WO2019132217A1 - Cosmetic composition comprising styphnolobium japonicum fruit fermented solution or extract liquid thereof as effective ingredient for reducing skin wrinkle and preparation method therefor - Google Patents

Abstract

The present invention relates to a cosmetic composition comprising a Styphnolobium japonicum fruit fermented solution or an extract liquid thereof as an effective ingredient for reducing skin wrinkles and a preparation method therefor. More particularly, the present invention relates to a Styphnolobium japonicum fruit fermented solution or an extract liquid thereof as an effective ingredient for reducing skin wrinkles and a preparation method therefor, wherein a Styphnolobium japonicum fruit is fermented with lactobacillus to afford a fermented solution and the fermented solution or an extract liquid therefrom is used as an effective ingredient in a cosmetic composition that has an excellent effect of skin wrinkle reduction and is free of the side effect of skin irritation. The composition is provided for reducing skin wrinkles by promoting the proliferation of fibroblasts and inhibiting the gene expression of intramolecular collagen, TIMP-1, tropoelastin, and MMP-1.

Description

Cosmetic composition for improving skin wrinkles containing as an active ingredient a fruit juice extract or extract thereof

The present invention relates to a cosmetic composition for improving skin wrinkles and a method for producing the same, and more particularly to a cosmetic composition for improving skin wrinkles containing a fermented lycopodium fruit juice or an extract thereof as an active ingredient and a method for producing the same, and more particularly to a fermentation liquor obtained by fermenting Lycopersicon esculentum with Lactobacillus, The present invention relates to a cosmetic composition for improving skin wrinkles and a method for producing the same, which comprises an extract of Lycoris squamycinum fruit or its extract, which is excellent in the effect of improving skin wrinkles and has no adverse effects on skin irritation.

Further, the present invention provides a cosmetic composition comprising a niacin fermentation broth or an extract thereof as an active ingredient to inhibit fibroblast proliferation promotion, gene expression of collagen, TIMP-1, and Tropoelastin in a molecule, and gene expression of MMP-1 To improve the wrinkles of the skin, and an extract thereof, as an active ingredient, and a process for producing the same.

The functions of cosmetics are not only clean and aesthetic, but also free radicals (radicals) due to external factors such as moisture, pollutants and stress, ultraviolet rays, internal factors such as impaired immune cell function, , And to remove or suppress the cause of skin aging such as protein, nucleic acid, cell membrane lipid breakage by peroxide and the like.

    In addition, cosmetics having whitening, skin wrinkle improvement and inhibition, and ultraviolet shielding function to meet consumers' desire for high-performance cosmetics are continuously being developed. Among them, wrinkle-improving and suppressing products are particularly attracted to consumers who want to keep their skin young.

     Human skin generally becomes rough with loss of moisture, elasticity, color and gloss due to internal and external environment as it gets older. This is called skin aging, and it is a process in which the stain, wrinkles, and freckles increase.

     When a child has collagen in the body (collagen), but the whole body is smaekgyeo, but at the age of collagen is lacking or vaginal depletion, the skin will lose elasticity and wrinkles. Skin wrinkles are influenced by various factors such as moisture content of skin, collagen content, and immune function. It is known that the content of collagen is the most important factor.

    Collagen is present in the dermal layer of the skin and accounts for about 70% of the total dry skin weight. The elasticity of the skin is known to be maintained by this collagen and elastin (elastic fibers).

     Collagen molecules are made in Fibroblasts, which form a triple helical structure after they are secreted out of the cell. The main functions of collagen are known to maintain the mechanical rigidity of the skin, to strengthen the binding force of the connective tissues and to strengthen the bonding strength of tissues, to support cell adhesion, to induce cell division and differentiation (Van der Rest et al., 1990).

     Synthesis and degradation of collagen-like extracellular matrix in vivo are moderately controlled, but their synthesis is reduced as aging progresses and expression of matrix metalloproteinase (MMP), an enzyme that degrades collagen, is promoted, The elasticity is lowered and wrinkles are formed.

     In addition, skin elasticity is reduced due to decrease in cellular activity due to natural aging, increase in active oxygen and free radicals due to internal factors such as collagenase activity, and external factors such as pollution, ultraviolet rays, and stress (Ingrid Emerit et al., Free radical and aging, 1992).

      The substrate metalloproteinase (MMP) is a proteolytic agent secreted in vivo by natural aging and exposure to ultraviolet light, which degrades connective tissue (Collagen, Elastin, Glycosamino-glycans, etc.) in the extracellular matrix (ECM) It is an enzyme. The substrate metalloproteinases (MMPs) are calcium and zinc-dependent endopeptidases (Endopeptidase) secreted from cells such as polymorphonuclear neutrophils, macrophages, fibroblasts, and bone cells. ) At neutral pH and uses a variety of extracellular substrates as substrates. The types exist from MMP 1-16. Substrate metalloproteinase (MMP), which is intensively studied in relation to double collagen degradation, is MMP 1 and MMP 9.

     In general, at 80 years of age, 65% of collagen is reduced compared to 20 years of age, resulting in thinner skin thickness, which is known to be closely related to the wrinkling of the skin (Arthur K. Balin et al., Aging and the skin, 1989).

      In addition, as the extensive research on skin aging has been conducted in recent years, the importance of collagen in skin has been further emphasized. Promoting the synthesis of collagen in the skin, inhibiting the activity of matrix metalloproteinases such as MMP 1 and MMP 9, thereby increasing antioxidant properties such as antioxidation, wrinkle improvement, elasticity enhancement, skin strengthening and wound healing It is known to be able to expect the effect of.

In order to obtain such an effect, conventionally, collagen was formulated into a cosmetic product. However, these cosmetics apply collagen to the surface of the skin, and since the collagen, which is a polymer, is difficult to absorb percutaneously, its function can not be expected.

In addition, recently, collagen is directly injected into the dermis of the skin. However, this method is also difficult to expect the improvement of correct skin wrinkles due to side effects.

In recent years, there has been a growing interest in substances promoting collagen synthesis in order to solve this problem. Retinoic acid and proteins derived from animal placenta (JP-A No. 8-231370) It was announced.

However, since the retinoic acid is unstable, the formulation technique is complicated, the use of the protein from the animal placenta is restricted due to safety problems such as irritation and redness in the skin, and the use of the bovine extract due to mad cow disease is prohibited. It is difficult to expect an effect of improving the wrinkles of the skin by promoting the synthesis of the skin.

Therefore, it is necessary to develop a material which is safe to the living body, easy to use, high in stability and excellent in shape stability, promotes new collagen production which promotes collagen production, inhibits the activities of MMP 1 and MMP 9, It is urgently required to develop cosmetics that are easy to use.

Sophora japonica L. is a broad-leaved arboreous tree belonging to the leguminous plants. It is distributed widely in Northeast Asia including Korea, China, and Japan. The height of the tree is 15 ~ 25m and the twigs have no hair and have a full color. Leaves are elliptical or petiole-shaped and have 9 to 15 discordant leaflets.

In July and August, light yellow flowers bloom at the ends of branches, and in one room they are called beak, buds are called gnomes, and fruits are called gnomes.

The flowers and fruits of the above painting trees are used as herbal medicines in oriental medicine. They contain apigenin and isoflavone, which are flavonoid compounds separated from bean leaves, and are effective for antiinflammation, hemostasis, hypertension, hemorrhoids and eczema treatment. , Uterine hemorrhage, inflammation of the gums and skin makeup (Song, Sun-sun et al., Korea Cosmetic Societies, 2016, 42 (4), p351-358).

On the other hand, Sophprae Flos, which contains a lot of honey, contains 10 ~ 28% of routine, a small amount of chemperol, quercetin, vesicular and genistein glycosides, A, soffin B, and soffin C were separated. The above-mentioned needle-making is excellent in tyrosinase inhibitory activity and melanin formation inhibitory effect, and is also useful as a composition for whitening. (Registered Patent No. 10-1289813)

Conventionally, methanol and ethanol reflux extraction methods have been used to examine the efficacy and efficacy of flowers, fruit, and egg plant extracts. The polyphenol content of the plant extracts of P. japonicum extracted by the above method was 38.9 mg / g, compared with that of 75.9% ethanol by the reflux extraction method, and the polyphenol content of the plant extracts was 261.38 ± 7.02 mg / g It can be seen that better results are obtained. The results of this study are as follows: (1) The effect of the extracts on the skin, flower, fruit, and tree extracts was investigated. )

Traditionally, the fruit of a painting tree is a pod or cylindrical shape. Fruit is used for the treatment of hemorrhoids along with branches and bark, and the garden or wood is also used as furniture. It has been found out that the above-mentioned fruit of the painting tree, especially the painting tree, has a better estrogen-releasing activity than the estradiol, which is the most effective of the estrogen, (Patent Application Publication No. 10-2011-0004603).

However, the conventionally used coniferous tree extract, which is effective for anti-aging and skin wrinkle, is a substance that simply inhibits ascorbic acid, retinol and collagenase activity. It is formulated into cosmetics and medicines to prevent skin wrinkles and aging However, there has been a problem that it is difficult to obtain a substantial effect because the effect is insignificant because the stability is poor or the skin is not easily absorbed when it is formulated.

Disclosure of the Invention The present invention has been conceived in order to solve the above-mentioned problems, and it is an object of the present invention to provide a fermentation broth obtained by fermenting Natto fruit with Lactobacillus or an extract obtained by extracting the fermentation broth, The present invention provides a cosmetic composition for improving skin wrinkles and a process for producing the same, which comprises a nutrient fermentation broth or an extract thereof as an active ingredient.

Further, the present invention provides a cosmetic composition comprising a niacin fermentation broth or an extract thereof as an active ingredient to inhibit fibroblast proliferation promotion, gene expression of collagen, TIMP-1, and Tropoelastin in a molecule, and gene expression of MMP-1 And to provide a cosmetic composition for improving skin wrinkles and a process for producing the same, which comprises a fruit juice fermented with or without an extract thereof as an active ingredient.

The present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing a fruit juice fermented with Natto fruit obtained by fermenting Natto fruit with Lactobacillus.

Further, the present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing an extract of a fruit juice obtained from fermentation of Fruit tree fruit with Lactobacillus.

In addition, in the present invention, the fruit tree extract may be any one selected from the group consisting of water, an anhydrous or hydrated lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol It is preferable to be extracted by using.

(S20) of obtaining a fermentation broth by inoculating a strain Lactobacillus in the extract of Lycoris chejuensis, and culturing the fermented broccoli in the fermentation broth of step (S20) (Step S30) of obtaining a fruit juice extract from the fruit tree using a hot water extraction method after removing the bacteria, and a step of adding a stabilizer, a vitamin, and a pigment to the fruit juice fermentation extract of Phalaenopsis fruit of step (S20) , A coloring matter and a flavoring agent (S40).

As described above, the cosmetic composition for improving skin wrinkles containing the fermented Lactococcus lactis L. or extract thereof according to the present invention as an active ingredient and the preparation method thereof can be obtained by obtaining a fermentation broth fermented with Lactobacillus or an extract obtained by extracting the fermented broth The effect of improving skin wrinkles is excellent and there is no side effect on skin irritation.

In addition, the cosmetic composition for improving skin wrinkles and the method for producing the same, which contains the fruit juice fermentation product or extract thereof as an active ingredient according to the present invention, can provide a cosmetic composition containing a fruit juice fermentation product as an active ingredient, , Intramolecular collagen, TIMP-1 and Tropoelastin gene expression and gene expression of MMP-1 are inhibited to improve the wrinkles of the skin.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a flowchart of a method for producing a cosmetic composition for improving skin wrinkles containing an extract of Lycoris spp. Or extract thereof according to an embodiment of the present invention as an active ingredient.

The present invention has been studied based on a fermentation technique for maximizing the effect of improving skin wrinkles and effectiveness. As a result, it was confirmed that the fermentation broth fermented with Lactobacillus or the extract thereof significantly inhibited the gene expression of Collagen, TIMP-1 and Tropoelastin and the gene expression of MMP-1 in the intramolecular form, Thereby completing the invention.

A cosmetic composition for improving skin wrinkles containing the fruit of the present invention as an active ingredient or an extract thereof is as follows.

The present invention is characterized in that the composition is a cosmetic composition for improving skin wrinkles containing a fruit juice fermented with Natto fruit obtained by fermenting Natto fruit with Lactobacillus.

Further, the present invention is characterized in that it is a cosmetic composition for improving skin wrinkles containing an extract obtained from a fruit juice fermentation obtained from fermentation of fruit tree fruit with lactobacillus.

In the prior art, the extract of Painted Tree Flower and Painted Tree Leaf was used as a cosmetic composition. However, in the present invention, only fruit tree fruit was used in order to maximize the effect of wrinkle improvement and effectiveness, and the skin absorption efficiency of the active ingredient was increased, In order to enhance the effect of the present invention, the present invention uses a fermentation broth fermented with Lactobacillus nucifera or its extract as a cosmetic composition for improving the wrinkles of skin, thereby determining gene expression of Collagen, TIMP-1 and Tropoelastin and gene expression of MMP-1 Is remarkably suppressed than in the prior art, thereby maximizing the skin improvement effect.

Preferably, the dried fruit weight of the fruit tree is 10 to 40% by weight, and the fruit fruit is selected from the group consisting of water, anhydrous or lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1 , 3-butylene glycol, and the like.

The nuts can be prepared by conventional methods known in the art, that is, under the conditions of ordinary temperature and pressure, using a conventional solvent.

For example, the active ingredient of the composition of the present invention may be selected from the group consisting of water, anhydrous or lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol Or extracting the nuts from the fruit with the above-mentioned solvent, and then mixing them.

The solvent is preferably an alcohol, preferably ethanol, and the ethanol is more preferably 60 to 80% ethanol. The appropriate amount of the above-mentioned extraction solvent is 1 to 20 times by weight, more preferably 5 to 20 times by weight, and most preferably 10 times by weight, of the dried woody fruit.

Meanwhile, the fermentation broth obtained by fermenting the nuts of the present invention with Lactobacillus not only includes the extract obtained by the above-mentioned extraction method but also the extract obtained through ordinary purification process.

For example, by separation using an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatographies (made for separation by size, charge, hydrophobicity or affinity), and the like, It is also interpreted that the fraction is also included in the fermentation broth fermented with lactobacillus of the present invention.

In addition, the fermentation broth obtained by fermenting the nuts of the present invention with lactobacillus may also include a fermentation broth prepared by further processing such as vacuum distillation, freeze-drying, spray drying and the like.

The present invention relates to a fermentation broth fermented with Lactobacillus or a fermentation broth obtained by extracting the above fermented broccoli fruit from Lactobacillus japonica or Lactobacillus sp. And suppresses gene expression of MMP-1, which is superior to skin wrinkle improving effect and has no side effects on skin irritation.

In the present invention, the fermentation broth fermented with Lactobacillus can be in the form of a concentrated liquid or a dried powder.

Lactobacillus was fermented using a strain of Lactobacillus rhamnsus vitaP1 (accession number: KACC92054P), which was identified from human feces, using a strain possessed by Deng Jing Biotech.

The cosmetic composition for improving skin wrinkles containing the fruit juice fermentation broth of the present invention as an active ingredient exhibits excellent wrinkle-reducing effect and exhibits excellent stability in applied products.

It also has effects such as promoting fibroblast proliferation, gene expression of intracellular collagen, TIMP-1, and Tropoelastin, and suppression of gene expression of MMP-1.

According to a preferred embodiment of the present invention, the fermentation broth fermented with Lactobacillus or the extract of the fermentation broth according to the present invention is 0.01 to 20.0% by weight, preferably 0.1 to 15.0% by weight based on the total weight of the cosmetic composition, By weight is from 1 to 10.0% by weight.

In the case where the extract of the above-mentioned fruit tree extract or fermentation broth extract is less than 0.01% by weight based on the total weight of the cosmetic composition, the effect of promoting fibroblast proliferation, the expression of collagen, TIMP-1 and Tropoelastin in the molecule and gene expression of MMP- , And if it is more than 20% by weight, it may cause skin itching and tingling to a person having dry skin.

The fruit juice fermentation extract of the present invention or extract of fermentation broth of the present invention has an effect of improving skin wrinkles and has no adverse effect on skin irritation except for a person having dry skin, A fruit juice fermentation extract or a fruit juice fermentation extract can be used as a cosmetic composition.

The ingredients contained in the cosmetic composition of the present invention include components commonly used in cosmetic compositions in addition to the fermentation broth obtained by fermenting Natto fruit as an active ingredient with Lactobacillus. Examples thereof include antioxidants, stabilizers, solubilizers, vitamins, Conventional auxiliaries such as coloring and flavoring agents, and carriers.

The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, a pack, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.

When the formulation of the present invention is a paste, cream or gel, at least one of an animal oil, a vegetable oil, a wax, a paraffin, a starch, a tracer, a cellulose derivative, polyethylene glycol, silicon, bentonite, silica, talc, Can be selected and used.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, Glycerol, aliphatic esters, phenoxyethanol, triethanolamine, polyethylene glycol, beeswax, polysorbate 60, sorbitan sesquiolead, paraffin, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene sorbitan fatty acid esters, Sorbitan stearate, glycerin monostearate, stearic acid, glyceryl stearate / fat-400 stearate, carboxy polymer, sitosterol, polyglyceryl 2-oleate, ceramide, cholesterol, , Macadamia oil, carboxyvinyl polymer, xanthan gum or sorbitan fatty acid Esters can be selected and used.

When the formulation of the present invention is a suspension, a liquid diluent such as water, ethanol, glycerin, butylene glycol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Such as, for example, suspensions, microcrystalline cellulose, hydroxyethylcellulose, sodium hyaruronate, phenoxyethanol, aluminum metahydroxide, bentonite, stearic acid, cetyl alcohol, glyceryl monostearate, polyoxyethylene sorbitan monostearate , Sorbitan sesquioleate, glyceryl monostearate / glyceryl stearate / polyoxyethylene stearate, wax, paraffin, squalane, caprylic / capric triglyceride, carboxyvinyl polymer, triethanolamine, Select one or more of the Kant It can be.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide At least one selected from ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.

The method for producing a cosmetic composition for improving skin wrinkles containing the fruit juice fermentation product of the present invention as an active ingredient will be described with reference to the accompanying drawings.

FIG. 1 is a flowchart showing a method for producing a cosmetic composition for improving skin wrinkles containing a fruit juice fermentation product according to the present invention as an active ingredient.

Hereinafter, preferred embodiments of the present invention will be described with reference to the accompanying drawings. A method for producing a cosmetic composition for improving skin wrinkles containing the present invention's nutritional liquid fruit juice as an active ingredient preferably includes the following steps But is not limited thereto.

(S20) of obtaining a fermentation broth by inoculating a strain Lactobacillus in the above extract of Lycoris chejuensis; (B) culturing the fermentation broth in the fermentation broth of step (S20); (S30) of obtaining a fruit juice extract from fruit juice using the hot water extraction method, and adding a stabilizer, a vitamin, a pigment, a coloring agent and a coloring agent to the fruit juice fermentation solution of Phalaenopsis fruit of step (S20) And a step (S40) of obtaining a cosmetic composition including a flavoring.

The manufacturing method of the present invention will be described separately for each step.

(S10) of obtaining the above-mentioned fruit tree extract.

The dried fruit is washed with purified water, dried and then pulverized, and a fine pulverized product is obtained using a sieve of 50 to 200 mesh. 100 to 300 g / L of distilled water is added to the above ground fruit juice, refluxed for 3 to 7 hours under reflux condition, and cold-frozen. Thereafter, it is filtered with a filter paper of 3 to 8 탆 to prepare an extract and used as an extract of the fermentation process.

Step (S20) of obtaining the fermentation broth by inoculating the strain Lactobacillus with the above extract of Lycoris sp.

The strain Lactobacillus and the LB Broth medium are added to the extract of Lycopersicon esculentum obtained in the step S10, and the fermentation is carried out for 25 to 35 days under the condition of 40 to 120 hours. After culturing, the culture solution is centrifuged to remove the culture solution first, and the filtrate thus obtained is filtered again to 0.2 μm using a filter, and sterilized to prevent further culture.

The fruit juice fermentation product obtained in step S20 may contain 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.

If the amount of the fermented fruit juice is less than 0.01% by weight based on the total weight of the cosmetic composition, there is a problem in that the activity of lipoxygenase and hyaruronidase is inhibited and free radicals are not extinguished. There is a problem that the skin gets itchy and tingling.

After removing the cultured bacterium from the Lactobacillus fermentation broth of step (S20), the step (S30) of obtaining the Lactobacillus fruit juice extract solution using the hot water extraction method is performed.

After the sterilization and preservative are administered to the fermented lycopene fruit obtained in the above step (S20), an extract of Lycoris fruit juice is obtained by extracting with hot water. After removing the culture, the fruit juice is extracted with reflux for 3 to 7 hours, refluxed, and filtered through a filter paper of 3 to 8 탆. After the filtration is completed, the fruit juice extract is obtained.

The fruit juice fermentation extract obtained in step S30 may contain 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.

When the extract is less than 0.01% by weight based on the total weight of the cosmetic composition, there is a problem in that the activity of lipoxygenase, hyaruronidase is inhibited and the free radical is not extinguished. When the extract is more than 20% by weight, People with skin itching and tingling may have problems.

(S40) of obtaining a cosmetic composition comprising a stabilizer, a vitamin, a pigment, a coloring matter and a flavoring agent in the fermented extract of Fagus nuratum in step S20 or the fermented extract of Fagus niger in step S30 .

Hereinafter, the production examples, examples, comparative examples, test examples and formulation examples of the present invention will be described in detail.

The following Production Examples, Examples, Comparative Examples, Test Examples and Formulation Examples are illustrative of the present invention, and the present invention is not limited to the following Production Examples, Examples, Comparative Examples, Test Examples and Formulation Examples.

[Production Example] Production method of woody fruit extract

The nuts were washed with purified water, dried and then pulverized, and then finely pulverized using a sieve of 100 mesh. A 10% (v / v) aqueous ethanol solution was added to 100 g / L of the crushed fruit juice, and the mixture was refluxed for 3 hours under reflux condition for 5 hours. Thereafter, the extract was filtered using a filter paper of 6 탆 (whatman # 3) and used as an extract of the fermentation process.

Further, the above extract was used at the concentration of 50 or less under reduced pressure and freeze-dried to evaluate the efficacy.

[EXAMPLES] Method for preparing fermented fruit juice and fruit juice

To the extract of Lycopersicon esculentum prepared in the above Production Example, the strain Lactobacillus rhamnosus VitaP1 (accession number: KACC92054P) and LB Broth medium, and fermentation is carried out under the condition of No. 30 for 96 hours. After the fermentation, the fermentation broth was centrifuged to remove the cultures first, and the filtrate thus obtained was filtered to 0.2 μm using a filter and sterilized (121, 15 minutes, 1.5 atm) to prevent further culture. Purified water was added to the fermented fruit juice obtained by sterilization, and the mixture was refluxed three times for 5 hours, cooled, and filtered through a filter paper (whatman # 3) of 6 μm. After filtration, the obtained extract was transferred to a concentration tank and concentrated under reduced pressure and freeze-dried at 50 or less.

[Comparative Example] Comparative Example of Production Method of Lactobacillus Culture Solution

In this comparative example, the fermentation strain Lactobacillus rhamnosus vitaP1 (accession number: KACC92054P) used in the example is cultured in LB broth medium for 30 hours under the condition of No. 30 for 96 hours. After culturing, the culture solution was centrifuged to remove the culture solution first, and the filtrate thus obtained was filtered again to 0.2 μm using a filter, and then sterilized (121, 15 minutes, 1.5 atm) to prevent further culture. The culture medium from which the cultures were removed was transferred to a concentration tank and concentrated under reduced pressure and freeze-dried at 50 or less.

[Test Example 1] Confirmation of cell proliferation and toxicity by the fermentation broth of the present invention

<Cell Culture>

Collagen and Timp-1 were used to determine the expression of the genes that act on the anti-aging of the dried powder of the natto fruit fermented product prepared in Examples and Comparative Examples, the dry powder of the lactobacillus culture solution and the dry powder prepared in the preparation example Human keratinocyte cell line (HaCaT) was used, and MMP-1 and Tropoelastin used CCD-986Sk (human fibroblast cell line). HaCaT and CCD-986Sk cells were cultured in DMEM containing 10% (v / v) FBS (fetal bovine serum, Gibco, USA), 100 U / mL streptomycin, 100 U / mL penicillin antibiotics (Gibco, USA) using Dulbecco's modified eagle's medium, Gibco , USA) medium and cultured in an incubator of 5% CO ₂ and 37 conditions.

&Lt; Measurement of cell survival rate (MTT assay) >

The effect of the dried powder of N. pombe powder prepared in the above Examples and Comparative Examples on the cell proliferation was examined with respect to the dry powder of the lactobacillus culture solution and the dry powder prepared in the Preparation Example.

Experiments were carried out in the following manner to confirm cell proliferation and toxicity.

The cells were cultured in a 96-well microplate at 5,000 cells / well in a thermostatic chamber for 30 minutes. The samples were treated with 0.01, 0.05, 0.1 and 0.5% (w / w) V)) and cultured for 72 hours. After 72 hours of incubation, thiazoline blue was added and further incubated for 4 hours. The culture medium was discarded and the reaction stop solution was added to each well of the microplate. After stirring for 5 minutes, the absorbance at 570 nm was measured. The control group was co-cultured with 10% Fetal Bovine Serum (FBS) medium as an optimal condition for cell growth, and the cell proliferation rate of the test group was calculated with the cell proliferation of the control group as 100% Respectively.

The cell proliferation effect was calculated by Equation 1, and the results are shown in Table 1 below.

[Equation 1]

Cell proliferation and toxicity mitigation effect of fruit juice

division		Painted tree fruit extract, Fermentation product  And Lactobacillus  Culture medium concentration (占 퐂 / ml)
		Control group	0	10	50	100	1,000
Growth rate (%)	Example	100	0.00	106.31	115.28	122.84	128.25
	Comparative Example	100	0.00	100.14	100.37	100.20	100.23
	Manufacturing example	100	0.00	104.10	110.22	116.76	121.15

As shown in Table 1, when the cell proliferation at the optimal cell growth conditions was regarded as 100%, the dried powder of the nutshell fermentation broth prepared in Examples and Comparative Examples, the dry powder of the lactobacillus culture solution, The dried powders of the fruit extract were not cytotoxic.

In particular, it was confirmed that the cell proliferation effect was exhibited in the examples and the production examples, and the cell proliferation effect was superior to the production examples. On the other hand, in the comparative example, there was no cytotoxicity, but the cell proliferation effect was also not confirmed.

[ Test Example  2] Intracellular  collagen, Timp -1 and Tropoelastin  Gene expression and MMP -1 gene expression inhibitory effect

HaCaT and CCD-986Sk cells were cultured in Petri dishes at 5% CO ₂ and 37 for 24 hours after preparing cells at 5 × 10 ⁵ cells / ㎖. Cells were grown in petri dishes at least 80% and then added at concentrations that were above 100% of the extract cell viability.

After treating the dried powder of the natto fruit fermentation broth prepared in Examples and Comparative Examples, the dry powder of the lactobacillus culture solution and the dried powder of the nuts extract prepared in Preparation Example, the cells were treated with DMEM / 10 FBS for 24 hours at 5% CO ₂ and 37 Lt; / RTI &gt; After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). RT-PCR confirmed the expression of COL1A1, TIMP-1 and Tropoelastin and the inhibition of MMP-1 expression. GAPDH was used as a house keeping gene to identify differences in gene expression.

The primer sequences of the respective genes are shown in Table 2. The extracted RNA was amplified with a dT-adapter primer (Oligo dT-adapter primer) and DEPC water to a total volume of 15 μl. After denaturing for 70 minutes, reverse transcription of Moloney murine leukemia virus (M-MLV) 42, 60, and 94 5 minutes. The synthesized cDNA was amplified by PCR and the total reaction volume was 25 μl. The final concentration of each reagent was 100 pmol of the primer, 1.0 M of the primer, 0.2 mM of the dNTP mixture, 5x green or colorless GoTaq Reaction buffer 1? 1.5 mM, MgCl ₂ (PCR buffer) and 1.25 units of GoTaq DNA polymerase. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 2 minutes, 95 30 seconds, 60 30 seconds, 72 1 minutes, 72 5 minutes, 30 to 40 cycles Respectively. After the PCR reaction, 10 μl of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Gene primer  Base sequence

Name of the primer	Base sequence
GAPDH	Forward: GGCATTGCTCTCAATGACAA
	Reverse: TGTGAGGGAGATGCTCAGTG
MITF	Forward: AACCGACAGAAGAAGCTGGA
	Reverse: ACAAGTTCCTGGCTGCAGTT
Tyrosinase	Forward: TTATGCGATGGAACACCTGA
	Reverse: ACTGGCAAATCCTTCCAGTG

Collagen expression by fermented fruit juice

division		Painted tree fruit extract, Fermentation product  And Lactobacillus  Culture medium concentration (占 퐂 / ml)
		0	10	50	100	1,000
Collagen expression (%)	Example	100.00	108.23	116.71	125.91	141.02
	Comparative Example	100.00	99.98	100.02	100.11	100.31
	Manufacturing example	100.00	104.96	107.76	118.68	127.8
	Adenosine					138.98

By fermented fruit juice TIMP - 1expression

division		Painted tree fruit extract, Fermentation product  And Lactobacillus  Culture medium concentration (占 퐂 / ml)
		0	10	50	100	1,000
TIMP-1expression (%)	Example	100.00	105.29	111.98	118.38	126.9
	Comparative Example	100.00	100.21	100.10	100.06	100.14
	Manufacturing example	100.00	100.64	103.91	109.53	115.06
	Adenosine					121.88

By fermented fruit juice Tropoelastin  expression

division		Painted tree fruit extract, Fermentation product  And Lactobacillus  Culture medium concentration (占 퐂 / ml)
		0	10	50	100	1,000
Tropoelastinexpression (%)	Example	100.00	118.28	128.18	131.88	137.55
	Comparative Example	100.00	99.96	100.12	100.17	100.15
	Manufacturing example	100.00	108.23	112.56	120.59	126.35
	Adenosine					135.03

By fermented fruit juice MMP -1 expression

division		Painted tree fruit extract, Fermentation product  And Lactobacillus  Culture medium concentration (占 퐂 / ml)
		0	10	50	100	1,000
MMP-1expression (%)	Example	100.00	94.23	90.07	82.61	77.1
	Comparative Example	100.00	99.92	100.07	100.11	100.09
	Manufacturing example	100.00	96.16	95.27	91.01	88.92
	Adenosine					78.26

As shown in Tables 3 to 6, after the PT-PCR was performed, the examples of the present invention showed that collagen and TIMP were more effective than the dry powder of the Lactobacillus culture liquid prepared in the Comparative Example and the dried powder of the Lactobacillus broth extract prepared in the Preparation Example, -1 expression, and the expression of MMP-1 tended to decrease in a concentration-dependent manner. Compared with the control group, adenosine (Adenosine), excellent or similar results were obtained.

In addition, Tropoelastin is a factor that forms elastic fiber-centered elastin showing skin elasticity, which is similar to that of control adenosine in Example 1

[Formulation Example 1] Production of Lotion Containing the Fermented Lactic Fruit Juice of the Present Invention

Table 7 shows formulation examples of cosmetic lotion (skin lotion) among the cosmetic compositions containing the dried powder of the natto fruit fermented product of Example.

Composition of Lotion Containing Fermented Juice of Painted Nuts

number	Raw material	content( weight% )
One	Dried fruit powder (Example)	1.0
2	glycerin	3.0
3	Butylene glycol	2.0
4	Propylene glycol	2.0
5	Polyol cyanuric acid castor oil	1.0
6	ethanol	10.0
7	Triethanolamine	0.1
8	antiseptic	a very small amount
9	Pigment	a very small amount
10	Spices	a very small amount
11	Purified water	Balance

To prepare the cosmetic lotion, 2, 3, 4, and 8 were added in order as described in Table 7, and the mixture was stirred and melted. The mixture was heated to 60 ° C to dissolve 5 times, And then put in 11 times. Finally, 1, 6, 7 and 9 were added and agitated after sufficient stirring.

[Formulation Example 1] Production of a nutritious lotion containing the fruit juice of the present invention

Table 8 shows formulation examples of nutritional lotion among the cosmetics containing the dried powder of the nude fruit fermented product of Example.

Containing a nutrient solution of natto fruit Nutritious lotion  Configuration

number	Raw material	content( weight% )
One	Dried fruit powder (Example)	2.0
2	Wax	1.0
3	Polysorbate 60	1.5
4	Sorbitan sesquioleate	0.5
5	Liquid paraffin	10.0
6	Sorbitan stearate	1.0
7	Pro-type glycerin monostearate	0.5
8	Stearic acid	1.5
9	Glyceryl stearate / FG-400 stearate	1.0
10	Propylene glycol	3.0
11	Carboxy polymer	0.1
12	Triethanolamine	0.2
13	antiseptic	a very small amount
14	Pigment	a very small amount
15	Spices	a very small amount
16	Purified water	Balance

In order to prepare the nutritious lotion, 10, 11, 13 and 16 as shown in Table 8 were heated to 80 to 85 while mixing and stirring, and then put into a manufacturing part and then emulsified by 2, 3, 4, 5, 6, 7, 8, 9 and 12 were melted by heating to 80 to 85, and then emulsified. After the emulsification was completed, the mixture was cooled to 50 with stirring using an agitator, and then 15 was added. After cooling to 45, 14 was added, and 1 was added to 35, followed by cooling to 25, followed by aging.

[Formulation Example 3] Preparation of a nutritional cream containing the fruit juice fermentation of the present invention

Table 9 shows formulation examples of nutritional creams among the cosmetic compositions containing the dried powder of the nectarine fermented product of Example.

Concentrated fruit juice  Composition of nutritional cream containing

number	Raw material	content( weight% )
One	Dried fruit powder (Example)	3.0
2	Stearic acid	2.0
3	Cetyl alcohol	2.0
4	Glyceryl monostearate	2.0
5	Polyoxyethylene sorbitan monostearate	0.5
6	Sorbitan sesquioleate	0.5
7	Glyceryl monostearate / glyceryl stearate / polyoxyethylene stearate	1.0
8	Wax	1.0
9	Liquid paraffin	4.0
10	Squalane	4.0
11	Caprylic / capric triglyceride	4.0
12	Carboxyvinyl polymer	0.2
13	Butylene glycol	5.0
14	glycerin	3.0
15	Triethanolamine	0.5
16	Purified water	Balance

In order to prepare the nutritive cream, the ingredients 12, 13, 14, and 16 as shown in Table 9 were heated to 80 to 85 while mixing and stirring, and then put into a manufacturing part and then emulsified with 2, 3, 4, 5, 6, 7 , 8, 9, 10 and 11 were melted by heating to 80 to 85 ° C, and then 15 parts of the mixture were stirred and introduced into the production section and emulsified. After the emulsification was completed, the mixture was cooled to 35 with stirring using an agitator, and the mixture was cooled to 25 ° C and aged.

[Formulation Example 4] Preparation of an essence containing the fruit juice fermentation of the present invention

Table 10 shows the formulation examples of the essence in cosmetics containing the dried powder of the natto fruit fermentation broth of the Example.

Composition of Essence Containing Trifolium trifoliate

number	Raw material	content( weight% )
One	Dried fruit powder (Example)	3.0
2	Sitosterol	1.7
3	Polyglyceryl 2-oleate	1.5
4	Ceramide	0.7
5	Steareth-4	1.2
6	cholesterol	1.5
7	Dicetyl phosphate	0.4
8	Concentrated glycerin	5.0
9	Macadamia oil	15.0
10	Carboxyvinyl polymer	0.2
11	Xanthan gum	0.2
12	antiseptic	a very small amount
13	Spices	a very small amount
14	Purified water	Balance

To prepare the essence, it is referred to as nonionic amphiphilic lipids prepared by homogenizing 2, 3, 4, 5 and 6 in Table 10 at a constant temperature. The non-ionic amphipathic lipid was mixed with 1, 7, 8 and 14, homogenized at a constant temperature, passed through a microfluidizer and then slowly inoculated at a constant temperature to homogenize the microfluidizer. And then 10, 11, 12 and 13 were added thereto, dispersed, stabilized and aged.

The present invention is not limited to the above-described embodiments, but may be practiced in various other forms, for example, a cosmetic composition for improving skin wrinkles and a method for producing the same, And it is to be understood that the present invention is not limited to the details of the foregoing embodiments, but, on the contrary, it is to be understood that the present invention may be embodied in many other specific forms without departing from the spirit or essential characteristics thereof. It is only defined by category.

Claims (9)

1. A cosmetic composition for improving skin wrinkles containing as an active ingredient, a fermented lycoris fruit juice or an extract thereof, characterized in that it contains a fermented lycopodium fruit or an extract thereof obtained by fermenting a fruit tree with Lactobacillus.
2. The method according to claim 1,

   The fruit tree is extracted using any one extraction solvent selected from the group consisting of water, an anhydrous or a lower alcohol having 1 to 4 carbon atoms, acetone, ethyl acetate, butyl acetate and 1,3-butylene glycol Wherein the cosmetic composition is a cosmetic composition for improving skin wrinkles.
3. The method according to claim 1,

   The cosmetic composition for improving skin wrinkles comprising the fermented lycopodium fruit juice or the extract thereof as an active ingredient, wherein the fermented lycopodium fruit extract or its extract is contained in an amount of 0.01 to 20.0% by weight based on the total weight of the cosmetic composition.
4. The method according to claim 1,

   The above-described fruit juice fermentation broth or extract thereof has an effect of improving skin wrinkles and has no adverse effect on skin irritation. The cosmetic composition for improving skin wrinkles containing the fermented broccoli extract or its extract as an active ingredient.
5. A step (S10) of obtaining a fruit tree extract;

   (S20) a step of obtaining a fermentation broth by inoculating the strain Lactobacillus with the above extract of Lycopersicon esculentum;

   A step (S30) of obtaining a fruit juice fermented by extracting fruit juice using a hot water extraction method after removing a culture bacterium from the fruit juice fermentation product of step (S20); And

   (S40) comprising a stabilizing agent, a vitamin, a pigment, a coloring matter and a flavoring agent in the fermented fruit of Nasi fruit of step (S20) or the fermentation extract of Nasi fruit of step (S30) to obtain a cosmetic composition Which comprises extracting a nutrient solution from a nutrient solution or an extract thereof as an active ingredient.
6. 6. The method of claim 5,

   The fruit juice fermentation product of Phalaenopsis fruit obtained in the step (S20) or the fruit extract of Phalaenia fruit obtained in the step (S30) is contained in an amount of 0.01 to 20.0% by weight based on the total weight of the cosmetic composition. As an active ingredient, a method for producing a cosmetic composition for improving skin wrinkles.
7. 6. The method of claim 5,

   In step (S10), the fruit of the above-mentioned method is washed with purified water, dried and pulverized, and then a fine pulverized product is obtained by using a sieve of 50 to 200 mesh. The fruit pulverized product is pulverized with 100 to 300 g / L of distilled water is added and the mixture is refluxed three times for 3 to 7 hours under a hot water condition, followed by cooling down and filtering with a filter paper of 3 to 8 탆 to obtain an extract. A method for producing a cosmetic composition for improving skin wrinkles.
8. 6. The method of claim 5,

   In step S20, the strain Lactobacillus and the LB Broth medium are added to the extract of Lycopersicon esculentum obtained in the step S10, and the fermentation is carried out under the condition of 25 to 35 for 40 to 120 hours. After the culture, the culture is centrifuged The filtrate obtained by firstly removing the culture is filtered again to a size of 0.2 탆 by means of a filter and sterilized, followed by preparation of a cosmetic composition for improving skin wrinkles containing the extract of the present invention as an active ingredient Way.
9. 6. The method of claim 5,

   In the step S30, the sterilization and preservative are added to the fruit juice fermentation solution obtained in step S20, and then the fruit juice fermentation extract is obtained by extracting with hot water. Wherein the extract is filtered with 3 to 8 탆 filter paper after extracting with reflux water for 3 hours each time for 7 hours, followed by cooling, followed by filtration to obtain a fruit juice fermentation extract of Fusarium oxyslavatus fruit or extract thereof. A method for producing a cosmetic composition for improvement.

Images