WO2019145739A1 - Composition antigénique du virus lassa - Google Patents

Composition antigénique du virus lassa Download PDF

Info

Publication number
WO2019145739A1
WO2019145739A1 PCT/GB2019/050233 GB2019050233W WO2019145739A1 WO 2019145739 A1 WO2019145739 A1 WO 2019145739A1 GB 2019050233 W GB2019050233 W GB 2019050233W WO 2019145739 A1 WO2019145739 A1 WO 2019145739A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
nucleic acid
acid sequence
lassa virus
seq
Prior art date
Application number
PCT/GB2019/050233
Other languages
English (en)
Inventor
Roger HEWSON
Stuart DOWALL
Emma KENNEDY
Original Assignee
Secretary of State for Health and Social Care
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Secretary of State for Health and Social Care filed Critical Secretary of State for Health and Social Care
Publication of WO2019145739A1 publication Critical patent/WO2019145739A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/10011—Arenaviridae
    • C12N2760/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the antiviral drug ribavirin seems to be an effective treatment for Lassa fever if given early on in the course of clinical illness.
  • ribavirin As post-exposure prophylactic treatment for Lassa fever.
  • Various attempts have been made to produce a Lassa virus vaccine (such as the“GeoVax” vaccine candidate which is a VLP based upon the Lassa virus GP and Z proteins), but although some such studies report success at the pre-clinical stage, none have progressed beyond the pre-clinical stage of development. There is currently no vaccine that protects against Lassa fever.
  • Lassa fever is the most commonly imported Viral Haemorrhagic Fever into Europe, the most recent case of which resulted in onward human to human transmission in Germany in 2016. The UK has received the most incursions out of all cases of Lassa fever that have been exported from West Africa, each one causing enormous burden to clinical, laboratory and public health resources.
  • the Lassa virus NP forms the protein scaffold of the genomic ribonucleoprotein complexes and is critical for transcription and replication of the viral genome.
  • the Lassa virus NP has been implicated in suppression of the host innate immune system and has been demonstrated to exhibit exonuclease activity, with strict specificity for double-stranded RNA substrates. This exonuclease activity is believed to be essential for the ability of NP to block activation of the innate immune system.
  • VL (SEQ ID NO: 2)
  • Reference nucleic acid and polypeptide sequence for Lassa virus nucleoprotein may be provided by GenBank Accession number X52400.1. Inventors note that the sense strand of the Lassa virus NP corresponds to nucleic acid positions 103-1812 of the reverse complement of the nucleic acid sequence provided in GenBank Accession number X52400.1. The reverse complement of the nucleic acid sequence provided in GenBank Accession number X52400.1 is provided by SEQ ID NO: 3.
  • the high fidelity nucleic acid sequence identified by the inventors differs from the corresponding nucleic acid sequence provided by GenBank Accession number X52400.1 by a single nucleic acid (corresponding to the “A” residue at position 1658 in SEQ ID NO: 1, and the“T” residue at positions 1770 and 1658 of SEQ ID NOs: 3 and 4, respectively).
  • the amino acid at position 553 of SEQ ID NO: 5 is Valine, as compared to Alanine in SEQ ID NO: 2.
  • antigenic fragment means a peptide or protein fragment of a Lassa virus NP which retains the ability to induce an immune response in an individual, as compared to the reference Lassa virus NP. An antigenic fragment may therefore include at least one epitope of the reference protein.
  • an antigenic fragment of the present invention may comprise (or consist of) a peptide sequence having at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550 or 570 amino acids, wherein the peptide sequence has at least 70% sequence homology over a corresponding peptide sequence of (contiguous) amino acids of the reference protein.
  • An antigenic fragment may comprise (or consist of) at least 10 consecutive amino acid residues from the sequence of the reference protein (for example, at least
  • an antigenic fragment comprises (or consists of) SEQ ID NO: 7.
  • an antigenic fragment comprises (or consist of) at least 10 consecutive amino acid residues from the sequence of SEQ ID NO: 7 (for example, at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 91 amino acids of SEQ ID NO: 7, wherein said fragment has at least 70% sequence homology over a corresponding peptide sequence of (contiguous) amino acids of the reference protein.
  • an antigenic fragment comprises (or consists of) SEQ ID NO: 7 and SEQ ID NO: 8.
  • an antigenic fragment comprises (or consist of) at least 10 consecutive amino acid residues from the sequence of SEQ ID NO: 7 (for example, at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 91 amino acids of SEQ ID NO: 7, and at least 10 consecutive amino acid residues from the sequence of SEQ ID NO: 8 (for example, at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 91 amino acids of SEQ ID NO: 8 wherein said fragment has at least 70% sequence homology over a corresponding peptide sequence of (contiguous) amino acids of the reference protein.
  • An antigenic fragment of a reference protein may have a common antigenic cross- reactivity and/or substantially the same in vivo biological activity as the reference protein.
  • an antibody capable of binding to an antigenic fragment of a reference protein would also be capable of binding to the reference protein itself.
  • the reference protein and the antigenic fragment thereof may share a common ability to induce a“recall response” of a T lymphocyte (e.g. CD4+, CD8+, effector T cell or memory T cell such as a TEM or TCM), which has been previously exposed to an antigenic component of a Lassa virus infection.
  • a T lymphocyte e.g. CD4+, CD8+, effector T cell or memory T cell such as a TEM or TCM
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 90% (such as at least 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 95% (such as at least 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 8.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 90% (such as at least 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 9.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 95% (such as at least 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 9.
  • SEQ ID NO: 9 is the nucleic acid sequence that encodes the polypeptide sequence of SEQ ID NO: 7. CATCTCTGGTTACAATTTCAGTTTGGGTGCTGCTGTCAAAGCAGGGGCCTG CAT GC TT GAT GGT GGT A AC AT GTT AGAGACT ATT A AGGTTT C AC CTC AGAC CAT GG AT GGT ATC TT G A AGT C A AT C T T G A A AGTT A AG A AG AGT C T GGG A A TGTTTGTATCAGACACACCGGGTGAAAGGAACCCTTATGAGAACATCCTA TACAAGATCTGTCTCTCTCAGGAGACGGATGGCCCTATATTGCATCAAGGAC CTC GATT GT GGGA AGAGC AT GG (SEQ ID NO: 9).
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 90% (such as at least 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 8 and a nucleic acid sequence having at least 90% (such as at least 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 9.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 95% (such as at least
  • nucleic acid sequence of SEQ ID NO: 8 and a nucleic acid sequence having at least 95% (such as at least 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 9.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 73% (such as at least 73, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4; wherein said nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 80% (such as at least 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 8 and 9.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 80% (such as at least 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4; wherein said nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 90% (such as at least 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 8 and 9.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 90% (such as at least 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4; wherein said nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 95% (such as at least 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 8 and 9.
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 73% (such as at least 73, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4; wherein said nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises a nucleic acid sequence having at least 80% (such as at least 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 8 and a nucleic acid sequence having at least 80% (such as at least 80, 82, 84, 86, 88, 90, 92, 94
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 80% (such as at least 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4; wherein said nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises a nucleic acid sequence having at least 90% (such as at least 90, 92,
  • nucleic acid sequence of SEQ ID NO: 8 sequence identity to the nucleic acid sequence of SEQ ID NO: 8 and a nucleic acid sequence having at least 90% (such as at least 90, 92, 94,
  • the nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises (or consists of) a nucleic acid sequence having at least 90% (such as at least 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4; wherein said nucleic acid sequence encoding a Lassa virus NP or antigenic fragment thereof comprises a nucleic acid sequence having least 95% (such as at least 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 8 and a nucleic acid sequence having least 95% (such as at least 95, 96, 97, 98, 99 or 100%) sequence identity to the nucleic acid sequence of SEQ ID NO: 9.
  • the present inventors have found that the Lassa virus NPs encoded by the nucleic acid sequences of SEQ ID NOs: 1 and 4 can be used to generate effective immune responses in individuals against Lassa virus.
  • the inventors have found that a highly effective immune response against Lassa virus is obtained when Lassa virus NP is delivered to the subject using a bacterial vector or a viral vector, such as a non-replicating poxvirus vector or an adenovirus vector.
  • Vectors are tools which can be used as vectors for the delivery of genetic material into a target cell.
  • viral vectors serve as antigen delivery vehicles and also have the power to activate the innate immune system through binding cell surface molecules that recognise viral elements.
  • a recombinant viral vector can be produced that carries nucleic acid encoding a given antigen.
  • the viral vector can then be used to deliver the nucleic acid to a target cell, where the encoded antigen is produced and then presented to the immune system by the target cell’s own molecular machinery. As“non-self’, the produced antigen generates an adaptive immune response in the target subject.
  • vectors of the invention have been demonstrated herein to provide a protective immune response.
  • Viral vectors suitable for use in the present invention include poxvirus vectors (such as non-replicating poxvirus vectors), adenovirus vectors, and influenza virus vectors.
  • a“viral vector” may be a virus-like particle (VLP).
  • VLPs are lipid enveloped particles which contain viral proteins. Certain viral proteins have an inherent ability to self-assemble, and in this process bud out from cellular membranes as independent membrane-enveloped particles. VLPs are simple to purify and can, for example, be used to present viral antigens. VLPs are therefore suitable for use in immunogenic compositions, such as described below.
  • the viral vector is not a virus-like particle.
  • the vector of the invention is a bacterial vector, wherein the bacterium is a Gram-negative bacterium. In one embodiment, the vector of the invention is a bacterial vector selected from an Escherichia coli vector, a Shigella vector, a Salmonella vector and a Listeria vector.
  • the inventors believe that antigen delivery using the vectors of the invention stimulates, amongst other responses, a T cell response in the subject.
  • one way in which the present invention provides for protection against Lassa virus infection is by stimulating T cell responses and the cell-mediated immunity system.
  • humoral (antibody) based protection can also be achieved.
  • Non replicating viral vectors may therefore advantageously have an improved safety profile as compared to replication-competent viral vectors.
  • a non-replicating viral vector may retain the ability to replicate in cells that are not target cells, allowing viral vector production.
  • a non-replicating viral vector e.g. a non replicating poxvirus vector
  • a viral vector of the invention may be a non-replicating poxvirus vector.
  • the viral vector encoding a Lassa virus NP or antigenic fragment thereof is a non-replicating poxvirus vector.
  • the non-replicating poxvirus vector is selected from: a Modified Vaccinia virus Ankara (MV A) vector, a NYVAC vaccinia virus vector, a canarypox (ALVAC) vector, and a fowlpox (FPV) vector.
  • MV A Modified Vaccinia virus Ankara
  • NYVAC vaccinia virus vector
  • AVAC canarypox
  • FV fowlpox
  • MVA and NYVAC are both attenuated derivatives of vaccinia virus. Compared to vaccinia virus, MVA lacks approximately 26 of the approximately 200 open reading frames.
  • the non-replicating poxvirus vector is an MVA vector.
  • a viral vector of the invention may be an adenovirus vector.
  • the viral vector encoding a Lassa virus NP or antigenic fragment thereof is an adenovirus vector.
  • both El and E3 gene region deletions are present in the adenovirus, thus allowing a greater size of transgene to be inserted. This is particularly important to allow larger antigens to be expressed, or when multiple antigens are to be expressed in a single vector, or when a large promoter sequence, such as the CMV promoter, is used. Deletion of the E3 as well as the El region is particularly favoured for recombinant Ad5 vectors.
  • the E4 region can also be engineered.
  • the expression cassette comprising the nucleic acid sequence encoding a Lassa virus NP is less than 8kb (such as less than 8.0, 7.9, 7.8, 7.7, 7.6, 7.5, 7.4, 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4,
  • the expression cassette comprising the nucleic acid sequence encoding a Lassa virus NP is less than 7kb (such as less than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, 5.5, 5.4,
  • the expression cassette comprising the nucleic acid sequence encoding a Lassa virus NP (or antigenic fragment thereof) is less than 6kb (such as less than 6, 5.9, 5.8, 5.7, 5.6, 5.5, 5.4, 5.3, 5.2, 5.1, 5.0, 4.9, 4.8, 4.7, 4.6, 4.5, 4.4, 4.3,
  • the expression cassette comprising the nucleic acid sequence encoding a Lassa virus NP (or antigenic fragment thereof) is less than 5kb (such as less than 5.0, 4.9, 4.8, 4.7, 4.6, 4.5, 4.4, 4.3, 4.2, 4.1, 4.0, 3.9, 3.8, 3.7, 3.6, 3.5, 3.4,
  • the expression cassette comprising the nucleic acid sequence encoding a Lassa virus NP (or antigenic fragment thereof) is less than 4.5kb (such as less than 4.5, 4.4, 4.3, 4.2, 4.1, 4.0, 3.9, 3.8, 3.7, 3.6, 3.5, 3.4, 3.3, 3.2, 3.1, 3.0, 2.9, 2.8, 2.7, 2.6, 2.5, 2.4, 2.3, 2.2, 2.1, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1.0 kb).
  • the vector is not a murine leukaemia virus (MLV) vector (for example, a Moloney murine leukaemia virus (MoMLV) vector).
  • MMV murine leukaemia virus
  • MoMLV Moloney murine leukaemia virus
  • the adenovirus is not a human adenovirus serotype 5 (AdHu5).
  • the vector is not a retrovirus vector, a Newcastle disease virus vector, or a human adenovirus serotype 5 vector.
  • the vector does not comprise a nucleic acid encoding a Lassa virus glycoprotein (GP).
  • GP Lassa virus glycoprotein
  • the vector does not comprise a nucleic acid encoding a Lassa virus matrix protein (Z) or a Lassa virus glycoprotein (GP).
  • Z Lassa virus matrix protein
  • GP Lassa virus glycoprotein
  • the vector does not comprise a nucleic acid encoding an epitope of a Lassa virus matrix protein (Z) or an epitope of a Lassa virus glycoprotein (GP).
  • Z Lassa virus matrix protein
  • GP Lassa virus glycoprotein
  • the nucleic acid sequence encoding a Lassa Virus NP or antigenic fragment thereof does not comprise a nucleic acid encoding a Lassa virus glycoprotein (GP).
  • GP Lassa virus glycoprotein
  • the nucleic acid sequence encoding a Lassa Virus NP or antigenic fragment thereof does not comprise a nucleic acid encoding a Lassa virus glycoprotein (GP) or a Lassa virus matrix protein (Z).
  • GP Lassa virus glycoprotein
  • Z Lassa virus matrix protein
  • the Lassa virus nucleoprotein or antigenic fragment thereof is the only Lassa virus nucleic acid sequence in the vector.
  • the vector is stable, expresses a Lassa virus NP product, and induces a protective immune response in a subject.
  • the nucleic acid sequences as described above may comprise a nucleic acid sequence encoding a Lassa virus NP wherein said NP comprises a fusion protein.
  • the fusion protein may comprise a Lassa virus NP polypeptide fused to one or more further polypeptides, for example an epitope tag, another antigen, or a protein that increases immunogenicity (e.g. a flagellin).
  • the vector is a non replicating poxvirus vector (such as an MVA vector)
  • said fusion protein typically does not comprise Lassa virus glycoprotein (GP) and/or Lassa virus matrix protein (Z).
  • the nucleic acid sequence encoding a Lassa virus NP (as described above) further encodes a Tissue Plasminogen Activator (tPA) signal sequence, and/or a V5 fusion protein sequence.
  • tPA Tissue Plasminogen Activator
  • the presence of a tPA signal sequence can provide for increased immunogenicity; the presence of a V5 fusion protein sequence can provide for identification of expressed protein by immunolabelling.
  • the vector (as described above) further comprises a nucleic acid sequence encoding an adjuvant (for example, a cholera toxin, an E. coli lethal toxin, or a flagellin).
  • an adjuvant for example, a cholera toxin, an E. coli lethal toxin, or a flagellin.
  • a bacterial vector of the invention may be generated by the use of any technique for manipulating and generating recombinant bacteria known in the art.
  • the nucleic acid sequence encoding a viral vector may be generated by the use of any technique for manipulating and generating recombinant nucleic acid known in the art.
  • obtaining the vector means using any technique known in the art that is suitable for separating the vector from the host cell.
  • the host cells may be lysed to release the vector.
  • the vector may subsequently be isolated and purified using any suitable method or methods known in the art.
  • the host cell is selected from: a 293 cell (also known as a HEK, or human embryonic kidney, cell), a CHO cell (Chinese Hamster Ovary), a CCL81.1 cell, a Vero cell, a HELA cell, a Per.C6 cell, a BHK cell (Baby Hamster Kidney), a primary CEF cell (Chick Embryo Fibroblast), a duck embryo fibroblast cell, a DF-l cell, or a rat IEC-6 cell.
  • a 293 cell also known as a HEK, or human embryonic kidney, cell
  • a CHO cell Choinese Hamster Ovary
  • CCL81.1 cell a Vero cell
  • HELA cell a HELA cell
  • Per.C6 cell a Per.C6 cell
  • BHK cell Baby Hamster Kidney
  • a primary CEF cell Choick Embryo Fibroblast
  • a duck embryo fibroblast cell a DF-l cell
  • the present invention also provides compositions comprising vectors as described above.
  • the invention provides a composition comprising a vector (as described above) and a pharmaceutically-acceptable carrier.
  • compositions suitable for use as pharmaceutically-acceptable carriers include water, saline, and phosphate-buffered saline.
  • the composition is in lyophilized form, in which case it may include a stabilizer, such as bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • buffering agents include, but are not limited to, sodium succinate (pH 6.5), and phosphate buffered saline (PBS; pH 7.4).
  • composition of the invention can be further combined with one or more of a salt, excipient, diluent, adjuvant, immunoregulatory agent and/or antimicrobial compound.
  • the composition may be formulated as a neutral or salt form.
  • Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, maleic, and the like.
  • Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
  • inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
  • the polypeptide antigen is not bonded to the vector. In one embodiment, the polypeptide antigen is a separate component to the vector. In one embodiment, the polypeptide antigen is provided separately from the vector.
  • the polypeptide antigen is a variant of the antigen encoded by the vector. In one embodiment, the polypeptide antigen is a fragment of the antigen encoded by the vector. In one embodiment, the polypeptide antigen comprises at least part of a polypeptide sequence encoded by a nucleic acid sequence of the vector. Thus, the polypeptide antigen may correspond to at least part of the antigen encoded by the vector.
  • the polypeptide antigen is a Lassa virus NP comprising (or consisting of) an amino acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to an amino acid sequence selected from SEQ ID NOs: 6 and 7.
  • the polypeptide antigen is a Lassa virus NP comprising an amino acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to the amino acid of SEQ ID NOs: 6 and an amino acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to the amino acid of SEQ ID NO: 7.
  • the naked DNA encodes a Lassa virus NP comprising (or consisting of) an amino acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to an amino acid sequence selected from SEQ ID NOs: 2 and 5.
  • a composition of the invention further comprises an adjuvant.
  • adjuvants suitable for use with compositions of the present invention include aluminium phosphate, aluminium hydroxide, and related compounds; monophosphoryl lipid A, and related compounds; outer membrane vesicles from bacteria; oil-in-water emulsions such as MF59; liposomal adjuvants, such as virosomes, Freund’s adjuvant and related mixtures; poly- lactid-co-glycolid acid (PLGA) particles; cholera toxin; E. coli lethal toxin; and flagellin.
  • PLGA poly- lactid-co-glycolid acid
  • compositions of the invention can be employed as vaccines.
  • a composition of the invention may be a vaccine composition.
  • a vaccine is a formulation that, when administered to an animal subject such as a mammal (e.g. a human, bovine, porcine, ovine, caprine, equine, cervine, canine or feline subject; in particular a human subject), stimulates a protective immune response against an infectious disease.
  • the immune response may be a humoral and/or a cell-mediated immune response.
  • the vaccine may stimulate B cells and/or T cells.
  • vaccine is herein used interchangeably with the terms “therapeutic/prophylactic composition”,“immunogenic composition”,“formulation”, “antigenic composition”, or“medicament”.
  • the invention provides a vector (as described above) or a composition (as described above) for use in medicine.
  • the invention provides a vector (as described above) or a composition (as described above) for use in a method of inducing an immune response in a subject.
  • the immune response may be against a Lassa virus antigen (e.g. a Lassa virus NP) and/or a Lassa virus infection.
  • a Lassa virus antigen e.g. a Lassa virus NP
  • the vectors and compositions of the invention can be used to induce an immune response in a subject against a Lassa virus NP (for example, as immunogenic compositions or as vaccines).
  • the method of inducing an immune response in a subject comprises administering to a subject an effective amount of a vector (as described above) or a composition (as described above).
  • the invention provides a vector (as described above) or a composition (as described above) for use in a method of preventing or treating a Lassa virus infection in a subject.
  • preventing includes preventing the initiation of Lassa virus infection and/or reducing the severity of intensity of a Lassa virus infection. Thus, “preventing” encompasses vaccination.
  • treating embraces therapeutic and preventative/prophylactic measures (including post-exposure prophylaxis) and includes post-infection therapy and amelioration of a Lassa virus infection.
  • Each of the above-described methods can comprise the step of administering to a subject an effective amount, such as a therapeutically effective amount, of a vector or a compound of the invention.
  • Administration to the subject can comprise administering to the subject a vector (as described above) or a composition (as described above) wherein the composition is sequentially administered multiple times (for example, wherein the composition is administered two, three or four times).
  • the subject is administered a vector (as described above) or a composition (as described above) and is then administered the same vector or composition (or a substantially similar vector or composition) again at a different time.
  • administration to a subject comprises administering a vector (as described above) or a composition (as described above) to a subject, wherein said composition is administered substantially prior to, simultaneously with, or subsequent to, another immunogenic composition.
  • the first and second vectors encode the same Lassa virus NP(s). In one embodiment, the first and second vectors encode different Lassa virus antigens.
  • each of the above-described methods further comprises the step of administration to the subject of a Lassa virus polypeptide antigen.
  • the Lassa virus polypeptide antigen is a Lassa virus NP (or antigenic fragment thereof) as described above.
  • the Lassa virus polypeptide antigen is a Lassa virus NP comprising an amino acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to an amino acid sequence selected from SEQ ID NOs: 2 and 5.
  • each of the above-described methods further comprises the step of administration to the subject of a naked DNA encoding a Lassa virus NP or antigenic fragment thereof.
  • the naked DNA comprises (or consists of) a nucleic acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NOs: 1 and 4.
  • the naked DNA encodes a Lassa virus NP comprising (or consisting of) an amino acid sequence having at least 70% (such as at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 95, 96, 97, 98, 99 or 100%) sequence identity to an amino acid sequence selected from SEQ ID NOs: 2 and 5.
  • the naked DNA is administered separately from the administration of a vector; preferably the naked DNA and a vector are administered sequentially.
  • the vector (“V”) and the naked DNA (“D”) may be administered in the order V-D, or in the order D-V.
  • a naked DNA (as described above) is administered to a subject as part of a prime-boost protocol.
  • polypeptide embraces peptides and proteins.
  • the above-described methods further comprise the administration to the subject of an adjuvant.
  • Adjuvant may be administered with one, two, three, or all four of: a first vector, a second vector, a polypeptide antigen, and a naked DNA.
  • the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations (e.g. vaccines) of the invention may be given in a single dose schedule (i.e. the full dose is given at substantially one time).
  • the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations (e.g. vaccines) of the invention may be given in a multiple dose schedule.
  • a multiple dose schedule is one in which a primary course of treatment (e.g. vaccination) may be with 1-6 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example (for human subjects), at 1-4 months for a second dose, and if needed, a subsequent dose(s) after a further 1-4 months.
  • a primary course of treatment e.g. vaccination
  • other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example (for human subjects)
  • the dosage regimen will be determined, at least in part, by the need of the individual and be dependent upon the judgment of the practitioner (e.g. doctor or veterinarian).
  • Simultaneous administration means administration at (substantially) the same time.
  • Sequential administration of two or more compositions/therapeutic agents/vaccines means that the compositions/therapeutic agents/vaccines are administered at (substantially) different times, one after the other.
  • sequential administration may encompass administration of two or more compositions/therapeutic agents/vaccines at different times, wherein the different times are separated by a number of days (for example, at least 1, 2, 5, 10, 15, 20, 30, 60, 90, 100, 150 or 200 days).
  • the vaccine of the present invention may be administered as part of a‘prime-boost’ vaccination regime.
  • the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations (e.g. vaccines) of the invention can be administered to a subject such as a mammal (e.g. a human, bovine, porcine, ovine, caprine, equine, cervine, ursine, canine or feline subject) in conjunction with (simultaneously or sequentially) one or more immunoregulatory agents selected from, for example, immunoglobulins, antibiotics, interleukins (e.g. IL-2, IL-12), and/or cytokines (e.g.
  • a mammal e.g. a human, bovine, porcine, ovine, caprine, equine, cervine, ursine, canine or feline subject
  • immunoregulatory agents selected from, for example, immunoglobulins, antibiotics, interleukins (e.g. IL-2, IL-12), and/or cytokines (e.
  • the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations may contain 5% to 95% of active ingredient, such as at least 10% or 25% of active ingredient, or at least 40% of active ingredient or at least 50, 55, 60, 70 or 75% active ingredient.
  • immunogenic compositions are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective.
  • immunogenic compositions are generally by conventional routes e.g. intravenous, subcutaneous, intraperitoneal, or mucosal routes.
  • the administration may be by parenteral administration; for example, a subcutaneous or intramuscular injection.
  • immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations (e.g. vaccines) of the invention may be prepared as injectables, either as liquid solutions or suspensions.
  • Solid forms suitable for solution in, or suspension in, liquid prior to injection may alternatively be prepared.
  • the preparation may also be emulsified, or the peptide encapsulated in liposomes or microcapsules.
  • the composition is in lyophilized form, in which case it may include a stabilizer, such as bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • buffering agents include, but are not limited to, sodium succinate (pH 6.5), and phosphate buffered saline (PBS; pH 6.5 and 7.5).
  • Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations or formulations suitable for distribution as aerosols.
  • traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably l%-2%.
  • compositions of the present invention may be desired to direct the compositions of the present invention (as described above) to the respiratory system of a subject. Efficient transmission of a therapeutic/prophylactic composition or medicament to the site of infection in the lungs may be achieved by oral or intra-nasal administration.
  • Formulations for intranasal administration may be in the form of nasal droplets or a nasal spray.
  • An intranasal formulation may comprise droplets having approximate diameters in the range of 100-5000 pm, such as 500-4000 pm, 1000-3000 pm or 100- 1000 pm.
  • the droplets may be in the range of about 0.001-100 pi, such as 0.1-50 pl or 1.0-25 pi, or such as 0.001-1 pi.
  • the therapeutic/prophylactic formulation or medicament may be an aerosol formulation.
  • the aerosol formulation may take the form of a powder, suspension or solution. The size of aerosol particles is relevant to the delivery capability of an aerosol. Smaller particles may travel further down the respiratory airway towards the alveoli than would larger particles.
  • the aerosol particles have a diameter distribution to facilitate delivery along the entire length of the bronchi, bronchioles, and alveoli.
  • the particle size distribution may be selected to target a particular section of the respiratory airway, for example the alveoli.
  • the particles may have diameters in the approximate range of 0.1-50 pm, preferably 1-25 pm, more preferably 1-5 pm.
  • Aerosol particles may be for delivery using a nebulizer (e.g. via the mouth) or nasal spray.
  • An aerosol formulation may optionally contain a propellant and/or surfactant.
  • the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations (e.g. vaccines) of the invention comprise a pharmaceutically acceptable carrier, and optionally one or more of a salt, excipient, diluent and/ or adjuvant.
  • the immunogenic compositions, therapeutic formulations, medicaments, pharmaceutical compositions, and prophylactic formulations (e.g. vaccines) of the invention may comprise one or more immunoregulatory agents selected from, for example, immunoglobulins, antibiotics, interleukins (e.g. IL-2, IL- 12), and/or cytokines (e.g. IFNY).
  • immunoglobulins antibiotics
  • interleukins e.g. IL-2, IL- 12
  • cytokines e.g. IFNY
  • the present invention encompasses polypeptides that are substantially homologous to polypeptides based on any one of the polypeptide antigens identified in this application (including fragments thereof).
  • sequence identity and “sequence homology” are considered synonymous in this specification.
  • a polypeptide of interest may comprise an amino acid sequence having at least 70, 75, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 99 or 100% amino acid sequence identity with the amino acid sequence of a reference polypeptide.
  • the BLOSUM62 table shown below is an amino acid substitution matrix derived from about 2,000 local multiple alignments of protein sequence segments, representing highly conserved regions of more than 500 groups of related proteins (Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919, 1992; incorporated herein by reference). Amino acids are indicated by the standard one- letter codes. The percent identity is calculated as:
  • the identity may exist over a region of the sequences that is at least 10 amino acid residues in length (e.g. at least 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425,
  • Substantially homologous polypeptides have one or more amino acid substitutions, deletions, or additions. In many embodiments, those changes are of a minor nature, for example, involving only conservative amino acid substitutions. Conservative substitutions are those made by replacing one amino acid with another amino acid within the following groups: Basic: arginine, lysine, histidine; Acidic: glutamic acid, aspartic acid; Polar: glutamine, asparagine; Hydrophobic: leucine, isoleucine, valine; Aromatic: phenylalanine, tryptophan, tyrosine; Small: glycine, alanine, serine, threonine, methionine.
  • Substantially homologous polypeptides also encompass those comprising other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically of 1 to about 30 amino acids (such as 1-10, or 1-5 amino acids); and small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag.
  • nucleic acid sequence and“polynucleotide” are used interchangeably and do not imply any length restriction.
  • nucleic acid and“nucleotide” are used interchangeably.
  • polynucleotide sequences of the present invention include nucleic acid sequences that have been removed from their naturally occurring environment, recombinant or cloned DNA isolates, and chemically synthesized analogues or analogues biologically synthesized by heterologous systems.
  • the polynucleotides of the present invention may also be produced by chemical synthesis, e.g. by the phosphoramidite method or the tri-ester method, and may be performed on commercial automated oligonucleotide synthesizers.
  • a double-stranded fragment may be obtained from the single stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
  • degenerate codon representative of all possible codons encoding each amino acid.
  • some polynucleotides encompassed by the degenerate sequence may encode variant amino acid sequences, but one of ordinary skill in the art can easily identify such variant sequences by reference to the amino acid sequences of the present invention.
  • A“variant” nucleic acid sequence has substantial homology or substantial similarity to a reference nucleic acid sequence (or a fragment thereof).
  • a nucleic acid sequence or fragment thereof is“substantially homologous” (or“substantially identical”) to a reference sequence if, when optimally aligned (with appropriate nucleotide insertions or deletions) with the other nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 70%, 75%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 99% of the nucleotide bases. Methods for homology determination of nucleic acid sequences are known in the art.
  • a“variant” nucleic acid sequence is substantially homologous with (or substantially identical to) a reference sequence (or a fragment thereof) if the“variant” and the reference sequence they are capable of hybridizing under stringent (e.g. highly stringent) hybridization conditions.
  • Nucleic acid sequence hybridization will be affected by such conditions as salt concentration (e.g. NaCl), temperature, or organic solvents, in addition to the base composition, length of the complementary strands, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art.
  • Stringent temperature conditions are preferably employed, and generally include temperatures in excess of 30°C, typically in excess of 37°C and preferably in excess of 45°C.
  • Stringent salt conditions will ordinarily be less than 1000 mM, typically less than 500 mM, and preferably less than 200 mM.
  • the pH is typically between 7.0 and 8.3. The combination of parameters is much more important than any single parameter.
  • nucleic acid percentage sequence identity Methods of determining nucleic acid percentage sequence identity are known in the art.
  • a sequence having a defined number of contiguous nucleotides may be aligned with a nucleic acid sequence (having the same number of contiguous nucleotides) from the corresponding portion of a nucleic acid sequence of the present invention.
  • Tools known in the art for determining nucleic acid percentage sequence identity include Nucleotide BLAST.
  • One of ordinary skill in the art appreciates that different species exhibit“preferential codon usage”.
  • the term“preferential codon usage” refers to codons that are most frequently used in cells of a certain species, thus favouring one or a few representatives of the possible codons encoding each amino acid.
  • the amino acid threonine (Thr) may be encoded by ACA, ACC, ACG, or ACT, but in mammalian host cells ACC is the most commonly used codon; in other species, different Thr codons may be preferential.
  • Preferential codons for a particular host cell species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferential codon sequences into recombinant DNA can, for example, enhance production of the protein by making protein translation more efficient within a particular cell type or species.
  • the nucleic acid sequence is codon optimized for expression in a host cell.
  • A“fragment” of a polynucleotide of interest comprises a series of consecutive nucleotides from the sequence of said full-length polynucleotide.
  • a“fragment” of a polynucleotide of interest may comprise (or consist of) at least 30 consecutive nucleotides from the sequence of said polynucleotide (e.g.
  • Figure 1A-B Example MVA vector construction.
  • Figure 1A provides a schematic representation of cassette “MVALassaNP”.
  • Figure IB provides a schematic representation of plasmid l6ADHWFP_2037865QAD_MVALassaNP (pMVALassaNP).
  • Figure 2. Agarose gel confirming the presence of the MVALassaNP construct.
  • Flank to flank primers (SEQ ID NOs: 20 and 22) cover the entire insert and run from the MVA flanking regions at either end of the vaccine insert yielding an expected amplification product size of 32l8bp. Contents of wells are as follows (numbered left to right): 1. Ladder; 2.“Passage 1” Pl; 3. P2; 4. P3; 5. P4; 6.
  • Splenocyte IFN-g ELISPOT re-stimulation responses to individual peptide pools i) black bars indicate mice vaccinated with a single dose of MVALassaNP; ii) white bars indicate mice vaccinated with a prime and boost regime iii) checked bars indicate MVA wild-type prime and boost vaccinated mice; and iv) diagonal striped bars indicate PBS control mice.
  • Figure 8 Percentage weight compared to day of challenge in guinea pigs challenged with Lassa virus and previously immunised with MVALassaNP vaccine or control.
  • Figure 9 Change in temperature compared to day of challenge in guinea pigs challenged with Lassa virus and previously immunised with MVALassaNP vaccine or control.
  • Figure 10. Clinical score in guinea pigs challenged with Lassa virus and previously immunised with MVALassaNP vaccine or control.
  • MVALassaNP A cassette for MVA-Lassa NP (denoted“MVALassaNP”) was generated to contain a Pl l promotor, Green Fluorescence Protein (GFP) and MH5 promotor followed by a kozak sequence upstream of the NP sequence of SEQ ID NO: 1. Downstream of the NP sequence was adjacent to a 24 residue linker sequence followed by a V5 epitope and stop codon.
  • GFP Green Fluorescence Protein
  • pMVALassaNP plasmid l6ADFtWFP_2037865QAD_MVAlassaNP
  • CTGC AGGGAAAGTTTT AT AGGT AGTTGAT AGAAC AAAAT AC AT AATTTTG
  • pMVALassaNP comprises:
  • AAAAATT GAAAAT AAAT AC AAAGGTTCTTGAGGGTT GT GTT AAATT GAAA GCGAGAAATAATCATAAATAA (SEQ ID NO: 15)
  • MVALassaNP was amplified on CEF cells, purified by sucrose cushion centrifugation and titrated by plaque assay on CEF cells prior to in vivo use. Plaques were visualised using GFP fluorescence and by immunostaining with rabbit anti-vaccinia antibody (AbD Serotec, UK) and Vectastain Universal ABC-AP kit (Vector laboratories, USA). Genomic DNA from infected cells was extracted using Wizard SV genomic DNA purification system (Promega, USA) and used as a template in PCR with KAPA2G Fast HotStart PCR Kit (KAPABiosystems, USA) for genotype analysis.
  • PCR Polymerase chain reaction
  • the passaged picks align to a positive control (the original received plasmid from Geneart).
  • a second set of primers were designed to identify the entire insert, from both MVA flanking regions. The results indicate presence of pure recombinant MVA (MVA containing the insert) from passage 3 onwards. Again the original plasmid was used as a positive control and all passaged picks from passage 3 have the same expected size product as the positive control.
  • An MVA wild-type control was also run to show the expected product size without the MVALassa insert and this can be seen in passage 1 and 2.
  • SEQ ID NO: 20 CGGCACCTCTCTTAAGAAGT (Fwd targets Del III Left flank)
  • SEQ ID NO: 21 GTGTAGCGTATACTAATGATATTAG (Rev targets Del III Right flank)
  • SEQ ID NO: 22 GGAGTACAACTACAACAGCCACAACG (Fwd targets GFP)
  • the GFP Fwd primer binds to the GFP sequence and, when used in combination with the Rev Del III Right flank primer, covers the GFP through the nucleoprotein to the right MVA flank, and specifically identifies presence of the NP gene.
  • CEF cells were infected with MVALassaNP at a multiplicity of infection of 0.05 and incubated at 37°C in Modified Eagle Medium (MEM) supplemented with 2% FBS (Sigma-Aldrich. UK). The medium was removed after 48 hours once good GFP fluorescence and CPE was observed microscopically.
  • Cells were lysed with lx LDS Nupage® reducing sample buffer (Nupage® LDS sample buffer containing lx Nupage® sample reducing buffer) (Thermofisher, UK), transferred to Eppendorf tubes and heated at 70°C for 10 minutes. Uninfected cells were treated in the same manner as a negative control.
  • MVALassaNP lysates were subjected to SDS-PAGE on a 4-12% Bis-Tris gel (Life technologies) and proteins transferred to a nitrocellulose membrane.
  • the nitrocellulose membrane was blocked using 5% milk powder (Merck Millipore), then incubated in the presence of a primary antibody (Rabbit anti-V5 polyclonal (Invitrogen) at 1/1000 in PBS-0.05%Tween) for 1-2 hours rocking, before washing in PBS containing 0.05% Tween-20 (Sigma-Aldrich) 3 times.
  • Membranes were incubated in the presence of a HRP-conjugated secondary antibody (anti-rabbit IgG peroxidase (Sigma-Aldrich) at 1/1000 in PBS-0.05%Tween) for 1 hour rocking and washed as before. Protein expression was determined by detection of bound antibody using Pierce ECL WB substrate kit (Thermofisher) according to the manufacturer’s instructions and visualised in a Chemi-Illuminescent Imager (Syngene). Molecular weights were determined using molecular ladder MagicMark XP Western Protein Standard (Invitrogen) as a reference.
  • HRP-conjugated secondary antibody anti-rabbit IgG peroxidase (Sigma-Aldrich) at 1/1000 in PBS-0.05%Tween
  • the antigenic Lassa virus NP region of SEQ ID NO: 23 corresponds to SEQ ID NO: 2
  • short amino acid sequence KREIIIN corresponds to the translated 3’ terminus of the MH5 promoter
  • short amino acid sequence KPGAT corresponds to the translated 3’ terminus of the MH5 promoter and Kozak sequence.
  • SEQ ID NOs: 24 and 25 are bi-products of translation and are not considered to contribute to the advantageous technical effects provided by the invention.
  • Amino acid sequence GKPIPNPLLGLDST (SEQ ID NO:
  • amino acid sequence DLEGPRFE (SEQ ID NO:
  • mice 24 female 5-8 week old Balb-C mice were randomly divided into 4 groups and ear tagged prior to vaccinations.
  • Group 1 received a single vaccine shot of MVALassaNP in endotoxin free phosphate buffered saline (PBS) at 1 x 10 7 plaque forming units (pfu) per animal on day 14.
  • PBS phosphate buffered saline
  • Group 2 received a two dose vaccination of MVALassaNP in endotoxin free PBS at 1 x 10 7 pfu per animal on days 0 and 14.
  • Group 3 received a two dose vaccination of MV A 1974 (wild-type) in endotoxin free PBS at 1 x 10 7 pfu per animal on days 0 and 14.
  • Group 4 received a two dose vaccination of endotoxin free PBS as a negative control on days 0 and 14.
  • an interferon-gamma ELISPOT assay was used to measure frequencies of responsive T-cells after stimulation with Lassa virus specific peptides.
  • Peptides spanning the Lassa NP protein sequence were 15 residues long, with an overlap of 10 residues between peptides. 140 peptides were produced in total that were tested in seven peptide pools. They were applied to cells at a final concentration of 2.5 mg/ml per peptide, with 20 peptides per pool. Plates were developed after 18 hours at 37°C, 5% C0 2 in a humidified incubator. Spots were counted visually on an automated ELISPOT reader (Cellular Technologies Limited, USA). Background values from wells containing cells and medium but no peptides were subtracted and data presented as response to individual pools or summed across the target protein. Results were expressed as spot forming units (SFU) per 10 6 cells. Wells that had too many spots to count were recorded as“TNTC” (too numerous to count) and given an arbitrary value of 100-200 greater than the highest countable value.
  • SFU spot forming units
  • mice from groups 1 to 3 had TNTC spots for a vaccinia peptide mix with the PBS group remaining negative when stimulated with the vaccinia peptides.
  • the MVA-WT group and PBS group (groups 3&4) were negative when stimulated with all LassaNP pools.
  • an IFN-g response was detected to 2 distinct regions of the NP (corresponding to pools 2 and 4).
  • Peptide pool 2 corresponds to positions 81-171 of SEQ ID NO: 2 (or SEQ ID NO: 5), and is represented by SEQ ID NO: 6:
  • Peptide pool 4 corresponds to positions 241-331 of SEQ ID NO: 2 (or SEQ ID NO: 5), and is represented by SEQ ID NO: 7: ISGYNF SLGAAVKAGACMLDGGNMLETIKV SPQTMDGILKSILKVKKSLGMF V SDTPGERNPYENILYKICLSGDGWP YIASRTSIV GRAW (SEQ ID NO: 7)
  • T-cell (IFN-g) stimulation significantly increased in respect of SEQ ID NOs: 6 and 7.
  • Normal mouse serum (Sigma-Aldrich) and a polyclonal Anti-Lassa virus hyper immune mouse ascetic fluid sample (BEI Resources, EISA) were used as positive and negative control samples respectively. Plates were washed with PBS + 0.0l%Tween-20 and lOOpl of a polyclonal anti-mouse HRP conjugate (Sigma-Aldrich) at a 1 :20,000 dilution in 5% milk PBS + 0.0l%Tween-20 was added to each well.
  • the MVA-WT and the PBS control groups showed very little absorbance with values similar to those in the blank wells.
  • the normal mouse serum observed an absorbance of 0.28.
  • the mean of the normal mouse serum +3 Standard Deviations (0.36) was used as a positive/negative cut off. All sera observing an OD greater than 0.36 were deemed as positive and therefore to have sero-converted.
  • Table 1 shows the mean OD of each serum sample - those highlighted are deemed to have seroconverted and those un-highlighted have not.
  • Table 1 showing individual results from each mouse (average OD values at a 1:50 dilution). Values highlighted have shown sero-conversion with an OD above the cut-off of 3 standard deviations greater than the average OD for normal mouse serum. Values that are not highlighted have not sero-converted.
  • mice in the MVA-WT and PBS control group had ODs below the 0.36 cut off and the response of all mice in both the prime and the prime/boost vaccinated groups were greater than the cut-off.
  • the prime only group recorded an average absorbance of -0.75 and the prime/boost an average OD of - 1.2.
  • the difference between the response in the prime/boost group and the prime only group was significant ( ⁇ 0.0001 using a one way ANOVA with multiple comparisons) as was the difference between the prime only group and the control groups.
  • Group 3 received a two dose vaccination of MV A 1974 (wild-type) in endotoxin free PBS at 2 x 10 7 pfu per animal on days 0 and 14.
  • Group 4 received a two dose vaccination of endotoxin free PBS as a negative control on days 0 and 14.
  • a non-replicating adenovirus is engineered to express a Lassa virus NP or partial fragment thereof.
  • the genetic sequence for the Lassa virus NP is inserted into the genome of the adenovirus vector. Expression of the Lassa virus NP is indicated by reactivity between a NP-specific antibody and products from the adenovirus by Western blotting or ELISA as follows:
  • products from cells infected with the recombinant adenovirus are used to coat an ELISA plate. Lassa virus-specific antibodies bind to the coating and are detected via a chemical reaction.
  • a vaccine expressing the Lassa virus NP gene or functional fragment thereof, in an adenovirus or non-replicating poxvirus vector is delivered via a parenteral route into mice that are susceptible to disease caused by Lassa virus. They are challenged with a lethal dose of Lassa virus, from a strain other than that on which the vaccine is based. The challenged animals show no or mild clinical signs of illness, and do not require euthanasia. Control animals which received the same challenge dose of Lassa virus, but did not receive the vaccine, show severe signs of illness, reach humane clinical endpoints and require euthanasia.
  • Example 6 Preparation and efficacy of a recombinant Influenza virus vector
  • Reverse genetics are used to construct a recombinant influenza virus that carries a protective epitope of Lassa virus NP in the neuraminidase stalk.
  • Lassa virus-specific cytotoxic T lymphocytes are induced in mice after intranasal or parenteral administration. These CTLs provide a reduction in viral load and clinical illness after challenge with Lassa virus.
  • Example 7 Preparation and efficacy of a recombinant bacterial vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne un vecteur viral ou un vecteur bactérien, ledit vecteur comprenant une séquence d'acide nucléique codant pour une nucléoprotéine du virus Lassa ou un fragment antigénique de celle-ci; ledit vecteur étant capable d'induire une réponse immunitaire protectrice chez un sujet. La présente invention concerne également des compositions et des utilisations du vecteur dans des méthodes de traitement médical.
PCT/GB2019/050233 2018-01-29 2019-01-29 Composition antigénique du virus lassa WO2019145739A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1801437.3A GB201801437D0 (en) 2018-01-29 2018-01-29 Lassa virus antigenic composition
GB1801437.3 2018-01-29

Publications (1)

Publication Number Publication Date
WO2019145739A1 true WO2019145739A1 (fr) 2019-08-01

Family

ID=61558299

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2019/050233 WO2019145739A1 (fr) 2018-01-29 2019-01-29 Composition antigénique du virus lassa

Country Status (2)

Country Link
GB (1) GB201801437D0 (fr)
WO (1) WO2019145739A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024115785A1 (fr) * 2022-12-02 2024-06-06 The Vaccine Group Limited Vaccin

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
CHAO ZHANG ET AL: "Adenoviral vector-based strategies against infectious disease and cancer", HUMAN VACCINES AND IMMUNOTHERAPEUTICS, vol. 12, no. 8, 22 April 2016 (2016-04-22), US, pages 2064 - 2074, XP055571462, ISSN: 2164-5515, DOI: 10.1080/21645515.2016.1165908 *
DAVID G TOWNSEND ET AL: "Recombinant fowlpox virus vector-based vaccines: expression kinetics, dissemination and safety profile following intranasal delivery", JOURNAL OF GENERAL VIROLOGY., vol. 98, no. 3, 1 March 2017 (2017-03-01), GB, pages 496 - 505, XP055571450, ISSN: 0022-1317, DOI: 10.1099/jgv.0.000702 *
DAVID SAFRONETZ ET AL: "A Recombinant Vesicular Stomatitis Virus-Based Lassa Fever Vaccine Protects Guinea Pigs and Macaques against Challenge with Geographically and Genetically Distinct Lassa Viruses", PLOS NEGLECTED TROPICAL DISEASES, vol. 9, no. 4, 17 April 2015 (2015-04-17), pages 1 - 14, XP055571561, DOI: 10.1371/journal.pntd.0003736 *
DREXLER I ET AL: "Modified vaccinia virus Ankara as antigen delivery system: how can we best use its potential?", CURRENT OPINION IN BIOTECHNOL, LONDON, GB, vol. 15, no. 6, 1 December 2004 (2004-12-01), pages 506 - 512, XP004653482, ISSN: 0958-1669, DOI: 10.1016/J.COPBIO.2004.09.001 *
HILARY G. MORRISON ET AL: "Protection of guinea pigs from lassa fever by vaccinia virus recombinants expressing the nucleoprotein or the envelope glycoproteins of lassa virus", VIROLOGY, vol. 171, no. 1, 1 July 1989 (1989-07-01), AMSTERDAM, NL, pages 179 - 188, XP055571578, ISSN: 0042-6822, DOI: 10.1016/0042-6822(89)90525-4 *
J.C.S CLEGG ET AL: "VACCINIA RECOMBINANT EXPRESSING LASSA-VIRUS INTERNAL NUCLEOCAPSID PROTEIN PROTECTS GUINEAPIGS AGAINST LASSA FEVER", THE LANCET, 1 January 1987 (1987-01-01), pages 186 - 188, XP055570336, Retrieved from the Internet <URL:https://www.sciencedirect.com/science/article/pii/S0140673687907677/pdf?md5=6576392d4d10876f6f2fffbf29dae694&pid=1-s2.0-S0140673687907677-main.pdf> [retrieved on 20190320], DOI: 10.1016/S0140-6736(87)90767-7 *
KATIE EWER ET AL: "Chimpanzee adenoviral vectors as vaccines for outbreak pathogens", HUMAN VACCINES AND IMMUNOTHERAPEUTICS, vol. 13, no. 12, 30 October 2017 (2017-10-30), US, pages 3020 - 3032, XP055571433, ISSN: 2164-5515, DOI: 10.1080/21645515.2017.1383575 *
M DJAVANI ET AL: "Mucosal immunization with Salmonella typhimurium expressing Lassa virus nucleocapsid protein cross-protects mice from lethal challenge with lymphocytic choriomeningitis virus", JOURNAL OF HUMAN VIROLOGY, 1 March 2001 (2001-03-01), United States, pages 103, XP055571573, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2391007/pdf/nihms47312.pdf> [retrieved on 20190320] *
M. D. BOWEN ET AL: "Genetic Diversity among Lassa Virus Strains", JOURNAL OF VIROLOGY., vol. 74, no. 15, 1 August 2000 (2000-08-01), US, pages 6992 - 7004, XP055570472, ISSN: 0022-538X, DOI: 10.1128/JVI.74.15.6992-7004.2000 *
MAHMOUD DJAVANI ET AL: "Murine immune responses to mucosally delivered Salmonella expressing Lassa fever virus nucleoprotein", VACCINE, vol. 18, no. 15, 1 February 2000 (2000-02-01), AMSTERDAM, NL, pages 1543 - 1554, XP055571575, ISSN: 0264-410X, DOI: 10.1016/S0264-410X(99)00439-9 *
S. P. FISHER-HOCH ET AL: "Effective Vaccine for Lassa Fever", JOURNAL OF VIROLOGY., vol. 74, no. 15, 1 August 2000 (2000-08-01), US, pages 6777 - 6783, XP055571563, ISSN: 0022-538X, DOI: 10.1128/JVI.74.15.6777-6783.2000 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024115785A1 (fr) * 2022-12-02 2024-06-06 The Vaccine Group Limited Vaccin

Also Published As

Publication number Publication date
GB201801437D0 (en) 2018-03-14

Similar Documents

Publication Publication Date Title
US10059747B2 (en) Crimean-congo haemorrhagic fever virus antigenic composition
US9951352B2 (en) Poxvirus expression system
US20220396810A1 (en) Vaccines and uses thereof to induce an immune response to sars-cov2
US11571471B2 (en) Recombinant modified vaccinia virus ankara (MVA) equine encephalitis virus vaccine
US20240123053A1 (en) Coronavirus vaccine through nasal immunization
EP3432922B1 (fr) Plateforme basée sur le virus orf pour l&#39;administration de vaccins
US20220275346A1 (en) Hantavirus antigenic composition
US20090053256A1 (en) Poxvirus Methods And Compositions
JP2023529124A (ja) コロナウイルスワクチンコンストラクトおよびこれを作製し使用する方法
WO2019145739A1 (fr) Composition antigénique du virus lassa
AU2022368453A1 (en) Chimeric betacoronavirus spike polypeptides
KR20230022206A (ko) 코로나바이러스 질환에 대응하는 재조합적 변형된 우두증 바이러스 앙카라 (mva) 백신
US20080299149A1 (en) Raccoon Poxvirus Expressing Genes of Feline Antigens
GB2624391A (en) Recombinant LSDV vectored bovine coronavirus antigen constructs
JP2024512103A (ja) ワクチンプラットフォームとしての高弱毒化複製可能組換えポックスウイルスおよびその利用方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19702967

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19702967

Country of ref document: EP

Kind code of ref document: A1