WO2019151698A1 - 효능이 개선된 인간 cd20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법 - Google Patents

효능이 개선된 인간 cd20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법 Download PDF

Info

Publication number
WO2019151698A1
WO2019151698A1 PCT/KR2019/000901 KR2019000901W WO2019151698A1 WO 2019151698 A1 WO2019151698 A1 WO 2019151698A1 KR 2019000901 W KR2019000901 W KR 2019000901W WO 2019151698 A1 WO2019151698 A1 WO 2019151698A1
Authority
WO
WIPO (PCT)
Prior art keywords
human
monoclonal antibody
specific monoclonal
transgenic
recombinant vector
Prior art date
Application number
PCT/KR2019/000901
Other languages
English (en)
French (fr)
Inventor
한재용
김영민
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190005990A external-priority patent/KR102192846B1/ko
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2019151698A1 publication Critical patent/WO2019151698A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Definitions

  • the present invention relates to a transgenic alga that produces human CD20 specific monoclonal antibodies with improved efficacy and a method for preparing the same.
  • transgenic animals using a combination of biotechnology using various stem cells and embryos and high-efficiency gene expression control technology is attracting attention as a key technology for the treatment of intractable diseases faced by humankind and for the improvement of health life.
  • Chickens have more litters than mammalian livestock, and can produce large amounts of protein through eggs, while eggs (egg) have only about 10 types of egg proteins, which separate the desired material from the protein produced through eggs. It is easy to purify and is considered an ideal bioreactor animal. However, the development of algae-specific technologies and related technologies has been lagging relative to mammals, which limits the development of practical technologies.
  • the present inventors transform the chicken's primordial germ cells (PGCs) using a piggyBac transposon containing an ovalbumin (OV) promoter for oviduct specific expression in chickens. Transformation progeny can be produced with high efficiency, high CDC (complement dependent cytotoxicity) and high ADCC (antibody dependent cell-mediated cytotoxicity)
  • the present invention was completed by confirming that human CD20 specific monoclonal antibodies are produced with high efficiency.
  • kits comprising (a) 5 'and 3' piggyBac transposon specific inverted terminal repeats (TR); And (b) a recombinant vector comprising an ovalbumin promoter positioned between the 5 'TR and 3' TR and a gene encoding a human CD20 specific monoclonal antibody operably linked to the ovalbumin promoter.
  • an object of the present invention is to provide a human CD20-specific monoclonal antibody produced by the above method comprising the steps of obtaining a human CD20-specific monoclonal antibody and a human CD20-specific monoclonal antibody from the transgenic bird model It is to provide a method for the preparation of a monoclonal antibody.
  • the present invention (a) 5 'and 3' piggyBac transposon specific inverted terminal repeat (Terminal Repeat, TR); And (b) a gene encoding an Ovalbumin (OV) promoter located between the 5 'TR and 3' TR and a gene encoding a human CD20 specific monoclonal antibody operably linked to the Ovalbumin promoter.
  • TR Terminal Repeat
  • OV Ovalbumin
  • the present invention also provides a donor germ cell line transformed with the recombinant vector.
  • the present invention also provides a method for producing a transformed algal model for producing a human CD20 specific monoclonal antibody comprising the step of transplanting the donor germ cell line into the embryo of the recipient bird.
  • the present invention also provides a transgenic avian model for producing human CD20 specific monoclonal antibodies prepared by the above method.
  • the present invention provides a method for producing a human CD20 specific monoclonal antibody comprising the step of obtaining a human CD20 specific monoclonal antibody from the transgenic bird model.
  • the present invention also provides a human CD20 specific monoclonal antibody produced by the above method.
  • the method for preparing a transgenic alga according to the present invention can produce a transgenic individual producing a human CD20 specific monoclonal antibody having improved efficacy with high efficiency, and thus can be proposed as a new model suitable for biobetter production.
  • Human CD20 specific monoclonal antibodies produced from the transgenic birds according to the present invention are afucosylated according to glycostructure analysis, resulting in higher complement dependent cytotoxicity (CDC) than commercial CD20 monoclonal antibodies, In the case of ADCC (antibody dependent cell-mediated cytotoxicity, antibody-mediated immune response) is about 8-16 times more efficient than the reference drug is expected to be widely used as an economical and stable antibody manufacturing method.
  • FIG. 1 is a diagram showing a result of confirming the cleavage map of the recombinant vector according to the present invention and the transformation of the chicken introduced the recombinant vector.
  • 1 a piggyBac Analysis of the cleavage map of the cCD20 mAb recombinant vector
  • B transgene from G0 to G3 of transgenic chicken with transgene and genome of each generation transgenic chicken with transgene.
  • FIG. 1 c Schematic of a set of transgene specific primers for detecting wild type and transgenic loci in FIG. 1, heterozygous transgenic chicken using transgene specific primers in FIG. 1 d: G2 PCR results of [Tg33 (he) 4 (he)] and homozygous transgenic chickens [Tg33 (ho) 4 (ho)].
  • Figure 2 is a diagram showing the results of verification of the expression of the fallopian tube bulge (magnum) specific transgene using cCD20 mAb-specific primers for the tissues of the transgenic chicken.
  • Figure 3 is a diagram showing the results of verifying the gene insertion position of the cCD20 mAb transgene through DNA walking.
  • FIG. 4 is a diagram showing the results of the identification and quantification of cCD20 mAb produced from transgenic chickens through ELISA and Western blot.
  • FIG. 4a shows the concentration of cCD20 mAb purified by ELISA using anti-human IgG antibody isolated from G2 Tg4 (he) and G2 Tg33 (he).
  • FIG. 4b G2 Tg4 (he) and G2.
  • Western blot of anti-human IgG antibody expressed in egg white obtained from Tg33 (he) transgenic chicken was shown in Figure 4c: G2 Tg33 (he) Tg4 (he) and G2 Tg33 (ho) 4 after SDS-PAGE.
  • Coomassie blue staining results for identifying cCD20 mAb in (ho) transgenic chickens FIG. *** p ⁇ 0.001, ** p ⁇ 0.01).
  • FIG. 5 is a diagram showing the results of N-glycan sugar chain content analysis of cCD20 mAb produced from transgenic chicken.
  • Figure 5a sugar chain structure of the analytical sample (cCD20 mAb)
  • Figure 5b 14 N-glycan profile analysis results by ion extraction chromatography (XIC).
  • Figure 6 is a diagram showing the results of analyzing the binding capacity and apoptosis ability of cCD20 mAb produced from transgenic chicken.
  • 6 a Flow cytometry analysis of CD20 binding affinity after treatment with cCD20 mAb of 0.01, 0.05, 0.1, 0.5, 1, 5 or 10 ⁇ g / ml, FIG.
  • FIG. 6 b 0.01, 0.1, 1, 5 or Concentration-specific mean fluorescence intensity (MFI) value analysis to confirm the binding affinity of cCD20 mAb and rituximab after 10 ⁇ g / ml antibody treatment
  • Figure 6 c flow cytometer after 5 ⁇ g / ml cCD20 mAb treatment Result of apoptotic cell analysis in Raji cells (using rituximab as positive control)
  • FIG. 6 d result of apoptotic cell analysis after treatment with 0.1, 1 or 5 ⁇ g / ml antibody (using rituximab as positive control, negative control CCD20 mAb untreated group; *** p ⁇ 0.001, p> 0.05 were not significantly different).
  • FIG. 7 is a diagram showing the results of analyzing CDC activity of cCD20 mAb produced from transgenic chickens (*** p ⁇ 0.001).
  • FIG. 8 is a diagram showing the results of ADCC activity analysis of cCD20 mAb produced from transgenic chickens (*** p ⁇ 0.001).
  • the present invention relates to (a) 5 'and 3' piggyBac transposon specific inverted terminal repeats (TR); And (b) a gene encoding an Ovalbumin (OV) promoter located between the 5 'TR and 3' TR and a gene encoding a human CD20 specific monoclonal antibody operably linked to the Ovalbumin promoter.
  • TR 5 'and 3' piggyBac transposon specific inverted terminal repeats
  • OV Ovalbumin
  • the term 'monoclonal antibody' refers to a highly specific antibody directed against a single antigenic site as it is known in the art.
  • monoclonal antibodies are directed against a single determinant on an antigen.
  • Monoclonal antibodies have the advantage of improving the selectivity and specificity of diagnostic and analytical assays using antigen-antibody binding, and also have the advantage that they are not contaminated by other immunoglobulins because they are synthesized by hybridoma culture.
  • Human CD20 specific monoclonal antibodies herein include functional fragments of antibody molecules as well as whole antibody forms.
  • the whole antibody is a structure having two full length light chains and two full length heavy chains, and each light chain is linked by a heavy chain and disulfide bond.
  • the heavy chain constant region has gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) and epsilon ( ⁇ ) types and subclasses gamma 1 ( ⁇ 1), gamma 2 ( ⁇ 2), and gamma 3 ( ⁇ 3). ), Gamma 4 ( ⁇ 4), alpha 1 ( ⁇ 1) and alpha 2 ( ⁇ 2).
  • the constant regions of the light chains have kappa ( ⁇ ) and lambda ( ⁇ ) types.
  • the functional fragment of the antibody molecule means a fragment having an antigen binding function and includes Fab, F (ab '), F (ab') 2, Fv and the like.
  • Fab in the antibody fragment has a structure having a variable region of the light and heavy chains, a constant region of the light chain and the first constant region (CH1) of the heavy chain has one antigen binding site.
  • a cysteine residue in the hinge region of Fab' forms a disulfide bond.
  • Fv refers to the smallest fragment of antibody having only the heavy and light chain variable regions
  • dsFv double-chain Fv
  • scFv short chain Fv
  • the variable region of the heavy chain and the variable region of the short chain are covalently linked or directly connected at the C-terminal to form a dimer-like structure such as dsFv.
  • the term 'vector' refers to any nucleic acid molecule, preferably a DNA sequence, which causes a promoter to induce the expression, ie transcription and translation, of an external DNA sequence.
  • the gene encoding the human CD20 specific monoclonal antibody may be characterized in that it comprises an internal ribosome entry site (IRES).
  • IRES internal ribosome entry site
  • the recombinant vector may further include one or more estrogen response elements (ERE) located between 5 'TR and 3' TR.
  • EEE estrogen response elements
  • the recombinant vector may be characterized in that it further comprises a 3 'UTR of the ovalbumin gene.
  • the recombinant vector may be characterized in that it further comprises a polyadenylation site (polyadenylation site, poly A).
  • the estrogen response element is intended to overexpress the gene of the present invention, and when reacted with estrogen, gene expression is increased.
  • ovalbumin is the most highly expressed protein in the fallopian tube of the bird, and the promoter can be specifically expressed in the fallopian tube (ofalbumin promoter or oviduct specific promoter).
  • the ovalbumin promoter is located between 5 'TR and 3' TR, characterized in that it comprises a sequence encoding the OV 5 'UTR.
  • 'promoter' refers to a DNA sequence that regulates the expression of a coding sequence or functional RNA.
  • the vector of the present invention may include an antibiotic resistance gene to identify transduced cells, and the antibiotic may preferably be neomycin.
  • 5 'TR and 3' TR is characterized in that consisting of the nucleotide sequence represented by SEQ ID NO: 3 and 11.
  • the promoter of ovalbumin including a 5 'UTR of the OV gene (tubal specific promoter) is characterized in that consisting of the nucleotide sequence represented by SEQ ID NO: 7, wherein the 3' UTR of the OV gene is represented by SEQ ID NO: 10 Characterized in that consisting of the base sequence.
  • the recombinant vector of the present invention comprises a neomycin resistance gene consisting of the nucleotide sequence represented by SEQ ID NO: 5.
  • the gene according to the present invention may include a base sequence having sequence homology with at least 70%, at least 80%, at least 90%, or at least 95% with the base sequence.
  • the gene encoding the human CD20 specific monoclonal antibody is a gene encoding the light chain region of the human CD20 specific monoclonal antibody represented by SEQ ID NO: 1 and human CD20 specific single represented by SEQ ID NO: 2 It may be characterized by comprising a gene encoding a heavy chain region of the clone antibody.
  • the gene encoding the light chain region of the human CD20 specific monoclonal antibody represented by SEQ ID NO: 1 is an antibody expression site gene sequence that expresses the kappa light chain of an antibody that binds to a human CD20 antigen.
  • a sequence encoding both the light chain variable region and the light chain constant region of the mAb (V L + hIg kappa region), and the amino acids translated by the sequence constitute kappa in the light chain variable region and form part of the Fab fragment.
  • the gene encoding the heavy chain region of the human CD20 specific monoclonal antibody represented by SEQ ID NO: 2 encodes both the heavy chain variable region (CDR) and the heavy chain constant region (CH1, CH2, CH3) of the anti-CD20 mAb. Sequence (V H + hIgG constant region), and the amino acids translated by the sequence make up part of the Fab fragment and Fc fragment of the antibody. This allows immune cells to recognize the antibody and induces an antibody dependent cell cytotoxicity (ADCC).
  • ADCC antibody dependent cell cytotoxicity
  • variants of the sequences are considered to be within the scope of the present invention.
  • Variant means a polynucleotide consisting of a nucleotide sequence that changes in nucleotide sequence but has functional characteristics similar to those of SEQ ID NO: 1 or 2, that is, the light chain region or heavy chain region of a human CD20 specific monoclonal antibody.
  • the gene encoding the human CD20 specific monoclonal antibody according to the present invention is a base having a sequence homology of at least 70%, at least 80%, at least 90%, or at least 95% with the nucleotide sequence of SEQ ID NO: 1 or 2, respectively. Sequences may be included.
  • the gene encoding the human CD20 specific monoclonal antibody may be characterized as codon-optimized for efficient expression in chicken.
  • the term 'codon optimization' refers to converting a nucleotide sequence of a gene so that when a specific gene is expressed in another individual, the gene can express a protein having the same amino acid sequence.
  • the gene encoding the codon optimized human CD20 specific monoclonal antibody of the present invention, when expressed in algae, can produce a protein having the same amino acid sequence as when expressed in humans, wherein c (chickenized) Used in combination with CD20.
  • the recombinant vector according to the present invention is a gene encoding the light chain region of the human CD20 specific monoclonal antibody represented by SEQ ID NO: 1 and the heavy chain region of the human CD20 specific monoclonal antibody represented by SEQ ID NO: 2
  • genes may include pIRES intron and IRES.
  • the pIRES intron is an intron sequence of the IRES so that gene translation by IRES can occur efficiently, and an internal ribosome entry site (IRS) is a site where ribosomes bind during the protein translation process, thereby efficiently translating the translation. Make it happen.
  • the IRES is present between the gene expressing the V L + hIg kappa region and the gene expressing the V H + hIgG constant region, thus intact human CD20 mAb in the protein translation process after transcription
  • expression of a desired antibody can be induced by transduction of one expression vector.
  • the recombinant vector is 5 'TR, poly A, neomycin resistance gene (Neo R ), SV40, OV promoter (OV 3.5), human CD20 specific chickenized monoclonal antibody (cCD20 mAb) , 3 'UTR (OV 3'UTR) and 3' TR gene of the OV gene may be included.
  • the human CD20 specific monoclonal antibody may comprise a gene encoding the V L + hIg kappa region, pIRES intron, IRES and V H + hIgG constant region.
  • the present invention also provides a donor germ cell line transformed with the recombinant vector.
  • the donor germ cell line may be characterized in that the primordial germ cells (PGCs) of the donor bird.
  • the primordial germ cells may be characterized in that derived from the primordial genitalia of 1-10 days old embryo of the donor bird.
  • the donor bird includes chicken, quail, turkey, duck, goose, pheasant and pigeon, preferably may be characterized in that the chicken.
  • the donor germ cell line may be characterized in that the accession number is KCLRF-BP-00431.
  • the present invention also provides a method for producing a transformed algal model for producing a human CD20 specific monoclonal antibody comprising the step of transplanting a donor germ cell line according to the present invention into an embryo of a recipient bird.
  • the transgenic avian model of the present invention may be transformed with a transformation vector having a cleavage map of FIG.
  • the transgenic algal model can produce human CD20 specific monoclonal antibodies.
  • the present invention provides a method for producing a human CD20 specific monoclonal antibody comprising the step of obtaining a human CD20 specific monoclonal antibody from the transgenic bird model and a human CD20 specific monoclonal antibody produced by the method to provide.
  • the monoclonal antibody of the present invention may be used without purification, but may be purified by necessity according to a method commonly used in the art.
  • purification methods include dialysis, salt precipitation, ion exchange chromatography, size exclusion chromatography, affinity chromatography, and the like, but the antibody purification method of the present invention is not limited by the above examples.
  • the monoclonal antibody of the present invention recognizes a specific epitope of the antigen and has the binding properties of the antigen-antibody complex, as well as the complete form having two full-length light chains and two full-length heavy chains, as well as the antibody molecule. Include functional fragments.
  • a functional fragment of an antibody molecule refers to a fragment having at least antigen binding function and may be Fab, F (ab '), F (ab') 2, Fv, and the like.
  • human CD20-specific monoclonal antibodies can be expressed in fallopian tubes and accumulated in egg white to produce human CD20-specific monoclonal antibodies with high efficiency.
  • the human CD20 specific monoclonal antibody may be characterized as afucosylated. Furthermore, as a result of non-fucosylation it may be characterized in that the cell-immunity function by the Fc domain is improved. Specifically, in one embodiment of the present invention, the human CD20 specific monoclonal antibody produced according to the present invention has a higher complement dependent cytotoxicity (CDC) than the commercial CD20 monoclonal antibody as a result of non-fucosylation. In addition, ADCC (antibody dependent cell-mediated cytotoxicity, antibody-mediated immune response) is confirmed that the efficiency of about 8-16 times higher than the reference drug. In this example, rituximab was used as a reference.
  • 'non-fucosylated' refers to an antibody with a fucose residue removed.
  • afucosylation is widely known as an important sugar chain modification method that greatly affects ADCC and CDC of antibodies.
  • the human CD20 specific monoclonal antibody is characterized in that it can exhibit a therapeutic effect against CD20 expressing cancer according to an increased ADCC (antibody mediated immune response).
  • 'CD20 expression' refers to a significant expression level of CD20 on the cell surface of a cell from a tumor or cancer, preferably a non-solid tumor, preferably a T or B cell, more preferably a B cell. It is intended to represent an antigen.
  • the term 'CD20 expressing cancer' refers to any cancer in which cancer cells exhibit expression of the CD20 antigen.
  • Such CD20 expressing cancers include, for example, lymphoma, lymphocytic leukemia, lung cancer, non-small cell lung (NSCL) cancer, bronchoalveolar lung cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, Ovarian cancer, rectal cancer, anal cancer, gastric cancer, gastrointestinal cancer, colon cancer, breast cancer, uterine cancer, tubal carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, Parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, bladder cancer, kidney or ureter cancer, kidney cell carcinoma, kidney pelvic carcinoma, mesothelio
  • transgenic algal model of the present invention and the human CD20 specific monoclonal antibody produced therefrom may be usefully used in related fields, including pharmaceuticals, such as pharmaceutical compositions.
  • the piggyBac OV anti-CD20 mAb expressing recombinant vector was constructed using the piggyBac transposon.
  • -CD20 mAb monoclonal antibody, monoclonal antibody
  • Gallus gallus Codon Usage database was codon optimized for using (https //www.kazusa.or.jp/codon) suitable for expression in the hen.
  • the codon optimized chickenized CD20 mAb gene contains a chicken lysozyme signal peptide sequence with a V L + hIg kappa region corresponding to the light chain and a V H hIgG constant region corresponding to the heavy chain and is internal Ribosome entry point (internal ribosome entry site, IRES).
  • the expression cassette was selected from the group consisting of 1.4 kb OV promoter and 1.6 kb OV 5 ′ UTR region; A piggyBac backbone containing a 1.6 kb OV 3 ′ UTR region containing the poly-A tail sequence was linked.
  • a cleavage map of the recombinant vector is shown in a of FIG. 1. Sequence information of all genes used, 3 'UTR, 5' TR, 3 'TR and promoter are shown in Table 1 below.
  • a male primordial germ cell (gPGC) line was established from the embryonic gonad of a six-day-old White Leghorn (WL) embryo.
  • the primordial germ cells were treated with 60-70% relative humidity, 5% carbon dioxide and 20% (v / v) fetal bovine serum (FBS; Invitrogen, Life Technologies) and 2% (v / v) chicken serum at 37 ° C. Sigma-Aldrich, St.
  • a small window is made at the tip of the Korean Ogye (KO) eggs (HH stage 14-17) and at least 3000 primitive reproductive cells.
  • 2 ⁇ L of cell suspension containing cells was microinjected into the dorsal aorta of the receptor embryo. Each egg window was sealed with a paraffin film, and the tip was kept downward until subsequent screening and incubation.
  • PCR was performed to confirm tissue specific expression of the transgenic chickens. Gene regions, including wild-type and transformed target sites, were amplified using primers specific for the cCD20 mAb sequence. PCR was performed using 10x PCR buffer (CoreBioSystem, Seoul, Korea), 1.6 ml dNTPs (10 mM each), 5 pmol of each primer and 0.5 U Taq polymerase (CoreBioSystem) for a total of 20 ml of 100 ng genomic DNA. The first denaturation was repeated once at 94 ° C. for 5 minutes, followed by denaturation at 94 ° C. for 30 seconds, annealing at 60 ° C. for 30 seconds and extending at 72 ° C. for 30 seconds. Finally, the post-extension was repeated once at 72 ° C. for 10 minutes. The PCR results are shown in FIG. 2. All primers used are shown in Table 2 below, and wild-type (WT) DNA was used as a negative control.
  • WT wild-type
  • cDNA obtained from untransformed chicken was negative for cCD20 specific primers, and cDNA of fallopian tube bulges obtained from transformed chicken appeared positive for cCD20 specific primers. It was confirmed.
  • Transgene insertion sites were identified using DNA Walking SpeedUp Premix Kit-II (Seegene, Seoul, Korea) according to the manufacturer's protocol. PCR products subjected to DNA walking three times were extracted from agarose gel, purified using a Power Gel Extraction Kit (Promega, Madison, WI, USA) and cloned into pGEM-T Easy Vector (Promega). Cloned PCR products were sequenced using ABI Prism 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA).
  • TCD4 (G1) transgenic males with cCD20 mAb transgenes on chromosome 4 and cCD20 mAb on chromosome 33 Tg33 (G1) transgenic females with transgenes were assayed with wild type chickens of different genders. Subsequently, the transgenic offspring (G2) produced from the G1 chickens were crossed with the transgenic chickens having the transgene at another locus.
  • Tg33 type transgenic males (G2) and Tg4 type transgenic females were crossed.
  • Pedigree of the cock Tg33 and hen Tg4 from G0 to G3 produced through the above process is shown in b of FIG.
  • a schematic of a set of transgene specific primers for detecting the wild type and transgenic loci is shown in c of FIG. 1.
  • the forward primer binds to the chicken genome and the reverse primer binds to the chicken genome or transgene.
  • PCR was performed under the following conditions: 1 round of primary denaturation at 94 ° C. for 5 minutes, followed by denaturation at 94 ° C. for 30 seconds, annealing at 60 ° C. for 30 seconds and 72 ° C. for 30 seconds. The step of extending at was repeated 35 times, and after-extension was repeated once at 72 ° C. for 7 minutes. The results are shown in d of FIG.
  • a G2 progeny with one copy in the same position as the Tg33 G1 transgenic chicken is Tg33 (he)
  • a G2 progeny with one copy in the same position as the Tg4 G1 transgenic chicken Tg4 (he)
  • two positions G2 progeny with two copies in all were expressed as Tg33 (he) 4 (he).
  • Tg33 (he) 4 (he) all 431bp, 610bp, 315bp and 480bp amplicons were obtained, indicating that the transgene was expressed on both chromosome 33 and chromosome 4.
  • Egg whites obtained from the transgenic chickens prepared in Example 4 were sheared and homogenized at 25 ° C. for 30 minutes. Three volumes of reverse osmosis water were added to the egg white suspension and stirred for 30 minutes. The egg white suspension was adjusted to pH 6.0 with 0.5 M phosphoric acid and centrifuged at 12,100 ⁇ g for 20 minutes to remove most egg white protein including ovomucin. Next, the supernatant was adjusted to pH 7.4 using 0.5 M dibasic sodium phosphate, the sample was filtered using a 0.2 ⁇ M syringe filter, and then a Protein A column (5 ml; GE Healthcare). Human IgG was purified using.
  • the Protein A column was washed with column volume 5 times loading buffer (20 mM sodium phosphate, pH7.4), 200 ml of sample was loaded into the column and then column volume 16 times loading buffer.
  • Human IgG protein was obtained using an elution buffer (100 mM sodium citrate, pH3.0) of three times the column volume.
  • the mAb concentration was 2.04 ⁇ g / ml for Tg4 (he) and 2.21 ⁇ g / ml for Tg33 (he), and there was no statistically significant difference. Confirmed.
  • Western blot showed that both light and heavy chains corresponding to anti-human IgG antibodies were detected in purified egg whites of both transgenic hens, through which cCD20 mAb was successfully It was confirmed that it was expressed and produced through egg whites.
  • the non-reduced form of mAb purified through SDS-PAGE had a size of 150 kDa, and for the reduced mAb, two heavy chains (H, about 50 kDa) and light chains (L, about 25 kDa). It was confirmed that it is composed of).
  • ELg assay showed that Tg33 (he) 4 (he), which has two transgenes, was significantly higher than Tg4 (he), and four transgenes were expressed. Tg33 (ho) 4 (ho) possessed higher amounts of antibodies.
  • Antibody N-glycan analysis was performed to analyze the sugar chain content of the cCD20 mAb obtained in Example 7. Specifically, N-glycan analysis was performed by treating PNGase F in the antibody according to LC / MS / MS test to isolate only the charged N-glycan and fluorescent labeling. The results are shown in FIG.
  • cCD20 mAb Tg33 (he) 4 (he) and Tg33 (ho) 4 (ho) produced from transgenic chickens were used.
  • Flow cytometry was performed. Specifically, the cCD20 mAb and rituximab (MabThera, Roche) were treated with Raji cells, B lymphocyte cell lines expressing CD20.
  • the binding capacity of cCD20 mAb to Raji cells was similar to rituximab used as a control in all concentration ranges.
  • the binding efficiency of all control and experimental groups at the concentration of 0.01, 0.1, 1, 5 and 10 ⁇ g / ml is very similar.
  • the cCD20 mAb produced in the transgenic chicken had a Fab binding capacity similar to that of rituximab, which is a commercial CD20 mAb.
  • Apoptosis was measured by flow cytometry (FACSCalibur, BD Biosciences, San Jose, Calif., USA) by staining Raji cells with Annexin V / PI (Thermo Fisher Scientific). Cells that were negative for Annexin V were considered survival and cells that were positive for Annexin V were considered apoptosis. The results are shown in c and d of FIG.
  • Complement-dependent cytotoxicity (CDC) analysis was performed by modifying a previous study (Natsume, et al. 2009). Specifically, Raji cells were seeded into opaque 96-well plates and used as target cells, and anti-CD20 antibodies (rituximab or two types of cCD20 mAb Tg33 (he) 4 (he) and Tg33 (ho) were used as target cells. 4 (ho)) is treated at a concentration of 0.0001 ⁇ g / ml to 100 ⁇ g / ml, followed by a medium containing 16% of human serum (Sigma, St. Louis, MO, USA) as a source of complement It was.
  • E is the absorbance of the experimental well
  • S is the absorbance of the well without mAb (cells cultured only with culture medium and complement)
  • M is the absorbance of the culture medium and complement (no target cells and antibodies).
  • each cCD20 mAb showed a high concentration-dependent CDC activity compared to rituximab.
  • ADCC Antibody-dependent cell-cytotoxicity assay
  • control anti-CD20 antibody, rituximab and chicken cCD20 mAb were sequentially diluted and reacted with WIL2-S cells for 6 hours at 5% carbon dioxide at 37 ° C, followed by Bio-Glo TM Luciferase Assay and Microplate Reader. Cytotoxicity was measured using. The results are shown in FIG.
  • the luminescence intensity was higher in cCD20 mAb compared to the control antibody, rituximab.
  • Control CD20 mAb and rituximab showed ADCC activity of 5.82 x 10 -9 EC 50 and 1.05 x 10 -9 EC 50
  • two types of cCD20 mAb produced in transgenic chickens were Tg33 (he) 4 (he ) ADCC activity of 1.26 x 10 -10 EC 50 and 6.77 x 10 -11 EC 50 at Tg33 (ho) 4 (ho), 8.3-fold and 15.5-fold higher ADCC for B lymphoid cells than rituximab, respectively It was confirmed to show activity.
  • the maximum ADCC activity of cCD20 mAb produced in transgenic chicken was 50% higher than rituximab, confirming that cCD20 mAb can increase ADCC activity more efficiently than rituximab produced in CHO cells.
  • Transgenic cell lines secreting monoclonal antibodies having the above characteristics were deposited with Korean Cell Line Bank (KCLB) under accession no. KCLRF-BP-00431 on May 11, 2018.
  • the transgenic cell line is a primordial germ cell, which can be transplanted into an embryo of a receptor bird to produce cCD20 mAb with high efficiency, and the monoclonal antibody has superior CDC and ADCC activity and has better efficacy than rituximab. It can be used as).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Environmental Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법에 관한 것이다. 본 발명에 따른 형질전환 조류의 제조방법은 고효율로 효능이 개선된 인간 CD20 특이적 단일클론항체를 생산하는 형질 전환 개체를 제조할 수 있어 바이오베터(biobetter) 생산에 적합한 새로운 모델로 제시될 수 있다. 본 발명에 따른 형질전환 조류로부터 생산된 인간 CD20 특이적 단일클론항체는 당쇄구조 분석 결과 비푸코실화(afucosylation)되어 상용 CD20 단일클론항체보다 CDC(complement dependent cytotoxicity, 보체매개성 면역반응)가 높고, ADCC(antibody dependent cell-mediated cytotoxicity, 항체매개성 면역반응)의 경우 대조약보다 약 8-16배의 효율이 높아 경제적이고 안정적인 항체 제조 방법으로 널리 활용될 수 있을 것으로 기대된다.

Description

효능이 개선된 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법
본 발명은 효능이 개선된 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법에 관한 것이다.
다양한 줄기세포 및 배아를 활용한 생명공학 기술과 고효율의 유전자 발현 조절기술 등을 복합적으로 활용한 형질전환 동물 생산은 인류가 직면한 난치병의 치료제 및 건강수명 증진을 위한 핵심기술로 주목 받고 있다.
닭의 경우, 포유류 가축들에 비해 산자수가 많고, 달걀을 통한 단백질의 대량생산이 가능하며, 계란(알)의 경우 난 단백질이 10여 종에 불과하여 알을 통하여 생산된 단백질로부터 원하는 물질을 분리 정제하는 것이 용이해 이상적인 생체반응기(bioreactor) 동물로 간주되고 있다. 그러나, 조류에 특화된 기술개발 및 연관기술의 도입이 포유류에 비해 상대적으로 뒤쳐져 실용기술 개발에 한계가 있었다.
이처럼 형질전환 닭이 치료용 항체 또는 기능적 물질 생산에 탁월한 장점을 가지고 있음이 기존의 연구를 통해 잘 알려져 있지만, 기술적 한계에 의해 높은 효율의 형질전환 조류 생산 및 알을 통한 의약용 단백질 생산 연구는 진행된 바가 거의 없다.
이에, 본 발명자들은 닭의 난관 특이 발현을 위한 오브알브민 (Ovalbumin, OV) 프로모터를 포함하는 piggyBac 트랜스포존(transposon)을 사용하여 닭의 원시생식세포(primordial germ cells, PGCs)를 형질전환 시키고, 이로부터 높은 효율로 형질전환 자손 생산이 가능하고, 생산된 형질전환 닭으로부터 CDC(complement dependent cytotoxicity, 보체매개성 면역반응)가 높고, ADCC(antibody dependent cell-mediated cytotoxicity, 항체매개성 면역반응)가 높은 인간 CD20 특이적 단일클론항체가 높은 효율로 생산됨을 확인하고 본 발명을 완성하였다.
따라서, 본 발명의 목적은 (a) 5' 및 3' 피기백 트랜스포존(piggyBac transposon) 특이적 역위 말단 반복부(Terminal Repeat, TR); 및 (b) 상기 5' TR과 3' TR 사이에 위치하는 오브알부민 프로모터 및 상기 오브알부민 프로모터에 작동가능하도록 연결된 인간 CD20 특이적 단일클론항체를 코딩하는 유전자를 포함하는 재조합 벡터를 제공하는 데에 있다.
또한, 본 발명의 목적은 상기 재조합 벡터로 형질전환된 공여생식세포주를 제공하는 데에 있다.
또한, 본 발명의 목적은 상기 공여생식세포주를 수용체 조류의 배아에 이식하는 단계를 포함하는 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류모델의 제조방법을 제공하는 데에 있다.
또한, 본 발명의 목적은 상기 방법으로 제조된 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류모델 및 상기 형질전환 조류모델로부터 인간 CD20 특이적 단일클론항체를 수득하는 단계를 포함하는 인간 CD20 특이적 단일클론항체의 제조방법을 제공하는 데에 있다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 (a) 5' 및 3' 피기백 트랜스포존(piggyBac transposon) 특이적 역위 말단 반복부(Terminal Repeat, TR); 및 (b) 상기 5' TR과 3' TR 사이에 위치하는 오브알부민(Ovalbumin, OV) 프로모터 및 상기 오브알부민 프로모터에 작동가능하도록 연결된 인간 CD20 특이적 단일클론항체를 코딩하는 유전자를 포함하는 재조합 벡터를 제공한다.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 공여생식세포주를 제공한다.
또한, 본 발명은 상기 공여생식세포주를 수용체 조류의 배아에 이식하는 단계를 포함하는 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류모델의 제조방법을 제공한다.
또한, 본 발명은 상기 방법으로 제조된 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류모델을 제공한다.
또한, 본 발명은 상기 형질전환 조류모델로부터 인간 CD20 특이적 단일클론항체를 수득하는 단계를 포함하는 인간 CD20 특이적 단일클론항체의 제조방법을 제공한다.
또한, 본 발명은 상기 방법으로 생산한 인간 CD20 특이적 단일클론항체를 제공한다.
본 발명에 따른 형질전환 조류의 제조방법은 고효율로 효능이 개선된 인간 CD20 특이적 단일클론항체를 생산하는 형질 전환 개체를 제조할 수 있어 바이오베터(biobetter) 생산에 적합한 새로운 모델로 제시될 수 있다. 본 발명에 따른 형질전환 조류로부터 생산된 인간 CD20 특이적 단일클론항체는 당쇄구조 분석 결과 비푸코실화(afucosylation)되어 상용 CD20 단일클론항체보다 CDC(complement dependent cytotoxicity, 보체매개성 면역반응)가 높고, ADCC(antibody dependent cell-mediated cytotoxicity, 항체매개성 면역반응)의 경우 대조약보다 약 8-16배의 효율이 높아 경제적이고 안정적인 항체 제조 방법으로 널리 활용될 수 있을 것으로 기대된다.
도 1은 본 발명에 따른 재조합 벡터의 개열지도 및 상기 재조합 벡터를 도입한 닭의 형질전환 여부를 확인한 결과를 나타낸 도이다. 도 1의 a: piggyBac cCD20 mAb 재조합 벡터의 개열지도, 도 1의 b: 트랜스진(transgene, 외래유전자)을 가진 형질전환 닭의 G0부터 G3까지의 계통도 및 트랜스진을 가진 각 세대 형질전환 닭의 유전체를 분석한 결과를 나타낸 도, 도 1의 c: 야생형 및 형질전환 타겟 부위(transgenic loci)를 검출하기 위한 트랜스진 특이적 프라이머 세트의 모식도, 도 1의 d: G2에서 트랜스진 특이적 프라이머를 사용한 이형접합성 형질전환 닭 [Tg33(he)4(he)] 및 동형접합성 형질전환 닭 [Tg33(ho)4(ho)]의 PCR 수행 결과.
도 2는 형질전환 닭의 조직들에 대한 cCD20 mAb 특이적 프라이머를 사용한 난관 팽대부(magnum) 특이적인 트랜스진 발현 검증 결과를 나타낸 도이다.
도 3은 DNA walking을 통한 cCD20 mAb 트랜스진의 유전자 삽입 위치 검증 결과를 나타낸 도이다.
도 4는 ELISA 및 웨스턴 블랏을 통해 형질전환 닭으로부터 생산된 cCD20 mAb의 확인 및 이를 정량화한 결과를 나타낸 도이다. 도 4의 a: G2 Tg4(he)와 G2 Tg33(he)에서 분리한 항-인간 IgG 항체를 이용한 ELISA를 통해 정제된 cCD20 mAb의 농도 측정 결과, 도 4의 b: G2 Tg4(he)와 G2 Tg33(he) 형질전환 닭으로부터 수득한 난백에서 발현된 항-인간 IgG 항체의 웨스턴 블랏 수행 결과, 도 4의 c: SDS-PAGE 이후 G2 Tg33(he)Tg4(he)와 G2 Tg33(ho)4(ho)형질전환 닭에서 cCD20 mAb를 확인하기 위한 쿠마시 블루 염색 결과, 도 4의 d: 항-인간 IgG 항체를 이용한 ELISA를 통한 G3 91ho/87ho 형질전환 닭에서 정제된 cCD20 mAb의 정량 결과 (***p < 0.001, **p < 0.01).
도 5는 형질전환 닭으로부터 생산된 cCD20 mAb의 N-글리칸 당쇄 함량 분석 결과를 나타낸 도이다. 도 5의 a: 분석 시료(cCD20 mAb)의 당쇄 구조, 도 5의 b: 이온 추출 크로마토그래피(XIC)를 통한 14개 N-글리칸 프로필 분석 결과.
도 6는 형질전환 닭으로부터 생산된 cCD20 mAb의 결합력 분석 및 세포사멸능력을 분석한 결과를 나타낸 도이다. 도 6의 a: 0.01, 0.05, 0.1, 0.5, 1, 5 또는 10㎍/ml의 cCD20 mAb 처리 후 CD20 결합 친화도에 대한 유세포 분석 수행 결과, 도 6의 b: 0.01, 0.1, 1, 5 또는 10㎍/ml 항체 처리 후 cCD20 mAb 및 리툭시맙의 결합 친화도를 확인하기 위한 농도별 평균 형광 강도(MFI) 값 분석 결과, 도 6의 c: 5㎍/ml의 cCD20 mAb 처리 후 유세포 분석기에 의한 Raji 세포에서의 apoptotic 세포 분석 결과(양성 대조군으로 리툭시맙 사용), 도 6의 d: 0.1, 1 또는 5㎍/ml 항체 처리 후 apoptotic 세포 분석 결과 (양성 대조군으로 리툭시맙 사용, 음성 대조군으로 cCD20 mAb 비처리군 사용; ***p<0.001, p>0.05는 유의차 없음).
도 7은 형질전환 닭으로부터 생산된 cCD20 mAb의 CDC 활성 분석 결과를 나타낸 도이다(***p<0.001).
도 8은 형질전환 닭으로부터 생산된 cCD20 mAb의 ADCC 활성 분석 결과를 나타낸 도이다(***p<0.001).
이하, 본 발명을 상세히 설명한다.
본 발명은 (a) 5' 및 3' 피기백 트랜스포존(piggyBac transposon) 특이적 역위 말단 반복부(Terminal Repeat, TR); 및 (b) 상기 5' TR과 3' TR 사이에 위치하는 오브알부민(Ovalbumin, OV) 프로모터 및 상기 오브알부민 프로모터에 작동가능하도록 연결된 인간 CD20 특이적 단일클론항체를 코딩하는 유전자를 포함하는 재조합 벡터를 제공한다.
본 명세서에서 사용된 용어 '단일클론 항체'란 당해 분야에 공지된 용어로서 단일 항원성 부위에 대해서 지시되는 고도의 특이적인 항체를 의미한다. 통상적으로, 상이한 에피토프(항원결정기)들에 대해 지시되는 상이한 항체들을 포함하는 다클론 항체와는 다르게, 단일클론 항체는 항원상의 단일 결정기에 대해서 지시된다. 단일클론항체는 항원-항체 결합을 이용하는 진단 및 분석학적 분석법의 선택성과 특이성을 개선시키는 장점이 있으며, 또한 하이브리도마 배양에 의해 합성되기 때문에 다른 면역글로불린에 의해 오염되지 않는 장점을 갖는다. 본 명세서의 인간 CD20 특이적 단일클론항체는, 전체 항체 형태뿐 아니라 항체 분자의 기능적인 단편을 포함한다. 전체 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조이며 각각의 경쇄는 중쇄와 다이설파이드 결합으로 연결되어 있다. 중쇄 불변 영역은 감마(γ), 뮤(μ), 알파(α), 델타(δ), 엡실론(ε) 타입을 가지고 서브클래스로 감마1(γ1), 감마2(γ2), 감마3(γ3), 감마4(γ4), 알파1(α1) 및 알파2(α2)를 가진다. 경쇄의 불변영역은 카파(κ) 및 람다(λ) 타입을 가진다.
상기 항체 분자의 기능적인 단편이란 항원 결합 기능을 보유하고 있는 단편을 뜻하며 Fab, F(ab'), F(ab')2, 및 Fv 등을 포함한다. 항체 단편 중 Fab는 경쇄 및 중쇄의 가변영역과 경쇄의 불변 영역 및 중쇄의 첫 번째 불변영역(CH1)을 가지는 구조로 1개의 항원 결합부위를 가진다. Fab'는 중쇄 CH1 도메인의 C 말단에 하나 이상의 시스테인 잔기를 포함하는 힌지 영역(hinge region)을 가진다는 점에서 Fab와 차이가 있다. F(ab')2 항체는 Fab'의 힌지 영역의 시스테인 잔기가 디설파이드 결합을 이루고 있다. Fv는 중쇄 가변영역 및 경쇄 가변영역만을 가지고 있는 최소의 항체조각을 말하며, dsFv(이쇄 Fv)는 비공유 결합으로 중쇄 가변영역과 경쇄 가변영역이 연결되어 있고 scFv(단쇄 Fv)는 일반적으로 펩타이드 링커를 통하여 중쇄의 가변 영역과 단쇄의 가변 영역이 공유 결합으로 연결되거나 또는 C 말단에서 바로 연결되어 있어서 dsFv와 같이 다이머와 같은 구조를 이룰 수 있다.
본 명세서에서 사용되는 용어 '벡터'는 프로모터로 하여금 외부 DNA 서열의 발현, 즉 전사 및 번역을 유도하도록 하는 모든 핵산 분자, 바람직하게는 DNA 서열을 의미한다.
본 발명에 있어서, 상기 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 IRES(internal ribosome entry site)를 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 재조합 벡터는 5' TR과 3' TR 사이에 위치하는 하나 이상의 에스트로겐 반응 요소(estrogen response element, ERE)를 더 포함하는 것을 특징으로 할 수 있다.
또한, 본 발명에 있어서, 상기 재조합 벡터는 오브알부민 유전자의 3' UTR을 더 포함하는 것을 특징으로 할 수 있다.
또한, 본 발명에 있어서, 상기 재조합 벡터는 폴리아데닐화 부위(polyadenylation site, poly A)를 더 포함하는 것을 특징으로 할 수 있다.
상기 에스트로겐 반응 요소는 본 발명의 유전자를 과발현 시키기 위한 것으로, 에스트로겐과 반응하는 경우, 유전자 발현이 증가한다. 또한, 오브알부민은 조류의 난관 내에서 가장 발현이 높은 단백질로, 상기 프로모터는 난관 내 특이적으로 발현할 수 있도록 한다(오브알부민 프로모터 또는 난관 특이적 프로모터). 본 발명의 일 구현예에 있어서, 상기 오브알부민 프로모터는 5' TR과 3' TR 사이에 위치하며, OV 5' UTR을 코딩하는 서열을 포함하는 것을 특징으로 한다.
본 명세서에서 사용되는 용어 '프로모터'는 코딩 서열 또는 기능적 RNA의 발현을 조절하는 DNA 서열을 의미한다.
본 발명의 벡터는 형질도입된 세포를 확인하기 위하여, 항생제 내성 유전자를 포함시킬 수 있으며, 상기 항생제는 바람직하게는 네오마이신일 수 있다.
본 발명의 일 구현예에 있어서, 5' TR 및 3' TR은 각각 서열번호 3 및 11로 표시되는 염기서열로 이루어진 것을 특징으로 한다. 또한, OV 유전자의 5' UTR를 포함하는 오브알부민의 프로모터(난관 특이적 프로모터)는 서열번호 7로 표시되는 염기서열로 이루어진 것을 특징으로 하며, OV 유전자의 3' UTR은 서열번호 10으로 표시되는 염기서열로 이루어진 것을 특징으로 한다. 나아가, 본 발명의 재조합 벡터는 서열번호 5로 표시되는 염기서열로 이루어진 네오마이신 내성 유전자를 포함한다.
상기 염기서열들의 변이체가 본 발명의 범위 내에 포함되는 것으로 본다. 구체적으로, 본 발명에 따른 유전자는 상기 염기서열과 각각 70% 이상, 80% 이상, 90% 이상 또는 95% 이상의 서열 상동성을 갖는 염기서열을 포함할 수 있다.
본 발명에 있어서, 상기 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 서열번호 1로 표시되는 인간 CD20 특이적 단일클론항체의 경쇄영역을 코딩하는 유전자 및 서열번호 2로 표시되는 인간 CD20 특이적 단일클론항체의 중쇄영역을 코딩하는 유전자를 포함하는 것을 특징으로 할 수 있다.
보다 구체적으로는, 상기 서열번호 1로 표시되는 인간 CD20 특이적 단일클론항체의 경쇄영역을 코딩하는 유전자는 인간의 CD20 항원에 결합 하는 항체의 카파 경쇄를 발현하는 항체 발현 부위 유전자 서열로 항-CD20 mAb의 경쇄 가변영역과 경쇄 불변영역 모두를 코딩하는 서열이며(V L + hIg 카파 부위), 해당 서열에 의해 번역된 아미노산은 경쇄가변영역 중 카파를 구성하며 Fab 조각의 일부를 구성한다. 또한, 상기 서열번호 2로 표시되는 인간 CD20 특이적 단일클론항체의 중쇄영역을 코딩하는 유전자는 항-CD20 mAb의 중쇄 가변영역(CDR)과 중쇄 불변영역(CH1, CH2, CH3) 모두를 코딩하는 서열이며(V H + hIgG 불변 부위), 해당 서열에 의해 번역된 아미노산은 항체의 Fab 조각의 일부 및 Fc 조각을 구성한다. 이를 이용해 면역세포들이 해당 항체를 인지할 수 있고, 항체매개성 면역반응(Antobody dependent cell cytotoxicity, ADCC)을 유도 할 수 있다.
상기 서열번호 1 또는 2 외에도 상기 서열들의 변이체가 본 발명의 범위 내에 포함되는 것으로 본다. 변이체는, 염기서열은 변화되지만 서열번호 1 또는 2의 염기서열과 유사한 기능적 특성, 즉 인간 CD20 특이적 단일클론항체의 경쇄영역 또는 중쇄영역을 코딩하는 특성을 갖는 염기서열로 이루어진 폴리뉴클레오티드를 의미한다. 구체적으로, 본 발명에 따른 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 서열번호 1 또는 2의 염기서열과 각각 70% 이상, 80% 이상, 90% 이상 또는 95% 이상의 서열 상동성을 갖는 염기서열을 포함할 수 있다.
본 발명에 있어서, 상기 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 닭에서의 효율적인 발현을 위해 코돈최적화된 것을 특징으로 할 수 있다.
본 명세서에서 사용되는 용어 '코돈 최적화'란 특정 유전자를 다른 개체에서 발현시키는 경우, 유전자가 동일한 아미노산 서열을 갖는 단백질을 발현할 수 있도록, 유전자의 염기서열을 변환시키는 것을 의미한다. 본 발명의 코돈 최적화된 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 이를 조류에서 발현시키는 경우, 인간에서 발현되는 경우와 동일한 아미노산 서열을 갖는 단백질을 생산할 수 있으며, 본 명세서 내에서는 c(chickenized)CD20과 병용하여 사용된다.
또한, 본 발명에 따른 재조합 벡터는 상기 서열번호 1로 표시되는 인간 CD20 특이적 단일클론항체의 경쇄영역을 코딩하는 유전자 및 서열번호 2로 표시되는 인간 CD20 특이적 단일클론항체의 중쇄영역을 코딩하는 유전자 사이에 pIRES intron 및 IRES를 포함할 수 있다. 상기 pIRES intron은 IRES의 인트론 서열로서 IRES에 의한 유전자 번역이 효율적으로 일어날 수 있도록 하며, IRES(internal ribosome entry site)는 단백질 번역과정에서 리보솜이 결합하는 부위로 상기 유전자 사이에 존재하여 번역을 효율적으로 일어날 수 있도록 한다. 본 발명의 일 구현예에서, 상기 IRES는 V L + hIg 카파 부위를 발현하는 유전자와 V H + hIgG 불변 부위를 발현하는 유전자 사이에 존재하여, 전사 후 단백질 번역 과정에서 온전한 형태의 인간 CD20 mAb를 발현함으로써 하나의 발현 벡터의 형질도입으로 목적하는 항체의 발현을 유도할 수 있다.
본 발명의 일 구현예에 있어서, 상기 재조합 벡터는 5' TR, poly A, 네오마이신 내성 유전자(Neo R), SV40, OV 프로모터(OV 3.5), 인간 CD20 특이적 chickenized 단일클론항체(cCD20 mAb), OV 유전자의 3' UTR(OV 3'UTR) 및 3' TR를 코딩하는 유전자를 포함할 수 있다. 또한, 상기 인간 CD20 특이적 단일클론항체는 V L + hIg 카파 부위, pIRES intron, IRES 및 V H + hIgG 불변 부위를 코딩하는 유전자를 포함할 수 있다.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 공여생식세포주를 제공한다.
본 발명에 있어서, 상기 공여생식세포주는 공여체 조류의 원시생식세포(primordial germ cells, PGCs)인 것을 특징으로 할 수 있다. 또한, 상기 원시생식세포는 상기 공여체 조류의 1-10일령 배아의 원시 생식기로부터 유래된 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 공여체 조류는 닭, 메추라기, 칠면조, 오리, 거위, 꿩 및 비둘기를 포함하며, 바람직하게는 닭인 것을 특징으로 할 수 있다.
또한, 본 발명에 있어서, 상기 공여생식세포주는 수탁번호가 KCLRF-BP-00431임을 특징으로 할 수 있다.
또한, 본 발명은 본 발명에 따른 공여생식세포주를 수용체 조류의 배아에 이식하는 단계를 포함하는 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류모델의 제조방법을 제공한다. 본 발명의 바람직한 양태에서, 본 발명의 형질전환 조류모델은 도 1의 a의 개열지도를 갖는 형질전환용 벡터로 형질전환된 것일 수 있다. 상기 형질전환 조류모델은 인간 CD20 특이적 단일클론항체를 생산할 수 있다.
또한, 본 발명은 상기 형질전환 조류모델로부터 인간 CD20 특이적 단일클론항체를 수득하는 단계를 포함하는 인간 CD20 특이적 단일클론항체의 제조방법 및 상기 제조방법으로 생산한 인간 CD20 특이적 단일클론항체를 제공한다.
본 발명의 단일클론항체는 정제하지 않은 상태로 사용될 수 있으나, 당업계에서 통상적으로 사용되는 방법에 따라 필요에 의해 정제하여 사용될 수 있다. 이러한 정제 방법의 예로는 투석, 염 침전, 이온 교환 크로마토그래피, 크기 배제 크로마토그래피, 친화성크로마토그래피 등이 있으나, 상기 예에 의해 본 발명의 항체 정제 방법이 제한되는 것은 아니다.
또한 본 발명의 단일클론 항체는 항원의 특정 에피토프를 인식하여 항원-항체 복합체의 결합특성을 갖는 한, 2개의 전체 길이의 경사슬 및 2개의 전체 길이의중사슬을 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab')2 및 Fv 등일 수 있다.
본 발명의 형질전환 조류모델은 인간 CD20 특이적 단일클론항체가 난관 특이적으로 발현되어 난백 내에 축적되어 고효율로 인간 CD20 특이적 단일클론항체를 생산할 수 있다.
상기 인간 CD20 특이적 단일클론항체는 비푸코실화(afucosylation)된 것을 특징으로 할 수 있다. 나아가, 비푸코실화된 결과로서 Fc 도메인에 의한 세포면역 기능이 향상된 것을 특징으로 할 수 있다. 구체적으로, 본 발명의 일 실시예에서는 본 발명에 따라 생산된 인간 CD20 특이적 단일클론항체는 비푸코실화된 결과로서 상용 CD20 단일클론항체보다 CDC(complement dependent cytotoxicity, 보체매개성 면역반응)가 높고, ADCC(antibody dependent cell-mediated cytotoxicity, 항체매개성 면역반응)의 경우 대조약보다 약 8-16배의 효율이 높음을 확인하고 있다. 상기 실시예에서는, 대조약으로 리툭시맙(rituximab)을 사용하였다.
본 명세서에서 사용되는 용어 '비푸코실화'는 푸코스 잔기가 제거된 상태의 항체를 의미한다. 갈락토실화(galactosylation)와 더불어, 비푸코실화는 항체의 ADCC 및 CDC에 큰 영향을 미치는 중요한 당쇄 변형방법으로 널리 알려져 있다.
나아가, 상기 인간 CD20 특이적 단일클론항체는 증가된 ADCC(항체매개성 면역반응)에 따른 CD20 발현 암에 대한 치료 효과를 나타낼 수 있는 것을 특징으로 한다.
본 명세서에서 사용되는 용어 'CD20 발현'은 종양 또는 암, 바람직하게는 비-고형 종양으로부터의 세포, 바람직하게는 T 또는 B 세포, 더욱 바람직하게는 B 세포의 세포 표면 상에서 유의한 발현 수준의 CD20 항원을 나타내는 것으로 의도된다.
본 명세서에서 사용되는 용어 'CD20 발현 암'은 암 세포가 CD20 항원의 발현을 나타내는 모든 암을 말한다. 이러한 CD20 발현 암은 예를 들어, 림프종, 림프구성 백혈병, 폐암, 비소세포 폐(NSCL)암, 세기관지폐포 폐암, 뼈암, 췌장암, 피부암, 머리 또는 목암, 피부 또는 안내(intraocular) 흑색종, 자궁암, 난소암, 직장암, 항문부암, 위암, 위장암, 결장암, 유방암, 자궁암, 난관암종, 자궁내막암종, 자궁경부암종, 질암종, 외음부암종, 호지킨 질환, 식도암, 소장암, 내분비계암, 갑상선암, 부갑상선암, 부신암, 연조직육종, 요도암, 음경암, 전립선암, 방광암, 신장 또는 요관암, 콩팥세포암종, 콩팥골반암종, 중피종, 간세포암, 담관암, 중추 신경계(CNS)의 신생물, 척추종양, 뇌줄기신경아교종, 다형성 아교모세포종, 별아교세포종, 신경초종, 뇌실막세포종, 속질모세포종, 수막종, 편평세포암종, 뇌하수체샘종일 수 있고, 상기 임의의 암 중 난치성 유형을 포함하며, 또는 상기 암 중 1 종 이상의 조합일 수 있다. 'CD20 발현 암' 환자는 당업계에 공지된 표준 어세이에 의해 결정될 수 있다. 예를 들어 CD20 항원 발현은 면역조직화학 (IHC) 검출, FACS, 또는 상응하는 mRNA 의 PCR-기반 검출을 통해 측정될 수 있다.
따라서, 본 발명의 형질전환 조류모델 및 이를 통해 생산된 인간 CD20 특이적 단일클론항체는 약학적 조성물 등 의약학을 비롯한 관련분야에서 유용하게 사용될 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
실시예 1. 실험동물 모델
모든 동물실험은 서울대학교 동물실험센터의 승인 하에 수행되었다(SNU-150827-1). 실험에 사용된 닭은 서울대학교 동물 농장의 표준 관리 프로그램에 따라 유지 및 관리 하였으며, 동물의 관리, 생식 및 배아 조작은 서울대학교 동물 유전공학과의 표준 프로토콜을 준수하여 진행하였다.
실시예 2. piggyBac 항-CD20 mAb 발현 재조합 벡터 구축
piggyBac 트랜스포존을 이용하여 piggyBac OV 항-CD20 mAb 발현 재조합 벡터를 제작하였다. 항-CD20 mAb(monoclonal antibody, 단일클론항체) 유전자는 Gallus gallus Codon Usage database ( https ://www.kazusa.or.jp/codon)를 이용하여 암탉에서 발현되기에 적합하도록 코돈 최적화하였다. 코돈 최적화된 닭화(chickenized) CD20 mAb(cCD20 mAb) 유전자는 경쇄에 해당하는 V L + hIg 카파 부위 및 중쇄에 해당하는 V H hIgG 불변 부위와 함께 닭 라이소자임(lysozyme) 신호 펩타이드 서열을 포함하고, 내부 리보솜 유입점(internal ribosome entry site, IRES)과 연결하였다. 상기 발현 카세트를 1.4kb의 OV 프로모터 및 1.6kb의 OV 5' UTR 영역; 폴리-A 꼬리 서열을 포함하는 1.6kb의 OV 3' UTR 영역을 포함하는 piggyBac 백본(backbone)에 연결하였다. 상기 재조합 벡터의 개열지도를 도 1의 a에 나타내었다. 사용한 모든 유전자, 3' UTR, 5' TR, 3' TR 및 프로모터의 서열 정보는 하기 표 1에 나타내었다.
이름 서열 (5' - 3') 서열번호
인간 CD20 mAb의 경쇄(V L + hIg Kappa) ATGGATTTTCAGGTGCAGATTATCAGCTTCCTGCTAATCAGTGCTTCAGTCATAATGTCCAGAGGACAAATTGTTCTCTCCCAGTCTCCAGCAATCCTGTCTGCATCTCCAGGGGAGAAGGTCACAATGACTTGCAGGGCCAGCTCAAGTGTAAGTTACATCCACTGGTTCCAGCAGAAGCCAGGATCCTCCCCCAAACCCTGGATTTATGCCACATCCAACCTGGCTTCTGGAGTCCCTGTTCGCTTCAGTGGCAGTGGGTCTGGGACTTCTTACTCTCTCACCATCAGCAGAGTGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTGGACTAGTAACCCACCCACGTTCGGAGGGGGGACCAAGCTGGAAATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAG 1
인간 CD20 mAb의 중쇄(V H hIgG constant) AGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTATAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCCCCGGGTAAATGAGG 2
5' TR ATGCGTCAATTTTACGCAGACTATCTTTCTAGGG 3
Poly A GAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTG 4
Neomycin-resistance gene ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGTGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA 5
SV40 GGGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCG 6
3.5kb OV promoter AGTACGCATATAAAGGGCTGGGCTCTGAAGGACTTCTGACTTTCACAGATTATATAAATCTCAGGAAAGCAACTAGATTCATGCTGGCTCCAAAAGCTGTGCTTTATATAAGCACACTGGCTATACAATAGTTGTACAGTTCAGCTCTTTATAATAGAAACAGACAGAACAAGTATAAATCTTCTATTGGTCTATGTCATGAACAAGAATTCATTCAGTGGCTCTGTTTTATAGTAAACATTGCTATTTTATCATGTCTGCATTTCTCTTCTGTCTGAATGTCACCACTAAAATTTAACTCCACAGAAAGTTTATACTACAGTACACATGCATATCTTTGAGCAAAGCAAACCATACCTGAAGGTGCAATAGAGCAGAATATGAATTACATGCGTGTCTTTCTCCTAGACTACATGACCCCATATAAATTACATTCCTTATCTATTCTGCCATCACCAAAACAAAGGTAAAAATACTTTTGAAGATCTACTCATAGCAAGTAGTGTGCAACAAACAGATATTTCTCTACATTTATTTTTAGGGAATAAAAATAAGAAATAAAATAGTCAGCAAGCCTCTGCTTTCTCATATATCTGTCCAAACCTAAAGTTTACTGAAATTTGCTCTTTGAATTTCCAGTTTTGCAAGCCTATCAGATTGTGTTTTAATCAGAGGTACTGAAAAGTATCAATGAATTCTAGCTTTCACTGAACAAAAATATGTAGAGGCAACTGGCTTCTGGGACAGTTTGCTACCCAAAAGACAACTGAATGCAAATACATAAATAGATTTATGAATATGGTTTTGAACATGCACATGAGAGGTGGATATAGCAACAGACACATTACCACAGAATTACTTTAAAACTACTTGTTAACATTTAATTGCCTAAAAACTGCTCGTAATTTACTGTTGTAGCCTACCATAGAGTACCCTGCATGGTACTATGTACAGCATTCCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAGACAACTCAGAGTTCACC 7
pIRES intron GTTGGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGGTCGATCGAGCATGCATCTAGGGCGGCCAATTC 8
IRES GCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACG 9
3' UTR CATTGCCAACAGAACAAAATCTCAAACTTATGGCTAGTGATGACAGCAGTCAGTTGTCCCATCTGTGACCCACCAAGGCTGGCATGCTGGAATGAGCAGGCTTTGGTGGCTTGTAGTTACTGGACAGCACCACTGACATGGGCAGGGGAAAAACTGAGCATGGTGTAAATCACTGCCTCAAAGCCACTTCTCTGTGCCTGCACCATGCTTGAAAGCTCTTCTACAGGAGCTGGGTTTGTTCAAGAAAGCTTCTGTTTCTCCCATCTGCTTCTTGTACCTTCACAGGGACAGAGTTAGAAGGGTACAGCCATGGCTGGAAGGGGCTGACTTTCAAATGTGCCTAATTTTCCTTTGGTTGCTGCTGCAGCTGCAGAAGAAGGGGTTCAGAAGCCAAGAGCTTTGAGATAAGGATGCCTAACCTATGTTGAAGACATTTGTGCTGACACCTCAGGCCCCAGGATAGGACAACTGCTGGATTGTGGCTAACCCACTAGCTACAGAACCTAATTTATATTACCAGATTAGGAAGAGCAAAAGAACATGTATTTATAACAGGAGGTCTTCTGTGCTTCTCTACTAAAAGGTGCTGTGAAGGAGCCCACAGTGC 10
3'TR CATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGG 11
실시예 3. 형질감염 및 G418을 통한 원시생식세포(PGCs)의 선별
6일령(stage 28) 화이트 레그혼(White Leghorn; WL) 배아의 원시 생식기(embryonic gonad)로부터 수컷 원시생식세포(gPGC) 라인을 확립하였다. 상기 원시생식세포를 60-70%의 상대습도, 5% 이산화탄소 및 37℃조건에서 20%(v/v) 소태아혈청(FBS; Invitrogen, Life Technologies), 2%(v/v) 닭 혈청(Sigma-Aldrich, St. Louis, MO, USA), 13 뉴클레오사이드 믹스(EMD Millipore, Temecula, CA, USA), 2mM L-글루타민, 13 비필수아미노산 믹스, 2-ME, 10mM 피루브산 나트륨(sodium pyruvate) 및 1x 안티바이오틱-안티마이코틱(Invitrogen, LifeTechnologies)이 첨가된 넉아웃(knockout) DMEM((Invitrogen, Life Technologies, Carlsbad, CA, USA) 배지 내에서 유지하였다. 원시생식세포 증식을 활성화시키기 위하여 인간 섬유아세포 성장인자(human basic fibroblast growth factor; 10 ng/ml; Koma Biotech, Seoul, Korea)를 사용하였다. 배양된 원시생식세포를 5-6일 간격으로 미토마이신(mitomycin) 불활성화된 마우스 배아 섬유아세포 위에서 계대 배양하였다. 상기 실시예 2에서 제조한 cCD20 mAb 발현 벡터 및 CAGG-PBase(pCyL43)를 Lipofectamine 2000 시약(Invitrogen, Life Technologies)과 혼합하고 원시생식세포 라인에 도입하여 공-형질감염(co-transfection)시켰다. 형질전환을 수행하고 1일 경과 후, G418(300 ㎍/ml)을 배양 배지에 첨가하여 2xERE-OV 항-CD20 mAB 콜로니를 선별하였다. 선별 과정은 3주까지 소요되었다.
실시예 4. 수용체 배아에 생식세포 주입 및 형질전환 닭의 스크리닝
수용체 배아에 상기 실시예 3에서 선별된 형질감염 원시생식세포를 주입하기 위해, 수용체 오계 (Korean Ogye, KO) 알(HH stage 14-17)의 첨단부에 작은 창을 만들고, 적어도 3000개의 원시생식세포가 포함된 세포 현탁액 2μL를 수용체 배아의 등쪽 대동맥에 주입(microinjection)하였다. 각각의 알에 생긴 창은 파라핀 필름으로 밀봉하였으며, 첨단부를 아래쪽으로 하여 이후 스크리닝 및 부화과정에 이르기까지 유지시켰다. 성 성숙(sex maturation) 이후, 공여체 원시생식세포 유래의 자손을 얻기 위하여 색소침착 억제 우성 유전자( I/I)를 가진 형질전환된 닭 및 색소침착 억제 열성 유전자( i/i)를 가진 야생형 닭 간에 검정교배(testcrossing)를 수행하였다. 그 결과, 사용된 104개의 배아로부터 46마리의 병아리가 부화하였다(44.2%).
추가적으로, 형질전환 닭의 조직 특이적 발현을 확인하기 위하여 PCR을 수행하였다. 야생형 및 형질전환된 타겟 부위를 포함하는 유전자 부위는 cCD20 mAb 서열에 특이적 프라이머를 사용하여 증폭시켰다. PCR은 총 20ml의 100ng 유전체 DNA에 대하여 10x PCR 버퍼(CoreBioSystem, Seoul, Korea), 1.6ml dNTPs(각각 10mM), 각 프라이머 5pmol 및 0.5 U Taq 폴리머레이즈(CoreBioSystem)를 사용하여 다음과 같은 조건으로 수행하였다: 5분 동안 94℃에서 1차 변성을 1회 반복하였고, 후에 30초 동안 94℃에서 변성, 30초 동안 60℃에서 어닐링(annealing) 및 30초 동안 72℃에서 연장하는 단계를 30회 반복하였으며, 마지막으로 10분 동안 72℃에서 후-연장을 1회 반복하였다. 상기 PCR 수행 결과를 도 2에 나타내었다. 사용한 모든 프라이머는 하기 표 2에 나타내었으며, 야생형(WT) DNA를 음성 대조군으로 사용하였다.
프라이머 서열 (5'→3') 크기(bp) 위치 서열번호
Ch33 F GTC GGG GCT CAT CTC TCC CT 431 Ch33 wild-type locus 12
Ch33 wild-type locus R GCG CCA AGT GAC GAT CTG GT 13
Ch33 F GTC GGG GCT CAT CTC TCC CT 610 Ch33 transgene locus 14
Ch33 transgene locus R CCG CTA GCC AAC AAG CTC GT(vector seq) 15
Ch4 F AGA AGC ACA ATA GAG CAA AGG ATG GAA 315 Ch4 wild-type locus 16
Ch4 wild-type locus R TCC TGT GAT GCT CCA GGC CT 17
Ch4 F AGA AGC ACA ATA GAG CAA AGG ATG GAA 480 Ch4 transgene locus 18
Ch4 transgene locus R AGC TCG TCA TCG CTT TGC AGA(vector seq) 19
piggyBac TSP1* GGATCTCATGCTGGAGTTCT - Integration site 20
piggyBac TSP2 GGCGTAATCATGGTCATAGCT - Integration site 21
piggyBac TSP3 GAGCCGGAAGCATAAAGTGT - Integration site 22
cCD20 transgene F ACCCCTGAGGTCACATGCGT 423 cCD20 transgene 23
cCD20 transgene R GGGAGGCGTGGTCTTGTAGT 24
도 2에 나타낸 바와 같이, 형질전환 되지 않은 닭으로부터 수득한 cDNA는 cCD20 특이적 프라이머에 대해 음성이었고, 형질전환된 닭으로부터 수득한 난관 팽대부(magnum)의 cDNA는 cCD20 특이적 프라이머에 대해 양성으로 나타남을 확인하였다.
실시예 5. DNA walking에 따른 트랜스진 ( transgene ) 삽입 부위 확인
DNA Walking SpeedUp Premix Kit-Ⅱ (Seegene, Seoul, Korea)을 제조사의 프로토콜에 따라 사용하여 트랜스진(외래유전자) 삽입 부위를 확인하였다. DNA walking을 3회 실시한 PCR 산물을 아가로즈 젤로부터 추출하고, Power Gel Extraction Kit (Promega, Madison, WI, USA)를 사용하여 정제하여 pGEM-T Easy Vector(Promega)에 클로닝하였다. 클로닝된 PCR 산물들을 ABI Prism 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA)를 사용하여 시퀀싱하였다. 형질전환된 닭에서 트랜스진 삽입 부위를 확인하기 위하여 BLAST Assembled Genome 데이터베이스( http://blast.ncbi.nlm.nih.gov/BLAST.cgi) 및 UCSC Genome Bioinformatics' 브라우저 (http://www.genome.ucsc.edu)를 사용하여 5' 주변부 서열(flanking region)을 분석하였다. 그 결과를 도 3에 나타내었다.
도 3에 나타낸 바와 같이, 수컷 4마리(#9107, #9187, #9615 및 #9643)와 암컷 2마리(#9191 및 #9184)가 cCD20 mAb 트랜스진을 보유하고 있음을 확인하였다. 이 중 4번 염색체에 트랜스진이 삽입된 #9187 수컷 및 33번 염색체에 트랜스진이 삽입된 #9191 암컷을 이후 실험에 사용하였다.
실시예 6. 트랜스진 유전체 분석( genotyping )
동일한 위치에 cCD20 mAb 도입 유전자(트랜스진) 2개를 갖는 동형접합성(homozygous) 닭을 생산하기 위해, 4번 염색체에 cCD20 mAb 도입 유전자를 가진 Tg4(G1) 형질전환 수컷과 33번 염색체에 cCD20 mAb 도입 유전자를 가진 Tg33(G1) 형질전환 암컷을 서로 다른 성별의 야생형 닭과 검정교배하였다. 계속하여, G1 닭으로부터 생산된 형질전환 후손(G2)을 다른 부위(locus)에 트랜스진을 가진 형질전환 닭과 교배하였다. 4번 염색체 및 33번 염색체 모두에 동형접합성 트랜스진을 보유한 4 카피의 동형접합성 닭을 생산하기 위하여, Tg33번 타입 형질전환 수컷(G2)과 Tg4번 타입 형질전환 암컷을 교배하였다. 상기 과정을 통하여 생산한 G0부터 G3까지의 수탉 Tg33 및 암탉 Tg4의 계통도(pedigree)를 도 1의 b에 나타내었다.
야생형 및 형질전환된 타겟 부위를 포함하는 유전자 부위를 특이 프라이머 세트를 사용하여 증폭시켰다. 상기 야생형 및 형질전환 타겟 부위(transgenic loci)를 검출하기 위한 트랜스진 특이적 프라이머 세트의 모식도를 도 1의 c에 나타내었다. 형질전환된 타겟 부위가 존재할 경우, 정방향 프라이머는 닭 유전체에 결합하고, 역방향 프라이머는 닭 유전체 또는 트랜스진에 결합하였다. PCR은 다음과 같은 조건으로 수행하였다: 5분 동안 94℃에서 1차 변성을 1회 반복하였고, 후에 30초 동안 94℃에서 변성, 30초 동안 60℃에서 어닐링(annealing) 및 30초 동안 72℃에서 연장하는 단계를 35회 반복하였으며, 마지막으로 7분 동안 72℃에서 후-연장을 1회 반복하였다. 그 결과를 도 1의 d에 나타내었다.
이하에서는 Tg33 G1 형질전환 닭과 동일한 위치에 1개 카피를 가진 G2 후손을 Tg33(he)로, Tg4 G1 형질전환 닭과 동일한 위치에 1개 카피를 가진 G2 후손을 Tg4(he)로, 두 위치 모두에 2개 카피를 가진 G2 후손을 Tg33(he)4(he)로 표현하였다. 예를 들어, Tg33(he)4(he)에서는 431bp, 610bp, 315bp 및 480bp 앰플리콘이 모두 얻어짐을 통해 트랜스진이 33번 염색체 좌위 및 4번 염색체 좌위 모두에서 발현됨을 확인하였다. 나아가, 2개 카피의 트랜스진을 가진 형질전환 닭(91he/87he)을 동일한 유전체를 가진 형질전환 닭과 교배시킨 경우, 4번 염색체와 33번 염색체 모두에 동형접합성 트랜스진을 가진 4 카피의 동형접합성 닭을[Tg33(ho)4(ho)] 생산함을 확인하였다.
실시예 7. 형질전환 암탉의 난백에서 인간 항체의 추출 및 정제
상기 실시예 4에서 제조한 형질전환 닭으로부터 수득한 계란 난백을 25℃에서 30분간 전단하고 균질화시켰다. 난백 현탁액에 3 부피의 역삼투수를 첨가하고 30분 동안 교반하였다. 난백 현탁액을 0.5M 인산(phosphoric acid)을 사용하여 pH6.0으로 조절하고, 12,100 x g 에서 20분 동안 원심분리하여 오보뮤신(ovomucin)을 포함한 대부분의 난백 단백질을 제거하였다. 다음으로, 상층액을 0.5M 이염기성 인산 나트륨(dibasic sodium phosphate)을 사용하여 pH7.4로 조절하고, 샘플을 0.2μM 시린지 필터를 사용하여 여과한 후, Protein A 컬럼(5 ml; GE Healthcare)을 사용하여 인간 IgG를 정제하였다. 평형을 위해 Protein A 컬럼을 컬럼 볼륨 5배의 로딩 버퍼(20mM 인산 나트륨, pH7.4)로 세척하고, 샘플 200ml를 컬럼에 로딩시킨 후 컬럼 볼륨 16배의 로딩 버퍼로 세척하였다. 여기에 컬럼 볼륨 3배의 용출 버퍼(100mM 시트르산 나트륨, pH3.0)를 사용하여 인간 IgG 단백질을 수득하였다.
정제된 cCD20 mAb를 10% SDS-PAGE 젤에 로딩시켜 웨스턴 블랏을 수행하였다. 용해된 단백질을 Hybond 0.45 PVDF 막(GE Healthcare Life Sciences, Little Chalfont, UK)에 옮기고 5% skimmed milk로 상온에서 1시간 동안 블락킹하였다. 화학 발광은 ECL 키트(GE Healthcare Life Sciences)를 사용하여 검출되었으며, 사용된 항체는 다음과 같다: 블락킹 버퍼로 희석된(1:1000) goat anti-Human IgG(H+L) 1차 항체 (Alpha diagnostic), 1:10000으로 희석된 horseradish peroxidase-conjugated 2차 항체(Thermo Fisher Scientific). 그 결과를 도 4의 a 내지 d에 나타내었다.
도 4의 a에 나타낸 바와 같이, mAb의 농도는 Tg4(he)의 경우 평균 2.04㎍/ml, Tg33(he)의 경우 평균 2.21㎍/ml로 나타났으며, 통계적으로 유의적인 차이는 보이지 않음을 확인하였다. 또한, 도 4의 b에 나타낸 바와 같이, 웨스턴 블랏 결과 두 형질전환 암탉 모두의 정제된 난백에서 항-인간 IgG 항체에 대응하는 경쇄 및 중쇄가 모두 검출되었고, 이를 통해 cCD20 mAb가 성공적으로 닭 개체에서 발현되고 난백을 통해 생산되었음을 확인하였다.
도 4의 c에 나타낸 바와 같이, SDS-PAGE를 통해 정제된 비환원 형태의 mAb는 150kDa의 크기를 보였으며, 환원된 mAb의 경우 두개의 중쇄(H, 약 50kDa) 및 경쇄(L, 약 25kDa)로 구성되어 있음을 확인하였다.
추가적으로, 도 4의 d에 나타낸 바와 같이, ELISA 분석 결과 Tg4(he)에 비해 2개의 트랜스진을 지닌 Tg33(he)4(he)가 월등히 높은량의 항체가 발현되고 있었으며, 4개의 트랜스진을 지닌 Tg33(ho)4(ho)에서는 그보다 높은량의 항체가 발현됨을 확인하였다.
실시예 8. 형질전환 닭에서 생산된 항-CD20 mAb의 당쇄 함량 분석
상기 실시예 7에서 수득한 cCD20 mAb의 당쇄 함량을 분석하기 위하여 항체 N-글리칸(N-glycan) 분석을 수행하였다. 구체적으로 N-글리칸 분석을 위하여 LC/MS/MS 시험법에 따라 항체에서 PNGase F를 처리하여 하전된 N-글리칸만을 분리하고 형광 라벨링 하여 분석을 수행하였다. 그 결과를 도 5에 나타내었다.
도 5의 a에 나타낸 바와 같이, 분석 결과 정제된 cCD20 mAb 200㎍에서 14개 종류의 N-글리칸이 확인되었다. 도 5의 b에 나타낸 바와 같이, 형질전환 닭 난백에서 생산된 cCD20 mAb는 14개의 주요 글리칸 중 8개(74.1%)가 갈락토오스 잔기를 함유하고 있는 반면, 모든 글리칸에서 비푸코실화된 것을 확인하였다.
실시예 9. CD20의 Fab 결합력 분석
형질전환 닭으로부터 생산된 cCD20 mAb의 CD20 항원에 대한 결합력을 평가하기 위하여, 형질전환 닭으로부터 생산된 2가지 종류의 cCD20 mAb Tg33(he)4(he) 및 Tg33(ho)4(ho)를 사용하여 유세포 분석을 수행하였다. 구체적으로, 상기 cCD20 mAb 및 리툭시맙(rituximab; MabThera, Roche)을 CD20을 발현하는 B 림프구 세포주인 Raji 세포에 처리하였다. 세포들을 상온에서 0.01, 0.05, 0.1, 0.5, 1, 5 및 10㎍/ml 농도의 단일클론항체와 함께 30분 동안 배양하고, FITC-conjugated goat anti-human IgG(Invitrogen)를 사용하여 결합된 단일클론항체를 검출하였다. 이후, 상기 세포들은 FACSCalibur를 사용하여 분석하였다. 그 결과를 도 6에 나타내었다.
도 6의 a에 나타낸 바와 같이, Raji 세포에 대한 cCD20 mAb의 결합능력은 모든 농도구간에서 대조군으로 사용된 리툭시맙과 유사하였다. 한편, 도 6의 b 에 나타낸 바와 같이, 0.01, 0.1, 1, 5 및 10㎍/ml 농도에서 모든 대조군 및 실험군의 결합효율은 매우 유사함을 확인하였다. 이를 통해, 형질전환 닭에서 생산된 cCD20 mAb는 상용 CD20 mAb인 리툭시맙과 유사한 Fab 결합력을 가짐을 확인하였다.
실시예 10. 세포사멸능력 분석
세포사멸능력은 Raji 세포를 Annexin Ⅴ/PI(Thermo Fisher Scientific)로 함께 염색함으로써 유세포 분석기(FACSCalibur, BD Biosciences, San Jose, CA, USA)를 통해 측정하였다. Annexin Ⅴ에 음성인 세포는 생존으로 간주하였고, Annexin Ⅴ 양성인 세포들은 세포사멸로 간주하였다. 그 결과를 도 6의 c와 d에 나타내었다.
도 6에 나타낸 바와 같이, 2가지 종류의 cCD20 mAb Tg33(he)4(he)및 Tg33(ho)4(ho)로 처리된 실험군은 대조군에 비하여 높은 수준의 세포사멸을 나타냄을 확인하였다. 구체적으로, 도 6의 c에 나타낸 바와 같이, mAb 처리 후 사멸 세포의 양은 (60.7% 및 55.3%) 상용 CD20 mAb인 리툭시맙 처리군(42.8%)에 비해 유의적으로 증가함을 확인하였다. 또한, 도 6의 d에 나타낸 바와 같이, 처리 항체의 농도별 세포사멸의 경우 리툭시맙 처리군과 비교하여 cCD20 mAb 처리군에서 현저히 높은 효율을 나타냄을 확인하였다. 이를 통해, 형질전환 닭에서 생산된 cCD20 mAb는 상용 CD20 mAb인 리툭시맙에 비해 현저히 높은 세포사멸능력을 가짐을 확인하였다.
실시예 11. CDC 분석
보체매개성 면역반응(Complement-dependent cytotoxicity, CDC) 분석은 이전 연구(Natsume, et al. 2009)를 변형하여 수행하였다. 구체적으로, Raji 세포를 불투명 96-웰 플레이트에 시딩하여 타겟 세포로 사용하고, 타겟 세포에 항-CD20 항체(리툭시맙 또는 2가지 종류의 cCD20 mAb Tg33(he)4(he)및 Tg33(ho)4(ho) 중 하나)를 0.0001㎍/ml 내지 100㎍/ml의 농도 별로 처리하고, 이어서 보체의 원천으로 인간 혈청(Sigma, St. Louis, MO, USA) 16%를 포함하는 배지를 처리하였다. 5% 이산화탄소, 37℃ 조건에서 2시간 동안 반응시킨 후, WST-1(Roche Diagnostic, Basel, Switzerland)을 처리하여 4시간 동안 더 배양하였다. 항체 농도별 % 세포 독성은 하기의 식을 사용하여 계산하였고, 그 결과를 도 7에 나타내었다.
Figure PCTKR2019000901-appb-img-000001
이 때, E는 실험군 웰의 흡광도, S는 mAb가 없는 웰의 흡광도(배양 배지 및 보체로만 배양된 세포), M은 배양 배지 및 보체의 흡광도(타겟 세포 및 항체가 없음)이다.
도 7에 나타낸 바와 같이, 각 cCD20 mAb는 리툭시맙과 비교하여 농도의존적으로 높은 CDC 활성을 나타냄을 확인하였다.
실시예 12. ADCC 분석
항체매개성 면역반응(Antibody-dependent cell-cytotoxicity assay, ADCC) 분석은 ADCC Reporter Bioassay complete kit(Promega, Madison, WI)를 사용하여 수행하였다. 구체적으로, cCD20 mAb의 ADCC 활성을 측정하기 위하여, B 림포상세포(lymphoblast)인 WIL2-S에 대한 면역 매개된 주효 세포(effector cell)기능을 리툭시맙과 비교하였다. CD20 양성 WIL2-S 세포를 원심분리하고 RPMI 1640 + 낮은 IgG 혈청에 재현탁시킨 후 주효 세포(effector cell; Jurkat 세포)가 있는 불투명 96-웰 플레이트에 시딩하였다. 대조군인 항-CD20 항체, 리툭시맙 및 닭 cCD20 mAb를 차례대로 희석하여 WIL2-S 세포와 함께 5% 이산화탄소, 37℃ 조건에서 6시간 동안 반응시킨 후, Bio-Glo™Luciferase 분석 및 마이크로 플레이트 리더를 이용하여 세포 독성을 측정하였다. 그 결과를 도 8에 나타내었다.
도 8에 나타낸 바와 같이, 발광(luminescence) 강도는 대조군 항체, 리툭시맙과 비교하여 cCD20 mAb가 더 높음을 확인하였다. 대조군 CD20 mAb 및 리툭시맙은 5.82 x 10 -9 EC 50의 및 1.05 x 10 -9 EC 50의 ADCC 활성을 나타낸 반면, 형질전환 닭에서 생산된 두 종류의 cCD20 mAb는 Tg33(he)4(he)에서 1.26 x 10 -10 EC 50 및 Tg33(ho)4(ho)에서 6.77 x 10 -11 EC 50 의 ADCC 활성을 나타내어 리툭시맙에 비해 B 림포상세포에 대하여 각각 8.3배 및 15.5배 높은 ADCC 활성을 나타냄을 확인하였다. 또한, 형질전환 닭에서 생산된 cCD20 mAb의 최대 ADCC 활성은 리툭시맙보다 50% 높아, cCD20 mAb가 CHO 세포에서 생성된 리툭시맙보다 효율적으로 ADCC 활성을 증가시킬 수 있음을 확인하였다.
상기의 특징을 가지는 단일클론항체를 분비하는 형질전환 세포주를 2018년 5월 11일 한국세포주은행(Korean Cell Line Bank, KCLB)에 수탁번호 KCLRF-BP-00431로 기탁하였다. 상기 형질전환 세포주는 원시생식세포로, 수용체 조류의 배아에 이식하여 고효율로 cCD20 mAb를 생산할 수 있고, 상기 단일클론항체는 우수한 CDC 및 ADCC 활성을 가져 리툭시맙보다 우수한 효능을 갖는 바이오베터(biobetter)로 활용될 수 있다.
이상, 본 발명의 바람직한 실시예에 대하여 상세히 설명하였으나, 본 발명의 기술적 범위는 전술한 실시예에 한정되지 않고 특허청구범위에 의하여 해석되어야 할 것이다. 이때, 이 기술분야에서 통상의 지식을 습득한 자라면, 본 발명의 범위에서 벗어나지 않으면서도 많은 수정과 변형이 가능함을 고려해야 할 것이다.
[수탁번호]
기탁기관명: 한국세포주은행
수탁번호: KCLRF-BP-00431
수탁일자: 20180425
Figure PCTKR2019000901-appb-img-000002
Figure PCTKR2019000901-appb-img-000003

Claims (17)

  1. (a) 5' 및 3' 피기백 트랜스포존(piggyBac transposon) 특이적 역위 말단 반복부(Terminal Repeat, TR); 및
    (b) 상기 5' TR과 3' TR 사이에 위치하는 오브알부민(Ovalbumin, OV) 프로모터 및 상기 오브알부민 프로모터에 작동가능하도록 연결된 인간 CD20 특이적 단일클론항체를 코딩하는 유전자를 포함하는 재조합 벡터.
  2. 제1항에 있어서, 상기 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 IRES(internal ribosome entry site)를 포함하는 것을 특징으로 하는, 재조합 벡터.
  3. 제1항에 있어서, 상기 재조합 벡터는 오브알부민 유전자의 3' UTR을 더 포함하는 것을 특징으로 하는, 재조합 벡터.
  4. 제1항에 있어서, 상기 재조합 벡터는 폴리아데닐화 부위(polyadenylation site, poly A)를 더 포함하는 것을 특징으로 하는, 재조합 벡터.
  5. 제1항에 있어서, 상기 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 서열번호 1로 표시되는 인간 CD20 특이적 단일클론항체의 경쇄영역을 코딩하는 유전자 및 서열번호 2로 표시되는 인간 CD20 특이적 단일클론항체의 중쇄영역을 코딩하는 유전자를 포함하는 것을 특징으로 하는, 재조합 벡터.
  6. 제1항에 있어서, 상기 인간 CD20 특이적 단일클론항체를 코딩하는 유전자는 닭의 코돈으로 최적화된 것을 특징으로 하는, 재조합 벡터.
  7. 제1항의 재조합 벡터로 형질전환된 공여생식세포주.
  8. 제7항에 있어서, 상기 공여생식세포주는 공여체 조류의 원시생식세포(primordial germ cells, PGCs)인 것을 특징으로 하는, 공여생식세포주.
  9. 제8항에 있어서, 상기 원시생식세포는 상기 공여체 조류의 1-10일령 배아의 원시 생식기로부터 유래된 것을 특징으로 하는, 공여생식세포주.
  10. 제9항에 있어서, 상기 공여체 조류는 닭인 것을 특징으로 하는, 공여생식세포주.
  11. 제7항에 있어서, 상기 공여생식세포주는 수탁번호가 KCLRF-BP-00431임을 특징으로 하는, 공여생식세포주.
  12. 제7항 내지 제11항 중 어느 한 항의 공여생식세포주를 수용체 조류의 배아에 이식하는 단계를 포함하는 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류모델의 제조방법.
  13. 제12항의 방법으로 제조된 인간 CD20 특이적 단일클론항체를 생산하는 형질전환 조류모델.
  14. 제12항의 형질전환 조류모델로부터 인간 CD20 특이적 단일클론항체를 수득하는 단계를 포함하는 인간 CD20 특이적 단일클론항체의 제조방법.
  15. 제14항의 방법으로 생산한 인간 CD20 특이적 단일클론항체.
  16. 제15항에 있어서, 상기 인간 CD20 특이적 단일클론항체는 비푸코실화(afucosylation)된 것을 특징으로 하는, 인간 CD20 특이적 단일클론항체.
  17. 제16항에 있어서, 상기 인간 CD20 특이적 단일클론항체는 비푸코실화된 결과로서 Fc 도메인에 의한 세포면역 기능이 향상된 것을 특징으로 하는, 인간 CD20 특이적 단일클론항체.
PCT/KR2019/000901 2018-01-31 2019-01-22 효능이 개선된 인간 cd20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법 WO2019151698A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0011888 2018-01-31
KR20180011888 2018-01-31
KR1020190005990A KR102192846B1 (ko) 2018-01-31 2019-01-17 효능이 개선된 인간 cd20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법
KR10-2019-0005990 2019-01-17

Publications (1)

Publication Number Publication Date
WO2019151698A1 true WO2019151698A1 (ko) 2019-08-08

Family

ID=67478463

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/000901 WO2019151698A1 (ko) 2018-01-31 2019-01-22 효능이 개선된 인간 cd20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법

Country Status (1)

Country Link
WO (1) WO2019151698A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004003157A2 (en) * 2002-06-26 2004-01-08 Transgenrx, Inc. Gene regulation in transgenic animals using a transposon-based vector

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004003157A2 (en) * 2002-06-26 2004-01-08 Transgenrx, Inc. Gene regulation in transgenic animals using a transposon-based vector

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 16 January 2017 (2017-01-16), XP055629586, Database accession no. KP684038.1 *
DATABASE NCBI 24 March 2009 (2009-03-24), XP055629587, Database accession no. BC066642.1 *
KIM, YOUNG MIN ET AL.: "The transgenic chicken derived anti CD 20 monoclonal antibodies exhibits greater anti-cancer therapeutic potential with enhanced Fc effector functions", BIOMATERIALS, vol. 167, 13 March 2018 (2018-03-13), pages 58 - 68, XP085374761, doi:10.1016/j.biomaterials.2018.03.021 *
WIRT, TIM ET AL.: "An Fc Double-Engineered CD 20 Antibody with Enhanced Ability to Trigger Complement-Dependent Cytotoxicity and Antibody-Dependent Cell -Mediated Cytotoxicity", TRANSFUS. MED. HEMOTHER., vol. 44, no. 5, 2017, pages 292 - 300 *
ZHU, LEI ET AL.: "Production of human monoclonal antibody in eggs of chimeric chickens", NAT. BIOTECHNOL., vol. 23, no. 9, 2005, pages 1159 - 1 169, XP002446624, doi:10.1038/nbt1132 *

Similar Documents

Publication Publication Date Title
US11230697B2 (en) Enhanced expression of human or humanized immunoglobulin in non-human transgenic animals
CA2468565C (en) Transgenic animals bearing human iglambda light chain genes
US9144229B2 (en) Tissue specific expression of antibodies in chickens
KR102150414B1 (ko) 히스티딘 엔지니어링된 경쇄 항체 및 그것을 생성하기 위한 유전자 변형된 비-인간 동물
CA2595576A1 (en) Transgenic chickens
KR20210133234A (ko) 인간화 면역글로불린 유전자좌를 갖는 유전적으로 변형된 비-인간 동물
JP6923232B2 (ja) 遺伝子改変家禽卵
US20170218336A1 (en) Enhanced expression of human or humanized immunoglobulin in non-human transgenic animals
WO2019184014A1 (zh) 一种核酸分子及其在制备人源单域抗体中的应用
Wang et al. Production of transgenic broilers by non-viral vectors via optimizing egg windowing and screening transgenic roosters
WO2019151698A1 (ko) 효능이 개선된 인간 cd20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법
JPWO2018169090A1 (ja) 光受容感度の抑制又は低減剤
KR102192846B1 (ko) 효능이 개선된 인간 cd20 특이적 단일클론항체를 생산하는 형질전환 조류 및 이의 제조방법
WO2022211177A1 (ko) 인간 면역 글로불린 fc 및 목적단백질을 생산하는 조류의 제조방법
WO2022245110A1 (ko) 아디포넥틴 및 목적 단백질을 생산하는 조류의 제조방법
SK16597A3 (en) Icam-4 materials and methods
RU2822367C2 (ru) Генетически модифицированные, не являющиеся человеком животные с гуманизированным иммуноглобулиновым локусом
WO2022242500A1 (zh) 一种基于基因改造脊椎动物的携带通用定点偶联接口的抗体的制备方法
JP2006141217A (ja) てんかん様痙攣を起こすトランスジェニック動物
Lei Characterization of Dmrt1 in testis differentiation
CN102791863A (zh) 用作干细胞标记的Tctex-1调控序列区

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19747078

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19747078

Country of ref document: EP

Kind code of ref document: A1