational sense), and does not necessarily require physical or chemical replacement of one polynucleotide by another.
- Any of the methods described herein can be used for insertion of a donor of any size and/or partial or complete inactivation of one or more target sequences in a ceil by targeted integration of donor sequence that disrupts expression of the gene(s) of interest.
- Cell lines with partially or completely inactivated genes are also provided.
- the exogenous nucleotide sequence can contain sequences that are homologous, but not identical, to genomic sequences in the region of interest, thereby stimulating homologous recombination to insert a non-identical sequence in the region of interest.
- portions of the donor sequence that are homologous to sequences in the region of interest exhibit between about 80 to 99% (or any integer therebetween) sequence identity to the genomic sequence that is replaced.
- the homology between the donor and genomic sequence is higher than 99%, for example if only 1 nucleotide differs as between donor and genomic sequences of over 100 contiguous base pairs.
- a non-homologous portion of the donor sequence can contain sequences not present in the region of interest, such that new sequences are introduced into the region of interest.
- the non-homologous sequence is generally flanked by sequences of 50-1,000 base pairs (or any integral value therebetween) or any number of base pairs greater than 1,000, that are homologous or identical to sequences in the region of interest.
- the donor sequence is non-homologous to the first sequence and is inserted into the genome by non-homologous recombination mechanisms.
- Cleavage refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, fusion polypeptides are used for targeted double-stranded DN A cleavage.
- A“cleavage half-domain” is a polypeptide sequence which, in conjunction with a second polypeptide (either identical or different) forms a complex having cleavage activity (preferably double-strand cleavage activity).
- the terms“first and second cleavage half-domains;”“+ and - cleavage half-domains” and“right and left cleavage half-domains” are used interchangeably to refer to pairs of cleavage half domains that dimerize.
- An“engineered cleavage half-domain” is a cleavage half-domain that has been modified so as to fonn obligate heterodimers with another cleavage half domain (e g., another engineered cleavage half-domain). See, also, U.S. Patent Nos. 8,623,618; 7,888,121; 7,914,796; and 8,034,598, incorporated herein by reference in their entireties.
- sequence refers to a nucleotide sequence of any length, which can be DN A or R A; can be linear, circular or branched and can be either single-stranded or double stranded.
- donor sequence refers to a nucleotide sequence that is inserted into a genome.
- a donor sequence can be of any length, for example between 2 and 100,000,000 nucleotides in length (or any integer value therebetween or thereabove), preferably between about 100 and 100,000 nucleotides in length (or any integer therebetween), more preferably between about 2000 and 20,000 nucleotides in length (or any value therebetween) and even more preferable, between about 5 and 15 kb (or any value therebetween).
- Chromatin is the nucleoprotein structure comprising the cellular genome.
- Cellular chromatin comprises nucleic acid, primarily DNA, and protein, including histones and non-histone chromosomal proteins.
- the majority of eukaryotic cellular chromatin exists in the fonn of nudeosomes, wherein a nucleosome core comprises approximately 150 base pairs of DNA associated with an oetamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores
- a molecule of histone HI is generally associated with the linker DNA.
- the term“chromatin” is meant to encompass all types of cellular nucleoprotein, both prokaryotic and eukaryotic.
- Cellular chromatin includes both chromosomal and episomal chromatin.
- A“chromosome,” is a chromatin complex comprising all or a portion of the genome of a cell.
- the genome of a ceil is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell.
- the genome of a cell can comprise one or more chromosomes.
- An“episome” is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell. Examples of epi somes include plasmids and certain viral genomes.
- An“accessible region” is a site in cellular chromatin in which a target site present in the nucleic acid can be bound by an exogenous molecule which recognizes the target site. Without wishing to be bound by any particular theory, it is believed that an accessible region is one that is not packaged into a nucleosomal structure. The distinct structure of an accessible region can often be detected by its sensitivity to chemical and enzymatic probes, for example, nucleases.
- A“target site” or“target sequence” is a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind, pro vided sufficient conditions for binding exist.
- Target sites may be any length, for example, 9 to 20 or more nucleotides and length and the bound nucleotides may be contiguous or lion-contiguous.
- An“exogenous” molecule is a molecule that is not normally present in a cell but can be introduced into a cell by one or more genetic, biochemical or other methods.“Normal presence in the cell” is determined with respect to the particular developmental stage and environmental conditions of the cell.
- a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell.
- a molecule induced by heat shock is an exogenous molecule with respect to a non-heat-shocked cell.
- An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule or a malfunctioning version of a normally- functioning endogenous molecule.
- A“fusion” molecule is a molecule in which two or more subunit molecules are linked, preferably covalently.
- the subunit molecules can be the same chemical type of molecule or can be different chemical types of molecules.
- Examples of the first type of fusion molecule include, but are not limited to, fusi on proteins (for example, a fusion between a ZFP DNA-binding domain and one or more activation domains) and fusion nucleic acids (for example, a nucleic acid encoding the fusion protein described supra).
- Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triplex-forming nucleic acid and a polypeptide, and a fusion between a minor groove binder and a nucleic acid.
- Fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein.
- Trans-splicing, polypeptide cleavage and polypeptide ligation can also be involved expression of a protein in a cell. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure
- a gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA) or a protein produced by translation of an mRNA.
- Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methyiation, and editing, and proteins modified by, for example, methyiation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and g!ycosy!ation.
- Modulation of gene expression refers to a change in the activity of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Genome editing (e.g., cleavage, alteration, inactivation, random mutation) can be used to modulate expression. Gene modulator refers to tiny change in gene expression as compared to a cell that does not include a ZFP genetic modulator as described herein. Thus, gene inactivation may be partial or complete.
- A“region of interest” is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which it is desirable to bind an exogenous molecule. Binding can be for the purposes of targeted DNA cleavage and/or targeted recombination.
- a region of interest can be present in a chromosome, an episome, an organellar genome (e.g., mitochondrial, chloroplast), or an infecting viral genome, for example.
- a region of interest can be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non -transcribed regions, either upstream or downstream of the coding region.
- a region of interest can be as small as a single nucleotide pair or up to 2,000 nucleotide pairs in length, or any integral value of nucleotide pairs.
- Eukaryotic cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells (e.g, T-cells), including stem cells (pluripotent and multipotent).
- operative linkage and“operatively linked” (or“operably linked”) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.
- a transcriptional regulatory sequence such as a promoter
- a transcriptional regulatory sequence is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors
- transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it.
- an enhancer is a transcriptional regulatory sequence that is operati vely linked to a coding sequence, even though they are not contiguous.
- the term“operatively linked” can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked.
- the DNA-binding domain and the repression domain are in operative linkage if, m the fusion molecule, the ZFP DNA- binding domain portion is able to bind its target site and/or its binding site, while the activation domain is able to upregulate gene expression.
- the ZFP DNA-binding domain and tire cleavage domain are in operative linkage if, in the fusion polypeptide, the ZFP DNA-binding domain portion is able to bind its target site and/or its binding site, while the cleavage domain is able to cleave DNA in the vicinity of the target site.
- A“functional fragment” of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid.
- a functional fragment can possess more, fewer, or the same number of residues as the corresponding nati ve molecule, and/or can contain one or more amino acid or nucleotide substitutions.
- DNA-binding function of a polypeptide can be determined, for example, by filter-binding, electrophoretic mobility-shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis. See Ausubel et al, supra.
- the ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, two-hybrid assays or complementation, both genetic and biochemical. See, for example, Fields et al. (1989 ) Nature 340:245-246; U.S. Patent No. 5,585,245 and International Patent Publication No. WO 98/44350.
- a " vector” is capable of transferring gene sequences to target cells.
- “vector construct,” ""expression vector,” and“gene transfer vector,” mean any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target ceils.
- the term includes cloning, and expression vehicles, as well as integrating vectors.
- subject and patient are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, dogs, cats, rats, mice, and other animals. Accordingly, the term “"subject” or“patient” as used herein means any mammalian patient or subject to which the nucleases, donors and/or genetically modified cells of the invention can be administered. Subjects of the present invention include those with a disorder. Zinc Finger DNA-binding domains
- DNA binding domains comprising a zinc finger protein that binds to an Htt gene. See, for example, U.S. Patent No. 8,841,260.
- An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein.
- Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger am o acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, co-owned U.S. Patent Nos. 6,453,242 and 6,534,261, incorporated by reference herein in their entireties.
- Exemplary selection methods including phage display and two-hybrid systems, are disclosed in U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988;
- the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein in addition, enhancement of binding specificity ' for zinc finger binding domains has been described, for example, in co-owned International Patent Publication No. WO 02/077227.
- zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary' linker sequences 6 or more amino acids in length.
- the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
- the DNA binding domain is an engineered zinc finger protein that binds (in a sequence-specific manner) to a target site in a Hit gene and modulates expression of Pitt.
- the ZFPs can bind selectively to ei ther a mutant Htt allele or a wild-type Htt sequence.
- Htt target sites typically include at least one zinc finger but can include a plurality of zinc fingers (e.g., 2, 3, 4, 5, 6 or more fingers).
- the ZFPs include at least three fingers. Certain of the ZFPs include four, five or six fingers, while some ZFPs include 8, 9, 10, 11 or 12 fingers.
- the ZFPs that include three fingers typically recognize a target site that includes 9 or 10 nucleotides; ZFPs that include four fingers typically recognize a target site that includes 12 to 14 nucleotides; while ZFPs having six fingers can recognize target sites that include 18 to 21 nucleotides.
- the ZFPs can also be fusion proteins that include one or more regulatory domains, which domains can he transcriptional activation or repression domains. In some embodiments, the fusion protein comprises two ZFP DNA binding domains linked together. These zinc finger proteins can thus comprise 8, 9, 10, 11 , 12 or more fingers.
- the two DNA binding domains are linked via an extendable flexible linker such that one DNA binding domain comprises 4, 5, or 6 zinc fingers and the second DNA binding domain comprises an additional 4, 5, or 5 zinc fingers.
- the linker is a standard inter-finger linker such that the finger array comprises one DNA binding domain comprising 8, 9, 10, 11 or 12 or more fingers.
- die linker is an atypical linker such as a flexible linker.
- the DNA binding domains are fused to at least one regulatory domain and can be thought of as a ZFP-ZFP-TF architecture.
- Zero- ZFP-KOX which comprises two DN A binding domains linked with a flexible linker and fused to a KOX repressor and“ZFP-KOX-ZFP-KOX” where two ZFP-KOX fusion proteins are fused together via a linker.
- the DNA-binding domain may be derived from a nuclease.
- the recognition sequences of homing endonucleases and meganucleases such as I-Sbel, I-Ceul, Pl-Pspl, PKSce, I-SceTV, l-Csml, l-Panl, I- SceYL, l-Ppol, I-SfceIII, l-Crel, I-Fevl, I-FevII and I-FevIII are known. See also U.S. Patent No. 5,420,032: U.S. Patent No. 6,833,252: Belfort et al. (1997) Nucleic Acids Res.
- TWO handed” zinc finger proteins are those proteins in which two clusters of zinc finger DNA binding domains are separated by intervening ammo acids so that the two zinc finger domains bind to two discontinuous target sites.
- An example of a two handed type of zinc finger binding protein is SIP 1 , where a cluster of four zinc fingers is located at the amino terminus of the protein and a cluster of three fingers is located at the carboxyl terminus (see Remade et al. (1999) EMBO Journal 18(18):5073-5Q84).
- Each cluster of zinc fingers in these proteins is able to bind to a unique target sequence and the spacing between the five target sequences can comprise many nucleotides.
- Two-handed ZFPs may include a functional domain, 5 for example fused to one or both of the ZFPs.
- functional domain may be attached to the exterior of one or both ZFPs or may be positioned between the ZFPs (attached to both ZFPs).
- Fusion proteins comprising DNA-binding proteins (e.g., ZFPs) as described herein and a heterologous regulator ' (functional) domain (or functional fragment thereof) are also provided.
- Common domains include, e.g., transcription factor domains (activators, repressors, co-activators, co-repressors), silencers, oncogenes (e.g., myc, jun, fos, myb, max, mad, rel, ets, bci, myb, mos family
- DNA repair enzymes and their associated factors and modifiers DNA rearrangement enzymes and their associated factors and modifiers; chromatin associated proteins and then modifiers (e.g. kinases, acetylases and deacetylases); and DNA modifying enzymes (e.g., inethyitransferases, topoisomerases, helieases, ligases, kinases, phosphatases, polymerases, endonucleases) and their associated factors and0 modifiers.
- DNA modifying enzymes e.g., inethyitransferases, topoisomerases, helieases, ligases, kinases, phosphatases, polymerases, endonucleases
- Suitable domains for achieving activation include the HSV VP 16 activation domain (see, e.g., Hagmann et al. (1997) J. Virol. 71:5952-5962) nuclear5 hormone receptors (see, e.g., Torchia et al. (1998) Curr. Opin. Cell. Biol. 10:373- 383); the p65 subunit of nuclear factor kappa B (Bitko & Barik (1998) J. Virol.
- Additional exemplary activation domains include, but are not limited to, OsGAI, HALF-1, Cl, API, ARF- 5, -6, -7, and -8, CPRF1, CPRF4, MYC-RP/GP, and TRAB 1. See, for example, Ogawa et al. (2000) Gene 245:21-29: Qkanami et al. (1996) Genes Cells 1 :87-99; Goff et al. (1991) Genes Dev. 5:298-309; Clio et al. (1999) Plant Mol. Biol. 40:419-429;
- Exemplar ⁇ repression domains include, but are not limited to, KRAB
- TGF -beta-inducible early gene TGF -beta-inducible early gene (TEG)
- v-erbA SID
- MBD2 MBD3, members of the ON M l family (e.g., DNMT1, DNMT3A, DNMT3B), Kb, and MeCP2.
- TGF -beta-inducible early gene TGF -beta-inducible early gene (TEG), v-erbA, SID, MBD2, MBD3, members of the ON M l family (e.g., DNMT1, DNMT3A, DNMT3B), Kb, and MeCP2.
- Fusion molecules are constructed by methods of cloning and biochemical conjugation that are well known to those of skill in the art. Fusion molecules comprise a DNA-binding domain and a functional domain (e.g., a transcriptional activation or repression domain). Fusion molecules also optionally comprise nuclear localization signals (such as, for example, that from the SV40 medium T-antigen) and epitope tags (such as, for example, FLAG and
- Fusion proteins are designed such that the translational reading frame is preserved among the components of the fusion.
- Fusions between a polypeptide component of a functional domain (or a functional fragment thereof) on the one hand, and a non-protein DNA-binding domain (e.g., antibiotic, intercalator, minor groove binder, nucleic acid) on the other, are constructed by methods of biochemical conjugation known to those of skill in the art. See, for example, the Pierce Chemical Company (Rockford, IL) Catalogue. Methods and compositions for making fusions between a minor groove binder and a polypeptide have been described. Mapp et al. (2000) Proc, Natl. Acad. Sci. USA 97:3930-3935
- the target site bound by the DNA binding domain is present in an accessible region of cellular chromatin.
- Accessible regions can be determined as described, for example, in eo-owned International Patent Publication No. WO 01/83732. If the target site is not present in an accessible region of cellular chromatin, one or more accessible regions can be generated as described in co-owned International Patent Publication No. WO 01/83793.
- the DN A-binding domain of a fusion molecule is capabl e of binding to cellular chromatin regardless of whether its target site is in an accessible region or not.
- such DNA-binding domains are capable of binding to linker DNA and/or nucleosomal DNA.
- the fusion molecule may be formulated with a pharmaceutically acceptable carrier, as is known to those of skill in the art. See, for example,
- the functional component/domain of a fusion molecule can be selected from any of a variety of different components capable of influencing transcription of a gene once the fusion molecule binds to a target sequence via its DNA binding domain.
- the functional component can include, but is not limited to, various transcription factor domains, such as activators, repressors, co-activators, co repressors, and silencers.
- transcription factor domains such as activators, repressors, co-activators, co repressors, and silencers.
- Additional exemplar ' functional domains are disclosed, for example, in co-owned U.S. Patent No. 6,534,261 and U.S. Patent Publication No.
- Functional domains that are regulated by exogenous small molecules or ligands may also be selected.
- RheoSwitch® technology may be employed wherein a functional domain only assumes its active conformation in the presence of the external RheoChemTM ligand (see for example U.S Patent Publication No. 2009/0136465).
- the ZFP may be operahly linked to the regulatable functional domain wherein the resultant activity of the ZFP-TF is controlled by the external ligand.
- nucleases, polynucleotides encoding these nucleases, donor polynucleotides and compositions comprising the proteins and/or polynucleotides described herein may be delivered by any suitable means.
- the nucleases and/or donors are delivered in vivo.
- the nucleases and/or donors are delivered to isolated cells (e.g., autologous or heterologous stem cells) for the provision of modified cells useful in ex vivo delivery to patients.
- Nucleases and/or donor constructs as described herein may also be delivered using any nucleic acid delivery ' mechanism, including naked DNA and/or RNA (e.g., mRNA) and vectors containing sequences encoding one or more of the components.
- Any vector systems may be used including, but not limited to, plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated vims vectors, etc., and combinations thereof. See, also, U.S. Patent Nos.
- nucleases and/or donor polynucleotide may be carried on the same deliver ⁇ ' system or on different delivery mechanisms.
- each deliver ⁇ mechanism may comprise a sequence encoding one or multiple nucleases and/or donor constructs (e.g., mRNA encoding one or more nucleases and/or mRNA or AAV carrying one or more donor constructs).
- Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acid, and nucleic acid complexed with a deliver ⁇ ' vehicle such as a liposome or poloxamer.
- Viral vector deliver ⁇ ’ systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
- Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or !ipidmucleic acid conjugates, lipid nanoparticles (LNP), naked DNA, naked RNA, capped RNA, artificial virions, and agent-enhanced uptake of DNA.
- Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for deliver ⁇ ' of nucleic acids.
- nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA) and Copernicus Therapeutics Inc. (see for example U.S. Patent No. 6,008,336) Lipofection is described in e.g., U.S. Patent Nos. 5,049,386; 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., TransfeetamTM and LipofectinTM).
- Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, International Patent Publication Nos WO 91 /17424, WO 91/16024.
- the nucleases are delivered as mENAs and die transgene is delivered via other modalities such as viral vectors, minicircle DNA, plasmid DNA, single-stranded DNA, linear DNA, liposomes, nanoparticles and the like.
- Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC deliver ⁇ ' vehicles (ED Vs).
- EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released ( see MacDiarmid et al. (2009) Nature Biotechnology 27(7):643).
- RNA or DNA viral based systems for the delivery of nucleic acids encoding engineered CRISPR/Cas systems take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
- Viral vectors can be administered directly to subjects (in vivo) or they can be used to treat cells in vitro and the modified cells are administered to subjects (ex vivo).
- CRISPR/Cas systems include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated, vaccinia and herpes simplex virus vectors for gene transfer.
- Lenti viral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of c/s -acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum civ-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate tire therapeutic gene into the target ceil to provide permanent transgene expression.
- Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency vims (SIV), human immunodeficiency vims (HIV), and combinations thereof (see, e.g., Buchscher et al. (1992) J. Virol. 66:2731-2739; Johann et al. (1992) ./ Virol. 66 : 1635 - 1640; Sommerfelt et al. (1990) Virol. 176:58- 59; Wilson et al. (1989) ./ Virol.63:2374-2378; Miller et al. (1991) ,/. Virol. 65:2220- 2224; International Patent Publication No. WO 1994/026877).
- MiLV murine leukemia virus
- GaLV gibbon ape leukemia virus
- SIV Simian Immunodeficiency vims
- HAV
- adenoviral based systems can be used.
- Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and high levels of expression have been obtained. This vector can be produced large quantities in a relatively simple system.
- Adeno-associated vims ('‘AAV”) vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g.. West et al. (1987) Virology 160:38-47; U.S. Patent No.
- Any AAV serotype can be used, including AAV1, AAV3, AAV4, AAV5, AAV 6 and AAV8, AAV 8.2, AAV9, and AAV rhl O and pseudotyped AAV such as AAV9.45, AAV2/8, AAV2/5 and AAV2/6.
- At least six viral vector approaches are currently available for gene transfer in clinical trials, which utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.
- pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al. (1995) Blood 85:3048-305; Kohn et al. (1995) Nat. Med. 1: 1017-102; Malecli et al (1997) PNAS 94(22): 12133-12138).
- PA317/pLASN was the first therapeutic vector used m a gene therapy trial. (Blaese et al. (1995) Science 270:475-480). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al. (1997) Immunol
- Recombinant adeno-associated virus vectors are promising alternative gene delivery systems based on the defective and nonpathogenic parvovirus adeno-associated type 2. virus. All vectors are derived from a plasmid that retains only the AAV 145 base pair (bp) inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene deliver - due to integration into the genomes of the transduced cell are key features for tins vector system. (Wagner et al (1998) Lancet 351(9117): 1702-3; Kearns et al (1996) Gene Ther. 9:748-55). Other AAV serotypes, including AAV1 , AAV3, AAV4,
- AAV5, AAV6, AAV8, AAV9, AAV9.45 and AAVrhlO, and all variants thereof, can also be used in accordance with the present invention.
- Ad Replication-deficient recombinant adenoviral vectors
- Ad can be produced at high titer and readily infect a number of different cell types.
- Most adenovirus vectors are engineered such that a transgene replaces the Ad Ela, Elb, and/or E3 genes; subsequently the replication defective vector is propagated in human 293 cells that supply deleted gene function in tram.
- Ad vectors can transduce multiple types of tissues in vivo, including non-dividing, differentiated cells such as those found in liver, kidney and muscle. Conventional Ad vectors have a large earning capacity.
- Ad vector An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for anti-tumor immunization with intramuscular injection (Sterman et al (1998 ) Hum. Gene Ther. 7: 1083-1089). Additional examples of the use of adenovirus vectors for gene transfer in clinical trials include Rosenecker et al. (1996) Infection 24(1):5-10; Sterman etal. (199%) Hum. Gene Ther. 9(7): 1083-1089; Welsh et al. (1995) Hum. Gene Ther. 2:205-18; Alvarez et al. (1997) Hum. Gene Ther. 5:597-613; and Topf et al. (1998) Gene Ther. 5:507-513.
- Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and y2 cells or PA317 cells, which package retrovirus.
- Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassete encoding the protein to be expressed. The missing viral functions are supplied in tra by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AA V genome which are required for packaging and integration into the host genome.
- ITR inverted terminal repeat
- Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
- the cell line is also infected with adenovirus as a helper.
- the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
- the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
- the gene therapy vector be delivered with a high degree of specificity to a particular tissue type.
- a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the vims.
- the ligand is chosen to have affinity for a receptor known to be present on the ceil type of interest.
- Han et al (1995) Proc. Natl. Acad. Sci. USA 92:9747-9751 reported that Moloney murine leukemia vims can be modified to express human heregulin fused to gp70, and the recombinant vinis infects certain human breast cancer cells expressing human epidermal growth factor receptor.
- filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
- Gene therapy vectors can be delivered in vivo by administration to an individual subject, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, sublingual or intracranial infusion) topical application, as described below, or via pulmonary inhalation.
- vectors can be delivered to cells ex vivo , such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.
- Vectors e.g., retroviruses, adenoviruses, liposomes, etc.
- nucleases and/or donor constructs can also be administered directly to an organism for transduction of cells in vivo.
- naked DNA can be administered.
- Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application, inhalation and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
- Vectors suitable for introduction of polynucleotides described herein include non-integrating lentivirus vectors (1DLV). See, for example, Ory etal. (1996) Pro Natl. Acad. Set USA 93: 11382-11388; Dull et al (1998) J Virol 72:8463- 8471; Zuffery el al. (1998) . Virol. 72:9873-9880; Follenzi et al. (2000) Nature Genetics 25:217-222; U.S. Patent No. 8,936,936.
- compositions are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington’s Pharmaceutical Sciences, 17th ed., 1989).
- nuclease-encoding sequences and donor constructs can be delivered using the same or different systems.
- a donor polynucleotide can be carried by an AAV, while the one or more nucleases can he carried by mRNA.
- the different systems can be administered by the same or different routes (intramuscular injection, tail vein injection, other intravenous in j ection, intraperitoneal administration and/or intramuscular in j ection. Multiple vectors can be delivered simultaneously or in any sequential order.
- Formulations for both ex vivo and in vivo administrations include suspensions in liquid or emulsified liquids.
- the active ingredients often are mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient.
- Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof.
- the composition may contain minor amounts of auxiliary substances, such as, wetting or emulsifying agents, pH buffering agents, stabilizing agents or other reagents that enhance the effectiveness of the pharmaceutical composition.
- RNA was synthesized using mMESSAGE mMACHINE® 17 ULTRA Transcription Kit (ThermoFisher
- the coding sequence for ZFP-2A-GFP was cloned into the lentivirus transfer vector pRRL downstream of the CMV promoter.
- HEK293T ceils cultured in 15 -cm tissue culture dishes were transfected with the following plasmids: pRRL- CMV-ZFP-2A-GFP (37.5 pg), the VSVG envelope plasmid (18.75 pg), and the packaging plasmids (pMDL and pREV, 18.75 pg for each (Dull, T., et a!. (1998) J Virol 72(11): 8463-8471)_ using Lipofectamine 2000 (ThermoFisher Scientific).
- the viral supernatants (30 mi) were harvested 48 and 72 hr post-transfection and filtered through a 0.45-pm filter before being concentrated 300-fold by ultracentrifugation at 4°C (Optima L-80K preparative ultracentrifuge, Beckman Coulter) at 50,000 c g for 90 mm. The pellets were then suspended an appropriate volume of Hank’s Buffered Salt Solution (Lonza). To determine infectious titer, 2 x IQ 4 HEK293T cells were transduced in triplicate with 100 m ⁇ of serially diluted vector preps overnight, then incubated for an additional 48 hr at 37°C with 5% C02. The infectious titer was determined using dilutions that gave a linear dose response for GFP expression. Production of AAV vectors
- AA V6-CMV-GFP and AAV6-CMV-ZFP were generated by baculovirus-based AAV production according to standard methods in the art. All AAV 6 vectors were purified by double CsCl ultracentrifugation, buffer-exchanged to PBS with 0.001% Pluronic F-68. AAV titers were determined using qPCR.
- vectors were generated by Evotee AG (Hamburg, Germany) to express ZFP-2A- GFP and GFP control under the control of human Synapsin 1 (hSYNl) promoter.
- AAV 1/2 vectors were produced by HEK293 transfection and purified by iodixanol gradient as described (Heikkinen et al. (2.012) PLoS ONE 7:e507! 7,
- FID fibroblasts lines GM04723 (CAG15/67 (SEQ ID NO: 81/82)
- GM02151 CAG 18/45 (SEQ ID NO: 79/80)
- ND30259 CAG21/38 (SEQ ID NO:83/84)
- mRNA transfection was performed using 96-well Shuttle Nucleofector (Lonza). 0.01-1000 ng ZFP mRNA per 1.5xlG 5 cells was transfected using P2 solution and program CA- 137; for doses less than 100 ng ZFP mRNA, GFP mRNA was added to bring the total amount of mRNA transfected to 100 ng. Twenty-four hours after transfection, cells were harvested for gene expression analysis by qRT-PCR.
- HD ESC line GENEA018 (CAG17/48 (SEQ ID NQ:76/78), Bradley et al. (2011) Stem Cells Dev 20:495-502, doi: 10.1089/scd.2010.0120) was a gift from CHDI. CAG repeat lengths were confirmed by sequencing. HD-ESCs were passaged with accutase and cultured on matrigel coated plates in E8 media (Thermo Fisher Scientific). Neural stem cells were derived using StemPro Neural Induction Medium ⁇ Thermo Fisher Scientific).
- ESCs were seeded into geltrex coated 6-well dish with 2xl0 5 cells/well and when 10-20% confluent the medium was changed to StemPro Neural Induction Medium (Thermo Fisher Scientific). Medium was changed every 2 days and NSCs were harvested and expanded on day 7. StemPro NSC SFM medium (Life Technologies) was used to culture HD-NSCs and non-HD NSCs (HIPTM Neural Stem Cells, Gloha!stem. NSCs were passaged with accutase on geltrex coated plates mRNA transfection was performed using 96-well Shuttle Nucleofector (Lonza).
- NSCs were prepared by in accordance with the NSC subculture protocol (StemPro NSC, Life Technologies), 2xl0 5 cells transfected using 20 pL SF solution and program CM-130. Immediately afterwards 80 pL of media was added to the well before transferring to a 96 well plate containing 50pL of warm media.
- Neuronal differentiation from NSC was induced by changing to neural differentiation media (NDIFF) consisting ofNeurobasal media with B-27 Seram-Free Supplement and GlutaMAXTM (ThennoFisher Scientific). Medium was changed every 3-4 days. After 7 days in NDIFF, cells adopt neuronal morphology.
- NDIFF neural differentiation media
- HD NSC or neurons were cultured on chamber slides (Lab-Tek, Thermo Fisher) for immunohistochemistry analysis of neuronal marker genes. Briefly, cells were fixed and permeablized using the BD Cytofix/CytopermTM Kit (BD Biosciences). Slides were blocked with 4%NGS and stained with primary antibodies anti ⁇ PAX6 (AB2237, Miilipore), anti- Nestin-488 (MAB5326A4, Miilipore) or anti- b-T ⁇ tubulin (MAB 119, R&D Systems) overnight at 4C. Appropriate Alexa 488 or 555 conjugated secondary antibodies (Molecular Probes) were diluted 1 :500 for secondary staining.
- GM04723 (CAG15/67 (SEQ ID NO:81/82)) human fibroblasts were transfected with ZFP (300 ng) at 150,000 cells/transfection in quadruplicate using Lonza program CA-l 37 in P2 solution. Cells were pooled post transfection in complete media, then separated into 4 wells of a 24-well plate and incubated at 37°, 5% C02 for 72 hours. Cells were trypsinized, washed, pelleted and lysed in hot 95° Laemmli sample buffer and incubated at 95° for 5 minutes.
- Blots were then incubated with secondary antibodies for 1 hour at RT with protection from light: goat anti -Mouse IgGl (1:5000; Li-Cor IRDye 800CW 926-32350) and goat anti-Rabbit (1 : 10,000; Li Cor IRDye 680RD #926-68071) in Odyssey blocking buffer containing 0.2% Tween-20, 0.01% SDS. With light protection, blots were washed 3x10 min in PBS-T, dried between Whatman paper, and scanned on a Li-Cor Odyssey near- infrared fluorescence imaging system.
- Lentiviral vectors with a CMV promoter dri ving expression of a ZFP linked with a 2.4 peptide to GFP were used to create HD-NSCs expressing ZFP.
- Concentrated vectors were inoculated with 1x106 cells in a 6 well plate. After several passages, the resulting cells were subjected to cell sorting to enrich GFP-positive cells. Sorted cells were further expanded and differentiated into neurons as described above.
- RNA isolation kit (Roche) and Pureiink RNA mini Kit (Ambion), respectively.
- cDNA was generated using High capacity cDNA reverse transcription kits (Thermo Fisher Scientific), quantitative PCR was performed using SsoAdvanced Universal probes supennix (Bio-Rad) and CFX real-time PCR instrument (Bio-Rad).
- qRT-PCR primer/probe sets for gene expression analysis were ordered from IDT: mouse total Hit (Mm.PT.58.6953479), DRD1A (Mm.PT.56a.43576955.g), DR 1)2 (Mm.PT.56a.781 1767), PDE10A (Mm.PT.56a 16919824), DARPP-32
- Hs.PT.58.40126607 ORC4 (Hs.PT.56a.24527823.g), THAP11 (Hs.PT.49a.15404553.g), GLS (Hs.PT.53a.20624732), FBXOl 1 (Hs.PT.58 2665601 ), DNM1 (Hs.PT.58.25262501), TBP (Hs.PT.56a.20792004), FOXP2
- ZFP and GFP rnRNA expressed from the AAV6 vector were detected by a common primer/probe set for the 5’ UTR:
- Reverse primer GTTCGAATCCCAATTCTTTGCC (SEQ ID NO:4)
- Probe AGCACGTTGCCCAGGAGGTCAC (SEQ ID NO:5)
- Reverse primer GCTGCACCGACCGTGAGT (SEQ ID NO: 7)
- Probe CAGCTCCCTGTCCCGGCGG (SEQ ID NO:8)
- 363099-R (Reverse primer, used with both 099-C and 099T forward primer) : TCG ACTA AAGCAGG ATTTC AGO (SEQ ID NO : 12 ) .
- the 099-T blocker oligo was designed to anneals to the“C/G” allele and was phosphorylated at the 3’ -end base to suppress amplification of the mutant allele (Morlan et al. (2009) FLOS ONE 4:e4584), it was added at a 2: 1 molar ratio relative to the 099T forward primer.
- ND30259 (CAG21/38 (SEQ ID NOS: 83/84) was performed with custom designed primers based on SNP rs362331 C/T (Exon 50): 362331-F (331 Forward
- v/Yra-transcribed mRNA encoding the ZFP-TFs 100 ng was transfected into 150,000 HD fibroblasts (GMQ2151) in biological sextuplicate (Amaxa shuttle, setting CA-137, solution P2, Lonza). After 24 hours, cells were washed IX with PBS, then processed for total RNA extraction (High Pure, Roche). Each replicate (50 ng total RNA) was processed according to the manufacturer’s protocol for sample preparation, hybridization, fluidics, and scanning (Human Primeview GeneChip arrays, Affymetrix). Robust Multi -array Average (RMA) was used to normalize the raw signal from each probe set.
- RMA Robust Multi -array Average
- CAGCAGnnGCAGCAnCAGCAG motifs (SEQ ID NO: 17) (ZFP-B) with the ‘moods dna.py Python script from the MOODS package (ver 1.9.2), with thresholds set to detect either zero or up to three mismatches in the motif. Regions found with this approach were converted to BED format using a custom python script. BED regions were sorted and motif regions winch were adjacent or overlapping were fused into single regions using BEDtools (v2.26.0)‘merge’ command independent of strandedness.
- ENSEMBL human transcripts and their transcription start site coordinates were obtained from ENSEMBL Biomart and filtered for only those with a GENCODE (v25) BASIC annotation and biotype of ‘protein_coding’.
- Distance of a CAG motif from a given transcription start site was determined via the bedtools command‘bedtoois closest -D ⁇
- Affymetrix Primeview probeset ID to ENSEMBL transcript mapping was performed using Biomart hg38 data.
- Affymetrix Primeview probesets which mapped to multiple genes according to ENSEMBL biomart annotations (GRCh38.7, release 87), or did not overlap an EN SEMBL transcript were removed from further analysis. In cases where multiple transcripts mapped to a Primeview probeset, the transcript with the least distance between a CAG motif and the TSS was chosen.
- Expression RPKM values for human tissue expression were obtained from the GTEX project data (Mele et al. (2015) Science 348:660-665,
- TUNEL deoxynucleotidyl transferase dUTP nick end labeling
- mice were decapitated and the brain was rapidly removed from the skull and rinsed in me cold saline to remove any surface blood.
- the striatum was dissected on a chilled surface and subdivided into 3 equal-sized pieces representing the rostral, middle and caudal portions of the striatum: striatal tissues were treated in RNALater (Qiagen) at 4°C overnight then stored at -80°C until RNA extraction. Because AAV injection does not lead to complete and uniform coverage of the striatum (data not shown), each striatum was dissected into 3 sections to reduce the likelihood that baseline Ht levels in poorly transduced regions would interfere with detection of Htt regulation in well-transduced regions. For each striatal section, Htt as well as ZFP expression was quantified by qRT-PCR. zQl 75 mouse study
- heterozygous zQ175 mice received intrastriatal injections of AAV1/2- hSYNl -ZFP-2A-GFP (Txl O 13 vg/mL) in the right hemisphere and AAVl /2-hSYNl- GFP (lxlG i3 vg/ml) in the left hemisphere.
- a total of 2 pL of AAV vectors per striatum was delivered using a Hamilton gas tight syringe (Model 1801 RN) and a customized gauge 26 needle at a constant flow rate of 200 0.5 pL /min., and the in j ection coordinate was A/P +0.8 mm, M/L +/-1.8 mm, D/V -3.8 mm.
- zQ175 mice were euthanized 2 or 4 months post injection by transcardial perfusion with 30 mL of ice-cold PBS followed by 50 mL of 4 % paraformaldehyde using a peristaltic pump.
- R6/2 transgenic mice were bred in PsychoGenics’ colony by crossing ovarian transplanted females on a CBAxC57BL/6 background (Jackson Laboratories) with C57BL/6 wild-type males. CAG repeat length was confirmed in transgenic mice to be 123 ⁇ 0.6. All experimenters were blinded to group treatments.
- Clasping behavior was recorded during each body weight session. In brief, each mouse was removed from its home cage, the cage lid was turned upside down, and the mouse was placed onto this surface. The animal was then gently pulled backward and upward by the observer in a smooth motion until the animal was suspended above the surface by about 12 inches. The animal was observed for 30 seconds. A full clasp, defined by simultaneous hindlimb and forelimb clasp pulled tightly into the core, was recorded and used for analysis.
- mice in the AAV-CMV-ZFP group Three mice in the AAV-CMV-ZFP group and five mice in the AAV-
- mice died during the course of the study.
- mice Male and female zQ175 C57B/L6J knock-in mice were obtained from the Jackson Laboratory (Bar Harbor, Maine, USA). The zQ 175 line was derived from a spontaneous expansion of the CAG copy number in the CAG 140 knock-in mice, and generated at Psychogenics (Tarrytown, NY, USA). Transgenic mice were backcrossed to C57BL/6J to generate heterozygous zQ175 mice and wild-type iittermates. Animals were housed in Eurostandard Type II long cages and given access to food and water ad libitum. Environmental conditions were kept as follow:
- plasmids were modified from the adeno- associated vims (AAV) vector pAAV-6P-SWB (M derer et ai (2012) J Physiol 590(1):99-107).
- ZFP-C FLAG-tagged
- phSynl human synapsin 1 promoter
- an inactive ZFP control construct was generated by deleting the ZFP DNA binding domain from ZFP- B (ZFP-ADBD).
- Pseudotyped rAAV2/l+2 particles were produced and purified as previously described (Zolotukhin, S. , et al. (1999) Gene Ther. 6(6):973-85. PMID: 10455399); Carty, N., et al. (2015) FLOS ONE 10:e0123527).
- HEK293 cells were co-transfected with AAV vector carrying the transcription units of interest and plasmids containing rep and cap genes (pDPlrs and pDP2rs, Plasmid Factory) in equimolar ratios by polyethylenimine-mediated plasmid transfection.
- Cells were lyzed 48 hours after transfection by three freeze-thaw cycles, and cellular debris were removed by centrifugation. The supernatant containing viral particles was treated with benzonase, and subjected to iodixanol density centrifugation (S6, S7) at 60,000 rpm.
- S6, S7 iodixanol density centrifugation
- lodixanol was removed and viral particles were concentrated in PBS 300 MK (300 mM NaCl, 1 mM MgCl2, 2.5 mM KC1) by filter centrifugation. The remaining rAAV solution was filtered through a Millex GV 0.22 pm pore size. Sterile rAAV particles were stored at 4°C and diluted 1 : 1 with sterile PBS buffer to obtain PBS MK (150 mM NaCl, 0.5 mM MgCk, 1.25 mM KC1) for in vivo application. AAV titers were determined using qPCR. Prior to in vivo application, ZFP-expressing rAAV particles were tested in vitro for
- striatal cultures were prepared in 24-well plates at a cell density of 2E5 cells/well.
- rAAV particles (3E8 genome containing copies, GSs) were added at 3 DIV and cells harvested at 14 DIV.
- Wt and mutant Htt knockdown was assessed via qPCR using the primers: forward CAG GTC CGG CAG AGG AAC C (SEQID NO: 18) and reverse TTC ACA CGG TCT TTC TTG GTG G (SEQ ID NO: 19) for WT, and forward GCC CGG CTG TGG CTG A (SEQ ID NO:20) and reverse TTC ACA CGG TCT TTC TTG GTG G (SEQ ID NO:2 i) for mutant Htt, respectively.
- mice Two groups of 16 zQ175 bet mice (8 males and 8 females) received bilateral intra-striatal injections of rAAV constructs either encoding the HTT allele- specific ZFP30640 or the ZFP-ADBD control at 2 months of age. Mice were individually anaesthetized with 3% isoflurane at a flow rate of 1 L/min and placed in a stereotaxic instrument (Kopf. Model No. 940). Anesthesia was maintained throughout the surgical procedure via gas nose cone delivery of 2% isoflurane at a flow' rate of 0.5 L/min.
- a longitudinal mid -sagittal incision of 1 cm in length was made in the scalp after sterilization with 70% ethanol and iodine solution, and lidocaine application. Following skin incision, a small hole corresponding to the striatal injection site was made in the skull using an electrical drill (Foredom; Model No. H.30).
- the coordinates measured according to the mouse bregma were 0.8 mm anterior, 1.8 mm lateral on right and 3.8 mm deep from bregma with flat skull nosebar setting.
- mice were euthanized at the age of 6 and 10 months by transcardial perfusion.
- mice were deeply anesthetized by intraperitonea! injection of ketamine/xylazine mixture (120 mg/ 15 rng per kg in 15 m ⁇ /g body weight) using small diameter 27G needles.
- ketamine/xylazine mixture 120 mg/ 15 rng per kg in 15 m ⁇ /g body weight
- 27G needles small diameter 27G needles.
- Mice were transcardial!y perfused with 30 mL of ice-cold PBS followed by 50 mL of 4% paraformaldehyde using a peristaltic pump.
- Brain samples were removed from the skull and post-fixed overnight in the same fixative at 4°C, and cryoprotected by incubating in 30% sucrose solutions until saturated.
- Whole brains w'ere embedded in TissueTek and stored at -80°C.
- Coronal sections of 25 pm were cut using a cryostat, collected as free floating in 24-well plates, and directly used for staining or stored in a cryoprotection solution (25 mM Na-phosphate buffer pH 7.4, 30% ethylene glycol, 20% glycerol) at -20° C until time of use.
- the following primary antibodies w'ere used for immunostaining monoclonal mouse anti-mutant huntingtin (1 : 100; EM48, Millipore, MAB5374, lot#2135055), monoclonal rabbit anti-DARPP-32 (1:250; clone 19A3, Cell Signaling, #2306, lot#2), polyclonal rabbit anti-NeuN (1 : 1000; Millipore, ABN78, lot#214G086), monoclonal mouse anti-GFAP (1 : 1500, Millipore, MAB3402, lot#1990686), polyclonal rabbit anti-Ibal (1 : 1000,
- Sections were washed in PBS as described above and mounted using aqueous mounting medium containing DAP1 (Fluoroshield, Sigma, F6057) in 24-well glass-bottom plates (Sensop!ate, Greiner, #662892) suitable for imaging with the Opera High Content Screening system (PerkinElmer Inc.).
- DAP1 Fluoroshield, Sigma, F6057
- 24-well glass-bottom plates Sensop!ate, Greiner, #662892
- the algorithm searched for neurite-like cell extensions in the GFAP and Thai channels. Extensions that connected to the previously determined nucleus border in a 4 pixel wide rim around the nucleus were considered valid. A cell was considered GFAP or Ibal- positive, only if extensions could be detected. Subsequently, a‘local” background signal intensity was determined within an extra-nuclear rim region of 3px width and 2px distance from the previously determined nucleus border. Finally, only cells with a nuclear GFAP or Ibal intensity higher than the mean“local” background intensity were considered astroglia or microglia, respectively. Image data from six sections were averaged per animal, and five animals per treatment group were used for statistical evaluation.
- mice Heterozygous zQ175 mice (mixed gender) were injected unilaterally with AAV 1/2- hSYNl-ZFP-D or AAV2/l-hSYNl-ADBD-ZFP at Evotec Hamburg, Germany at either 2 months or 4 months of age
- [3H]raciopride (D2 ligand), [3H]MNI-659 (PDE10 ligand), and [3HJNNC112 (Dl ligand).
- PET-MRI and the nanoScan® PET-CT pre-clmical small animal imaging systems have identical PET performance (Nagy et al. (2013) J. Nucl Med 54(10): 1825-32) and were calibrated to provide consistent result.
- the first PET measurement was performed when the animals were 6.5 to 7 months of age. On the experimental day, the animal was anesthetized with inhalation of isoflurane (4-5% isoflurane in 100% oxygen). After induction of anesthesia, the isoflurane
- the image reconstruction - was made with a fully 3-dimensional maximum-likelihood expectation maximization algorithm (MLEM) with 20 iterations, without scatter and attenuation correction.
- Tire reconstmcted dynamic PET images were co-registered to an inbuilt mice MRI template available in PMQD, winch also incorporates volumes of interest (VQI s) sets (PMOD Technologies Ltd., Zurich, Switzerland). With the help of these VOI sets, decay corrected time activity curves (TAG) were generated.
- Hie binding potential (BPND) was calculated in PMOD with the simplified reference tissue model (SRTM) using cerebellum as a reference region.
- the % difference between left and right striatum was calculated according to the following equation;
- Patch pipetes (4-6 MW) were prepared with a Sutter Instruments horizontal puller using borosilicate glass with filament and filled with (in mM): 135 KMeS04, 5 KC1, 5 HEPES, 0.05 EGTA, 2 ATP ⁇ Mg2, 0.5 GTP-Na, 10 phosphocreatine-di (tris); pH was adjusted to 7.25 with KOH and osmolarity to 270-280 mosM.
- Electrophysiological characterization of neurons was made in current clamp configuration. The amplifier bridge circuit was adjusted to compensate for electrode resistance. Access resistances were continuously monitored and experiments were discarded if changes >20% were observed. Only stable recorded neurons were considered for analysis. 30% of our recordings w ? ere discarded because of changes in access resistance. Membrane potential was maintained at -80 mV. Digitized data were imported for analysis with commercial software (IGOR Pro 6.0, WaveMetrics, Oregon).
- bAPs (five bAP triplets, each; 5GHz intra train; 5 Hz between trains; in the ZFP experiments, bAP were generated with a single 50Hz triplet).
- Ca2+ transients were recorded at proximal (50-60 pm) and distal dendritic spines (>100 pm) from co- planar sections of the same dendrite using Ultima Laser Scanning Microscope system (Bruker Technologies, former Prairie) attached to a tunable laser (Chameleon, Coherent Laser Group, Santa Clara, CA) with 820 nm excitation wavelength (80- MHz pulse frequency; 250fs pulse duration).
- IGOR Pro WiveMetrics, Lake Oswego, OR
- the mean fluorescence as a function of time F(t) was the spatial average of 5 adjacent pixels, while the basal fluorescence, Fo, was average of the first 30 time points within a line scan.
- the normalized difference in Ca2+ signal (AF/Fo) due to current injection was defined as the maximum fluorescence change normalized by the basal fluorescence.
- Single spine stimulation was calibrated to evoke a somatic excitatory postsynaptic potential of 1-2 mV for each stimulated spine.
- Custom written software (WinFluor) was used to synchronize Ca2+ transients, electrophysiological recordings and two-photon laser stimulation.
- the plasmid containing ZFP-D cDNA and non-binding ZFP cDNA were subcloned and packaged into AAV 9 by Virovek (Hayward, CA).
- the expression of N-term NLS and C-term FLAG tagged human mutant Htt-repressor ZFP and tdTomato is bridged by viral 2A cleavage peptide.
- a striatal derived cell line ST HDH Q7/111 (Cortell, CHD1-90000072) from a knock in transgenic mouse containing heterozygous Huntingtin (HIT) loci with a humanized Exon 1 with 111
- polyglutamine repeats was used to test the ZFP mediated repression of mHTT expression.
- Cells were plated in 12 well plates and then infected with AAV carrying ZFP-30645 after overnight incubation and harvested after 72 h of infection for RNA isolation.
- ACt Ct (Htt) - Ct (GAPDH). Expression levels were calculated relative to controls using the formula: AACt ::: Ct (treated)- ACt (control). The final expression levels were obtained using the formula 2-AACt.
- Example 2 Identification of ZFP-TFs that selectively repress HTT alleles bearing an expanded poly-CAG tract
- Each ZFP was linked to the KRAB transcriptional repression domain from the KOX1 protein as previously described.
- tire ZFPs are assembled from either one or two-fingered modules, and the proteins used different finger linkers between the ZFP modules (termed“Mod link” in Table 1 below).
- the linkers used are as folkws:“0a” is TGEKPFQ (SEQ ID NO:27); “0c” is TGSQKPFQ (SEQ ID NO:28);“lc” is THPRAPIPKPFQ (SEQ ID NO:88); “2f” is TPNPHRRTDP SHKPF Q (SEQ ID NO: 24).
- the 0a and 0c linkers do not skip any nucleotide bases between modules, while lc and 2f skip 1 bp and 2 bp respectively.
- Example 3 Allele-selective repression of mHTT over broad ZFP dose range [0209] We next extended assessed dose ranges compatible with allele-specific repression, as well via quantitation of Htt protein product using two ZFP-TFs that selectively repressed the mutant allele in the initial screen (ZFP -A and ZFP-B, Figure 1C). Full sequences for ZFP -A through ZFP-D are provided in Table 3 below . Table 3: Amino acid sequences for ZFP-A, ZFP-B, ZFP-C and ZFP-D
- ZFP-A and ZFP-B selectively repressed mHTT over a -100 fold dose range with ⁇ 15% repression of the CAG18 (SEQ ID NO: 79) allele seen at any dose.
- Example 5 Long-term allele-selective repression of ihHTT&h ⁇ improvement of HD-re!ated phenotypes in human neurons and mouse striatum
- Microarray performance was broadly confirmed via qRT-PCR of a control transcript set ( Figures 1 IB and 11C). Importantly, membership analyses of microarray data revealed no overlap between genes regulated by ZFP-A and ZFP-B ( Figure 2G, Figure 1 ID), and examination of the corresponding promoters showed no strict correspondence between whether a gene was regulated and the presence, length or location of a CAG repeat (see Tables 5 and 6).
- Table 5 Microarray analysis results in neurons for ZFP A, B and C
- CAG I 7/48 (SEQ ID NOS:76/78) neurons had a significant decrease in intracellular ATP levels and an increased susceptibility to apoptosis compared to non-HD neurons ( Figures 2H and 21) compared to non-HD neurons.
- ATP levels increased -70% compared to control-treated neurons, suggesting that ZFP -mediated suppression of m HTT can improve HD-related metabolic defects.
- Cultured HD neurons also exhibit an increased susceptibility to apoptosis.
- AAYs encoding either ZFP-B or GFP were administered by bilateral intrastriatal injection to 11 -week-old Q50 heterozygotes at two doses (3xiO i0 or 9xl0 10 VG/hetnisphere; Figure 2J). Seven weeks after delivery, transgene expression and Hit regulation were assessed by qRT- PCR.
- a key consideration for any therapeutic strategy is the evaluation of specificity and off-target effects.
- This approach was the prevalence of the other 1,053 endogenous CAG arrays (length % 6 to account for the approximate DNA footprint of a 6 finger ZFP) in the human genome that, collectively, are adjacent to the promoters of 176 genes (See methods).
- Partially discontiguous arrays up to 3 mismatches per hexamer are even more abundant, with 21,456 total sites (all CAG arrays) proximal to 1,872 human genes.
- ZFP-A and ZFP-B had similar on-target behavior for all queried niHTT alleles, they had mutually exclusive off-target profiles in two cellular contexts (Figure 2G, Figure 11).
- MBD5 a CAG-adjacent gene with a discontiguous CAG tract (CAG 19 (SEQ ID NO:92), 0 bp from the TSS), was repressed by ZFP-B, but not ZFP-A ( Figure 1 IB and 1 1C).
- ZFP-A and ZFP-B target different frames of the CAG tract, are composed of different ZF modules, and employ different linker architectures, suggesting that their off-target properties may be design-dependent and therefore amenable to optimization.
- recent advances in engineering ZF modules e.g., with improved preference for the targetable frames in the
- CAG/CTG array as well as the ablation of non-specific interactions between the ZF and DNA backbones, provide potential complementary paths for optimizing ZFP specificity and the development of a ZFP suitable for clinical use.
- ZFP-treated mice performed significantly better at several timepoints after ZFP administration, and the greatest benefit relative to control-treated mice w'as observed at the final time point (12 weeks) .
- mice provided evidence of ZFP- driven improvements in both behavioral and molecular neuropathological endpoints, and prompted further investigation into the potential neuroprotective benefit of an allele-selective ZFP at the cellular level in the context of a less aggressive disease model.
- mice harbor a knock-in mHtt human exon 1 allele with -188 CAG repeats, and display HD-related molecular, histological, electrophysiological, and behavioral phenotypes. See Example 1.
- Heterozygous zQ 175 mice develop hallmark mHTT- containing inclusions at 3-4 months of age that continue to accumulate through 12 months of age, molecular and electrophysiological disease signatures between 4-6 months of age, and a delayed onset of relatively mild locomotor deficits at 10-12 months of age (Menalied et al. (2012) PLoS ONE 7:e49838; Heikkinen et al. (2012) PLoS ONE 7:e50717; Carty et al (2015) PLoS One 10x0123527; Beaumont et al (2016) Neuron 92: 1220-1237), thus permitting an assessment of ZFP efficacy at different stages of disease progression.
- ZFP-D was in line with our previous stereotaxic deliver ⁇ studies and unchanged in a non -targeted cortical region (data not shown).
- bAP back-propagating action potential
- Example 8 Restoration of translational biomarkers in ZFP-treated zQ175 mice [0245]
- the importance of monitoring these genes cannot be overstated, since PET imaging studies have shown early, progressive, and profound declines in the levels of PDE10A enzyme and D2-like receptors in HD patients, beginning many years prior to clinical diagnosis (CHDI/Karolinska Institute unpublished results; for review see Niccolini el al. (2018 ) J Neurol Neurosurg Psychiatry PMID:28889093).
- CHDI/Karolinska Institute unpublished results; for review see Niccolini el al. (2018 ) J Neurol Neurosurg Psychiatry PMID:28889093.
- Table 7 Average injected radioactivity levels (Injected RA), injected mass and weight of zQT75 mice imaged with [11C] Raclopride and [18F]MNI-659.
- Table 8 Average %SUV and BPND values of [l l CJraelopride or [18F] MNI-659 in striatum of Q175 animals treated with ZFP-D vs control viruses.
- ZFPs in our in vitro or in vivo studies, we sought to more closely examine markers of tolerability and specificity after short- and long-term ZFP treatment in vivo.
- GFAP astrogliosis
- Tbal microgliosis
- NeuN general neuronal viability
- CAG (MTUS2, RSLD241, AKT3, KCNA6, ITGA7); the exception being DNAJC12, which was regulated 70% by ZFP-B and 62% by ZFP-D, and lacks a CAG repeat in the human orthoiog. Examination of the mouse Dnajcl2 promoter revealed 12 CAA repeats directly adjacent to the CAG array, which may explain why it was regulated, whereas other similar-length CAG candidates were not.
- zQ175 het mice did not show an obvious clasping phenotype or alterations in spontaneous locomotion in the open field or neurological index deficits. Striatal ZFP treatment did not significantly alter the minor zQ175 het rotarod performance deficit observed at 15 months, body weight changes during disease progression, or affect neurological index scores. Moreover, intra- striatal ZFP-D administration had no impact on zQ175 whole brain, striatal and cortical volume as assessed by MRI.
- CAG- targeted ZFP repressors described in this study have the potential to selectively downregulate expression from the pathogenic allele in a large majority of HD subjects.
- ZFP binding to a chromosomal repeat array offers myriad possibilities for such communication, including noncovalent contacts between adjacent DNA-bound fingers (Nekludova & Pabo (1994) Proc Natl Acad Sci USA 91 :6948-6952), binding-dependent DNA distortion (Mirny (2010) Proc Natl Acad Sci USA 107:22534-22539), nucleosome ejection (Iyengar & Famham (201 1) J Biol Chem 286:26267-26276) , and the potential for avidity effects given the interaction of the KRAB repression domain with large corepressor complexes, components of which form multimers and higher level oligomers (Lupo et al.
- a key consideration for any therapeutic strategy is the evaluation of specificity and off-target effects.
- This approach was the prevalence of the other 1,053 endogenous CAG arrays (length 6 to account for the approximate DNA footprint of a 6 finger ZFP) in the human genome that, collectively, are adjacent to the promoters of 176 genes).
- Partially discontiguous arrays up to 3 mismatches per hexamer are even more abundant, with 21,456 total sites (all CAG arrays) proximal to 1 ,872 human genes.
- ZFP-A and ZFP-B had similar on -target behavior for all queried mPITT alleles, they had mutually exclusive off-target profiles in two cellular contexts ( Figure 2G, Figure 11, Figure 17).
- MBD5 a CAG-adjacent gene with a discontiguous CAG tract (CAG19 (SEQ ID NO:92), 0 bp from the TSS), was repressed by ZFP-B, but not ZFP-A ( Figures 1 I B and 1 1C)
- ZFP-A and ZFP-B target different frames of the CAG tract, are composed of different ZF modules, and employ different linker architectures, suggesting that their off-target properties may be design-dependent and therefore amenable to optimization.
- R6/2 is an aggressive model, and introducing the ZFP at 5 weeks of age (the earliest time point at which stereotaxic injection can be reliably performed) may be too late to affect certain behavioral endpoints. While the involvement of the striatum is critical for motor control, whether striatal selective suppression of mHTT is sufficient to ameliorate these symptoms is unclear given the role of the broader cortico-striatal-thalamocortical loops in motor pattern learning and execution. Additionally, whether the changes in locomotor behavior in HD mice are driven exclusively by striatal mHTT expression is unknown.
- mice Clearly other brain regions contribute to spontaneous locomotor control in mice, including the motor- relevant cortical areas, cerebellum and brainstem nuclei, which could also be affected in these models (Capeili et al. (2017) Nature 551 :373-377; Datson et al (2017) PLoS One J 2 : e 0171127). Therefore, widespread suppression of mHTT might be necessary to rescue these disease phenotypes in HD mouse models. In support of this notion, improvements in spontaneous locomotion and rotarod performance have been reported for alternative approaches (e.g., ASOs or siRNAs) that were shown to distribute more broadly throughout the murine brain, albeit with effects that are typically mild or partially restorative (Stanek et al.
- ASOs or siRNAs e.g., siRNAs
- D2-hke receptors and PDE10A enzyme showed that lowering mHTT in Q 175 heterozygous mice w ' as associated with increased specific binding of [3HJNNC112, [3H]raclopride and [3HJMNI-659, in both the early and later treatment studies (after symptom onset and decline in their expression).
- the largest difference was observed for Dl -like receptors, followed by PDE!OA and D2 ⁇ bke receptors, suggesting that the effect of lowering mHTT after symptom onset in mice was more pronounced in direct-pathway striatal neurons, as PDE10 is expressed by both populations of SPNs.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Neurology (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Neurosurgery (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2020556850A JP7332622B2 (ja) | 2018-04-18 | 2019-04-17 | ハンチンチン(htt)の調節のためのジンクフィンガータンパク質組成物 |
| CN201980040791.1A CN112313246B (zh) | 2018-04-18 | 2019-04-17 | 用于调节亨廷顿蛋白(htt)的锌指蛋白组合物 |
| EP19788921.5A EP3781587A4 (en) | 2018-04-18 | 2019-04-17 | ZINC FINGER PROTEIN COMPOSITIONS FOR THE MODULATION OF HUNTINGTINE (HTT) |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862659552P | 2018-04-18 | 2018-04-18 | |
| US62/659,552 | 2018-04-18 | ||
| US201862780605P | 2018-12-17 | 2018-12-17 | |
| US62/780,605 | 2018-12-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019204457A1 true WO2019204457A1 (en) | 2019-10-24 |
Family
ID=68237491
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/027891 Ceased WO2019204457A1 (en) | 2018-04-18 | 2019-04-17 | Zinc finger protein compositions for modulation of huntingtin (htt) |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US11421007B2 (enExample) |
| EP (1) | EP3781587A4 (enExample) |
| JP (1) | JP7332622B2 (enExample) |
| CN (1) | CN112313246B (enExample) |
| WO (1) | WO2019204457A1 (enExample) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024243438A3 (en) * | 2023-05-23 | 2025-01-16 | Omega Therapeutics, Inc. | Compositions and methods for reducing cxcl9, cxcl10, and cxcl11 gene expression |
| WO2025151707A1 (en) | 2024-01-11 | 2025-07-17 | Entrada Therapeutics, Inc. | Method for preparing multimers of phosphorodiamidate morpholino oligomers |
| WO2026038105A1 (en) * | 2024-08-13 | 2026-02-19 | Fondazione Telethon Ets | Engineered transcription repressors and uses thereof |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3911349A4 (en) * | 2019-01-15 | 2023-01-18 | Sangamo Therapeutics, Inc. | HTT REPRESSORS AND THEIR USES |
| CN121729237A (zh) | 2023-06-30 | 2026-03-24 | 武田药品工业株式会社 | Htt阻遏物及其用途 |
| CN118649252B (zh) * | 2024-08-21 | 2024-11-05 | 核工业四一六医院 | Zfp36l2基因在治疗和/或预防辐射损伤中的应用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060079475A1 (en) * | 2004-04-08 | 2006-04-13 | Sangamo Biosciences, Inc. | Methods and compositions for modulating cardiac contractility |
| US20160200781A1 (en) * | 2010-10-15 | 2016-07-14 | Fundacio Privada Centre De Regulacio Genomica | Peptides and uses thereof |
| US20170096460A1 (en) * | 2015-09-23 | 2017-04-06 | Sangamo Biosciences, Inc. | Htt repressors and uses thereof |
Family Cites Families (69)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6242568B1 (en) | 1994-01-18 | 2001-06-05 | The Scripps Research Institute | Zinc finger protein derivatives and methods therefor |
| US6140466A (en) | 1994-01-18 | 2000-10-31 | The Scripps Research Institute | Zinc finger protein derivatives and methods therefor |
| DE69534629D1 (de) | 1994-01-18 | 2005-12-29 | Scripps Research Inst | Derivate von zinkfingerproteinen und methoden |
| USRE39229E1 (en) | 1994-08-20 | 2006-08-08 | Gendaq Limited | Binding proteins for recognition of DNA |
| GB9824544D0 (en) | 1998-11-09 | 1999-01-06 | Medical Res Council | Screening system |
| US5789538A (en) | 1995-02-03 | 1998-08-04 | Massachusetts Institute Of Technology | Zinc finger proteins with high affinity new DNA binding specificities |
| US5925523A (en) | 1996-08-23 | 1999-07-20 | President & Fellows Of Harvard College | Intraction trap assay, reagents and uses thereof |
| GB2338237B (en) | 1997-02-18 | 2001-02-28 | Actinova Ltd | In vitro peptide or protein expression library |
| GB9703369D0 (en) | 1997-02-18 | 1997-04-09 | Lindqvist Bjorn H | Process |
| GB9710807D0 (en) | 1997-05-23 | 1997-07-23 | Medical Res Council | Nucleic acid binding proteins |
| GB9710809D0 (en) | 1997-05-23 | 1997-07-23 | Medical Res Council | Nucleic acid binding proteins |
| US6410248B1 (en) | 1998-01-30 | 2002-06-25 | Massachusetts Institute Of Technology | General strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites |
| ES2341926T3 (es) | 1998-03-02 | 2010-06-29 | Massachusetts Institute Of Technology | Poliproteinas con dedos de cinc que tienen enlazadores mejorados. |
| US6140081A (en) | 1998-10-16 | 2000-10-31 | The Scripps Research Institute | Zinc finger binding domains for GNN |
| US6453242B1 (en) | 1999-01-12 | 2002-09-17 | Sangamo Biosciences, Inc. | Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites |
| US6534261B1 (en) | 1999-01-12 | 2003-03-18 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| US7013219B2 (en) | 1999-01-12 | 2006-03-14 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| US6599692B1 (en) | 1999-09-14 | 2003-07-29 | Sangamo Bioscience, Inc. | Functional genomics using zinc finger proteins |
| US6794136B1 (en) | 2000-11-20 | 2004-09-21 | Sangamo Biosciences, Inc. | Iterative optimization in the design of binding proteins |
| AU776576B2 (en) | 1999-12-06 | 2004-09-16 | Sangamo Biosciences, Inc. | Methods of using randomized libraries of zinc finger proteins for the identification of gene function |
| US6689558B2 (en) | 2000-02-08 | 2004-02-10 | Sangamo Biosciences, Inc. | Cells for drug discovery |
| US20020061512A1 (en) | 2000-02-18 | 2002-05-23 | Kim Jin-Soo | Zinc finger domains and methods of identifying same |
| ATE353361T1 (de) | 2000-04-28 | 2007-02-15 | Sangamo Biosciences Inc | Gezielten modifikation der chromatinstruktur |
| AU2001255870B2 (en) | 2000-04-28 | 2006-07-13 | Sangamo Biosciences, Inc. | Databases of regulatory sequences; methods of making and using same |
| AU2001263155A1 (en) | 2000-05-16 | 2001-11-26 | Massachusetts Institute Of Technology | Methods and compositions for interaction trap assays |
| JP2002060786A (ja) | 2000-08-23 | 2002-02-26 | Kao Corp | 硬質表面用殺菌防汚剤 |
| US6919204B2 (en) | 2000-09-29 | 2005-07-19 | Sangamo Biosciences, Inc. | Modulation of gene expression using localization domains |
| AU2002217929A1 (en) | 2000-11-28 | 2002-06-11 | Sangamo Biosciences, Inc. | Modulation of gene expression using insulator binding proteins |
| US7067317B2 (en) | 2000-12-07 | 2006-06-27 | Sangamo Biosciences, Inc. | Regulation of angiogenesis with zinc finger proteins |
| GB0108491D0 (en) | 2001-04-04 | 2001-05-23 | Gendaq Ltd | Engineering zinc fingers |
| JP2005500061A (ja) | 2001-08-20 | 2005-01-06 | ザ スクリップス リサーチ インスティテュート | Cnnについての亜鉛フィンガー結合ドメイン |
| US7262054B2 (en) | 2002-01-22 | 2007-08-28 | Sangamo Biosciences, Inc. | Zinc finger proteins for DNA binding and gene regulation in plants |
| WO2003087341A2 (en) | 2002-01-23 | 2003-10-23 | The University Of Utah Research Foundation | Targeted chromosomal mutagenesis using zinc finger nucleases |
| WO2003080809A2 (en) | 2002-03-21 | 2003-10-02 | Sangamo Biosciences, Inc. | Methods and compositions for using zinc finger endonucleases to enhance homologous recombination |
| EP2806025B1 (en) | 2002-09-05 | 2019-04-03 | California Institute of Technology | Use of zinc finger nucleases to stimulate gene targeting |
| US8409861B2 (en) | 2003-08-08 | 2013-04-02 | Sangamo Biosciences, Inc. | Targeted deletion of cellular DNA sequences |
| US7888121B2 (en) | 2003-08-08 | 2011-02-15 | Sangamo Biosciences, Inc. | Methods and compositions for targeted cleavage and recombination |
| US7972854B2 (en) | 2004-02-05 | 2011-07-05 | Sangamo Biosciences, Inc. | Methods and compositions for targeted cleavage and recombination |
| AU2005287278B2 (en) | 2004-09-16 | 2011-08-04 | Sangamo Biosciences, Inc. | Compositions and methods for protein production |
| ES2465996T3 (es) | 2006-05-25 | 2014-06-09 | Sangamo Biosciences, Inc. | Métodos y composiciones para la inactivación genética |
| EP2027262B1 (en) | 2006-05-25 | 2010-03-31 | Sangamo Biosciences Inc. | Variant foki cleavage half-domains |
| DE602008003684D1 (de) | 2007-04-26 | 2011-01-05 | Sangamo Biosciences Inc | Gezielte integration in die ppp1r12c-position |
| US8585526B2 (en) | 2007-06-18 | 2013-11-19 | American Axle & Manufacturing, Inc. | Vehicle driveline component having heat sink for increased heat rejection capabilities |
| HRP20161004T1 (hr) | 2007-09-27 | 2016-10-21 | Dow Agrosciences Llc | Tehnološki konstruirani proteini cinkovi prsti koji imaju kao cilj gene za sintazu 5-enolpiruvilshikimat-3-fosfata |
| US8563314B2 (en) | 2007-09-27 | 2013-10-22 | Sangamo Biosciences, Inc. | Methods and compositions for modulating PD1 |
| MX2010003371A (es) | 2007-09-28 | 2010-05-05 | Intrexon Corp | Constructos interruptores genicos terapeuticos y biorreactores para la expresion de moleculas bioterapeuticas y usos de los mismos. |
| EP2205752B1 (en) | 2007-10-25 | 2016-08-10 | Sangamo BioSciences, Inc. | Methods and compositions for targeted integration |
| CA2720903C (en) | 2008-04-14 | 2019-01-15 | Sangamo Biosciences, Inc. | Linear donor constructs for targeted integration |
| EP2352369B1 (en) | 2008-12-04 | 2017-04-26 | Sangamo BioSciences, Inc. | Genome editing in rats using zinc-finger nucleases |
| CN102333868B (zh) | 2008-12-17 | 2015-01-07 | 陶氏益农公司 | 靶向整合入Zp15 基因座 |
| EP2408921B1 (en) | 2009-03-20 | 2017-04-19 | Sangamo BioSciences, Inc. | Modification of cxcr4 using engineered zinc finger proteins |
| CA2769262C (en) * | 2009-07-28 | 2019-04-30 | Sangamo Biosciences, Inc. | Methods and compositions for treating trinucleotide repeat disorders |
| US8956828B2 (en) | 2009-11-10 | 2015-02-17 | Sangamo Biosciences, Inc. | Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases |
| ES2751916T3 (es) | 2010-02-08 | 2020-04-02 | Sangamo Therapeutics Inc | Semidominios de escisión genomanipulados |
| EP2660318A1 (en) | 2010-02-09 | 2013-11-06 | Sangamo BioSciences, Inc. | Targeted genomic modification with partially single-stranded donor molecules |
| US9567573B2 (en) | 2010-04-26 | 2017-02-14 | Sangamo Biosciences, Inc. | Genome editing of a Rosa locus using nucleases |
| HRP20200254T1 (hr) * | 2010-05-03 | 2020-05-29 | Sangamo Therapeutics, Inc. | Pripravci za povezivanje modula cink fingera |
| AU2011281062B2 (en) | 2010-07-21 | 2015-01-22 | Board Of Regents, The University Of Texas System | Methods and compositions for modification of a HLA locus |
| CA2848417C (en) | 2011-09-21 | 2023-05-02 | Sangamo Biosciences, Inc. | Methods and compositions for regulation of transgene expression |
| CA3099582A1 (en) | 2011-10-27 | 2013-05-02 | Sangamo Biosciences, Inc. | Methods and compositions for modification of the hprt locus |
| WO2013130824A1 (en) | 2012-02-29 | 2013-09-06 | Sangamo Biosciences, Inc. | Methods and compositions for treating huntington's disease |
| EP2930788B1 (en) | 2012-11-20 | 2019-02-13 | Kuang-Chi Innovative Technology Ltd. | Metamaterial, metamaterial preparation method and metamaterial design method |
| EP2994531B1 (en) | 2013-05-10 | 2018-03-28 | Sangamo Therapeutics, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
| CN105683376A (zh) | 2013-05-15 | 2016-06-15 | 桑格摩生物科学股份有限公司 | 用于治疗遗传病状的方法和组合物 |
| WO2015070212A1 (en) * | 2013-11-11 | 2015-05-14 | Sangamo Biosciences, Inc. | Methods and compositions for treating huntington's disease |
| CN106459894B (zh) * | 2014-03-18 | 2020-02-18 | 桑格摩生物科学股份有限公司 | 用于调控锌指蛋白表达的方法和组合物 |
| WO2015171932A1 (en) * | 2014-05-08 | 2015-11-12 | Sangamo Biosciences, Inc. | Methods and compositions for treating huntington's disease |
| GB2544270A (en) | 2015-11-05 | 2017-05-17 | Fundació Centre De Regulació Genòmica | Nucleic acids, peptides and methods |
| EP3911349A4 (en) * | 2019-01-15 | 2023-01-18 | Sangamo Therapeutics, Inc. | HTT REPRESSORS AND THEIR USES |
-
2019
- 2019-04-17 US US16/386,885 patent/US11421007B2/en active Active
- 2019-04-17 WO PCT/US2019/027891 patent/WO2019204457A1/en not_active Ceased
- 2019-04-17 JP JP2020556850A patent/JP7332622B2/ja active Active
- 2019-04-17 EP EP19788921.5A patent/EP3781587A4/en active Pending
- 2019-04-17 CN CN201980040791.1A patent/CN112313246B/zh active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060079475A1 (en) * | 2004-04-08 | 2006-04-13 | Sangamo Biosciences, Inc. | Methods and compositions for modulating cardiac contractility |
| US20160200781A1 (en) * | 2010-10-15 | 2016-07-14 | Fundacio Privada Centre De Regulacio Genomica | Peptides and uses thereof |
| US20170096460A1 (en) * | 2015-09-23 | 2017-04-06 | Sangamo Biosciences, Inc. | Htt repressors and uses thereof |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024243438A3 (en) * | 2023-05-23 | 2025-01-16 | Omega Therapeutics, Inc. | Compositions and methods for reducing cxcl9, cxcl10, and cxcl11 gene expression |
| WO2025151707A1 (en) | 2024-01-11 | 2025-07-17 | Entrada Therapeutics, Inc. | Method for preparing multimers of phosphorodiamidate morpholino oligomers |
| WO2026038105A1 (en) * | 2024-08-13 | 2026-02-19 | Fondazione Telethon Ets | Engineered transcription repressors and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190322711A1 (en) | 2019-10-24 |
| CN112313246A (zh) | 2021-02-02 |
| EP3781587A1 (en) | 2021-02-24 |
| CN112313246B (zh) | 2025-05-13 |
| JP7332622B2 (ja) | 2023-08-23 |
| EP3781587A4 (en) | 2022-03-30 |
| JP2021521775A (ja) | 2021-08-30 |
| US11421007B2 (en) | 2022-08-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zeitler et al. | Allele-selective transcriptional repression of mutant HTT for the treatment of Huntington’s disease | |
| US12551575B2 (en) | Htt repressors and uses thereof | |
| US11421007B2 (en) | Zinc finger protein compositions for modulation of huntingtin (Htt) | |
| AU2015255877B2 (en) | Methods and compositions for treating huntington's disease | |
| Kong et al. | Correction of the disease phenotype in the mouse model of Stargardt disease by lentiviral gene therapy | |
| JP2019116502A (ja) | ハンチントン病を処置するための方法および組成物 | |
| JP2021502058A (ja) | Rnaを編集するための組成物および方法 | |
| JP2018521014A (ja) | ミスフォールドタンパク質の分解のための組成物及び方法 | |
| US20230381225A1 (en) | Methods for the treatment of beta-thalassemia | |
| Mich et al. | AAV-mediated interneuron-specific gene replacement for Dravet syndrome | |
| Bouaita et al. | Downregulation of apoptosis-inducing factor in Harlequin mice induces progressive and severe optic atrophy which is durably prevented by AAV2-AIF1 gene therapy | |
| CA2998500C (en) | Htt repressors and uses thereof | |
| BR112018005779B1 (pt) | Proteína dedo de zinco de ocorrência não natural que se liga ao gene htt, proteína de fusão, e uso de uma célula hospedeira |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19788921 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2020556850 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2019788921 Country of ref document: EP Effective date: 20201118 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 201980040791.1 Country of ref document: CN |