WO2019132217A1 - Cosmetic composition comprising styphnolobium japonicum fruit fermented solution or extract liquid thereof as effective ingredient for reducing skin wrinkle and preparation method therefor - Google Patents
Cosmetic composition comprising styphnolobium japonicum fruit fermented solution or extract liquid thereof as effective ingredient for reducing skin wrinkle and preparation method therefor Download PDFInfo
- Publication number
- WO2019132217A1 WO2019132217A1 PCT/KR2018/012963 KR2018012963W WO2019132217A1 WO 2019132217 A1 WO2019132217 A1 WO 2019132217A1 KR 2018012963 W KR2018012963 W KR 2018012963W WO 2019132217 A1 WO2019132217 A1 WO 2019132217A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- extract
- fruit
- cosmetic composition
- fermented
- fruit juice
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9789—Magnoliopsida [dicotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
- A61K2800/85—Products or compounds obtained by fermentation, e.g. yoghurt, beer, wine
Definitions
- the present invention relates to a cosmetic composition for improving skin wrinkles and a method for producing the same, and more particularly to a cosmetic composition for improving skin wrinkles containing a fermented lycopodium fruit juice or an extract thereof as an active ingredient and a method for producing the same, and more particularly to a fermentation liquor obtained by fermenting Lycopersicon esculentum with Lactobacillus,
- the present invention relates to a cosmetic composition for improving skin wrinkles and a method for producing the same, which comprises an extract of Lycoris squamycinum fruit or its extract, which is excellent in the effect of improving skin wrinkles and has no adverse effects on skin irritation.
- the present invention provides a cosmetic composition
- a cosmetic composition comprising a niacin fermentation broth or an extract thereof as an active ingredient to inhibit fibroblast proliferation promotion, gene expression of collagen, TIMP-1, and Tropoelastin in a molecule, and gene expression of MMP-1 To improve the wrinkles of the skin, and an extract thereof, as an active ingredient, and a process for producing the same.
- cosmetics are not only clean and aesthetic, but also free radicals (radicals) due to external factors such as moisture, pollutants and stress, ultraviolet rays, internal factors such as impaired immune cell function, , And to remove or suppress the cause of skin aging such as protein, nucleic acid, cell membrane lipid breakage by peroxide and the like.
- Human skin generally becomes rough with loss of moisture, elasticity, color and gloss due to internal and external environment as it gets older. This is called skin aging, and it is a process in which the stain, wrinkles, and freckles increase.
- Collagen is present in the dermal layer of the skin and accounts for about 70% of the total dry skin weight.
- the elasticity of the skin is known to be maintained by this collagen and elastin (elastic fibers).
- Collagen molecules are made in Fibroblasts, which form a triple helical structure after they are secreted out of the cell.
- the main functions of collagen are known to maintain the mechanical rigidity of the skin, to strengthen the binding force of the connective tissues and to strengthen the bonding strength of tissues, to support cell adhesion, to induce cell division and differentiation (Van der Rest et al., 1990).
- MMP matrix metalloproteinase
- skin elasticity is reduced due to decrease in cellular activity due to natural aging, increase in active oxygen and free radicals due to internal factors such as collagenase activity, and external factors such as pollution, ultraviolet rays, and stress (Ingrid Emerit et al., Free radical and aging, 1992).
- the substrate metalloproteinase is a proteolytic agent secreted in vivo by natural aging and exposure to ultraviolet light, which degrades connective tissue (Collagen, Elastin, Glycosamino-glycans, etc.) in the extracellular matrix (ECM) It is an enzyme.
- the substrate metalloproteinases are calcium and zinc-dependent endopeptidases (Endopeptidase) secreted from cells such as polymorphonuclear neutrophils, macrophages, fibroblasts, and bone cells. ) At neutral pH and uses a variety of extracellular substrates as substrates. The types exist from MMP 1-16.
- Substrate metalloproteinase (MMP) which is intensively studied in relation to double collagen degradation, is MMP 1 and MMP 9.
- the formulation technique is complicated, the use of the protein from the animal placenta is restricted due to safety problems such as irritation and redness in the skin, and the use of the bovine extract due to mad cow disease is prohibited. It is difficult to expect an effect of improving the wrinkles of the skin by promoting the synthesis of the skin.
- Sophora japonica L. is a broad-leaved arboreous tree belonging to the leguminous plants. It is distributed widely in Northeast Asia including Korea, China, and Japan. The height of the tree is 15 ⁇ 25m and the twigs have no hair and have a full color. Leaves are elliptical or petiole-shaped and have 9 to 15 discordant leaflets.
- the flowers and fruits of the above painting trees are used as herbal medicines in oriental medicine. They contain apigenin and isoflavone, which are flavonoid compounds separated from bean leaves, and are effective for antiinflammation, hemostasis, hypertension, hemorrhoids and eczema treatment. , Uterine hemorrhage, inflammation of the gums and skin makeup (Song, Sun-sun et al., Korea Cosmetic Societies, 2016, 42 (4), p351-358).
- Sophprae Flos which contains a lot of honey, contains 10 ⁇ 28% of routine, a small amount of chemperol, quercetin, vesicular and genistein glycosides, A, soffin B, and soffin C were separated.
- the above-mentioned needle-making is excellent in tyrosinase inhibitory activity and melanin formation inhibitory effect, and is also useful as a composition for whitening. (Registered Patent No. 10-1289813)
- the fruit of a painting tree is a pod or cylindrical shape. Fruit is used for the treatment of hemorrhoids along with branches and bark, and the garden or wood is also used as furniture. It has been found out that the above-mentioned fruit of the painting tree, especially the painting tree, has a better estrogen-releasing activity than the estradiol, which is the most effective of the estrogen, (Patent Application Publication No. 10-2011-0004603).
- the conventionally used coniferous tree extract which is effective for anti-aging and skin wrinkle, is a substance that simply inhibits ascorbic acid, retinol and collagenase activity. It is formulated into cosmetics and medicines to prevent skin wrinkles and aging.
- it is difficult to obtain a substantial effect because the effect is insignificant because the stability is poor or the skin is not easily absorbed when it is formulated.
- the present invention has been conceived in order to solve the above-mentioned problems, and it is an object of the present invention to provide a fermentation broth obtained by fermenting Natto fruit with Lactobacillus or an extract obtained by extracting the fermentation broth,
- the present invention provides a cosmetic composition for improving skin wrinkles and a process for producing the same, which comprises a nutrient fermentation broth or an extract thereof as an active ingredient.
- the present invention provides a cosmetic composition
- a cosmetic composition comprising a niacin fermentation broth or an extract thereof as an active ingredient to inhibit fibroblast proliferation promotion, gene expression of collagen, TIMP-1, and Tropoelastin in a molecule, and gene expression of MMP-1 And to provide a cosmetic composition for improving skin wrinkles and a process for producing the same, which comprises a fruit juice fermented with or without an extract thereof as an active ingredient.
- the present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing a fruit juice fermented with Natto fruit obtained by fermenting Natto fruit with Lactobacillus.
- the present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing an extract of a fruit juice obtained from fermentation of Fruit tree fruit with Lactobacillus.
- the fruit tree extract may be any one selected from the group consisting of water, an anhydrous or hydrated lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol It is preferable to be extracted by using.
- Step S20 of obtaining a fermentation broth by inoculating a strain Lactobacillus in the extract of Lycoris chejuensis, and culturing the fermented broccoli in the fermentation broth of step (S20)
- Step S30 of obtaining a fruit juice extract from the fruit tree using a hot water extraction method after removing the bacteria, and a step of adding a stabilizer, a vitamin, and a pigment to the fruit juice fermentation extract of Phalaenopsis fruit of step (S20) , A coloring matter and a flavoring agent (S40).
- the cosmetic composition for improving skin wrinkles containing the fermented Lactococcus lactis L. or extract thereof according to the present invention as an active ingredient and the preparation method thereof can be obtained by obtaining a fermentation broth fermented with Lactobacillus or an extract obtained by extracting the fermented broth
- the effect of improving skin wrinkles is excellent and there is no side effect on skin irritation.
- the cosmetic composition for improving skin wrinkles and the method for producing the same which contains the fruit juice fermentation product or extract thereof as an active ingredient according to the present invention, can provide a cosmetic composition containing a fruit juice fermentation product as an active ingredient, , Intramolecular collagen, TIMP-1 and Tropoelastin gene expression and gene expression of MMP-1 are inhibited to improve the wrinkles of the skin.
- FIG. 1 is a flowchart of a method for producing a cosmetic composition for improving skin wrinkles containing an extract of Lycoris spp. Or extract thereof according to an embodiment of the present invention as an active ingredient.
- the present invention has been studied based on a fermentation technique for maximizing the effect of improving skin wrinkles and effectiveness. As a result, it was confirmed that the fermentation broth fermented with Lactobacillus or the extract thereof significantly inhibited the gene expression of Collagen, TIMP-1 and Tropoelastin and the gene expression of MMP-1 in the intramolecular form, Thereby completing the invention.
- a cosmetic composition for improving skin wrinkles containing the fruit of the present invention as an active ingredient or an extract thereof is as follows.
- the present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing a fruit juice fermented with Natto fruit obtained by fermenting Natto fruit with Lactobacillus.
- the present invention is characterized in that it is a cosmetic composition for improving skin wrinkles containing an extract obtained from a fruit juice fermentation obtained from fermentation of fruit tree fruit with lactobacillus.
- the extract of Painted Tree Flower and Painted Tree Leaf was used as a cosmetic composition.
- the present invention only fruit tree fruit was used in order to maximize the effect of wrinkle improvement and effectiveness, and the skin absorption efficiency of the active ingredient was increased.
- the present invention uses a fermentation broth fermented with Lactobacillus nucifera or its extract as a cosmetic composition for improving the wrinkles of skin, thereby determining gene expression of Collagen, TIMP-1 and Tropoelastin and gene expression of MMP-1 Is remarkably suppressed than in the prior art, thereby maximizing the skin improvement effect.
- the dried fruit weight of the fruit tree is 10 to 40% by weight, and the fruit fruit is selected from the group consisting of water, anhydrous or lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1 , 3-butylene glycol, and the like.
- the nuts can be prepared by conventional methods known in the art, that is, under the conditions of ordinary temperature and pressure, using a conventional solvent.
- the active ingredient of the composition of the present invention may be selected from the group consisting of water, anhydrous or lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol Or extracting the nuts from the fruit with the above-mentioned solvent, and then mixing them.
- the solvent is preferably an alcohol, preferably ethanol, and the ethanol is more preferably 60 to 80% ethanol.
- the appropriate amount of the above-mentioned extraction solvent is 1 to 20 times by weight, more preferably 5 to 20 times by weight, and most preferably 10 times by weight, of the dried woody fruit.
- the fermentation broth obtained by fermenting the nuts of the present invention with Lactobacillus not only includes the extract obtained by the above-mentioned extraction method but also the extract obtained through ordinary purification process.
- the fermentation broth obtained by fermenting the nuts of the present invention with lactobacillus may also include a fermentation broth prepared by further processing such as vacuum distillation, freeze-drying, spray drying and the like.
- the present invention relates to a fermentation broth fermented with Lactobacillus or a fermentation broth obtained by extracting the above fermented broccoli fruit from Lactobacillus japonica or Lactobacillus sp. And suppresses gene expression of MMP-1, which is superior to skin wrinkle improving effect and has no side effects on skin irritation.
- the fermentation broth fermented with Lactobacillus can be in the form of a concentrated liquid or a dried powder.
- Lactobacillus was fermented using a strain of Lactobacillus rhamnsus vitaP1 (accession number: KACC92054P), which was identified from human feces, using a strain possessed by Deng Jing Biotech.
- the cosmetic composition for improving skin wrinkles containing the fruit juice fermentation broth of the present invention as an active ingredient exhibits excellent wrinkle-reducing effect and exhibits excellent stability in applied products.
- the fermentation broth fermented with Lactobacillus or the extract of the fermentation broth according to the present invention is 0.01 to 20.0% by weight, preferably 0.1 to 15.0% by weight based on the total weight of the cosmetic composition, By weight is from 1 to 10.0% by weight.
- the extract of the above-mentioned fruit tree extract or fermentation broth extract is less than 0.01% by weight based on the total weight of the cosmetic composition, the effect of promoting fibroblast proliferation, the expression of collagen, TIMP-1 and Tropoelastin in the molecule and gene expression of MMP- , And if it is more than 20% by weight, it may cause skin itching and tingling to a person having dry skin.
- the fruit juice fermentation extract of the present invention or extract of fermentation broth of the present invention has an effect of improving skin wrinkles and has no adverse effect on skin irritation except for a person having dry skin,
- a fruit juice fermentation extract or a fruit juice fermentation extract can be used as a cosmetic composition.
- the ingredients contained in the cosmetic composition of the present invention include components commonly used in cosmetic compositions in addition to the fermentation broth obtained by fermenting Natto fruit as an active ingredient with Lactobacillus.
- examples thereof include antioxidants, stabilizers, solubilizers, vitamins, Conventional auxiliaries such as coloring and flavoring agents, and carriers.
- the cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, a pack, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.
- the formulation of the present invention is a paste, cream or gel
- lactose When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component.
- a spray in particular, / Propane or dimethyl ether.
- a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, Glycerol, aliphatic esters, phenoxyethanol, triethanolamine, polyethylene glycol, beeswax, polysorbate 60, sorbitan sesquiolead, paraffin, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene sorbitan fatty acid esters, Sorbitan stearate, glycerin monostearate, stearic acid, glyceryl stearate / fat-400 stearate, carboxy polymer, sitosterol, polyglyceryl 2-oleate, ceramide, cholesterol, , Macadamia oil, carboxyvinyl polymer
- a liquid diluent such as water, ethanol, glycerin, butylene glycol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester
- a liquid diluent such as water, ethanol, glycerin, butylene glycol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester
- suspensions microcrystalline cellulose, hydroxyethylcellulose, sodium hyaruronate, phenoxyethanol, aluminum metahydroxide, bentonite, stearic acid, cetyl alcohol, glyceryl monostearate, polyoxyethylene sorbitan monostearate , Sorbitan sesquioleate, glyceryl monostearate / glyceryl stearate / polyoxyethylene stearate, wax,
- the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide At least one selected from ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.
- FIG. 1 is a flowchart showing a method for producing a cosmetic composition for improving skin wrinkles containing a fruit juice fermentation product according to the present invention as an active ingredient.
- a method for producing a cosmetic composition for improving skin wrinkles containing the present invention's nutritional liquid fruit juice as an active ingredient preferably includes the following steps But is not limited thereto.
- the dried fruit is washed with purified water, dried and then pulverized, and a fine pulverized product is obtained using a sieve of 50 to 200 mesh.
- 100 to 300 g / L of distilled water is added to the above ground fruit juice, refluxed for 3 to 7 hours under reflux condition, and cold-frozen. Thereafter, it is filtered with a filter paper of 3 to 8 ⁇ to prepare an extract and used as an extract of the fermentation process.
- the strain Lactobacillus and the LB Broth medium are added to the extract of Lycopersicon esculentum obtained in the step S10, and the fermentation is carried out for 25 to 35 days under the condition of 40 to 120 hours. After culturing, the culture solution is centrifuged to remove the culture solution first, and the filtrate thus obtained is filtered again to 0.2 ⁇ m using a filter, and sterilized to prevent further culture.
- the fruit juice fermentation product obtained in step S20 may contain 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.
- the amount of the fermented fruit juice is less than 0.01% by weight based on the total weight of the cosmetic composition, there is a problem in that the activity of lipoxygenase and hyaruronidase is inhibited and free radicals are not extinguished. There is a problem that the skin gets itchy and tingling.
- step (S30) of obtaining the Lactobacillus fruit juice extract solution using the hot water extraction method is performed.
- an extract of Lycoris fruit juice is obtained by extracting with hot water. After removing the culture, the fruit juice is extracted with reflux for 3 to 7 hours, refluxed, and filtered through a filter paper of 3 to 8 ⁇ . After the filtration is completed, the fruit juice extract is obtained.
- the fruit juice fermentation extract obtained in step S30 may contain 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.
- the extract When the extract is less than 0.01% by weight based on the total weight of the cosmetic composition, there is a problem in that the activity of lipoxygenase, hyaruronidase is inhibited and the free radical is not extinguished. When the extract is more than 20% by weight, People with skin itching and tingling may have problems.
- the nuts were washed with purified water, dried and then pulverized, and then finely pulverized using a sieve of 100 mesh.
- a 10% (v / v) aqueous ethanol solution was added to 100 g / L of the crushed fruit juice, and the mixture was refluxed for 3 hours under reflux condition for 5 hours. Thereafter, the extract was filtered using a filter paper of 6 ⁇ (whatman # 3) and used as an extract of the fermentation process.
- the above extract was used at the concentration of 50 or less under reduced pressure and freeze-dried to evaluate the efficacy.
- the strain Lactobacillus rhamnosus VitaP1 accession number: KACC92054P
- LB Broth medium LB Broth medium
- fermentation is carried out under the condition of No. 30 for 96 hours.
- the fermentation broth was centrifuged to remove the cultures first, and the filtrate thus obtained was filtered to 0.2 ⁇ m using a filter and sterilized (121, 15 minutes, 1.5 atm) to prevent further culture.
- Purified water was added to the fermented fruit juice obtained by sterilization, and the mixture was refluxed three times for 5 hours, cooled, and filtered through a filter paper (whatman # 3) of 6 ⁇ m. After filtration, the obtained extract was transferred to a concentration tank and concentrated under reduced pressure and freeze-dried at 50 or less.
- the fermentation strain Lactobacillus rhamnosus vitaP1 (accession number: KACC92054P) used in the example is cultured in LB broth medium for 30 hours under the condition of No. 30 for 96 hours. After culturing, the culture solution was centrifuged to remove the culture solution first, and the filtrate thus obtained was filtered again to 0.2 ⁇ m using a filter, and then sterilized (121, 15 minutes, 1.5 atm) to prevent further culture. The culture medium from which the cultures were removed was transferred to a concentration tank and concentrated under reduced pressure and freeze-dried at 50 or less.
- Collagen and Timp-1 were used to determine the expression of the genes that act on the anti-aging of the dried powder of the natto fruit fermented product prepared in Examples and Comparative Examples, the dry powder of the lactobacillus culture solution and the dry powder prepared in the preparation example Human keratinocyte cell line (HaCaT) was used, and MMP-1 and Tropoelastin used CCD-986Sk (human fibroblast cell line).
- HaCaT Human keratinocyte cell line
- MMP-1 and Tropoelastin used CCD-986Sk (human fibroblast cell line).
- HaCaT and CCD-986Sk cells were cultured in DMEM containing 10% (v / v) FBS (fetal bovine serum, Gibco, USA), 100 U / mL streptomycin, 100 U / mL penicillin antibiotics (Gibco, USA) using Dulbecco's modified eagle's medium, Gibco , USA) medium and cultured in an incubator of 5% CO 2 and 37 conditions.
- FBS fetal bovine serum, Gibco, USA
- streptomycin 100 U / mL
- penicillin antibiotics Gibco, USA
- the cells were cultured in a 96-well microplate at 5,000 cells / well in a thermostatic chamber for 30 minutes.
- the samples were treated with 0.01, 0.05, 0.1 and 0.5% (w / w) V)) and cultured for 72 hours. After 72 hours of incubation, thiazoline blue was added and further incubated for 4 hours. The culture medium was discarded and the reaction stop solution was added to each well of the microplate. After stirring for 5 minutes, the absorbance at 570 nm was measured.
- the control group was co-cultured with 10% Fetal Bovine Serum (FBS) medium as an optimal condition for cell growth, and the cell proliferation rate of the test group was calculated with the cell proliferation of the control group as 100% Respectively.
- FBS Fetal Bovine Serum
- Example 100 0.00 106.31 115.28 122.84 128.25 Comparative Example 100 0.00 100.14 100.37 100.20 100.23 Manufacturing example 100 0.00 104.10 110.22 116.76 121.15
- the cell proliferation effect was exhibited in the examples and the production examples, and the cell proliferation effect was superior to the production examples.
- the comparative example there was no cytotoxicity, but the cell proliferation effect was also not confirmed.
- Test Example 2 Intracellular collagen, Timp -1 and Tropoelastin Gene expression and MMP -1 gene expression inhibitory effect
- HaCaT and CCD-986Sk cells were cultured in Petri dishes at 5% CO 2 and 37 for 24 hours after preparing cells at 5 ⁇ 10 5 cells / ml. Cells were grown in petri dishes at least 80% and then added at concentrations that were above 100% of the extract cell viability.
- the cells were treated with DMEM / 10 FBS for 24 hours at 5% CO 2 and 37 Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.
- the primer sequences of the respective genes are shown in Table 2.
- the extracted RNA was amplified with a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to a total volume of 15 ⁇ l. After denaturing for 70 minutes, reverse transcription of Moloney murine leukemia virus (M-MLV) 42, 60, and 94 5 minutes.
- M-MLV Moloney murine leukemia virus
- the synthesized cDNA was amplified by PCR and the total reaction volume was 25 ⁇ l.
- the final concentration of each reagent was 100 pmol of the primer, 1.0 M of the primer, 0.2 mM of the dNTP mixture, 5x green or colorless GoTaq Reaction buffer 1?
- GAPDH Forward GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG MITF Forward: AACCGACAGAAGAAGCTGGA Reverse: ACAAGTTCCTGGCTGCAGTT Tyrosinase Forward: TTATGCGATGGAACACCTGA Reverse: ACTGGCAAATCCTTCCAGTG
- the examples of the present invention showed that collagen and TIMP were more effective than the dry powder of the Lactobacillus culture liquid prepared in the Comparative Example and the dried powder of the Lactobacillus broth extract prepared in the Preparation Example, -1 expression, and the expression of MMP-1 tended to decrease in a concentration-dependent manner.
- adenosine (Adenosine), excellent or similar results were obtained.
- Tropoelastin is a factor that forms elastic fiber-centered elastin showing skin elasticity, which is similar to that of control adenosine in Example 1
- Table 7 shows formulation examples of cosmetic lotion (skin lotion) among the cosmetic compositions containing the dried powder of the natto fruit fermented product of Example.
- Table 8 shows formulation examples of nutritional lotion among the cosmetics containing the dried powder of the nude fruit fermented product of Example.
- 10, 11, 13 and 16 as shown in Table 8 were heated to 80 to 85 while mixing and stirring, and then put into a manufacturing part and then emulsified by 2, 3, 4, 5, 6, 7, 8, 9 and 12 were melted by heating to 80 to 85, and then emulsified. After the emulsification was completed, the mixture was cooled to 50 with stirring using an agitator, and then 15 was added. After cooling to 45, 14 was added, and 1 was added to 35, followed by cooling to 25, followed by aging.
- Table 9 shows formulation examples of nutritional creams among the cosmetic compositions containing the dried powder of the nectarine fermented product of Example.
- Concentrated fruit juice Composition of nutritional cream containing number Raw material content( weight% )
- One Dried fruit powder (Example) 3.0 2
- Stearic acid 2.0
- Cetyl alcohol 2.0
- Glyceryl monostearate 2.0
- Polyoxyethylene sorbitan monostearate 0.5
- Sorbitan sesquioleate 0.5
- Wax 1.0 Liquid paraffin 4.0
- Squalane 4.0 Caprylic / capric triglyceride 4.0
- Carboxyvinyl polymer 0.2
- Butylene glycol 5.0
- Triethanolamine 0.5 16 Purified water Balance
- the ingredients 12, 13, 14, and 16 as shown in Table 9 were heated to 80 to 85 while mixing and stirring, and then put into a manufacturing part and then emulsified with 2, 3, 4, 5, 6, 7 , 8, 9, 10 and 11 were melted by heating to 80 to 85 ° C, and then 15 parts of the mixture were stirred and introduced into the production section and emulsified. After the emulsification was completed, the mixture was cooled to 35 with stirring using an agitator, and the mixture was cooled to 25 ° C and aged.
- Table 10 shows the formulation examples of the essence in cosmetics containing the dried powder of the natto fruit fermentation broth of the Example.
- nonionic amphiphilic lipids prepared by homogenizing 2, 3, 4, 5 and 6 in Table 10 at a constant temperature.
- the non-ionic amphipathic lipid was mixed with 1, 7, 8 and 14, homogenized at a constant temperature, passed through a microfluidizer and then slowly inoculated at a constant temperature to homogenize the microfluidizer. And then 10, 11, 12 and 13 were added thereto, dispersed, stabilized and aged.
- the present invention is not limited to the above-described embodiments, but may be practiced in various other forms, for example, a cosmetic composition for improving skin wrinkles and a method for producing the same, And it is to be understood that the present invention is not limited to the details of the foregoing embodiments, but, on the contrary, it is to be understood that the present invention may be embodied in many other specific forms without departing from the spirit or essential characteristics thereof. It is only defined by category.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Dermatology (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Birds (AREA)
- Epidemiology (AREA)
- Cosmetics (AREA)
Abstract
The present invention relates to a cosmetic composition comprising a Styphnolobium japonicum fruit fermented solution or an extract liquid thereof as an effective ingredient for reducing skin wrinkles and a preparation method therefor. More particularly, the present invention relates to a Styphnolobium japonicum fruit fermented solution or an extract liquid thereof as an effective ingredient for reducing skin wrinkles and a preparation method therefor, wherein a Styphnolobium japonicum fruit is fermented with lactobacillus to afford a fermented solution and the fermented solution or an extract liquid therefrom is used as an effective ingredient in a cosmetic composition that has an excellent effect of skin wrinkle reduction and is free of the side effect of skin irritation. The composition is provided for reducing skin wrinkles by promoting the proliferation of fibroblasts and inhibiting the gene expression of intramolecular collagen, TIMP-1, tropoelastin, and MMP-1.
Description
본 발명은 회화나무열매발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법에 관한 것으로, 상세하게는 회화나무열매를 락토바실러스로 발효한 발효액 또는 상기 발효액을 추출한 추출액을 수득하여 피부 주름개선 효과가 우수하고 피부 자극에 대한 부작용이 없는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법에 관한 것이다. The present invention relates to a cosmetic composition for improving skin wrinkles and a method for producing the same, and more particularly to a cosmetic composition for improving skin wrinkles containing a fermented lycopodium fruit juice or an extract thereof as an active ingredient and a method for producing the same, and more particularly to a fermentation liquor obtained by fermenting Lycopersicon esculentum with Lactobacillus, The present invention relates to a cosmetic composition for improving skin wrinkles and a method for producing the same, which comprises an extract of Lycoris squamycinum fruit or its extract, which is excellent in the effect of improving skin wrinkles and has no adverse effects on skin irritation.
또한, 본 발명은 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 화장료 조성물을 제공함으로써, 섬유아세포 증식 촉진, 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현을 억제하여 피부의 주름을 개선하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물 및 그의 제조방법에 관한 것이다.Further, the present invention provides a cosmetic composition comprising a niacin fermentation broth or an extract thereof as an active ingredient to inhibit fibroblast proliferation promotion, gene expression of collagen, TIMP-1, and Tropoelastin in a molecule, and gene expression of MMP-1 To improve the wrinkles of the skin, and an extract thereof, as an active ingredient, and a process for producing the same.
화장품의 기능은 청결과 미적 기능뿐만 아니라, 수분, 공해 물질과 스트레스, 자외선 등의 외적인 요인과 면역세포의 기능저하, 세포 활성의 저하 등의 내적 요인에 기인한 자유 라디칼(Free Radical), 활성산소, 과산화물 등에 의한 단백질, 핵산, 세포막 지질 파괴 등의 피부 노화의 원인을 제거하거나 억제하는 것이다. The functions of cosmetics are not only clean and aesthetic, but also free radicals (radicals) due to external factors such as moisture, pollutants and stress, ultraviolet rays, internal factors such as impaired immune cell function, , And to remove or suppress the cause of skin aging such as protein, nucleic acid, cell membrane lipid breakage by peroxide and the like.
또한, 소비자의 고기능 화장품에 대한 욕구를 충족시키기 위한 미백, 피부주름 개선 및 억제, 그리고 자외선 차단 기능을 갖는 화장품들이 계속해서 개발되고 있다. 그 중에서도 특히 주름 개선 및 억제 제품은 피부를 젊게 유지하려는 소비자의 많은 관심을 받는 대상이다. In addition, cosmetics having whitening, skin wrinkle improvement and inhibition, and ultraviolet shielding function to meet consumers' desire for high-performance cosmetics are continuously being developed. Among them, wrinkle-improving and suppressing products are particularly attracted to consumers who want to keep their skin young.
사람의 피부는 일반적으로 나이가 들어감에 따라 내, 외적인 환경에 의하여 수분, 탄력성, 색 및 윤기를 잃고 거칠어진다. 이것을 피부 노화라고 하며, 기미, 주름, 주근깨 등이 많아지는 과정이다. Human skin generally becomes rough with loss of moisture, elasticity, color and gloss due to internal and external environment as it gets older. This is called skin aging, and it is a process in which the stain, wrinkles, and freckles increase.
아이 때는 체내에 콜라겐(collagen)이 많아서 온몸이 매끌매끌하지만, 나이가 들면 콜라겐이 부족하거나 질이 저하되어 피부는 탄력을 잃고 주름이 생기게 된다. 피부의 주름은 피부의 수분 함유량과 콜라겐의 함유량 그리고 면역 기능 등의 여러 요인에 영향을 받으며, 이 중에서도 가장 큰 영향을 미치는 것이 콜라겐의 함유량인 것으로 알려져 있다. When a child has collagen in the body (collagen), but the whole body is smaekgyeo, but at the age of collagen is lacking or vaginal depletion, the skin will lose elasticity and wrinkles. Skin wrinkles are influenced by various factors such as moisture content of skin, collagen content, and immune function. It is known that the content of collagen is the most important factor.
콜라겐은 피부의 진피층에 존재하며 전체 피부 건조중량의 약 70 %를 차지한다. 피부의 탄력은 이 콜라겐과 엘라스틴(elastin, 탄력섬유)에 의해서 유지되는 것으로 알려져 있다. Collagen is present in the dermal layer of the skin and accounts for about 70% of the total dry skin weight. The elasticity of the skin is known to be maintained by this collagen and elastin (elastic fibers).
콜라겐 분자는 파이브로블라스트(Fibroblast) 내에서 만들어지며, 이들이 세포 밖으로 분비된 후에 3중 나선 구조를 형성한다. 콜라겐의 주된 기능으로는, 피부의 기계적인 견고성 유지, 결합 조직의 저항력 및 조직의 결합력 강화, 세포 접착의 지탱, 세포 분할 및 분화의 유도 등이 알려져 있다(Van der Rest 등, 1990). Collagen molecules are made in Fibroblasts, which form a triple helical structure after they are secreted out of the cell. The main functions of collagen are known to maintain the mechanical rigidity of the skin, to strengthen the binding force of the connective tissues and to strengthen the bonding strength of tissues, to support cell adhesion, to induce cell division and differentiation (Van der Rest et al., 1990).
생체 내에서 콜라겐과 같은 세포외기질의 합성과 분해는 적절하게 조절되나 노화가 진행되면서 그 합성이 감소하며 콜라겐을 분해하는 효소인 기질 금속 단백질 분해효소(MMP, matrix metalloproteinase)의 발현이 촉진되어 피부의 탄력이 저하되고 주름이 형성된다. Synthesis and degradation of collagen-like extracellular matrix in vivo are moderately controlled, but their synthesis is reduced as aging progresses and expression of matrix metalloproteinase (MMP), an enzyme that degrades collagen, is promoted, The elasticity is lowered and wrinkles are formed.
또한, 자연 노화에 의한 세포 활성의 감소 및 콜라게나아제(collagenase)의 활성으로 인한 내적 요인 및 공해, 자외선, 스트레스 등의 외적 요인에 의한 활성산소 및 자유 라디칼의 증가로 인해 피부의 탄력이 감소하게 된다(Ingrid Emerit 등, Free radical and aging, 1992). In addition, skin elasticity is reduced due to decrease in cellular activity due to natural aging, increase in active oxygen and free radicals due to internal factors such as collagenase activity, and external factors such as pollution, ultraviolet rays, and stress (Ingrid Emerit et al., Free radical and aging, 1992).
기질금속 단백질 분해효소(MMP)는 자연 노화와 자외선 노출에 의해서 생체 내에서 분비되는 단백질 분해제로 세포외기질(ECM, Extra Cellular Matrix)내의 결합조직(Collagen, Elastin, Glycosamino-glycans 등)을 분해하는 효소(Enzyme) 이다. 기질금속 단백질 분해효소(MMP)는 다형 핵성 호중구 (Polymorphonuclearneutrophil), 대식 세포(Macrophage), 섬유아세포(Fibroblast), 골세포(Born cell)와 같은 세포로부터 분비되는 칼슘 및 아연의존성 엔도펩티다제(Endopeptidase)로 중성 pH에서 작용하며 기질로써 여러가지 세포외기질을 이용한다. 그 종류는 MMP 1~16까지 존재한다. 이중 collagen 분해와 관련하여 집중적으로 연구되는 기질금속 단백질 분해효소(MMP)는 MMP 1, MMP 9이다. The substrate metalloproteinase (MMP) is a proteolytic agent secreted in vivo by natural aging and exposure to ultraviolet light, which degrades connective tissue (Collagen, Elastin, Glycosamino-glycans, etc.) in the extracellular matrix (ECM) It is an enzyme. The substrate metalloproteinases (MMPs) are calcium and zinc-dependent endopeptidases (Endopeptidase) secreted from cells such as polymorphonuclear neutrophils, macrophages, fibroblasts, and bone cells. ) At neutral pH and uses a variety of extracellular substrates as substrates. The types exist from MMP 1-16. Substrate metalloproteinase (MMP), which is intensively studied in relation to double collagen degradation, is MMP 1 and MMP 9.
일반적으로 80세에는 20세에 비해 65%의 콜라겐이 감소하여 피부의 두께가 얇아지고, 이는 피부의 주름 형성과 밀접한 관련이 있다고 알려져 있다(Arthur K. Balin 등, Aging and the skin, 1989). In general, at 80 years of age, 65% of collagen is reduced compared to 20 years of age, resulting in thinner skin thickness, which is known to be closely related to the wrinkling of the skin (Arthur K. Balin et al., Aging and the skin, 1989).
또한, 근래에는 피부 노화에 대한 광범위한 연구가 진행되면서 피부에서 콜라겐의 중요성이 한층 강조되고 있다. 피부 내 콜라겐의 합성촉진, MMP 1, MMP 9 등과 같은 기질 금속 단백질 분해효소의 활성억제를 통하여 진피 기질의 성분이 증가됨으로 이로부터 항산화, 주름개선, 탄력증진, 피부강화 및 상처 치유와 같은 항노화의 효과를 기대할 수 있는 것으로 알려져 있다. In addition, as the extensive research on skin aging has been conducted in recent years, the importance of collagen in skin has been further emphasized. Promoting the synthesis of collagen in the skin, inhibiting the activity of matrix metalloproteinases such as MMP 1 and MMP 9, thereby increasing antioxidant properties such as antioxidation, wrinkle improvement, elasticity enhancement, skin strengthening and wound healing It is known to be able to expect the effect of.
이러한 효과를 얻기 위하여, 종래에는 콜라겐을 화장품에 배합하여 제품화 하였다. 그러나 이들 화장품은 콜라겐을 피부 표면에 도포하는 것으로서, 고분자인 콜라겐의 경피 흡수가 어려워 그 기능을 기대할 수 없다. In order to obtain such an effect, conventionally, collagen was formulated into a cosmetic product. However, these cosmetics apply collagen to the surface of the skin, and since the collagen, which is a polymer, is difficult to absorb percutaneously, its function can not be expected.
또한, 근래에는 피부의 진피에 직접 콜라겐을 주입하지만, 이 방법 역시 부작용으로 인해 올바른 피부 주름의 개선을 기대하기는 어렵다. In addition, recently, collagen is directly injected into the dermis of the skin. However, this method is also difficult to expect the improvement of correct skin wrinkles due to side effects.
최근에는 이 문제를 해결하고자 콜라겐 합성을 촉진하는 물질에 대한 관심이 높아졌으며, 콜라겐 합성 촉진물질로는 레티노익 산(Retinoic acid), 동물 태반 유래의 단백질(일본특허 특개평 8-231370)등이 알려졌다. In recent years, there has been a growing interest in substances promoting collagen synthesis in order to solve this problem. Retinoic acid and proteins derived from animal placenta (JP-A No. 8-231370) It was announced.
그러나, 레티노익 산은 불안정하여 제형 기술이 복잡하며, 피부에 자극과 발적 등의 안전성 문제로 인해 사용에 한계가 있고, 동물 태반 유래의 단백질은 광우병에 의한 소 적출물의 사용이 금지되고 있으므로 실질적인 피부 콜라겐의 합성 촉진에 의한 피부 주름 개선효과를 기대하기는 어렵다. However, since the retinoic acid is unstable, the formulation technique is complicated, the use of the protein from the animal placenta is restricted due to safety problems such as irritation and redness in the skin, and the use of the bovine extract due to mad cow disease is prohibited. It is difficult to expect an effect of improving the wrinkles of the skin by promoting the synthesis of the skin.
따라서, 생체에 안전하고 사용의 간편성이 있으며 또한 제형상 안정성이 높고 우수하며, 콜라겐 생성 촉진효과를 갖는 새로운 콜라겐 생성 촉진, MMP 1, MMP 9 등의 활성을 억제하는 물질의 개발과 이 물질을 함유하는 사용이 용이한 화장료 개발이 절실히 요구되고 있다. Therefore, it is necessary to develop a material which is safe to the living body, easy to use, high in stability and excellent in shape stability, promotes new collagen production which promotes collagen production, inhibits the activities of MMP 1 and MMP 9, It is urgently required to develop cosmetics that are easy to use.
회화나무(Sophora japonica L.)는 콩과 식물에 속하는 활엽교목으로 한국과 중국, 일본 등 동북아시아 일대에 널리 분포하고 있으며, 나무의 높이는 15 내지 25m 가량 자라고 잔가지는 털이없고 풀색을 나타낸다. 잎은 타원형 또는 들잎모양 으로 9 내지 15개의 어긋나는 형태의 쪽잎으로 되어있다. Sophora japonica L. is a broad-leaved arboreous tree belonging to the leguminous plants. It is distributed widely in Northeast Asia including Korea, China, and Japan. The height of the tree is 15 ~ 25m and the twigs have no hair and have a full color. Leaves are elliptical or petiole-shaped and have 9 to 15 discordant leaflets.
7~8월에는 가지 끝에 연한 황색 꽃이 피며 한방에서는 괴화라 불리며 꽃봉오리는 괴미, 열매를 괴실 또는 괴각이라 한다. In July and August, light yellow flowers bloom at the ends of branches, and in one room they are called beak, buds are called gnomes, and fruits are called gnomes.
상기의 회화나무의 꽃과 열매는 한방에서 한약재로 사용되며, 콩잎에서 분리한 플라보노이드 화합물인 apigenin과 isoflavone류의 성분을 함유하고 있어 항염, 지혈, 고혈압, 치질, 습진 치료 등에 효과를 보이고 있으며, 장출혈, 자궁출혈, 잇몸염증과 피부 화장 등에도 사용된다고 보고 되었다(송행선 등, 대한화장품학회, 2016, 42(4), p351-358).The flowers and fruits of the above painting trees are used as herbal medicines in oriental medicine. They contain apigenin and isoflavone, which are flavonoid compounds separated from bean leaves, and are effective for antiinflammation, hemostasis, hypertension, hemorrhoids and eczema treatment. , Uterine hemorrhage, inflammation of the gums and skin makeup (Song, Sun-sun et al., Korea Cosmetic Societies, 2016, 42 (4), p351-358).
한편, 꿀을 많이 함유하고 있는 회화나무의 괴화(Sophprae Flos)에는 주요성분으로 루틴 10 ~28%, 적은 양의 켐페롤, 쿠에르세틴, 소포로시드와 게니스테인 배당체가 있으며, 최근에는 소포린 A, 소포린 B, 소포린 C가 분리되었다. 상기 괴화는 티로시나제 억제 활성 및 멜라닌 생성 억제효과가 뛰어나 미백용 조성물로도 유용하게 사용되고 있다.(등록특허 제 10-1289813호) On the other hand, Sophprae Flos, which contains a lot of honey, contains 10 ~ 28% of routine, a small amount of chemperol, quercetin, vesicular and genistein glycosides, A, soffin B, and soffin C were separated. The above-mentioned needle-making is excellent in tyrosinase inhibitory activity and melanin formation inhibitory effect, and is also useful as a composition for whitening. (Registered Patent No. 10-1289813)
또한, 종래에는 회화나무 꽃, 열매, 가지 추출물의 효능과 효과를 알아보기 위해 메탄올이나 에탄올 환류 추출법 등이 이용되고 있다. 상기와 같은 방법으로 추출된 메탄올 회화나무 꽃 추출물의 폴리페놀 함량은 38.9 mg/g임에 비해 75% 에탄올 환류 추출법에 의해 추출된 회화나무 꽃 추출물의 폴리페놀 함량은 평균 261.38 ± 7.02 mg/g으로 보다 좋은 결과가 나타남을 볼 수 있다. 이러한 결과는 용매와 추출법 등에 성분의 효과에 영향을 준다고 볼 수 있다.(회화나무 꽃, 열매, 가지 추출물의 피부개선 효과에 관한 연구. 저자 송행선,장혜인. 대한화장품학회 2016년 11월 10일)Conventionally, methanol and ethanol reflux extraction methods have been used to examine the efficacy and efficacy of flowers, fruit, and egg plant extracts. The polyphenol content of the plant extracts of P. japonicum extracted by the above method was 38.9 mg / g, compared with that of 75.9% ethanol by the reflux extraction method, and the polyphenol content of the plant extracts was 261.38 ± 7.02 mg / g It can be seen that better results are obtained. The results of this study are as follows: (1) The effect of the extracts on the skin, flower, fruit, and tree extracts was investigated. )
그리고 전통적으로 회화나무의 열매는 꼬투리로 원기둥 또는 염주모양이며, 과실은 가지 및 나무껍질과 더불어 치질치료에 쓰이기도 하며, 정원수나 목재는 가구재로 이용되기도 한다. 상기와 같은 회화나무, 특히 회화나무의 열매가 에스트로겐 중 가장 효능이 뛰어난 것으로 알려진 에스트라디올보다 회화나무 열매 추출물의 에스트로겐 분비 활성이 더욱 좋은 것이 밝혀지면서 회화나무 추출물을 유효성분으로 포함하는 조성물의 연구가 활발히 진행되고 있다.(공개특허 제 10-2011-0004603 호)Traditionally, the fruit of a painting tree is a pod or cylindrical shape. Fruit is used for the treatment of hemorrhoids along with branches and bark, and the garden or wood is also used as furniture. It has been found out that the above-mentioned fruit of the painting tree, especially the painting tree, has a better estrogen-releasing activity than the estradiol, which is the most effective of the estrogen, (Patent Application Publication No. 10-2011-0004603).
하지만 종래에 사용되고 있는 항노화, 피부주름개선에 효과있는 회화나무 추출물은 아스코르브산, 레티놀 및 콜라게나제활성을 단순히 억제하는 물질로 화장료나 의약품에 배합함으로써 피부의 주름 개선 및 노화를 방지하는 방법으로 이용되어 왔는데, 배합 시 안정성이 좋지 못하거나 피부 흡수가 용이하지 않아 그 효과가 미미하여 실질적인 효과를 얻기가 어려운 문제점이 있었다.However, the conventionally used coniferous tree extract, which is effective for anti-aging and skin wrinkle, is a substance that simply inhibits ascorbic acid, retinol and collagenase activity. It is formulated into cosmetics and medicines to prevent skin wrinkles and aging However, there has been a problem that it is difficult to obtain a substantial effect because the effect is insignificant because the stability is poor or the skin is not easily absorbed when it is formulated.
본 발명은 상기와 같은 문제를 해결하기 위해 안출된 것으로, 회화나무열매를 락토바실러스로 발효한 발효액 또는 상기 발효액을 추출한 추출액을 수득하여, 피부 주름 개선 효과가 우수하고 피부 자극에 대한 부작용이 없는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법을 제공하는 데 목적이 있다.Disclosure of the Invention The present invention has been conceived in order to solve the above-mentioned problems, and it is an object of the present invention to provide a fermentation broth obtained by fermenting Natto fruit with Lactobacillus or an extract obtained by extracting the fermentation broth, The present invention provides a cosmetic composition for improving skin wrinkles and a process for producing the same, which comprises a nutrient fermentation broth or an extract thereof as an active ingredient.
또한, 본 발명은 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 화장료 조성물을 제공함으로써, 섬유아세포 증식 촉진, 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현을 억제하여 피부의 주름을 개선하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법을 제공하는 데 목적이 있다.Further, the present invention provides a cosmetic composition comprising a niacin fermentation broth or an extract thereof as an active ingredient to inhibit fibroblast proliferation promotion, gene expression of collagen, TIMP-1, and Tropoelastin in a molecule, and gene expression of MMP-1 And to provide a cosmetic composition for improving skin wrinkles and a process for producing the same, which comprises a fruit juice fermented with or without an extract thereof as an active ingredient.
본 발명은 회화나무열매를 락토바실러스로 발효시켜 수득한 회화나무열매 발효액을 함유하는 피부 주름개선용 화장료 조성물인 것을 특징으로 한다.The present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing a fruit juice fermented with Natto fruit obtained by fermenting Natto fruit with Lactobacillus.
또한, 본 발명은 회화나무열매를 락토바실러스로 발효시켜 수득한 회화나무열매 발효물의 추출액을 함유하는 피부 주름개선용 화장료 조성물인 것을 특징으로 한다. Further, the present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing an extract of a fruit juice obtained from fermentation of Fruit tree fruit with Lactobacillus.
또한, 본 발명에서 상기 회화나무열매는 물, 탄소수 1 내지 4개의 무수 또는 함수 저급 알코올, 아세톤, 에틸아세테이트, 부틸아세테이트 및 1,3-부틸렌 글리콜로 구성된 군으로부터 선택되는 어느 하나의 추출 용매를 사용하여 추출되는 것이 바람직하다.In addition, in the present invention, the fruit tree extract may be any one selected from the group consisting of water, an anhydrous or hydrated lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol It is preferable to be extracted by using.
아울러, 본 발명은 회화나무열매 추출액을 얻는 단계(S10)와, 상기 회화나무열매 추출액에 균주 락토바실러스를 접종하여 발효액을 얻는 단계(S20)와, 상기 단계(S20)의 회화나무열매 발효액에서 배양균을 제거한 후 중탕 추출법을 이용하여 회화나무열매 발효 추출액을 얻는 단계(S30) 및 상기 단계(S20)의 회화나무열매 발효액 또는 상기 단계(S30)의 회화나무열매 발효 추출액에 안정화제, 비타민, 안료, 색소 및 향료를 포함하여 화장료 조성물을 얻는 단계(S40)로 이루어지는 것을 특징으로 한다.(S20) of obtaining a fermentation broth by inoculating a strain Lactobacillus in the extract of Lycoris chejuensis, and culturing the fermented broccoli in the fermentation broth of step (S20) (Step S30) of obtaining a fruit juice extract from the fruit tree using a hot water extraction method after removing the bacteria, and a step of adding a stabilizer, a vitamin, and a pigment to the fruit juice fermentation extract of Phalaenopsis fruit of step (S20) , A coloring matter and a flavoring agent (S40).
상기와 같이 본 발명에 따른 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법은 회화나무열매를 락토바실러스로 발효한 발효액 또는 상기 발효액을 추출한 추출액으로 수득하여 피부 주름 개선 효과가 우수하고 피부 자극에 대한 부작용이 없는 효과가 있다.As described above, the cosmetic composition for improving skin wrinkles containing the fermented Lactococcus lactis L. or extract thereof according to the present invention as an active ingredient and the preparation method thereof can be obtained by obtaining a fermentation broth fermented with Lactobacillus or an extract obtained by extracting the fermented broth The effect of improving skin wrinkles is excellent and there is no side effect on skin irritation.
또한, 본 발명에 따른 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법은 회화나무열매 발효액을 유효성분으로 함유하는 화장료 조성물을 제공함으로써, 섬유아세포 증식 촉진, 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현을 억제하여 피부 주름을 개선하는 효과가 있다.In addition, the cosmetic composition for improving skin wrinkles and the method for producing the same, which contains the fruit juice fermentation product or extract thereof as an active ingredient according to the present invention, can provide a cosmetic composition containing a fruit juice fermentation product as an active ingredient, , Intramolecular collagen, TIMP-1 and Tropoelastin gene expression and gene expression of MMP-1 are inhibited to improve the wrinkles of the skin.
도 1은 본 발명의 일 실시예를 따른 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물의 제조방법의 플로우 차트.BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a flowchart of a method for producing a cosmetic composition for improving skin wrinkles containing an extract of Lycoris spp. Or extract thereof according to an embodiment of the present invention as an active ingredient.
본 발명은 피부 주름을 개선하는 효과와 유효성을 극대화시키기 위한 발효기술을 기초로 하여 연구하였다. 그 결과, 회화나무열매를 락토바실러스로 발효한 발효액 또는 이의 추출액이 현저하게 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현을 억제하여 피부 개선 효과를 나타냄을 확인하여 본 발명을 완성하였다.The present invention has been studied based on a fermentation technique for maximizing the effect of improving skin wrinkles and effectiveness. As a result, it was confirmed that the fermentation broth fermented with Lactobacillus or the extract thereof significantly inhibited the gene expression of Collagen, TIMP-1 and Tropoelastin and the gene expression of MMP-1 in the intramolecular form, Thereby completing the invention.
본 발명에 따른 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물에 대하여 설명하면 다음과 같다.A cosmetic composition for improving skin wrinkles containing the fruit of the present invention as an active ingredient or an extract thereof is as follows.
본 발명은 회화나무열매를 락토바실러스로 발효시켜 수득한 회화나무열매 발효액을 함유하는 피부 주름개선용 화장료 조성물인 것을 특징으로 한다.The present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing a fruit juice fermented with Natto fruit obtained by fermenting Natto fruit with Lactobacillus.
또한, 회화나무열매를 락토바실러스로 발효시켜 수득한 회화나무열매 발효액으로부터 추출한 추출액을 함유하는 피부 주름개선용 화장료 조성물인 것을 특징으로 한다. Further, the present invention is characterized in that it is a cosmetic composition for improving skin wrinkles containing an extract obtained from a fruit juice fermentation obtained from fermentation of fruit tree fruit with lactobacillus.
종래 기술에서는 회화나무 꽃, 회화나무 잎의 추출물을 화장료 조성물로 사용하고 있었으나 본 발명에서는 피부주름 개선 효과와 유효성을 극대화시키기 위해서 회화나무 열매만을 사용하였으며, 또한 유효성분의 피부흡수 효율을 높여 피부주름 개선 효과를 높이기 위해 본 발명에서는 회화나무 열매를 락토바실러스로 발효시킨 발효액 또는 이의 추출액을 피부주름 개선용 화장료 조성물로 사용하여 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현을 종래보다 현저하게 억제하여 피부 개선 효과를 극대화시켰다.In the prior art, the extract of Painted Tree Flower and Painted Tree Leaf was used as a cosmetic composition. However, in the present invention, only fruit tree fruit was used in order to maximize the effect of wrinkle improvement and effectiveness, and the skin absorption efficiency of the active ingredient was increased, In order to enhance the effect of the present invention, the present invention uses a fermentation broth fermented with Lactobacillus nucifera or its extract as a cosmetic composition for improving the wrinkles of skin, thereby determining gene expression of Collagen, TIMP-1 and Tropoelastin and gene expression of MMP-1 Is remarkably suppressed than in the prior art, thereby maximizing the skin improvement effect.
상기 회화나무열매의 바람직한 건조 중량비는 회화나무열매 10 내지 40 중량%가 되는 것이 바람직하며, 상기 회화나무열매는 물, 탄소수 1 내지 4개의 무수 또는 함수 저급 알코올, 아세톤, 에틸아세테이트, 부틸아세테이트 및 1,3-부틸렌 글리콜로 구성된 군으로부터 선택되는 어느 하나의 추출 용매를 사용하여 추출되는 것이 바람직하다.Preferably, the dried fruit weight of the fruit tree is 10 to 40% by weight, and the fruit fruit is selected from the group consisting of water, anhydrous or lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1 , 3-butylene glycol, and the like.
상기 회화나무열매는 당업계에 공지된 통상의 방법에 따라, 즉, 통상적인 온도와 압력의 조건하에서, 통상적인 용매를 사용하여 회화나무열매 추출액이 제조될 수 있다. The nuts can be prepared by conventional methods known in the art, that is, under the conditions of ordinary temperature and pressure, using a conventional solvent.
일 예로, 본 발명의 조성물의 유효성분인 회화나무열매는 물, 탄소수 1 내지 4개의 무수 또는 함수 저급 알코올, 아세톤, 에틸아세테이트, 부틸아세테이트 및 1,3-부틸렌 글리콜로 구성된 군으로부터 선택되는 용매를 사용하여 추출하거나 회화나무열매를 상기 용매를 이용하여 추출한 후, 이를 혼합하여 제조할 수 있다.For example, the active ingredient of the composition of the present invention may be selected from the group consisting of water, anhydrous or lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol Or extracting the nuts from the fruit with the above-mentioned solvent, and then mixing them.
상기 용매는 알코올이 좋으며, 바람직하게는 에탄올이 좋은데, 에탄올은 더욱 바람직하게 60 ~ 80% 에탄올인 것이 좋다. 상기 추출 용매의 적합한 첨가량은 회화나무열매 건조 중량의 1 내지 20배중량이며, 더욱 바람직하게는 5 내지 20배중량이며, 가장 바람직하게는 10배중량이다.The solvent is preferably an alcohol, preferably ethanol, and the ethanol is more preferably 60 to 80% ethanol. The appropriate amount of the above-mentioned extraction solvent is 1 to 20 times by weight, more preferably 5 to 20 times by weight, and most preferably 10 times by weight, of the dried woody fruit.
한편, 본 발명의 회화나무열매를 락토바실러스로 발효한 발효액은 상술한 추출법에 의한 추출물뿐만 아니라, 통상적인 정제과정을 거친 추출물도 포함한다. Meanwhile, the fermentation broth obtained by fermenting the nuts of the present invention with Lactobacillus not only includes the extract obtained by the above-mentioned extraction method but also the extract obtained through ordinary purification process.
예컨대, 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 이용한 분리, 다양한 크로마토그래피 (크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 등, 추가적으로 실시된 다양한 정제 방법을 통해 얻어진 분획도 본 발명의 회화나무열매를 락토바실러스로 발효한 발효액에 포함된다고 해석한다.For example, by separation using an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatographies (made for separation by size, charge, hydrophobicity or affinity), and the like, It is also interpreted that the fraction is also included in the fermentation broth fermented with lactobacillus of the present invention.
또한, 본 발명의 회화나무열매를 락토바실러스로 발효한 발효액은 발효액을 감압 증류 및 동결 건조 또는 분무 건조 등과 같은 추가적인 과정에 의해 분말 상태로 제조된 것을 포함하기도 한다.In addition, the fermentation broth obtained by fermenting the nuts of the present invention with lactobacillus may also include a fermentation broth prepared by further processing such as vacuum distillation, freeze-drying, spray drying and the like.
본 발명의 회화나무열매 발효액 또는 회화나무열매 발효 추출액은 상기 회화나무열매를 락토바실러스로 발효한 발효액 또는 상기 발효액을 추출한 추출액으로써, 섬유아세포 증식 촉진, 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현을 억제하여 피부의 주름개선 효과가 우수하고 피부 자극에 대한 부작용이 없는 천연의 안전 제제에 해당하며, 생산비용이 저렴하다. The present invention relates to a fermentation broth fermented with Lactobacillus or a fermentation broth obtained by extracting the above fermented broccoli fruit from Lactobacillus japonica or Lactobacillus sp. And suppresses gene expression of MMP-1, which is superior to skin wrinkle improving effect and has no side effects on skin irritation.
본 발명에서 회화나무열매를 락토바실러스로 발효한 발효액은 농축된 액상일 수도 있고, 건조된 분말형태일 수도 있다.In the present invention, the fermentation broth fermented with Lactobacillus can be in the form of a concentrated liquid or a dried powder.
상기 락토바실러스는 인간의 대변으로부터 동정된 균주인 락토바실러스 람노서스 (Lactobacillus rhamnsus) vitaP1(수탁번호:KACC92054P) 균주로 ㈜단정바이오에서 보유하고 있는 균주를 이용하여 발효를 진행하였다.Lactobacillus was fermented using a strain of Lactobacillus rhamnsus vitaP1 (accession number: KACC92054P), which was identified from human feces, using a strain possessed by Deng Jing Biotech.
본 발명의 회화나무열매 발효액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물은 매우 우수한 주름 개선 효능을 나타내며, 적용 제품들에서 우수한 안정성을 나타낸다. The cosmetic composition for improving skin wrinkles containing the fruit juice fermentation broth of the present invention as an active ingredient exhibits excellent wrinkle-reducing effect and exhibits excellent stability in applied products.
또한, 섬유아세포 증식 촉진, 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현 억제 등의 효과를 가진다.It also has effects such as promoting fibroblast proliferation, gene expression of intracellular collagen, TIMP-1, and Tropoelastin, and suppression of gene expression of MMP-1.
본 발명의 바람직한 실시예에 따르면, 회화나무열매를 락토바실러스로 발효한 발효액 또는 발효액을 추출한 추출액은 화장료 조성물 중 총 중량대비 0.01 내지 20.0 중량%이며, 바람직하게는 0.1 내지 15.0 중량%이며, 보다 바람직하게는 1 내지 10.0 중량%이다. According to a preferred embodiment of the present invention, the fermentation broth fermented with Lactobacillus or the extract of the fermentation broth according to the present invention is 0.01 to 20.0% by weight, preferably 0.1 to 15.0% by weight based on the total weight of the cosmetic composition, By weight is from 1 to 10.0% by weight.
상기 회화나무열매 발효액 또는 발효액을 추출한 추출액은 화장료 조성물 총 중량대비 0.01 중량% 미만인 경우 섬유아세포 증식 촉진, 분자내 Collagen, TIMP-1, Tropoelastin의 유전자 발현과 MMP-1의 유전자 발현을 억제효과가 나타나지 않는 문제가 있으며, 20 중량% 초과인 경우 건조 피부를 가진 사람에게 피부 가려움과 따끔거림이 발생되는 문제가 발생할 수 있다. In the case where the extract of the above-mentioned fruit tree extract or fermentation broth extract is less than 0.01% by weight based on the total weight of the cosmetic composition, the effect of promoting fibroblast proliferation, the expression of collagen, TIMP-1 and Tropoelastin in the molecule and gene expression of MMP- , And if it is more than 20% by weight, it may cause skin itching and tingling to a person having dry skin.
본 발명의 회화나무열매 발효액 또는 발효액을 추출한 추출액은 피부 주름 개선의 효과를 가지며, 건조 피부를 가진 사람을 제외하고는 피부 자극에 대한 부작용이 없기 때문에, 20중량%를 초과하여 100 중량%까지 회화나무열매 발효액 또는 회화나무열매 발효 추출액을 화장료 조성물로 사용할 수 있다. The fruit juice fermentation extract of the present invention or extract of fermentation broth of the present invention has an effect of improving skin wrinkles and has no adverse effect on skin irritation except for a person having dry skin, A fruit juice fermentation extract or a fruit juice fermentation extract can be used as a cosmetic composition.
본 발명의 화장료 조성물에 포함되는 성분은 유효 성분으로서의 회화나무열매를 락토바실러스로 발효한 발효액 이외에 화장료 조성물에 통상적으로 이용되는 성분들을 포함하며, 예컨대 항산화제, 안정화제, 용해화제, 비타민, 안료, 색소 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함한다.The ingredients contained in the cosmetic composition of the present invention include components commonly used in cosmetic compositions in addition to the fermentation broth obtained by fermenting Natto fruit as an active ingredient with Lactobacillus. Examples thereof include antioxidants, stabilizers, solubilizers, vitamins, Conventional auxiliaries such as coloring and flavoring agents, and carriers.
본 발명의 화장료 조성물은 당 업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 맛사지 크림, 에센스, 팩, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, a pack, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.
본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 중 어느 하나 이상을 선택하여 이용될 수 있다.When the formulation of the present invention is a paste, cream or gel, at least one of an animal oil, a vegetable oil, a wax, a paraffin, a starch, a tracer, a cellulose derivative, polyethylene glycol, silicon, bentonite, silica, talc, Can be selected and used.
본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether.
본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 부틸렌글리콜, 1,3-부틸글리콜 오일, 폴리옥시에칠렌 경화피마자유, 글리세롤, 글리세린, 지방족 에스테르, 페녹시에탄올, 트리에탄올아민, 폴리에틸렌 글리콜, 밀납, 폴리솔베이트 60, 솔비탄세스퀴오레이드, 파라핀, 소르비탄 스테아레이트, 친유형 모노스테아린산 글리세린, 스테아린산, 글리세릴스테아레이트/피이지-400 스테아레이트, 카르복시폴리머, 시토스테롤, 폴리글리세릴 2-올레이트, 세라마이드, 콜레스테롤, 스테아레스-4, 디세틸포스페이트, 마카다미아 오일, 카르복시비닐폴리머, 산탄검 또는 소르비탄의 지방산 에스테르 중 어느 하나 이상을 선택하여 이용될 수 있다.When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, Glycerol, aliphatic esters, phenoxyethanol, triethanolamine, polyethylene glycol, beeswax, polysorbate 60, sorbitan sesquiolead, paraffin, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene sorbitan fatty acid esters, Sorbitan stearate, glycerin monostearate, stearic acid, glyceryl stearate / fat-400 stearate, carboxy polymer, sitosterol, polyglyceryl 2-oleate, ceramide, cholesterol, , Macadamia oil, carboxyvinyl polymer, xanthan gum or sorbitan fatty acid Esters can be selected and used.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올, 글리세린, 부틸렌글리콜 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 하이드록시에틸셀룰로오즈, 소디움히아루로네이트, 페녹시에탄올, 알루미늄 메타히드록시드, 벤토나이트, 스테아린산, 세틸알코올, 글리세릴모노스테아레이트, 폴리옥시에틸렌소르비탄모노스테아레이트, 솔비탄세스퀴올레이트, 글리세릴모노스테아레이트/글리세릴스테아레이트/폴리옥시에틸렌스테아레이트, 왁스, 파리핀, 스쿠알란, 카프릴릭/카프릭트리글리세라이드, 카르복시비닐폴리머, 트리에탄올아민, 아가 또는 트라칸트 중 어느 하나 이상을 선택하여 이용될 수 있다.When the formulation of the present invention is a suspension, a liquid diluent such as water, ethanol, glycerin, butylene glycol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Such as, for example, suspensions, microcrystalline cellulose, hydroxyethylcellulose, sodium hyaruronate, phenoxyethanol, aluminum metahydroxide, bentonite, stearic acid, cetyl alcohol, glyceryl monostearate, polyoxyethylene sorbitan monostearate , Sorbitan sesquioleate, glyceryl monostearate / glyceryl stearate / polyoxyethylene stearate, wax, paraffin, squalane, caprylic / capric triglyceride, carboxyvinyl polymer, triethanolamine, Select one or more of the Kant It can be.
본 발명의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 중 어느 하나 이상을 선택하여 이용될 수 있다.When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide At least one selected from ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.
본 발명에 따른 회화나무열매 발효액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물의 제조방법은 첨부 도면을 참조하여 설명하면 다음과 같다.The method for producing a cosmetic composition for improving skin wrinkles containing the fruit juice fermentation product of the present invention as an active ingredient will be described with reference to the accompanying drawings.
도 1은 본 발명에 따른 회화나무열매 발효액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물의 제조방법을 보여주는 플로우 차트이다.FIG. 1 is a flowchart showing a method for producing a cosmetic composition for improving skin wrinkles containing a fruit juice fermentation product according to the present invention as an active ingredient.
이하, 본 발명에 대한 바람직한 실시 내용은 첨부한 도면을 참조하여 설명하면, 본 발명의 회화나무열매 발효액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물의 제조방법은 하기 단계를 포함하는 것이 바람직하나 이에 한정되지 않는다.Hereinafter, preferred embodiments of the present invention will be described with reference to the accompanying drawings. A method for producing a cosmetic composition for improving skin wrinkles containing the present invention's nutritional liquid fruit juice as an active ingredient preferably includes the following steps But is not limited thereto.
본 발명은 회화나무열매 추출액을 얻는 단계(S10)와, 상기 회화나무열매 추출액에 균주 락토바실러스를 접종하여 발효액을 얻는 단계(S20)와, 상기 단계(S20)의 회화나무열매 발효액에서 배양균을 제거한 후 중탕 추출법을 이용하여 회화나무열매 발효 추출액을 얻는 단계(S30) 및 상기 단계(S20)의 회화나무열매 발효액 또는 상기 단계(S30)의 회화나무열매 발효 추출액에 안정화제, 비타민, 안료, 색소 및 향료를 포함하여 화장료 조성물을 얻는 단계(S40)로 이루어지는 것을 특징으로 한다. (S20) of obtaining a fermentation broth by inoculating a strain Lactobacillus in the above extract of Lycoris chejuensis; (B) culturing the fermentation broth in the fermentation broth of step (S20); (S30) of obtaining a fruit juice extract from fruit juice using the hot water extraction method, and adding a stabilizer, a vitamin, a pigment, a coloring agent and a coloring agent to the fruit juice fermentation solution of Phalaenopsis fruit of step (S20) And a step (S40) of obtaining a cosmetic composition including a flavoring.
본 발명의 제조방법을 각 단계별로 나누어서 설명하면 다음과 같다.The manufacturing method of the present invention will be described separately for each step.
상기 회화나무열매 추출액을 얻는 단계(S10)를 수행한다.(S10) of obtaining the above-mentioned fruit tree extract.
상기 회화나무열매를 정제수로 세척하고 건조한 다음 모두 분쇄한 후 50 내지 200 메시(mesh)의 체를 이용하여 미세한 분쇄물을 얻는다. 상기 회화나무열매 분쇄물에 100 내지 300 g/L의 증류수를 가하고 중탕 조건에서 3 내지 7시간씩 3회 환류추출하고 냉침을 한다. 그 후, 3 내지 8 ㎛ 여과지로 여과하여 추출액을 제조하여 발효 과정의 추출액으로 사용한다.The dried fruit is washed with purified water, dried and then pulverized, and a fine pulverized product is obtained using a sieve of 50 to 200 mesh. 100 to 300 g / L of distilled water is added to the above ground fruit juice, refluxed for 3 to 7 hours under reflux condition, and cold-frozen. Thereafter, it is filtered with a filter paper of 3 to 8 탆 to prepare an extract and used as an extract of the fermentation process.
상기 회화나무열매 추출액에 균주 락토바실러스를 접종하여 발효액을 얻는 단계(S20)를 수행한다.Step (S20) of obtaining the fermentation broth by inoculating the strain Lactobacillus with the above extract of Lycoris sp.
상기 단계(S10)에서 얻은 회화나무열매 추출액에 균주 락토바실러스와 LB Broth 배지를 넣어 25 내지 35 호기적 조건에서 40 내지 120 시간 발효를 진행한다. 배양 후 배양액을 원심분리하여 배양균을 1차 제거하고, 이렇게 얻은 여과액을 다시 여과기를 이용하여 0.2 ㎛ 까지 여과한 후 더 이상 배양되지 않도록 멸균 처리를 한다.The strain Lactobacillus and the LB Broth medium are added to the extract of Lycopersicon esculentum obtained in the step S10, and the fermentation is carried out for 25 to 35 days under the condition of 40 to 120 hours. After culturing, the culture solution is centrifuged to remove the culture solution first, and the filtrate thus obtained is filtered again to 0.2 μm using a filter, and sterilized to prevent further culture.
상기 단계(S20)에서 수득한 회화나무열매 발효액은 화장료 조성물 총 중량에 대해 0.01 내지 20.0 중량%이 포함될 수 있다.The fruit juice fermentation product obtained in step S20 may contain 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.
상기 회화나무열매 발효액은 화장료 조성물 총 중량대비 0.01 중량% 미만인 경우 리폭시게나아제, 히아루로니다아제의 활성억제 및 자유라디칼의 소거 효과가 나타나지 않는 문제가 있으며, 20 중량% 초과인 경우 건조 피부를 가진 사람에게 피부 가려움과 따끔거림이 발생되는 문제가 있다. If the amount of the fermented fruit juice is less than 0.01% by weight based on the total weight of the cosmetic composition, there is a problem in that the activity of lipoxygenase and hyaruronidase is inhibited and free radicals are not extinguished. There is a problem that the skin gets itchy and tingling.
상기 단계(S20)의 회화나무열매 발효액에서 배양균을 제거한 후 중탕 추출법을 이용하여 회화나무열매 발효 추출액을 얻는 단계(S30)를 수행한다.After removing the cultured bacterium from the Lactobacillus fermentation broth of step (S20), the step (S30) of obtaining the Lactobacillus fruit juice extract solution using the hot water extraction method is performed.
상기 단계(S20)에서 수득한 회화나무열매 발효액에 멸균 및 방부제를 투여한 후, 중탕 추출법으로 회화나무열매 발효 추출액을 얻는다. 상기 배양균을 제거한 회화나무열매 발효액을 3 내지 7시간씩 3회 환류중탕추출하고 냉침한 후, 3 내지 8 ㎛ 여과지로 여과한다. 여과가 완료 후 회화나무열매 발효 추출액을 얻는다.After the sterilization and preservative are administered to the fermented lycopene fruit obtained in the above step (S20), an extract of Lycoris fruit juice is obtained by extracting with hot water. After removing the culture, the fruit juice is extracted with reflux for 3 to 7 hours, refluxed, and filtered through a filter paper of 3 to 8 탆. After the filtration is completed, the fruit juice extract is obtained.
상기 단계(S30)에서 수득한 회화나무열매 발효 추출액은 화장료 조성물 총 중량에 대해 0.01 내지 20.0 중량%이 포함될 수 있다.The fruit juice fermentation extract obtained in step S30 may contain 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.
상기 회화나무열매 발효 추출액은 화장료 조성물 총 중량대비 0.01 중량% 미만인 경우 리폭시게나아제, 히아루로니다아제의 활성억제 및 자유라디칼의 소거 효과가 나타나지 않는 문제가 있으며, 20 중량% 초과인 경우 건조 피부를 가진 사람에게 피부 가려움과 따끔거림이 발생되는 문제가 있을 수도 있다. When the extract is less than 0.01% by weight based on the total weight of the cosmetic composition, there is a problem in that the activity of lipoxygenase, hyaruronidase is inhibited and the free radical is not extinguished. When the extract is more than 20% by weight, People with skin itching and tingling may have problems.
상기 단계(S20)의 회화나무열매 발효액 또는 상기 단계(S30)의 회화나무열매 발효 추출액에 안정화제, 비타민, 안료, 색소 및 향료를 포함하여 화장료 조성물을 얻는 단계(S40)로 이루어지는 것을 특징으로 한다. (S40) of obtaining a cosmetic composition comprising a stabilizer, a vitamin, a pigment, a coloring matter and a flavoring agent in the fermented extract of Fagus nuratum in step S20 or the fermented extract of Fagus niger in step S30 .
이하, 본 발명의 제조예, 실시예, 비교예, 시험예 및 제형예에 의해 상세히 설명한다.Hereinafter, the production examples, examples, comparative examples, test examples and formulation examples of the present invention will be described in detail.
하기 제조예, 실시예, 비교예, 시험예 및 제형예는 본 발명을 예시하는 것일뿐, 본 발명이 하기 제조예, 실시예, 비교예, 시험예 및 제형예에 한정되는 것이 아니다.The following Production Examples, Examples, Comparative Examples, Test Examples and Formulation Examples are illustrative of the present invention, and the present invention is not limited to the following Production Examples, Examples, Comparative Examples, Test Examples and Formulation Examples.
[제조예] 회화나무열매 추출액 제조방법[Production Example] Production method of woody fruit extract
회화나무열매를 정제수로 세척하고 건조한 다음 모두 분쇄한 후 100 메시(mesh)의 체를 이용하여 미세한 분쇄물을 얻었다. 회화나무열매 분쇄물을 100 g/L가 되도록 10%(V/V) 에탄올 수용액을 가하고 중탕 조건에서 5 시간씩 3회 환류추출하고 냉침하였다. 그 후, 6 ㎛의 여과지(와트만(whatman) #3)로 여과하여 추출액을 제조하여 발효 과정의 추출액으로 사용하였다. The nuts were washed with purified water, dried and then pulverized, and then finely pulverized using a sieve of 100 mesh. A 10% (v / v) aqueous ethanol solution was added to 100 g / L of the crushed fruit juice, and the mixture was refluxed for 3 hours under reflux condition for 5 hours. Thereafter, the extract was filtered using a filter paper of 6 탆 (whatman # 3) and used as an extract of the fermentation process.
또한, 상기의 추출액을 50 이하에서 감압농축 및 동결 건조하여 효능 평가 시에 사용하였다.Further, the above extract was used at the concentration of 50 or less under reduced pressure and freeze-dried to evaluate the efficacy.
[실시예] 회화나무열매 발효액 및 회화나무열매 발효 추출액의 제조방법[EXAMPLES] Method for preparing fermented fruit juice and fruit juice
상기 제조예에서 제조된 회화나무열매 추출액에 균주 Lactobacillus rhamnosus vitaP1(수탁번호:KACC92054P)과 LB Broth 배지를 넣어 30 호기적 조건에서 96 시간 발효를 진행한다. 발효 후 발효배양액을 원심분리하여 배양균을 1차 제거하고, 이렇게 얻은 여과액을 다시 여과기를 이용하여 0.2 ㎛ 까지 여과한 후 더 이상 배양되지 않도록 멸균(121, 15분, 1.5기압)하였다. 멸균하여 얻은 회화나무열매 발효물에 정제수를 첨가하여 5시간씩 3회 환류중탕추출하고 냉침한 후, 6 ㎛의 여과지(와트만(whatman) #3)로 여과하였다. 여과가 한 후 얻어진 추출액을 농축조로 이송하여 50 이하에서 감압농축 및 동결 건조하였다.To the extract of Lycopersicon esculentum prepared in the above Production Example, the strain Lactobacillus rhamnosus VitaP1 (accession number: KACC92054P) and LB Broth medium, and fermentation is carried out under the condition of No. 30 for 96 hours. After the fermentation, the fermentation broth was centrifuged to remove the cultures first, and the filtrate thus obtained was filtered to 0.2 μm using a filter and sterilized (121, 15 minutes, 1.5 atm) to prevent further culture. Purified water was added to the fermented fruit juice obtained by sterilization, and the mixture was refluxed three times for 5 hours, cooled, and filtered through a filter paper (whatman # 3) of 6 μm. After filtration, the obtained extract was transferred to a concentration tank and concentrated under reduced pressure and freeze-dried at 50 or less.
[비교예] 락토바실러스 배양액 제조방법의 비교예[Comparative Example] Comparative Example of Production Method of Lactobacillus Culture Solution
본 비교예에서는 실시예에서 사용된 발효균주 Lactobacillus rhamnosus vitaP1 (수탁번호 : KACC92054P)을 LB broth 배지에 30 호기적 조건에서 96 시간 배양을 진행한다. 배양 후 배양액을 원심분리하여 배양균을 1차 제거하고, 이렇게 얻은 여과액을 다시 여과기를 이용하여 0.2 ㎛ 까지 여과한 후 더 이상 배양되지 않도록 멸균(121, 15분, 1.5기압)하였다. 배양균을 제거한 배양액을 농축조로 이송하여 50 이하에서 감압농축 및 동결 건조하였다.In this comparative example, the fermentation strain Lactobacillus rhamnosus vitaP1 (accession number: KACC92054P) used in the example is cultured in LB broth medium for 30 hours under the condition of No. 30 for 96 hours. After culturing, the culture solution was centrifuged to remove the culture solution first, and the filtrate thus obtained was filtered again to 0.2 μm using a filter, and then sterilized (121, 15 minutes, 1.5 atm) to prevent further culture. The culture medium from which the cultures were removed was transferred to a concentration tank and concentrated under reduced pressure and freeze-dried at 50 or less.
[시험예 1] 본 발명의 회화나무열매 발효액에 의한 세포 증식 및 독성 확인[Test Example 1] Confirmation of cell proliferation and toxicity by the fermentation broth of the present invention
< 세포 배양 ><Cell Culture>
상기 실시예, 비교예에서 제조된 회화나무열매 발효액 건조분말과 락토바실러스 배양액 건조분말 및 제조예에서 제조한 건조분말의 항노화에 작용하는 유전자 발현을 확인하기 위하여 콜라겐(Collagen)와 Timp-1는 HaCaT(Human keratinocyte cell line)을 사용하고, MMP-1와 트로포엘라스틴(Tropoelastin)은 CCD-986Sk(Human fibroblast cell line)을 사용하였다. HaCaT, CCD-986Sk 세포는 10 %(v/v)의 FBS(fetal bovine serum, Gibco, USA), 100 U/mL의 streptomycin, 100 U/mL의 penicillin 항생제(Gibco, USA)가 포함된 DMEM(Dulbecco's modified eagle's medium, Gibco, USA)배지를 사용하여 5 % CO2 및 37 조건의 인큐베이터에서 배양하였다.Collagen and Timp-1 were used to determine the expression of the genes that act on the anti-aging of the dried powder of the natto fruit fermented product prepared in Examples and Comparative Examples, the dry powder of the lactobacillus culture solution and the dry powder prepared in the preparation example Human keratinocyte cell line (HaCaT) was used, and MMP-1 and Tropoelastin used CCD-986Sk (human fibroblast cell line). HaCaT and CCD-986Sk cells were cultured in DMEM containing 10% (v / v) FBS (fetal bovine serum, Gibco, USA), 100 U / mL streptomycin, 100 U / mL penicillin antibiotics (Gibco, USA) using Dulbecco's modified eagle's medium, Gibco , USA) medium and cultured in an incubator of 5% CO 2 and 37 conditions.
< 세포 생존율 측정 실험(MTT assay) >≪ Measurement of cell survival rate (MTT assay) >
상기 실시예, 비교예에서 제조된 회화나무열매 발효액 건조분말과 락토바실러스 배양액 건조분말 및 제조예에서 제조한 건조분말에 대하여 세포 증식에 미치는 영향을 확인하였다.The effect of the dried powder of N. pombe powder prepared in the above Examples and Comparative Examples on the cell proliferation was examined with respect to the dry powder of the lactobacillus culture solution and the dry powder prepared in the Preparation Example.
세포 증식 및 독성 확인을 위하여 하기와 같은 방법으로 실험을 진행하였다.Experiments were carried out in the following manner to confirm cell proliferation and toxicity.
배양하고 있는 세포 3T3(fibroblast cell line)을 96 웰 마이크로플레이트에 5,000 세포/웰로 분주(分株)하여 30분간 항온조에서 배양하고, 시료를 농도 별 각각 0.01, 0.05, 0.1, 0.5(%, W/V))로 투여하여 72시간 동안 배양하였다. 72시간 배양 후, 티아졸린 블루(Thiazoline blue)를 투여하고 4시간 동안 추가 배양을 하였다. 배양액을 모두 버리고 마이크로플레이트의 각 웰에 반응 정지액을 가하고 5분간 교반한 후, 570 ㎚에서 흡광도를 측정하였다. 대조군은 시료 주입량만큼 10 % 우태아혈청(Fetal Bovine Ser㎛, FBS) 배지를 투여하여 세포 성장의 최적 조건으로 동시배양을 하였으며, 대조군의 세포증식을 100 %로 하고 시료 투입 실험군의 세포 증식율을 계산하였다. The cells were cultured in a 96-well microplate at 5,000 cells / well in a thermostatic chamber for 30 minutes. The samples were treated with 0.01, 0.05, 0.1 and 0.5% (w / w) V)) and cultured for 72 hours. After 72 hours of incubation, thiazoline blue was added and further incubated for 4 hours. The culture medium was discarded and the reaction stop solution was added to each well of the microplate. After stirring for 5 minutes, the absorbance at 570 nm was measured. The control group was co-cultured with 10% Fetal Bovine Serum (FBS) medium as an optimal condition for cell growth, and the cell proliferation rate of the test group was calculated with the cell proliferation of the control group as 100% Respectively.
세포증식 효과는 계산식 1에 의해 산출되었고, 그 결과는 하기 표 1에 나타내었다.The cell proliferation effect was calculated by Equation 1, and the results are shown in Table 1 below.
[계산식1][Equation 1]
구분division | 회화나무열매 추출물, Painted tree fruit extract, 발효물Fermentation product 및 And 락토바실러스Lactobacillus 배양액 농도 (㎍/㎖) Culture medium concentration (占 퐂 / ml) | ||||||
대조군Control group | 00 | 1010 | 5050 | 100100 | 1,0001,000 | ||
증식율(%)Growth rate (%) | 실시예Example | 100100 | 0.000.00 | 106.31106.31 | 115.28115.28 | 122.84122.84 | 128.25128.25 |
비교예Comparative Example | 100100 | 0.000.00 | 100.14100.14 | 100.37100.37 | 100.20100.20 | 100.23100.23 | |
제조예Manufacturing example | 100100 | 0.000.00 | 104.10104.10 | 110.22110.22 | 116.76116.76 | 121.15121.15 |
표 1에 나타낸 바와 같이, 세포 성장 최적 조건에서의 세포 증식을 100 %로 하였을 때, 실시예와 비교예에서 제조된 회화나무열매 발효액 건조분말과 락토바실러스 배양액 건조분말 및 제조예에서 제조된 회화나무열매 추출액 건조분말 모두 세포 독성이 없었다.As shown in Table 1, when the cell proliferation at the optimal cell growth conditions was regarded as 100%, the dried powder of the nutshell fermentation broth prepared in Examples and Comparative Examples, the dry powder of the lactobacillus culture solution, The dried powders of the fruit extract were not cytotoxic.
특히, 실시예와 제조예에서는 세포 증식효과가 있음을 확인하였고, 실시예는 제조예보다 월등한 세포증식효과를 나타내어 가장 우수하였다. 반면, 비교예의 경우 세포독성은 없었으나 세포증식효과 또한 없는 것으로 확인되었다.In particular, it was confirmed that the cell proliferation effect was exhibited in the examples and the production examples, and the cell proliferation effect was superior to the production examples. On the other hand, in the comparative example, there was no cytotoxicity, but the cell proliferation effect was also not confirmed.
[[
시험예Test Example
2] 2]
세포내Intracellular
collagen, collagen,
TimpTimp
-1 및 -1 and
Tropoelastin의Tropoelastin
유전자 발현과 Gene expression and
MMPMMP
-1의 유전자 발현 억제 효과-1 gene expression inhibitory effect
HaCaT와 CCD-986Sk 세포는 세포의 수를 5?105 cells/㎖로 조제한 후에 페트리디쉬에 처리하여 24시간 동안 5% CO2 및 37 의 조건에서 배양하였다. 세포가 페트리디쉬에서 80% 이상 자란 다음, 추출물 세포 생존률 100% 이상으로 나타난 농도로 첨가하였다.HaCaT and CCD-986Sk cells were cultured in Petri dishes at 5% CO 2 and 37 for 24 hours after preparing cells at 5 × 10 5 cells / ㎖. Cells were grown in petri dishes at least 80% and then added at concentrations that were above 100% of the extract cell viability.
실시예와 비교예에서 제조된 회화나무열매 발효액 건조분말과 락토바실러스 배양액 건조분말 및 제조예에서 제조된 회화나무열매 추출액 건조분말을 처리한 후 DMED/10 FBS에서 24시간 동안 5% CO2 및 37 의 조건에서 배양하였다. 24시간 후 세포에서 RNA 분리, cDNA 합성 및 RT-PCR은 Komoroski 등(Drug Metab. Dispos. 32:512-518, 2004)이 기술한 방법에 따라 수행하였다. RT-PCR에서 측정한 유전자는 COL1A1, TIMP-1 및 Tropoelastin의 발현과 MMP-1의 발현 억제를 확인하였다. 유전자 발현의 차이를 확인하기 위해 house keeping gene으로 GAPDH을 사용하였다.After treating the dried powder of the natto fruit fermentation broth prepared in Examples and Comparative Examples, the dry powder of the lactobacillus culture solution and the dried powder of the nuts extract prepared in Preparation Example, the cells were treated with DMEM / 10 FBS for 24 hours at 5% CO 2 and 37 Lt; / RTI > After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.
각각의 유전자의 프라이머 서열은 표 2에 나타냈다. 추출된 RNA를 주형으로 올리고 dT-어댑터 프라이머(Oligo dT-adaptor primer)와 DEPC water를 이용하여 총량 15 ㎕로 하고 70 5분 변성후, M-MLV(Moloney murine leukemia virus) RNA의 역전사를 수행하여 42 60분, 94 5분 cDNA를 합성하였다. 합성된 cDNA는 PCR 반응을 통해 증폭하였으며, 총 반응액은 25 ㎕로 하였다. 각 반응물의 최종 농도는 프라이머 100 p㏖, 1.0 ?M, dNTP 혼합액 0.2 mM, 5x green or colorless GoTaq Reaction buffer 1?1.5 mM, MgCl2(PCR 완충액) 및 GoTaq DNA 폴리머라제 1.25 units 이었다. 변성(Denaturation), 어닐링(annealing) 및 익스텐션(extension)에 대한 PCR 반응 조건은 다음과 같으며, 95 2분, 95 30초, 60 30초, 72 1분, 72 5분, 30~40 사이클로 수행하였다. PCR 반응 후 생성물의 10 ㎕를 2% 아가로즈 겔(agarose gel)에서 전기영동 하였다. Gel Documentation system(코리아랩텍, Cat. No DGS-200D)을 이용하여 발현양을 확인했다.The primer sequences of the respective genes are shown in Table 2. The extracted RNA was amplified with a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to a total volume of 15 μl. After denaturing for 70 minutes, reverse transcription of Moloney murine leukemia virus (M-MLV) 42, 60, and 94 5 minutes. The synthesized cDNA was amplified by PCR and the total reaction volume was 25 μl. The final concentration of each reagent was 100 pmol of the primer, 1.0 M of the primer, 0.2 mM of the dNTP mixture, 5x green or colorless GoTaq Reaction buffer 1? 1.5 mM, MgCl 2 (PCR buffer) and 1.25 units of GoTaq DNA polymerase. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 2 minutes, 95 30 seconds, 60 30 seconds, 72 1 minutes, 72 5 minutes, 30 to 40 cycles Respectively. After the PCR reaction, 10 μl of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).
프라이머 이름Name of the primer | 염기서열Base sequence |
GAPDHGAPDH | Forward : GGCATTGCTCTCAATGACAAForward: GGCATTGCTCTCAATGACAA |
Reverse : TGTGAGGGAGATGCTCAGTGReverse: TGTGAGGGAGATGCTCAGTG | |
MITFMITF | Forward : AACCGACAGAAGAAGCTGGAForward: AACCGACAGAAGAAGCTGGA |
Reverse : ACAAGTTCCTGGCTGCAGTTReverse: ACAAGTTCCTGGCTGCAGTT | |
TyrosinaseTyrosinase | Forward : TTATGCGATGGAACACCTGAForward: TTATGCGATGGAACACCTGA |
Reverse : ACTGGCAAATCCTTCCAGTGReverse: ACTGGCAAATCCTTCCAGTG |
구분division | 회화나무열매 추출물, Painted tree fruit extract, 발효물Fermentation product 및 And 락토바실러스Lactobacillus 배양액 농도(㎍/㎖) Culture medium concentration (占 퐂 / ml) | |||||
00 | 1010 | 5050 | 100100 | 1,0001,000 | ||
Collagen expression(%)Collagen expression (%) | 실시예Example | 100.00100.00 | 108.23108.23 | 116.71116.71 | 125.91125.91 | 141.02141.02 |
비교예Comparative Example | 100.00100.00 | 99.9899.98 | 100.02100.02 | 100.11100.11 | 100.31100.31 | |
제조예Manufacturing example | 100.00100.00 | 104.96104.96 | 107.76107.76 | 118.68118.68 | 127.8127.8 | |
아데노신Adenosine | 138.98138.98 |
구분division | 회화나무열매 추출물, Painted tree fruit extract, 발효물Fermentation product 및 And 락토바실러스Lactobacillus 배양액 농도(㎍/㎖) Culture medium concentration (占 퐂 / ml) | |||||
00 | 1010 | 5050 | 100100 | 1,0001,000 | ||
TIMP-1expression(%)TIMP-1expression (%) | 실시예Example | 100.00100.00 | 105.29105.29 | 111.98111.98 | 118.38118.38 | 126.9126.9 |
비교예Comparative Example | 100.00100.00 | 100.21100.21 | 100.10100.10 | 100.06100.06 | 100.14100.14 | |
제조예Manufacturing example | 100.00100.00 | 100.64100.64 | 103.91103.91 | 109.53109.53 | 115.06115.06 | |
아데노신Adenosine | 121.88121.88 |
구분division | 회화나무열매 추출물, Painted tree fruit extract, 발효물Fermentation product 및 And 락토바실러스Lactobacillus 배양액 농도(㎍/㎖) Culture medium concentration (占 퐂 / ml) | |||||
00 | 1010 | 5050 | 100100 | 1,0001,000 | ||
Tropoelastinexpression (%)Tropoelastinexpression (%) | 실시예Example | 100.00100.00 | 118.28118.28 | 128.18128.18 | 131.88131.88 | 137.55137.55 |
비교예Comparative Example | 100.00100.00 | 99.9699.96 | 100.12100.12 | 100.17100.17 | 100.15100.15 | |
제조예Manufacturing example | 100.00100.00 | 108.23108.23 | 112.56112.56 | 120.59120.59 | 126.35126.35 | |
아데노신Adenosine | 135.03135.03 |
구분division | 회화나무열매 추출물, Painted tree fruit extract, 발효물Fermentation product 및 And 락토바실러스Lactobacillus 배양액 농도(㎍/㎖) Culture medium concentration (占 퐂 / ml) | |||||
00 | 1010 | 5050 | 100100 | 1,0001,000 | ||
MMP-1expression(%)MMP-1expression (%) | 실시예Example | 100.00100.00 | 94.2394.23 | 90.0790.07 | 82.6182.61 | 77.177.1 |
비교예Comparative Example | 100.00100.00 | 99.9299.92 | 100.07100.07 | 100.11100.11 | 100.09100.09 | |
제조예Manufacturing example | 100.00100.00 | 96.1696.16 | 95.2795.27 | 91.0191.01 | 88.9288.92 | |
아데노신Adenosine | 78.2678.26 |
상기 표 3 내지 6에서 보는 바와 같이, PT-PCR 수행 후 관찰결과, 본 발명의 실시예는 비교예에서 제조된 락토바실러스 배양액 건조분말 및 제조예에서 제조한 회화나무열매 추출액 건조분말 보다 collagen 및 TIMP-1의 발현이 증가하였고, MMP-1의 발현은 농도 의존적으로 감소하는 경향을 확인할 수 있었다. 대조군인 아데노신(Adenosine)과 비교했을 때 우수하거나 비슷한 결과를 확인할 수 있었다. As shown in Tables 3 to 6, after the PT-PCR was performed, the examples of the present invention showed that collagen and TIMP were more effective than the dry powder of the Lactobacillus culture liquid prepared in the Comparative Example and the dried powder of the Lactobacillus broth extract prepared in the Preparation Example, -1 expression, and the expression of MMP-1 tended to decrease in a concentration-dependent manner. Compared with the control group, adenosine (Adenosine), excellent or similar results were obtained.
또한, 트로포엘라스틴(Tropoelastin)은 피부 탄력을 나타내는 탄력 섬유 중심의 엘라스틴을 형성하고 있는 인자로 실시예 1에서 대조군 Adenosine과 비슷한 결과를 확인할 수 있었다In addition, Tropoelastin is a factor that forms elastic fiber-centered elastin showing skin elasticity, which is similar to that of control adenosine in Example 1
[제형예 1] 본 발명의 회화나무열매 발효액을 함유하는 화장수의 제조 [Formulation Example 1] Production of Lotion Containing the Fermented Lactic Fruit Juice of the Present Invention
실시예의 회화나무열매 발효액 건조 분말을 함유한 화장료 중 화장수(스킨로션)의 제형예는 표 7과 같다.Table 7 shows formulation examples of cosmetic lotion (skin lotion) among the cosmetic compositions containing the dried powder of the natto fruit fermented product of Example.
번호number | 원료Raw material | 함량(content( 중량%weight% )) |
1One | 회화나무열매 발효액 건조분말 (실시예)Dried fruit powder (Example) | 1.01.0 |
22 | 글리세린glycerin | 3.03.0 |
33 | 부틸렌 글리콜Butylene glycol | 2.02.0 |
44 | 프로필렌 글리콜Propylene glycol | 2.02.0 |
55 | 폴리올시에틸렌 경화피마자유Polyol cyanuric acid castor oil | 1.01.0 |
66 | 에탄올ethanol | 10.010.0 |
77 | 트리에탄올아민Triethanolamine | 0.10.1 |
88 | 방부제antiseptic | 미량a very small amount |
99 | 색소Pigment | 미량a very small amount |
1010 | 향료Spices | 미량a very small amount |
1111 | 정제수Purified water | 잔량Balance |
상기 화장수를 제조하기 위하여, 표 7에 기재된 11번에 2, 3, 4 및 8번을 순서대로 투입하고 교반하여 용해시킨 후, 5번을 60 정도 가열하여 용해시킨 후, 10번을 투입하여 용해한 후 11번에 투입하였다. 마지막으로 1, 6, 7 및 9번을 투입하여 충분히 교반한 뒤 숙성시켰다.To prepare the cosmetic lotion, 2, 3, 4, and 8 were added in order as described in Table 7, and the mixture was stirred and melted. The mixture was heated to 60 ° C to dissolve 5 times, And then put in 11 times. Finally, 1, 6, 7 and 9 were added and agitated after sufficient stirring.
[제형예 1] 본 발명의 회화나무열매 발효액을 함유하는 영양로션의 제조[Formulation Example 1] Production of a nutritious lotion containing the fruit juice of the present invention
실시예의 회화나무열매 발효액 건조 분말을 함유한 화장료 중 영양로션의 제형예는 표 8과 같다.Table 8 shows formulation examples of nutritional lotion among the cosmetics containing the dried powder of the nude fruit fermented product of Example.
번호number | 원료Raw material | 함량(content( 중량%weight% )) |
1One | 회화나무열매 발효액 건조분말 (실시예)Dried fruit powder (Example) | 2.02.0 |
22 | 밀납Wax | 1.01.0 |
33 | 폴리솔베이트 60Polysorbate 60 | 1.51.5 |
44 | 솔비탄 세스퀴올레이트Sorbitan sesquioleate | 0.50.5 |
55 | 유동 파라핀Liquid paraffin | 10.010.0 |
66 | 소르비탄 스테아레이트Sorbitan stearate | 1.01.0 |
77 | 친유형 모노스테아린산 글리세린Pro-type glycerin monostearate | 0.50.5 |
88 | 스테아린산Stearic acid | 1.51.5 |
99 | 글리세릴스테아레이트/피이지-400 스테아레이트Glyceryl stearate / FG-400 stearate | 1.01.0 |
1010 | 프로필렌글리콜Propylene glycol | 3.03.0 |
1111 | 카르복시폴리머Carboxy polymer | 0.10.1 |
1212 | 트리에탄올아민Triethanolamine | 0.20.2 |
1313 | 방부제antiseptic | 미량a very small amount |
1414 | 색소Pigment | 미량a very small amount |
1515 | 향료Spices | 미량a very small amount |
1616 | 정제수Purified water | 잔량Balance |
상기 영양로션을 제조하기 위하여, 표 8에 기재된 10, 11, 13 및 16번을 혼합 교반하면서 80 ~ 85 사이로 가열하여 제조부에 투입한 후 유화기를 작용시키고 2, 3, 4, 5, 6, 7, 8, 9 및 12번을 80 ~ 85 사이로 가열 용해한 후 유화하였다. 유화가 끝나면 교반기를 이용하여 교반하면서 50 까지 냉각한 뒤 15번을 투입하고 45 까지 냉각한 뒤 14번을 투입하고 35 에 1번을 투입하여 25 까지 냉각한 뒤 숙성시켰다.In order to prepare the nutritious lotion, 10, 11, 13 and 16 as shown in Table 8 were heated to 80 to 85 while mixing and stirring, and then put into a manufacturing part and then emulsified by 2, 3, 4, 5, 6, 7, 8, 9 and 12 were melted by heating to 80 to 85, and then emulsified. After the emulsification was completed, the mixture was cooled to 50 with stirring using an agitator, and then 15 was added. After cooling to 45, 14 was added, and 1 was added to 35, followed by cooling to 25, followed by aging.
[제형예 3] 본 발명의 회화나무열매 발효액을 함유하는 영양크림의 제조[Formulation Example 3] Preparation of a nutritional cream containing the fruit juice fermentation of the present invention
실시예의 회화나무열매 발효액 건조 분말을 함유한 화장료 중 영양크림의 제형예는 표 9와 같다.Table 9 shows formulation examples of nutritional creams among the cosmetic compositions containing the dried powder of the nectarine fermented product of Example.
번호number | 원료Raw material | 함량(content( 중량%weight% )) |
1One | 회화나무열매 발효액 건조분말 (실시예)Dried fruit powder (Example) | 3.03.0 |
22 | 스테아린산Stearic acid | 2.02.0 |
33 | 세틸알콜Cetyl alcohol | 2.02.0 |
44 | 글리세릴모노스테아레이트Glyceryl monostearate | 2.02.0 |
55 | 폴리옥시에틸렌소르비탄모노스테아레이트Polyoxyethylene sorbitan monostearate | 0.50.5 |
66 | 솔비탄세스퀴올레이트Sorbitan sesquioleate | 0.50.5 |
77 | 글리세릴모노스테아레이트/글리세릴스테아레이트/폴리옥시에틸렌스테아레트Glyceryl monostearate / glyceryl stearate / polyoxyethylene stearate | 1.01.0 |
88 | 왁스Wax | 1.01.0 |
99 | 유동파라핀Liquid paraffin | 4.04.0 |
1010 | 스쿠알란Squalane | 4.04.0 |
1111 | 카프릴릭/카프릭트리글리세라이드Caprylic / capric triglyceride | 4.04.0 |
1212 | 카르복시비닐폴리머Carboxyvinyl polymer | 0.20.2 |
1313 | 부틸렌글리콜Butylene glycol | 5.05.0 |
1414 | 글리세린glycerin | 3.03.0 |
1515 | 트리에탄올아민Triethanolamine | 0.50.5 |
1616 | 정제수Purified water | 잔량Balance |
상기 영양크림을 제조하기 위하여 표 9에 기재된 12, 13, 14 및 16번을 혼합 교반하면서 80 ~ 85 사이로 가열하여 제조부에 투입한 후 유화기를 작용시키고 2, 3, 4, 5, 6, 7, 8, 9, 10 및 11번을 80 ~ 85 사이로 가열하여 용해한 후 15번을 투입 교반하여 제조부에 투입하고 유화하였다. 유화가 끝나면 교반기를 이용하여 교반하면서 35 까지 냉각하고 1번을 투입하여 25 까지 냉각한 뒤 숙성시켰다.In order to prepare the nutritive cream, the ingredients 12, 13, 14, and 16 as shown in Table 9 were heated to 80 to 85 while mixing and stirring, and then put into a manufacturing part and then emulsified with 2, 3, 4, 5, 6, 7 , 8, 9, 10 and 11 were melted by heating to 80 to 85 ° C, and then 15 parts of the mixture were stirred and introduced into the production section and emulsified. After the emulsification was completed, the mixture was cooled to 35 with stirring using an agitator, and the mixture was cooled to 25 ° C and aged.
[제형예 4 ] 본 발명의 회화나무열매 발효액을 함유하는 에센스의 제조[Formulation Example 4] Preparation of an essence containing the fruit juice fermentation of the present invention
실시예의 회화나무열매 발효액 건조 분말을 함유한 화장료 중 에센스의 제형예는 표 10과 같다.Table 10 shows the formulation examples of the essence in cosmetics containing the dried powder of the natto fruit fermentation broth of the Example.
번호number | 원료Raw material | 함량(content( 중량%weight% )) |
1One | 회화나무열매 발효액 건조분말 (실시예)Dried fruit powder (Example) | 3.03.0 |
22 | 시토 스테롤Sitosterol | 1.71.7 |
33 | 폴리글리세릴 2-올레이트Polyglyceryl 2-oleate | 1.51.5 |
44 | 세라마이드Ceramide | 0.70.7 |
55 | 스테아레스-4Steareth-4 | 1.21.2 |
66 | 콜레스테롤cholesterol | 1.51.5 |
77 | 디세틸포스페이트Dicetyl phosphate | 0.40.4 |
88 | 농글리세린Concentrated glycerin | 5.05.0 |
99 | 마카다미아 오일Macadamia oil | 15.015.0 |
1010 | 카르복시비닐폴리머Carboxyvinyl polymer | 0.20.2 |
1111 | 산탄검Xanthan gum | 0.20.2 |
1212 | 방부제antiseptic | 미량a very small amount |
1313 | 향료Spices | 미량a very small amount |
1414 | 정제수Purified water | 잔량Balance |
상기 에센스를 제조하기 위하여 표 10에 기재된 2, 3, 4, 5 및 6번을 일정한 온도에서 균질화하여 제조되는 것을 비이온계 양친매성 지질이라 칭한다. 상기 비이온계 양친매성 지질과 1, 7, 8 및 14번을 혼합하고 일정한 온도에서 균질화하여 마이크로플루이다이져를 통과하고 이어 9번을 일정한 온도에서 서서히 접종하여 균질화한 후 다시 마이크로플루이다이져에 재차 통과시켰다 그리고 10, 11, 12 및 13번을 투입하여 분산시켜 안정화하고 숙성시켰다.To prepare the essence, it is referred to as nonionic amphiphilic lipids prepared by homogenizing 2, 3, 4, 5 and 6 in Table 10 at a constant temperature. The non-ionic amphipathic lipid was mixed with 1, 7, 8 and 14, homogenized at a constant temperature, passed through a microfluidizer and then slowly inoculated at a constant temperature to homogenize the microfluidizer. And then 10, 11, 12 and 13 were added thereto, dispersed, stabilized and aged.
본 발명에서 설명한 것은 회화나무열매 발효액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법을 위한 실시예에 불과한 것으로, 본 발명은 상기 실시예에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있으며, 단지 본 실시예는 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.The present invention is not limited to the above-described embodiments, but may be practiced in various other forms, for example, a cosmetic composition for improving skin wrinkles and a method for producing the same, And it is to be understood that the present invention is not limited to the details of the foregoing embodiments, but, on the contrary, it is to be understood that the present invention may be embodied in many other specific forms without departing from the spirit or essential characteristics thereof. It is only defined by category.
Claims (9)
- 회화나무열매를 락토바실러스로 발효시켜 수득한 회화나무열매 발효액 또는 이의 추출액을 함유하는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물.A cosmetic composition for improving skin wrinkles containing as an active ingredient, a fermented lycoris fruit juice or an extract thereof, characterized in that it contains a fermented lycopodium fruit or an extract thereof obtained by fermenting a fruit tree with Lactobacillus.
- 제 1 항에 있어서,The method according to claim 1,상기 회화나무열매는 물, 탄소수 1 내지 4개의 무수 또는 함수 저급 알코올, 아세톤, 에틸아세테이트, 부틸아세테이트 및 1,3-부틸렌 글리콜로 구성된 군으로부터 선택되는 어느 하나의 추출 용매를 사용하여 추출되는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물.The fruit tree is extracted using any one extraction solvent selected from the group consisting of water, an anhydrous or a lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol Wherein the cosmetic composition is a cosmetic composition for improving skin wrinkles.
- 제 1 항에 있어서, The method according to claim 1,상기 회화나무열매 발효액 또는 이의 추출액은 화장료 조성물 총 중량에 대해 0.01 내지 20.0 중량% 포함되는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물.The cosmetic composition for improving skin wrinkles comprising the fermented lycopodium fruit juice or the extract thereof as an active ingredient, wherein the fermented lycopodium fruit extract or its extract is contained in an amount of 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.
- 제 1 항에 있어서,The method according to claim 1,상기 회화나무열매 발효액 또는 이의 추출액은 피부 주름 개선 효과를 가지며 피부 자극에 대한 부작용이 없는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물.The above-described fruit juice fermentation broth or extract thereof has an effect of improving skin wrinkles and has no adverse effect on skin irritation. The cosmetic composition for improving skin wrinkles containing the fermented broccoli extract or its extract as an active ingredient.
- 회화나무열매 추출액을 얻는 단계(S10);A step (S10) of obtaining a fruit tree extract;상기 회화나무열매 추출액에 균주 락토바실러스를 접종하여 발효액을 얻는 단계(S20);(S20) a step of obtaining a fermentation broth by inoculating the strain Lactobacillus with the above extract of Lycopersicon esculentum;상기 단계(S20)의 회화나무열매 발효액에서 배양균을 제거한 후 중탕 추출법을 이용하여 회화나무열매 발효 추출액을 얻는 단계(S30); 및 A step (S30) of obtaining a fruit juice fermented by extracting fruit juice using a hot water extraction method after removing a culture bacterium from the fruit juice fermentation product of step (S20); And상기 단계(S20)의 회화나무열매 발효액 또는 상기 단계(S30)의 회화나무열매 발효 추출액에 안정화제, 비타민, 안료, 색소 및 향료를 더 포함하여 화장료 조성물을 얻는 단계(S40)로 이루어지는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물의 제조방법.(S40) comprising a stabilizing agent, a vitamin, a pigment, a coloring matter and a flavoring agent in the fermented fruit of Nasi fruit of step (S20) or the fermentation extract of Nasi fruit of step (S30) to obtain a cosmetic composition Which comprises extracting a nutrient solution from a nutrient solution or an extract thereof as an active ingredient.
- 제 5 항에 있어서,6. The method of claim 5,상기 단계(S20)에서 수득한 회화나무열매 발효액 또는 단계(S30)에서 수득한 회화나무열매 발효 추출액은 화장료 조성물 총 중량에 대해 0.01 내지 20.0 중량% 포함되는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물의 제조방법.The fruit juice fermentation product of Phalaenopsis fruit obtained in the step (S20) or the fruit extract of Phalaenia fruit obtained in the step (S30) is contained in an amount of 0.01 to 20.0% by weight based on the total weight of the cosmetic composition. As an active ingredient, a method for producing a cosmetic composition for improving skin wrinkles.
- 제 5 항에 있어서,6. The method of claim 5,상기 단계(S10)는 상기 회화나무열매를 정제수로 세척하고 건조한 다음 분쇄한 후 50 내지 200 메시(mesh)의 체를 이용하여 미세한 분쇄물을 얻으며, 상기 회화나무열매 분쇄물에 100 내지 300 g/L의 증류수를 가하고 중탕 조건에서 3 내지 7시간씩 3회 환류추출하고 냉침을 한 후, 3 내지 8 ㎛ 여과지로 여과하여 추출액을 얻는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물의 제조방법.In step (S10), the fruit of the above-mentioned method is washed with purified water, dried and pulverized, and then a fine pulverized product is obtained by using a sieve of 50 to 200 mesh. The fruit pulverized product is pulverized with 100 to 300 g / L of distilled water is added and the mixture is refluxed three times for 3 to 7 hours under a hot water condition, followed by cooling down and filtering with a filter paper of 3 to 8 탆 to obtain an extract. A method for producing a cosmetic composition for improving skin wrinkles.
- 제 5 항에 있어서,6. The method of claim 5,상기 단계(S20)는 상기 단계(S10)에서 얻은 회화나무열매 추출액에 균주 락토바실러스와 LB Broth 배지를 넣어 25 내지 35 호기적 조건에서 40 내지 120 시간 발효를 진행하며, 배양 후 배양액을 원심분리하여 배양균을 1차 제거하여 얻은 여과액을 다시 여과기를 이용하여 0.2 ㎛ 까지 여과한 후 멸균 처리를 하는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물의 제조방법.In step S20, the strain Lactobacillus and the LB Broth medium are added to the extract of Lycopersicon esculentum obtained in the step S10, and the fermentation is carried out under the condition of 25 to 35 for 40 to 120 hours. After the culture, the culture is centrifuged The filtrate obtained by firstly removing the culture is filtered again to a size of 0.2 탆 by means of a filter and sterilized, followed by preparation of a cosmetic composition for improving skin wrinkles containing the extract of the present invention as an active ingredient Way.
- 제 5 항에 있어서,6. The method of claim 5,상기 단계(S30)는 상기 단계(S20)에서 수득한 회화나무열매 발효액에 멸균 및 방부제를 투여한 후, 중탕 추출법으로 회화나무열매 발효 추출액을 얻고, 상기 배양균을 제거한 회화나무열매 발효액을 3 내지 7시간씩 3회 환류중탕추출하고 냉침한 후, 3 내지 8 ㎛ 여과지로 여과하며, 여과 완료 후 회화나무열매 발효 추출액을 얻는 것을 특징으로 하는 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 하는 피부 주름개선용 화장료 조성물의 제조방법.In the step S30, the sterilization and preservative are added to the fruit juice fermentation solution obtained in step S20, and then the fruit juice fermentation extract is obtained by extracting with hot water. Wherein the extract is filtered with 3 to 8 탆 filter paper after extracting with reflux water for 3 hours each time for 7 hours, followed by cooling, followed by filtration to obtain a fruit juice fermentation extract of Fusarium oxyslavatus fruit or extract thereof. A method for producing a cosmetic composition for improvement.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201880082923.2A CN111491615B (en) | 2017-12-26 | 2018-10-30 | Cosmetic composition containing fermented liquid of fruit of Sophora japonica or its extract as effective component for improving skin wrinkle, and its preparation method |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2017-0179148 | 2017-12-26 | ||
KR1020170179148A KR102121457B1 (en) | 2017-12-26 | 2017-12-26 | Cosmetic composition comprising the extract of fermented Sophora Japonica Fruits for skin anti-wrinkle effect and producing method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2019132217A1 true WO2019132217A1 (en) | 2019-07-04 |
Family
ID=67063965
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2018/012963 WO2019132217A1 (en) | 2017-12-26 | 2018-10-30 | Cosmetic composition comprising styphnolobium japonicum fruit fermented solution or extract liquid thereof as effective ingredient for reducing skin wrinkle and preparation method therefor |
Country Status (3)
Country | Link |
---|---|
KR (1) | KR102121457B1 (en) |
CN (1) | CN111491615B (en) |
WO (1) | WO2019132217A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115969035A (en) * | 2023-03-21 | 2023-04-18 | 广东金骏康生物技术有限公司 | A composition containing enzymatic flos Sophorae Immaturus extract, and its preparation method and application in caring skin and resisting aging |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20090123458A (en) * | 2008-05-28 | 2009-12-02 | 주식회사 엘씨에스바이오텍 | A method for fermentation of natural plants or herbal medicines, a fermented product prepared therefrom and a cosmetic composition, a food composition and a pharmaceutical composition comprising the same |
KR101042845B1 (en) * | 2011-05-30 | 2011-06-17 | 이노스킨 주식회사 | Process for fermented bombyx mori extract on containing bombyx moriextract and cosmetic compositions for prevention of skin aging, bad dry and itching containing threrof |
KR20130023606A (en) * | 2011-08-29 | 2013-03-08 | 동국대학교 경주캠퍼스 산학협력단 | Composition for whitening of the skin comprising an extract of sophora japonica l., leguminosae |
KR101315265B1 (en) * | 2010-10-14 | 2013-10-08 | 소셜테크 주식회사 | Cosmetic composition for improving skin senescence |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2002265343A (en) * | 2001-03-07 | 2002-09-18 | Ichimaru Pharcos Co Ltd | Cosmetic composition |
KR20110004603A (en) * | 2009-07-08 | 2011-01-14 | (주)노바셀테크놀로지 | Extracts from sophora japonica l. for treating or preventing menopausal complaints, skin-aging, or skin wrinkle |
CN101708210B (en) * | 2009-12-04 | 2011-10-05 | 广东工业大学 | Application of pagodatree flower general flavone extract in preparing medicament for inhabiting cutaneous pigmentation |
-
2017
- 2017-12-26 KR KR1020170179148A patent/KR102121457B1/en active IP Right Grant
-
2018
- 2018-10-30 WO PCT/KR2018/012963 patent/WO2019132217A1/en active Application Filing
- 2018-10-30 CN CN201880082923.2A patent/CN111491615B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20090123458A (en) * | 2008-05-28 | 2009-12-02 | 주식회사 엘씨에스바이오텍 | A method for fermentation of natural plants or herbal medicines, a fermented product prepared therefrom and a cosmetic composition, a food composition and a pharmaceutical composition comprising the same |
KR101315265B1 (en) * | 2010-10-14 | 2013-10-08 | 소셜테크 주식회사 | Cosmetic composition for improving skin senescence |
KR101042845B1 (en) * | 2011-05-30 | 2011-06-17 | 이노스킨 주식회사 | Process for fermented bombyx mori extract on containing bombyx moriextract and cosmetic compositions for prevention of skin aging, bad dry and itching containing threrof |
KR20130023606A (en) * | 2011-08-29 | 2013-03-08 | 동국대학교 경주캠퍼스 산학협력단 | Composition for whitening of the skin comprising an extract of sophora japonica l., leguminosae |
Non-Patent Citations (1)
Title |
---|
SONG, HAENG SEON: "Study on the Effects of the Extracts from Sophora Japonica L. Flowers, Fruits and Branches on Improvements in Skin Condition", 2013 THESIS, 30 June 2014 (2014-06-30) * |
Also Published As
Publication number | Publication date |
---|---|
CN111491615B (en) | 2022-10-18 |
KR20190077722A (en) | 2019-07-04 |
CN111491615A (en) | 2020-08-04 |
KR102121457B1 (en) | 2020-06-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2019045259A2 (en) | Cosmetic composition including dendrobium candidum wallich ex lindley flower extract | |
KR101921211B1 (en) | Cosmetic composition for skin regeneration comprising Ainsliaea acerifolia extract or its fraction as effective component | |
WO2018164369A1 (en) | Composition for improving skin wrinkles, containing enzyme-treated hibiscus syriacus extract as active ingredient | |
WO2013180526A1 (en) | Skin regeneration and hair growth promoter containing edelweiss extract | |
KR20190088664A (en) | Cosmetic Composition for Improving Skin Elasticity and Winkles Comprising Plant Complex Extracts as Active Ingredient | |
KR101648148B1 (en) | Cosmetic composition containing fermented graviola for improving anti-wrinkle and method of preparing the same | |
WO2024123024A1 (en) | Composition including centipeda minima extract for prevention and treatment of inflammation and autoimmune diseases and manufacturing method therefor | |
WO2020071630A1 (en) | Composition for improving skin comprising extracts of natural products | |
WO2016056781A1 (en) | Composition for hair loss prevention or hair growth stimulation comprising artemisia umbelliformis extract | |
WO2019132217A1 (en) | Cosmetic composition comprising styphnolobium japonicum fruit fermented solution or extract liquid thereof as effective ingredient for reducing skin wrinkle and preparation method therefor | |
WO2018111042A2 (en) | Cosmetic composition comprising extract of medicinal herbs as active ingredient | |
WO2017119535A1 (en) | Anti-aging composition comprising carnosine, soy peptide, and andrographis paniculata extract | |
WO2020045921A1 (en) | Composition for improving skin transparency and reducing dullness | |
KR102119524B1 (en) | Cosmetic composition comprising the extract of fermented Sprout leaf/stem ginseng for skin anti-wrinkle effect and producing method thereof | |
WO2023128426A1 (en) | Cosmetic composition comprising fermented pine needle extract | |
WO2016056780A1 (en) | Composition for hair loss prevention or hair growth stimulation comprising scutellaria alpina extract | |
KR20210060801A (en) | Cosmetic Compositions for Anti-aging Comprising Complex Fermented Product of Plants | |
WO2019139403A1 (en) | Composition containing sericin, torilis japonica extract, and viscum album extract for skin generation, skin soothing, or wound healing | |
KR101854766B1 (en) | Skin whitening complex containing trihydroxyisoflavone and glycyrrhiza uralensis extracts | |
WO2020246766A1 (en) | Composition for preventing or alleviating skin aging, containing rhodiola sachalinensis extract fermented with bovista plumbea | |
WO2021215882A1 (en) | Composition for preventing hair loss or promoting hair growth comprising camellia pericarp extract as active ingredient | |
KR20140081137A (en) | A skin-care agent containig Morchella esculenta fruit body extract or Morchella esculenta mycelium extract | |
WO2012173383A2 (en) | Skin composition for external use containing cryptotanshinone as active ingredient | |
KR101317433B1 (en) | The cosmetic composition for skin whitening comprising the mixture of extract of Hovenia dulcia, Platycodon grandiflorum, wheat bud and sage | |
WO2016017894A1 (en) | Cosmetic composition containing upland rice extract and method for preparing same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18897466 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 18897466 Country of ref document: EP Kind code of ref document: A1 |