WO2019106027A1 - SynP61, A PRIMATE RETINAL PIGMENT EPITHELIUM CELL-SPECIFIC PROMOTER - Google Patents

SynP61, A PRIMATE RETINAL PIGMENT EPITHELIUM CELL-SPECIFIC PROMOTER Download PDF

Info

Publication number
WO2019106027A1
WO2019106027A1 PCT/EP2018/082872 EP2018082872W WO2019106027A1 WO 2019106027 A1 WO2019106027 A1 WO 2019106027A1 EP 2018082872 W EP2018082872 W EP 2018082872W WO 2019106027 A1 WO2019106027 A1 WO 2019106027A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid sequence
sequence
cells
acid molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2018/082872
Other languages
English (en)
French (fr)
Inventor
Josephine JUETTNER
Jacek Krol
Botond Roska
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Forschungsstiftung Zweigniederlassung Friedrich Miescher Institute for Biomedical Research
Original Assignee
Novartis Forschungsstiftung Zweigniederlassung Friedrich Miescher Institute for Biomedical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US16/768,055 priority Critical patent/US20230193314A1/en
Priority to BR112020010775-1A priority patent/BR112020010775A2/pt
Priority to CN201880084798.9A priority patent/CN111527102A/zh
Priority to AU2018376544A priority patent/AU2018376544B2/en
Priority to RU2020121390A priority patent/RU2020121390A/ru
Priority to KR1020207018368A priority patent/KR20200091435A/ko
Priority to SG11202005002QA priority patent/SG11202005002QA/en
Priority to EP18833620.0A priority patent/EP3717509A1/en
Priority to CR20200235A priority patent/CR20200235A/es
Application filed by Novartis Forschungsstiftung Zweigniederlassung Friedrich Miescher Institute for Biomedical Research filed Critical Novartis Forschungsstiftung Zweigniederlassung Friedrich Miescher Institute for Biomedical Research
Priority to MX2020005648A priority patent/MX2020005648A/es
Priority to CA3083404A priority patent/CA3083404A1/en
Priority to JP2020529473A priority patent/JP7390290B2/ja
Publication of WO2019106027A1 publication Critical patent/WO2019106027A1/en
Priority to IL274885A priority patent/IL274885A/en
Priority to PH12020550766A priority patent/PH12020550766A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • the present invention relates to a nucleic acid sequence leading to the expression of genes specifically in cells of the retinal pigment epithelium (RPE).
  • RPE retinal pigment epithelium
  • recombinant genes are usually transfected into the target cells, cell populations or tissues, as cDNA constructs in the context of an active expression cassette to allow transcription of the heterologous gene.
  • the DNA construct is recognized by the cellular transcription machinery in a process that involves the activity of many trans-acting transcription factors (TF) at cis-regulatory elements, including enhancers, silencers, insulators and promoters (herein globally referred to as“promoters”).
  • TF trans-acting transcription factors
  • Gene promoter are involved in all of these levels of regulation, serving as the determinant in gene transcription by integrating the influences of the DNA sequence, transcription factor binding and epigenetic features. They determines the strength of e.g. transgene expression which is encoded by a plasmid vector as well as in which cell type or types said transgene will be expressed.
  • CMV human and mouse cytomegalovirus
  • RSV Rous Sarcoma Virus
  • LTR long-terminal-repeat
  • cellular promoters can also be used.
  • known promoters are those from house-keeping genes that encode abundantly transcribed cellular transcripts, such as beta-actin, elongation factor 1-alpha (EF-1alpha), or ubiquitin.
  • EF-1alpha elongation factor 1-alpha
  • ubiquitin elongation factor 1-alpha
  • One of the aspects concerning the use of endogenous regulatory elements for transgene expression is the generation of stable mRNA and that expression can take place in the native environment of the host cell where trans-acting transcription factors are provided accordingly. Since expression of eukaryotic genes is controlled by a complex machinery of cis- and transacting regulatory elements, most cellular promoters suffer from a lack of extensive functional characterization. Parts of the eukaryotic promoter are usually located immediately upstream of its transcribed sequence and serves as the point of transcriptional initiation. The core promoter immediately surrounds the transcription start site (TSS) which is sufficient to be recognized by the transcription machinery.
  • TSS transcription start site
  • the proximal promoter comprises the region upstream of the core promoter and contains the TSS and other sequence features required for transcriptional regulation.
  • Transcription factors act sequence-specific by binding to regulatory motifs in the promoter and enhancer sequence thereby activating chromatin and histone modifying enzymes that alter nucleosome structure and its position which finally allows initiation of transcription.
  • the identification of a functional promoter is mainly dependent on the presence of associated upstream or downstream enhancer elements.
  • Another crucial aspect concerning the use of endogenous regulatory elements for transgene expression is that some promoters can act in a cell specific manner and will lead to the expression of the transgene on in cells of a specific type or, depending on the promoter, in cells of a particular subset.
  • one goal of the present invention is to obtain new sequences suitable for expressing recombinant genes in mammal cells of the retina with high expression levels and in a cell type specific manner.
  • Such sequence address a need in the art for retinal cells specific promoter to develop systems for the study of neurodegenerative disorders, vision restoration, drug discovery, tumor therapies and diagnosis of disorders.
  • a promoter which was known to drive gene expression specifically in Muller cells in a murine model as described in WO 2015/121793, has unexpectedly and atypically a totally different specificity in primates.
  • this promoter specifically drives gene expression in cells of the retinal pigment epithelium (RPE).
  • RPE retinal pigment epithelium
  • This specificity is extremely useful to address and target gene expression in retinal pigment epithelium cells in diseased retina of e.g. age-related macular degeneration, retinitis pigmentosa, diabetic retinopathy or retinal pigment epithelium hypertrophy patients.
  • the nucleic acid sequence of this promoter is:
  • the present invention hence provides method for expressing an exogenous gene specifically in cells of the retinal pigment epithelium of a primate, said method comprising the step of delivering an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 , or consisting of a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said sequence of SEQ ID NO: 1 , to cells of the retinal pigment epithelium of said primate, wherein said isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for said exogenous gene is operatively linked to said isolated nucleic acid molecule.
  • the isolated nucleic acid molecule can further comprise, operatively linked to said isolated nucleic acid molecule, a minimal promoter, e.g. the minimal promoter of SEQ ID NO:2.
  • a minimal promoter e.g. the minimal promoter of SEQ ID NO:2.
  • the isolated nucleic acid molecule can be part of an expression cassette, which in turn can be part of a vector, for instance a viral vector.
  • the present invention also provides the use of an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 , or consisting of a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said sequence of SEQ ID NO: 1 , wherein said isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for said exogenous gene is operatively linked to said isolated nucleic acid molecule, to express an exogenous gene specifically in cells of the retinal pigment epithelium of a primate.
  • the isolated nucleic acid molecule can further comprise a minimal promoter, e.g. the minimal promoter of SEQ ID NO:2.
  • the isolated nucleic acid molecule can be part of an expression cassette, which can be part of a vector, e.g. a viral vector.
  • the present invention further provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 , or consisting of a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said sequence of SEQ ID NO: 1 , wherein said isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for said exogenous gene is operatively linked to said isolated nucleic acid molecule, for use in treating a disease associated with retinal pigment epithelium.
  • the disease associated with retinal pigment epithelium can be selected from the group consisting of age-related macular degeneration, retinitis pigmentosa, diabetic retinopathy and retinal pigment epithelium hypertrophy.
  • the isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said nucleic acid sequence of SEQ ID NO: 1 , wherein said isolated nucleic acid molecule specifically leads to the expression in cells of the retinal pigment epithelium of primates of a gene operatively linked to said nucleic acid sequence coding for said gene can be at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 80 % identity to said nucleic acid sequence of SEQ ID NO:1 .
  • the nucleic acid sequence is 1500bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 85 % overall identity to said nucleic acid sequence of SEQ ID NO: 1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 90 % overall identity to said nucleic acid sequence of SEQ ID NO:1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 95 % overall identity to said nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 96 % overall identity to said nucleic acid sequence of SEQ ID NO: 1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 97 % overall identity to said nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 98 % overall identity to said nucleic acid sequence of SEQ ID NO: 1. In some
  • the nucleic acid sequence at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 99 % overall identity to said nucleic acid sequence of SEQ ID NO: 1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has 100 % overall identity to said nucleic acid sequence of SEQ ID NO:1.
  • the isolated nucleic acid molecule of the invention can comprise a minimal promoter, for instance a SV40 minimal promoter, e.g. the SV40 minimal promoter
  • GCT CG AG AT CT GCG AT CTGCAT CT CAATT AGT CAGCAACCAT AGT CCCGCCCCT AACT CCGC CCAT CCCGCCCCTAACT CCGCCCAGTT CCGCCCATT CT CCGCCCCAT CGCT GACTAATTTTT TTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAG GCTTTTTTGGAGGCCTAGGCTTTTGCAAA (SEQ ID NO:2), preferably operatively linked to said isolated nucleic acid molecule.
  • a typical gene which can be operatively linked to the promoter of the invention is a gene encoding for a photoreceptor.
  • a photoreceptor For instance it can be a photosensitive molecule such as a channelrhodopsin or a halorhodopsin.
  • Figure 1 Targeted expression to retinal pigmented epithelium cells in primate retina from promoter ID NO:1.
  • Induced expression in retinal pigmented epithelium cells can be observed.
  • Green EGFP driven by the SEQ ID NO: 1.
  • White Hoechst. DETAILED DESCRIPTION OF THE INVENTION
  • the nucleic acid sequence of this promoter is:
  • the present invention hence provides method for expressing an exogenous gene specifically in cells of the retinal pigment epithelium of a primate, said method comprising the step of delivering an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 , or consisting of a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said sequence of SEQ ID NO: 1 , to cells of the retinal pigment epithelium of said primate, wherein said isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for said exogenous gene is operatively linked to said isolated nucleic acid molecule.
  • the isolated nucleic acid molecule can further comprise, operatively linked to said isolated nucleic acid molecule, a minimal promoter, e.g. the minimal promoter of SEQ ID NO:2.
  • a minimal promoter e.g. the minimal promoter of SEQ ID NO:2.
  • the isolated nucleic acid molecule can be part of an expression cassette, which in turn can be part of a vector, for instance a viral vector.
  • the present invention also provides the use of an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 , or consisting of a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said sequence of SEQ ID NO: 1 , wherein said isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for said exogenous gene is operatively linked to said isolated nucleic acid molecule, to express an exogenous gene specifically in cells of the retinal pigment epithelium of a primate.
  • the isolated nucleic acid molecule can further comprise a minimal promoter, e.g. the minimal promoter of SEQ ID NO:2.
  • the isolated nucleic acid molecule can be part of an expression cassette, which can be part of a vector, e.g. a viral vector.
  • the present invention further provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 , or consisting of a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said sequence of SEQ ID NO: 1 , wherein said isolated nucleic acid molecule specifically leads to the expression of an exogenous gene in cells of the retinal pigment epithelium of primates when a nucleic acid sequence coding for said exogenous gene is operatively linked to said isolated nucleic acid molecule, for use in treating a disease associated with retinal pigment epithelium.
  • the disease associated with retinal pigment epithelium can be selected from the group consisting of age-related macular degeneration, retinitis pigmentosa, diabetic retinopathy and retinal pigment epithelium hypertrophy.
  • the isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence of at least 1500 bp having at least 80% overall identity to said nucleic acid sequence of SEQ ID NO: 1 , wherein said isolated nucleic acid molecule specifically leads to the expression in cells of the retinal pigment epithelium of primates of a gene operatively linked to said nucleic acid sequence coding for said gene can be at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 80 % identity to said nucleic acid sequence of SEQ ID NO:1 .
  • the nucleic acid sequence is 1500bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 85 % overall identity to said nucleic acid sequence of SEQ ID NO: 1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 90 % overall identity to said nucleic acid sequence of SEQ ID NO:1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 95 % overall identity to said nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 96 % overall identity to said nucleic acid sequence of SEQ ID NO: 1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 97 % overall identity to said nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 98 % overall identity to said nucleic acid sequence of SEQ ID NO: 1. In some
  • the nucleic acid sequence at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has at least 99 % overall identity to said nucleic acid sequence of SEQ ID NO: 1.
  • the nucleic acid sequence is at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp, and has 100 % overall identity to said nucleic acid sequence of SEQ ID NO:1.
  • the isolated nucleic acid molecule of the invention can comprise a minimal promoter, for instance a SV40 minimal promoter, e.g. the SV40 minimal promoter
  • GCT CG AG AT CT GCG AT CTGCAT CT CAATT AGT CAGCAACCAT AGT CCCGCCCCT AACT CCGC CCAT CCCGCCCCTAACT CCGCCCAGTT CCGCCCATT CT CCGCCCCAT CGCT GACTAATTTTT TTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAG GCTTTTTTGGAGGCCTAGGCTTTTGCAAA (SEQ ID NO:2), preferably operatively linked to said isolated nucleic acid molecule.
  • a typical gene which can be operatively linked to the promoter of the invention is a gene encoding for a photoreceptor.
  • a photoreceptor For instance it can be a photosensitive molecule such as a channelrhodopsin or a halorhodopsin.
  • Expression of exogeneous genes using the promoter of the invention can be done in vitro, in vivo or ex vivo.
  • promoter refers to any cis-regulatory elements, including enhancers, silencers, insulators and promoters.
  • a promoter is a region of DNA that is generally located upstream (towards the 5' region) of the gene that is needed to be transcribed. The promoter permits the proper activation or repression of the gene which it controls. In the context of the present invention, the promoters lead to the specific expression of genes operably linked to them in the interneurons.
  • “Specific expression”, also referred to as“expression only in a certain type of cell” means that at least more than 75% of the cells expressing the gene of interest are of the type specified, i.e. cells of the retinal pigment epithelium (RPE) in the present case.
  • RPE retinal pigment epithelium
  • the pigmented layer of retina or retinal pigment epithelium is the pigmented cell layer just outside the neurosensory retina that nourishes retinal visual cells, and is firmly attached to the underlying choroid and overlying retinal visual cells.
  • the RPE is composed of a single layer of hexagonal cells that are densely packed with pigment granules.
  • the RPE continues as a membrane passing over the ciliary body and continuing as the back surface of the iris. This generates the fibers of the dilator.
  • the neuroepithelium i.e., rods and cones
  • each cell consists of an outer non-pigmented part containing a large oval nucleus and an inner pigmented portion which extends as a series of straight thread-like processes between the rods, this being especially the case when the eye is exposed to light.
  • the RPE has several functions, namely, light absorption, epithelial transport, spatial ion buffering, visual cycle, phagocytosis, secretion and immune modulation.
  • Expression cassettes are typically introduced into a vector that facilitates entry of the expression cassette into a host cell and maintenance of the expression cassette in the host cell.
  • vectors are commonly used and are well known to those of skill in the art. Numerous such vectors are commercially available, e. g., from Invitrogen, Stratagene, Clontech, etc., and are described in numerous guides, such as Ausubel, Guthrie, Strathem, or Berger, all supra.
  • Such vectors typically include promoters, polyadenylation signals, etc. in conjunction with multiple cloning sites, as well as additional elements such as origins of replication, selectable marker genes (e. g.,
  • Viral vectors for instance an AAV, a PRV or a lentivirus, are suitable to target and deliver genes to cells of the retinal pigment epithelium using a promoter of the invention.
  • the output of retinal cells can be measured using an electrical method, such as a multi-electrode array or a patch-clamp, or using a visual method, such as the detection of fluorescence.
  • an electrical method such as a multi-electrode array or a patch-clamp
  • a visual method such as the detection of fluorescence.
  • the methods using nucleic acid sequence of the invention can be used for identifying therapeutic agents for the treatment of a neurological disorder or of a disorder of the retina involving cells of the RPE, said method comprising the steps of contacting a test compound with retinal pigment epithelium cells expressing one or more transgene under a promoter of the invention, and comparing at least one output of retinal pigment epithelium cells obtained in the presence of said test compound with the same output obtained in the absence of said test compound.
  • the methods using promoters of the invention can also be used for in vitro testing of vision restoration, said method comprising the steps of contacting retinal pigment epithelium cells expressing one or more transgene under the control of a promoter of the invention with an agent, and comparing at least one output obtained after the contact with said agent with the same output obtained before said contact with said agent.
  • Channelrhodopsins are a subfamily of opsin proteins that function as light-gated ion channels. They serve as sensory photoreceptors in unicellular green algae, controlling phototaxis, i.e. movement in response to light. Expressed in cells of other organisms, they enable the use of light to control intracellular acidity, calcium influx, electrical excitability, and other cellular processes. At least three“natural” channelrhodopsins are currently known: Channelrhodopsin-1 (ChR1 ), Channelrhodopsin-2 (ChR2), and Volvox Channelrhodopsin (VChR1 ). Moreover, some modified/improved versions of these proteins also exist. All known Channelrhodopsins are unspecific cation channels, conducting H+, Na+, K+, and Ca2+ ions.
  • Halorhodopsin is a light-driven ion pump, specific for chloride ions, and found in phylogenetically ancient“bacteria” (archaea), known as halobacteria. It is a seven-transmembrane protein of the retinylidene protein family, homologous to the light-driven proton pump bacteriorhodopsin, and similar in tertiary structure (but not primary sequence structure) to vertebrate rhodopsins, the pigments that sense light in the retina. Halorhodopsin also shares sequence similarity to channelrhodopsin, a light-driven ion channel.
  • Halorhodopsin contains the essential light- isomerizable vitamin A derivative all-trans-retinal.
  • Halorhodopsin is one of the few membrane proteins whose crystal structure is known. Halorhodopsin isoforms can be found in multiple species of halobacteria, including H. salinarum, and N. pharaonis. Much ongoing research is exploring these differences, and using them to parse apart the photocycle and pump properties. After bacteriorhodopsin, halorhodopsin may be the best type I (microbial) opsin studied. Peak absorbance of the halorhodopsin retinal complex is about 570 nm. Recently, halorhodopsin has become a tool in optogenetics.
  • halorhodopsin opens up the ability to silence excitable cells with brief pulses of yellow light.
  • halorhodopsin and channelrhodopsin together enable multiple-color optical activation, silencing, and desynchronization of neural activity, creating a powerful neuroengineering toolbox.
  • the promoter is part of a vector targeted a retina, said vector expressing at least one reporter gene which is detectable in living retinal pigment epithelium cells.
  • reporter genes can be indicative of a functioning neural circuit.
  • Examples of such vectors are activity sensors or rainbow viruses ( Nature Methods 6, 127 - 130 (2009)).
  • Examples of such viruses are retrograde, transsynaptic pseudorabies viruses (PRVs) with genetically encoded activity sensors that optically report the activity of connected neurons among spatially intermingled neurons in the brain.
  • PRVs transsynaptic pseudorabies viruses
  • Such activity sensor can be an isolated transsynaptic virus expressing an exogenous fluorescent activity sensor.
  • the transsynaptic virus can be a rhabdovirus, e.g. rabies virus, or a herpesvirus, for instance an alphaherpesvirus, e.g.
  • the fluorescent exogenous activity sensor can be a fluorescent protein Ca 2+ sensor, e.g. yellow cameleon, camgaroo, G-CaMP/Pericam, or TN-L15, or a fluorescent protein voltage sensor, e.g. FlaSh, SPARC, or a VSP, preferably VSP1.
  • a fluorescent protein Ca 2+ sensor e.g. yellow cameleon, camgaroo, G-CaMP/Pericam, or TN-L15
  • a fluorescent protein voltage sensor e.g. FlaSh, SPARC, or a VSP, preferably VSP1.
  • Suitable viral vectors for the invention are well-known in the art.
  • an AAV, a PRV or a lentivirus are suitable to target and deliver genes to retinal pigment epithelium cells.
  • optimal viral delivery for photoreceptors can be achieved by mounting the ganglion cell side downwards, so that the photoreceptor side of the retina is exposed and can thus be better transfected.
  • Another technique is slicing, e.g. with a razor blade, the inner limiting membrane of the retina, such that the delivering viruses can penetrate the inner membranes.
  • a further way is to embed the retina in agar, slicing said retina and applying the delivery viruses from the side of the slice.
  • the output of transfected cells can be measured using well-known methods, for instance using an electrical method, such as a multi-electrode array or a patch-clamp, or using a visual method, such as the detection of fluorescence.
  • an electrical method such as a multi-electrode array or a patch-clamp
  • a visual method such as the detection of fluorescence.
  • the inner limiting membrane is removed by micro-surgery the inner limiting membrane.
  • recording is achieved through slices performed to the inner limiting membrane.
  • the source of retinal cells to be used for the present invention is a primate.
  • the retinal cells come from, or are in, a human retina.
  • the retina is from another primate from any of the two distinct lineages, strepsirrhines and haplorhines.
  • Human retina can be easily obtained from cornea banks where said retinas are normally discarded after the dissection of the cornea.
  • Adult human retina has a large surface (about 1 100 mm 2 ) and can therefore be easily separated to a number of experimentally subregions.
  • retinas can also be used as an extraordinarily, a large surface for synaptic
  • the term "animal” is used herein to include all animals.
  • the non-human animal is a vertebrate. Examples of animals are human, mice, rats, cows, pigs, horses, chickens, ducks, geese, cats, dogs, etc.
  • the term “animal” also includes an individual animal in all stages of development, including embryonic and fetal stages.
  • a "genetically-modified animal” is any animal containing one or more cells bearing genetic information altered or received, directly or indirectly, by deliberate genetic manipulation at a sub-cellular level, such as by targeted recombination, microinjection or infection with recombinant virus.
  • genetically-modified animal is not intended to encompass classical crossbreeding or in vitro fertilization, but rather is meant to encompass animals in which one or more cells are altered by, or receive, a recombinant DNA molecule.
  • This recombinant DNA molecule may be specifically targeted to a defined genetic locus, may be randomly integrated within a chromosome, or it may be extrachromosomally replicating DNA.
  • the term "germ-line genetically-modified animal” refers to a genetically-modified animal in which the genetic alteration or genetic information was introduced into germline cells, thereby conferring the ability to transfer the genetic information to its offspring. If such offspring in fact possess some or all of that alteration or genetic information, they are genetically-modified animals as well.
  • the alteration or genetic information may be foreign to the species of animal to which the recipient belongs, or foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient.
  • the altered or introduced gene may be expressed differently than the native gene, or not expressed at all.
  • genes used for altering a target gene may be obtained by a wide variety of techniques that include, but are not limited to, isolation from genomic sources, preparation of cDNAs from isolated mRNA templates, direct synthesis, or a combination thereof.
  • ES cells A type of target cells for transgene introduction is the ES cells.
  • ES cells may be obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans et al. (1981 ), Nature 292:154-156; Bradley et al. (1984), Nature 309:255-258; Gossler et al. (1986), Proc. Natl. Acad. Sci. USA 83:9065-9069; Robertson et al. (1986), Nature 322:445-448; Wood et al. (1993), Proc. Natl. Acad. Sci. USA 90:4582- 4584).
  • Transgenes can be efficiently introduced into the ES cells by standard techniques such as DNA transfection using electroporation or by retrovirus-mediated transduction.
  • the resultant transformed ES cells can thereafter be combined with morulas by aggregation or injected into blastocysts from a non-human animal.
  • the introduced ES cells thereafter colonize the embryo and contribute to the germline of the resulting chimeric animal (Jaenisch (1988), Science 240:1468-1474).
  • the use of gene-targeted ES cells in the generation of gene-targeted genetically-modified mice was described 1987 (Thomas et al. (1987), Cell 51 :503-512) and is reviewed elsewhere (Frohman et al.
  • a "targeted gene” is a DNA sequence introduced into the germline of a nonhuman animal by way of human intervention, including but not limited to, the methods described herein.
  • the targeted genes of the invention include DNA sequences which are designed to specifically alter cognate endogenous alleles.
  • isolated refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered “by the hand of man” from its natural state.
  • an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the
  • isolated does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide/sequences of the present invention.
  • isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • a nucleic acid contained in a clone that is a member of a library e.g., a genomic or cDNA library
  • a chromosome removed from a cell or a cell lysate e.g. , a "chromosome spread", as in a karyotype
  • isolated nucleic acid molecules according to the present invention may be produced naturally, recombinantly, or synthetically.
  • Polynucleotides can be composed of single-and double-stranded DNA, DNA that is a mixture of single-and double-stranded regions, single-and double-stranded RNA, and RNA that is mixture of single-and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single-and double-stranded regions.
  • polynucleotides can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. Polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • Stringent hybridization conditions refers to an overnight incubation at 42 degree C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 pg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 50 degree C. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC). Variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments.
  • Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • fragment when referring to polypeptides means polypeptides which either retain substantially the same biological function or activity as such polypeptides.
  • An analog includes a pro-protein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region “leader and trailer” as well as intervening sequences (introns) between individual coding segments (exons).
  • Polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene- encoded amino acids.
  • the polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide.
  • polypeptides may contain many types of modifications.
  • Polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods.
  • Modifications include, but are not limited to, acetylation, acylation, biotinylation, ADP- ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, denivatization by known protecting/blocking groups, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, linkage to an antibody molecule or other cellular ligand, methylation, myristoylation, oxidation, pegylation, proteolytic processing (e.g., cleavage), phosphorylation, preny
  • a polypeptide fragment "having biological activity” refers to polypeptides exhibiting activity similar, but not necessarily identical to, an activity of the original polypeptide, including mature forms, as measured in a particular biological assay, with or without dose dependency. In the case where dose dependency does exist, it need not be identical to that of the polypeptide, but rather substantially similar to the dose-dependence in a given activity as compared to the original polypeptide (i.e. , the candidate polypeptide will exhibit greater activity or not more than about 25- fold less and, in some embodiments,, not more than about tenfold less activity, or not more than about three-fold less activity relative to the original polypeptide.)
  • Species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source for the desired homologue.
  • Variant refers to a polynucleotide or polypeptide differing from the original polynucleotide or polypeptide, but retaining essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the original polynucleotide or polypeptide.
  • nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a nucleotide sequence of the present invention can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence aligmnent can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Blosci. (1990) 6:237-245). In a sequence alignment the query and subject sequences are both DNA sequences.
  • RNA sequence can be compared by converting U's to T's.
  • the result of said global sequence alignment is in percent identity.
  • the FASTDB program does not account for 5' and 3' truncations of the subject sequence when calculating percent identity.
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention.
  • a 90 base subject sequence is compared with a 100 base query sequence.
  • the deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • overall identity refers only to the portions of a sequence which have at least some degrees of similarities with the sequence of e.g. SEQ ID NO:1.
  • sequence identity of a 2000bp query sequence would only be calculated for the part of the sequence comprising SEQ ID NO:1 or a very similar part thereof.
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, or substituted with another amino acid.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, or 100% identical to, for instance, the amino acid sequences shown in a sequence or to the amino acid sequence encoded by deposited DNA clone can be determined conventionally using known computer programs.
  • a preferred method for determining, the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245).
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is in percent identity.
  • the FASTDB program does not account for N-and C-terminal truncations of the subject sequence when calculating global percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N-and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This final percent identity score is what is used for the purposes of the present invention. Only residues to the N-and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N-and C-terminal residues of the subject sequence. Only residue positions outside the N-and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to be made for the purposes of the present invention.
  • Naturally occurring protein variants are called "allelic variants," and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. (Genes 11 , Lewin, B., ed., John Wiley & Sons, New York (1985).) These allelic variants can vary at either the polynucleotide and/or polypeptide level. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.
  • Label refers to agents that are capable of providing a detectable signal, either directly or through interaction with one or more additional members of a signal producing system. Labels that are directly detectable and may find use in the invention include fluorescent labels. Specific fluorophores include fluorescein, rhodamine, BODIPY, cyanine dyes and the like.
  • fluorescent label refers to any label with the ability to emit light of a certain wavelength when activated by light of another wavelength.
  • Fluorescence refers to any detectable characteristic of a fluorescent signal, including intensity, spectrum, wavelength, intracellular distribution, etc.
  • Detecting fluorescence refers to assessing the fluorescence of a cell using qualitative or quantitative methods. In some of the embodiments of the present invention, fluorescence will be detected in a qualitative manner. In other words, either the fluorescent marker is present, indicating that the recombinant fusion protein is expressed, or not.
  • the fluorescence can be determined using quantitative means, e. g., measuring the fluorescence intensity, spectrum, or intracellular distribution, allowing the statistical comparison of values obtained under different conditions. The level can also be determined using qualitative methods, such as the visual analysis and comparison by a human of multiple samples, e. g., samples detected using a fluorescent microscope or other optical detector (e. g., image analysis system, etc.).
  • An "alteration” or “modulation” in fluorescence refers to any detectable difference in the intensity, intracellular distribution, spectrum, wavelength, or other aspect of fluorescence under a particular condition as compared to another condition. For example, an "alteration" or
  • modulation is detected quantitatively, and the difference is a statistically significant difference. Any “alterations” or “modulations” in fluorescence can be detected using standard
  • instrumentation such as a fluorescent microscope, CCD, or any other fluorescent detector
  • an automated system such as the integrated systems, or can reflect a subjective detection of an alteration by a human observer.
  • The“green fluorescent protein” is a protein, composed of 238 amino acids (26.9 kDa), originally isolated from the jellyfish Aequorea victorialAequorea aequoreal Aequorea forskalea that fluoresces green when exposed to blue light.
  • the GFP from A. victoria has a major excitation peak at a wavelength of 395 nm and a minor one at 475 nm. Its emission peak is at 509 nm which is in the lower green portion of the visible spectrum.
  • the GFP from the sea pansy Renilla reniformis
  • The“yellow fluorescent protein” (YFP) is a genetic mutant of green fluorescent protein, derived from Aequorea victoria. Its excitation peak is 514nm and its emission peak is 527nm.
  • A“virus” is a sub-microscopic infectious agent that is unable to grow or reproduce outside a host cell.
  • Each viral particle, or virion consists of genetic material, DNA or RNA, within a protective protein coat called a capsid.
  • the capsid shape varies from simple helical and icosahedral (polyhedral or near-spherical) forms, to more complex structures with tails or an envelope.
  • Viruses infect cellular life forms and are grouped into animal, plant and bacterial types, according to the type of host infected.
  • transsynaptic virus refers to viruses able to migrate from one neurone to another connecting neurone through a synapse.
  • transsynaptic virus examples include rhabodiviruses, e.g. rabies virus, and alphaherpesviruses, e.g. pseudorabies or herpes simplex virus.
  • transsynaptic virus as used herein also encompasses viral sub-units having by themselves the capacity to migrate from one neurone to another connecting neurone through a synapse and biological vectors, such as modified viruses, incorporating such a sub-unit and demonstrating a capability of migrating from one neurone to another connecting neurone through a synapse.
  • Transsynaptic migration can be either anterograde or retrograde.
  • a virus will travel from a postsynaptic neuron to a presynaptic one. Accordingly, during anterograde migration, a virus will travel from a presynaptic neuron to a postsynaptic one.
  • Homologs refer to proteins that share a common ancestor. Analogs do not share a common ancestor, but have some functional (rather than structural) similarity that causes them to be included in a class (e.g. trypsin like serine proteinases and subtilisin's are clearly not related - their structures outside the active site are completely different, but they have virtually geometrically identical active sites and thus are considered an example of convergent evolution to analogs).
  • Orthologs are the same gene (e.g. cytochome 'c'), in different species. Two genes in the same organism cannot be orthologs. Paralogs are the results of gene duplication (e.g. hemoglobin beta and delta). If two
  • genes/proteins are homologous and in the same organism, they are paralogs.
  • disorder refers to an ailment, disease, illness, clinical condition, or pathological condition.
  • the term "pharmaceutically acceptable carrier” refers to a carrier medium that does not interfere with the effectiveness of the biological activity of the active ingredient, is chemically inert, and is not toxic to the patient to whom it is administered.
  • pharmaceutically acceptable derivative refers to any homolog, analog, or fragment of an agent, e.g. identified using a method of screening of the invention, that is relatively non-toxic to the subject.
  • therapeutic agent refers to any molecule, compound, or treatment, that assists in the prevention or treatment of disorders, or complications of disorders.
  • compositions comprising such an agent formulated in a compatible pharmaceutical carrier may be prepared, packaged, and labeled for treatment.
  • the complex is water-soluble, then it may be formulated in an appropriate buffer, for example, phosphate buffered saline or other physiologically compatible solutions.
  • an appropriate buffer for example, phosphate buffered saline or other physiologically compatible solutions.
  • the resulting complex may be formulated with a non-ionic surfactant such as Tween, or polyethylene glycol.
  • a non-ionic surfactant such as Tween, or polyethylene glycol.
  • the compounds and their physiologically acceptable solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral, rectal administration or, in the case of tumors, directly injected into a solid tumor.
  • the pharmaceutical preparation may be in liquid form, for example, solutions, syrups or suspensions, or may be presented as a drug product for reconstitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.
  • compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e. g., pregelatinized maize starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose); fillers (e.
  • the tablets may be coated by methods well-known in the art.
  • Preparations for oral administration may be suitably formulated to give controlled release of the active compound.
  • the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e. g., dichlorodifluoromethane,
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e. g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the compounds may be formulated for parenteral administration by injection, e. g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e. g., in ampoules or in multi-dose containers, with an added preservative.
  • compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e. g., sterile pyrogen-free water, before use.
  • a suitable vehicle e. g., sterile pyrogen-free water
  • the compounds may also be formulated as a topical application, such as a cream or lotion.
  • the compounds may also be formulated as a depot preparation.
  • Such long acting formulations may be administered by implantation (for example, intraocular, subcutaneous or intramuscular) or by intraocular injection.
  • the compounds may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • suitable polymeric or hydrophobic materials for example, as an emulsion in an acceptable oil
  • ion exchange resins for example, as an emulsion in an acceptable oil
  • sparingly soluble derivatives for example, as a sparingly soluble salt.
  • Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophilic drugs.
  • compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • kits for carrying out the therapeutic regimens of the invention comprise in one or more containers therapeutically or prophylactically effective amounts of the compositions in pharmaceutically acceptable form.
  • composition in a vial of a kit may be in the form of a pharmaceutically acceptable solution, e. g., in combination with sterile saline, dextrose solution, or buffered solution, or other
  • the complex may be lyophilized or desiccated; in this instance, the kit optionally further comprises in a container a pharmaceutically acceptable solution (e. g., saline, dextrose solution, etc.), preferably sterile, to reconstitute the complex to form a solution for injection purposes.
  • a pharmaceutically acceptable solution e. g., saline, dextrose solution, etc.
  • kits further comprises a needle or syringe, preferably packaged in sterile form, for injecting the complex, and/or a packaged alcohol pad. Instructions are optionally included for administration of compositions by a clinician or by the patient.
  • the synthetic promoter used in this study (SEQ ID NO:1 ) consists of 2000 bp before the translation start codon of the mouse gene encoding the retinal G protein coupled receptor (Rgr). ChR2-eGFP coding sequence was inserted immediately after this promoters and the optimized Kozak sequence (GCCACC), and followed by a woodchuck hepatitis virus posttranscriptional regulatory element ( WPRE ) and SV40 polyadenylation site.
  • Non-human primate retinal neurons were targeted using AAVs serotype BP2 with a titer of 1.56E+13 GC/mL.
  • the AAV administration was performed in collaboration with an ophthalmologist and a third party contractor in Kunming, China.
  • the rhesus monkeys were anaesthetized with ketamine and phenobarbital sodium.
  • Two puncture tunnels were created using a 25-gauge puncture needle, which were localized at the nasal and the temporal sclera region, respectively.
  • An illumination fiber was injected into the vitreous chamber through one tunnel, and 50mI of AAV was injected subretinally using a 30-gauge needle mounted on Hamilton syringe through the second tunnel. After 3 months, the isolated retinas were fixed for 30 min in 4% PFA in PBS, followed by a washing step in PBS at 4°C.
  • Sections were washed, mounted with ProLong Gold antifade reagent (Molecular Probes Inc.) on glass slides, and photographed using a Zeiss LSM 700 Axio Imager Z2 laser scanning confocal microscope (Carl Zeiss Inc.).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Ophthalmology & Optometry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Neurology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/EP2018/082872 2017-11-30 2018-11-28 SynP61, A PRIMATE RETINAL PIGMENT EPITHELIUM CELL-SPECIFIC PROMOTER Ceased WO2019106027A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
CR20200235A CR20200235A (es) 2017-11-30 2018-11-28 Synp61, un promotor específico de células del epitelio pigmentario retiniano de primates
CN201880084798.9A CN111527102A (zh) 2017-11-30 2018-11-28 灵长类动物视网膜色素上皮细胞特异性启动子SynP61
AU2018376544A AU2018376544B2 (en) 2017-11-30 2018-11-28 SynP61, a primate retinal pigment epithelium cell-specific promoter
RU2020121390A RU2020121390A (ru) 2017-11-30 2018-11-28 SynP61, ПРОМОТОР, СПЕЦИФИЧЕСКИЙ В ОТНОШЕНИИ КЛЕТОК ПИГМЕНТНОГО ЭПИТЕЛИЯ СЕТЧАТКИ ПРИМАТОВ
KR1020207018368A KR20200091435A (ko) 2017-11-30 2018-11-28 영장류 망막 색소 상피 세포-특이적 프로모터 SynP61
SG11202005002QA SG11202005002QA (en) 2017-11-30 2018-11-28 SynP61, A PRIMATE RETINAL PIGMENT EPITHELIUM CELL-SPECIFIC PROMOTER
EP18833620.0A EP3717509A1 (en) 2017-11-30 2018-11-28 SynP61, A PRIMATE RETINAL PIGMENT EPITHELIUM CELL-SPECIFIC PROMOTER
US16/768,055 US20230193314A1 (en) 2017-11-30 2018-11-28 SynP61, A PRIMATE RETINAL PIGMENT EPITHELIUM CELL-SPECIFIC PROMOTER
MX2020005648A MX2020005648A (es) 2017-11-30 2018-11-28 Synp61, un promotor especifico de celulas del epitelio pigmentario retiniano de primates.
BR112020010775-1A BR112020010775A2 (pt) 2017-11-30 2018-11-28 synp61, promotor específico à célula de epitélio de pigmento retiniano de primata
CA3083404A CA3083404A1 (en) 2017-11-30 2018-11-28 Synp61, a primate retinal pigment epithelium cell-specific promoter
JP2020529473A JP7390290B2 (ja) 2017-11-30 2018-11-28 霊長類網膜色素上皮細胞特異的プロモーターSynP61
IL274885A IL274885A (en) 2017-11-30 2020-05-24 SynP61, a retinal pigment specific promoter in a primate epithelial cell
PH12020550766A PH12020550766A1 (en) 2017-11-30 2020-05-28 Synp61, a primate retinal pigment epithelium cell-specific promoter

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17204746.6 2017-11-30
EP17204746 2017-11-30

Publications (1)

Publication Number Publication Date
WO2019106027A1 true WO2019106027A1 (en) 2019-06-06

Family

ID=60543414

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/082872 Ceased WO2019106027A1 (en) 2017-11-30 2018-11-28 SynP61, A PRIMATE RETINAL PIGMENT EPITHELIUM CELL-SPECIFIC PROMOTER

Country Status (15)

Country Link
US (1) US20230193314A1 (https=)
EP (1) EP3717509A1 (https=)
JP (1) JP7390290B2 (https=)
KR (1) KR20200091435A (https=)
CN (1) CN111527102A (https=)
AU (1) AU2018376544B2 (https=)
BR (1) BR112020010775A2 (https=)
CA (1) CA3083404A1 (https=)
CR (1) CR20200235A (https=)
IL (1) IL274885A (https=)
MX (1) MX2020005648A (https=)
PH (1) PH12020550766A1 (https=)
RU (1) RU2020121390A (https=)
SG (1) SG11202005002QA (https=)
WO (1) WO2019106027A1 (https=)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020174369A3 (en) * 2019-02-25 2020-11-12 Novartis Ag Compositions and methods to treat bietti crystalline dystrophy
US10857241B2 (en) 2015-09-15 2020-12-08 Friedrich Miescher Institute For Biomedical Research Therapeutical tools and methods for treating blindness by targeting photoreceptors
US10898586B2 (en) 2015-12-03 2021-01-26 Friedrich Miescher Institute For Biomedical Research SynP161, a promoter for the specific expression of genes in rod photoreceptors
US10941417B2 (en) 2015-04-30 2021-03-09 Friedrich Miescher Institute For Biomedical Research Promoter for the specific expression of genes in Müller cells
US10987404B2 (en) 2006-07-04 2021-04-27 Friedrich Miescher Institute For Biomedical Research Therapeutical tools and methods for treating blindness
US10995344B2 (en) 2015-12-03 2021-05-04 Friedrich Miescher Institute For Biomedical Research SYNP159, a promoter for the specific expression of genes in rod photoreceptors
US10994026B2 (en) 2015-12-03 2021-05-04 Friedrich Miescher Institute For Biomedical Research SynP160, a promoter for the specific expression of genes in rod photoreceptors
US11059871B2 (en) 2015-12-03 2021-07-13 Friedrich Miescher Institute For Biomedical Research SYNP162, a promoter for the specific expression of genes in rod photoreceptors
US11254934B2 (en) 2015-10-14 2022-02-22 Friedrich Miescher Institute For Biomedical Research Promoter for the specific expression of genes in retinal endothelial cells
US11371060B2 (en) 2017-02-08 2022-06-28 Friedrich Miescher Institute For Biomedical Research SYNP88, a promoter for the specific expression of genes in retinal ganglion cells
US11525145B2 (en) 2016-11-02 2022-12-13 Friedrich Miescher Institute For Biomedical Research SynP198, a promoter for the specific expression of genes in direction selective retinal ganglion cells
US11591615B2 (en) 2017-11-30 2023-02-28 Friedrich Miescher Institute For Biomedical Research SynPIII, a promoter for the specific expression of genes in retinal pigment epithelium
US11739349B2 (en) 2017-11-15 2023-08-29 Friedrich Miescher Institute For Biomedical Research Primate retinal pigment epithelium cell-specific promoter

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015121793A1 (en) 2014-02-11 2015-08-20 Friedrich Miescher Institute For Biomedical Research Müller cell-specific promoter

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7309487B2 (en) * 2004-02-09 2007-12-18 George Inana Methods and compositions for detecting and treating retinal diseases
MX2020005033A (es) * 2017-11-15 2020-10-28 Friedrich Miescher Institute For Biomedical Res Promotor especifico de las celulas del epitelio pigmentario retinal en primates.

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015121793A1 (en) 2014-02-11 2015-08-20 Friedrich Miescher Institute For Biomedical Research Müller cell-specific promoter

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
"POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS", 1983, ACADEMIC PRESS, pages: 1 - 12
BARIBAULT ET AL., MOL. BIOL. MED., vol. 6, 1989, pages 481 - 492
BRADLEY ET AL., BIO/TECHNOLOGY, vol. 10, 1992, pages 534 - 539
BRADLEY ET AL., NATURE, vol. 309, 1984, pages 255 - 258
BRUTLAG ET AL., COMP. APP. BIOSCI., vol. 6, 1990, pages 237 - 245
BRUTLAG ET AL., COMP. APP. BLOSCI., vol. 6, 1990, pages 237 - 245
CAPECCHI, TRENDS IN GENET, vol. 5, 1989, pages 70 - 76
COUGHLIN BRANDON A ET AL: "Müller cells and diabetic retinopathy", VISION RESEARCH, PERGAMON PRESS, OXFORD, GB, vol. 139, 5 September 2017 (2017-09-05), pages 93 - 100, XP085290738, ISSN: 0042-6989, DOI: 10.1016/J.VISRES.2017.03.013 *
EVANS ET AL., NATURE, vol. 292, 1981, pages 154 - 156
FROHMAN ET AL., CELL, vol. 56, 1989, pages 145 - 147
GOSSLER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 9065 - 9069
JAENISCH, SCIENCE, vol. 240, 1988, pages 1468 - 1474
LAURA FERNÁNDEZ-SÁNCHEZ ET AL: "Astrocytes and Müller Cell Alterations During Retinal Degeneration in a Transgenic Rat Model of Retinitis Pigmentosa", FRONTIERS IN CELLULAR NEUROSCIENCE, vol. 9, 22 December 2015 (2015-12-22), CH, XP055461805, ISSN: 1662-5102, DOI: 10.3389/fncel.2015.00484 *
NATURE METHODS, vol. 6, 2009, pages 127 - 130
RATTAN ET AL., ANN NY ACAD SCI, vol. 663, 1992, pages 48 - 62
ROBERTSON ET AL., NATURE, vol. 322, 1986, pages 445 - 448
SEIFTER ET AL., METH ENZYMOL, vol. 182, 1990, pages 626 - 646
SOO-YOUNG KIM: "Retinal phagocytes in age-related macular degeneration", MACROPHAGE, 30 March 2015 (2015-03-30), XP055461798, DOI: 10.14800/macrophage.698 *
T. E. CREIGHTON: "PROTEINS-STRUCTURE AND MOLECULAR PROPERTIES", 1993, W. H. FREEMAN AND COMPANY
THOMAS ET AL., CELL, vol. 51, 1987, pages 503 - 512
WAGNER, EMBO J., vol. 9, 1990, pages 3025 - 3032
WOOD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 4582 - 4584

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10987404B2 (en) 2006-07-04 2021-04-27 Friedrich Miescher Institute For Biomedical Research Therapeutical tools and methods for treating blindness
US10941417B2 (en) 2015-04-30 2021-03-09 Friedrich Miescher Institute For Biomedical Research Promoter for the specific expression of genes in Müller cells
US10857241B2 (en) 2015-09-15 2020-12-08 Friedrich Miescher Institute For Biomedical Research Therapeutical tools and methods for treating blindness by targeting photoreceptors
US11931427B2 (en) 2015-09-15 2024-03-19 Friedrich Miescher Institute For Biomedical Research Therapeutical tools and methods for treating blindness by targeting photoreceptors
US11254934B2 (en) 2015-10-14 2022-02-22 Friedrich Miescher Institute For Biomedical Research Promoter for the specific expression of genes in retinal endothelial cells
US11857642B2 (en) 2015-12-03 2024-01-02 Friedrich Miescher Institute For Biomedical Research SYNP161, a promoter for the expression of genes
US10994026B2 (en) 2015-12-03 2021-05-04 Friedrich Miescher Institute For Biomedical Research SynP160, a promoter for the specific expression of genes in rod photoreceptors
US11059871B2 (en) 2015-12-03 2021-07-13 Friedrich Miescher Institute For Biomedical Research SYNP162, a promoter for the specific expression of genes in rod photoreceptors
US10898586B2 (en) 2015-12-03 2021-01-26 Friedrich Miescher Institute For Biomedical Research SynP161, a promoter for the specific expression of genes in rod photoreceptors
US11591618B2 (en) 2015-12-03 2023-02-28 Friedrich Miescher Institute For Biomedical Research SynP159, a promoter for the expression of genes
US11883507B2 (en) 2015-12-03 2024-01-30 Friedrich Miescher Institute For Biomedical Research Expression cassette with a SynP160 promoter
US11608365B2 (en) 2015-12-03 2023-03-21 Friedrich Miescher Institute For Biomedical Research SYNP162, a promoter for the expression of genes
US10995344B2 (en) 2015-12-03 2021-05-04 Friedrich Miescher Institute For Biomedical Research SYNP159, a promoter for the specific expression of genes in rod photoreceptors
US11525145B2 (en) 2016-11-02 2022-12-13 Friedrich Miescher Institute For Biomedical Research SynP198, a promoter for the specific expression of genes in direction selective retinal ganglion cells
US11371060B2 (en) 2017-02-08 2022-06-28 Friedrich Miescher Institute For Biomedical Research SYNP88, a promoter for the specific expression of genes in retinal ganglion cells
US11739349B2 (en) 2017-11-15 2023-08-29 Friedrich Miescher Institute For Biomedical Research Primate retinal pigment epithelium cell-specific promoter
US11591615B2 (en) 2017-11-30 2023-02-28 Friedrich Miescher Institute For Biomedical Research SynPIII, a promoter for the specific expression of genes in retinal pigment epithelium
WO2020174369A3 (en) * 2019-02-25 2020-11-12 Novartis Ag Compositions and methods to treat bietti crystalline dystrophy

Also Published As

Publication number Publication date
US20230193314A1 (en) 2023-06-22
CR20200235A (es) 2020-10-19
RU2020121390A (ru) 2021-12-30
BR112020010775A2 (pt) 2020-11-24
CA3083404A1 (en) 2019-06-06
SG11202005002QA (en) 2020-06-29
MX2020005648A (es) 2020-10-14
JP2021503933A (ja) 2021-02-15
AU2018376544B2 (en) 2022-06-16
IL274885A (en) 2020-07-30
RU2020121390A3 (https=) 2022-02-03
EP3717509A1 (en) 2020-10-07
AU2018376544A1 (en) 2020-06-11
JP7390290B2 (ja) 2023-12-01
PH12020550766A1 (en) 2021-05-10
CN111527102A (zh) 2020-08-11
KR20200091435A (ko) 2020-07-30

Similar Documents

Publication Publication Date Title
US11739349B2 (en) Primate retinal pigment epithelium cell-specific promoter
AU2018376544B2 (en) SynP61, a primate retinal pigment epithelium cell-specific promoter
US11591615B2 (en) SynPIII, a promoter for the specific expression of genes in retinal pigment epithelium
EP3383439B1 (en) Synp161, a promoter for the specific expression of genes in rod photoreceptors
EP3384033B1 (en) Synp160, a promoter for the specific expression of genes in rod photoreceptors
US9999685B2 (en) AII retinal amacrine cell-specific promoter
US9579399B2 (en) Retinal OFF circuit-specific promoter
EP3289090B1 (en) Promoter for the specific expression of genes in müller cells
EP2776459A1 (en) Rod cell-specific promoter
EP3383438A1 (en) Synp159, a promoter for the specific expression of genes in rod photoreceptors
EP3383440A1 (en) Synp162, a promoter for the specific expression of genes in rod photoreceptors
US9862970B2 (en) Retinal on bipolar cells-specific artificial promoter
EP3176177A1 (en) Synp157, a promoter for the specific expression of genes in rod photoreceptors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18833620

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3083404

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020529473

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2020/08279

Country of ref document: TR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018376544

Country of ref document: AU

Date of ref document: 20181128

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20207018368

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018833620

Country of ref document: EP

Effective date: 20200630

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020010775

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112020010775

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200528

WWW Wipo information: withdrawn in national office

Ref document number: 274885

Country of ref document: IL

WWW Wipo information: withdrawn in national office

Ref document number: 2018833620

Country of ref document: EP