WO2019096054A1 - Method for screening glutamine synthetase-deficient hek293 cell line - Google Patents

Abstract

Provided is an HEK293 cell-based glutamine synthetase-deficient cell line HEK293-GS-/- that can be stably passaged, adapted to a suspension culture, and is applicable to recombinant protein expression constructed using a CRISPR/Cas9 system. The cell line can express various recombinant proteins through screening using a GS/MSX screening system, can stably express a target protein after multiple passages, and can adapt to most commercial serum-free media.

Description

Method for screening glutamine synthetase deficient HEK293 cell line

The present application claims priority to Chinese Patent Application No. 200911122567.6, entitled "A Method for Screening a Glutamine Synthetase Deficient HEK293 Cell Line", filed on November 14, 2017, the entire disclosure of which is incorporated herein by reference. The content is incorporated herein by reference.

Technical field

The present invention relates to the field of biotechnology, and in particular to a method for screening a glutamine synthetase (GS)-deficient HEK293 cell line and a method for screening a recombinant protein cell line based on the glutamine synthetase-deficient HEK293 cell line.

Background technique

Post-translational modifications (PTMs) play a crucial role in protein activity, stability and immunogenicity, directly affecting the efficacy, half-life and drug resistance of recombinant protein drugs. In the future, drug upgrading and new drug development will inevitably focus on the similarity between PTMs and human own proteins. The use of human cells to produce recombinant proteins is a shortcut to address the differences in PTMs.

HEK293 cells are derived from human embryonic kidney cells and are immortalized by transfection of the adenovirus 5 gene. The transfected HEK293 cell line genome carries the adenoviral 5E1 region, expressing E1A, which can make cells immortalized, and E1B, a gene that inhibits virus-mediated cell killing. HEK293 cells are widely used in cell signaling pathway research, recombinant protein expression, viral vector preparation, drug research and development, etc., because of their rapid growth, simple operation, high transfection efficiency and high expression of foreign proteins. One of the source cell lines. In recent years, the cell culture process of HEK293 has developed rapidly. Well-known reagent companies such as Invitrogen, Hyclone, Lonza, Millipore, Xell, PAN-BIOTECH have developed serum-free media optimized for HEK293 cells, and many experimental groups have successfully achieved high efficiency. Transfection of HEK293 in suspension culture in serum-free medium further promoted the application of HEK293 cells in scientific research and industry. In addition, based on (1) the low tumorigenicity of HEK293 in immunodeficient mice, in line with drug safety requirements; (2) the functional limitations of existing engineering cell lines for drug development and production, such as CHO cells can not meet Drotrecogin alfa (recombinant human activated protein C) leader peptide cleavage and glutamic acid residue γ-carboxylation two PTM modifications; (3) HEK293 in the viral vector preparation irreplaceability and other three main reasons, the US FDA Announced in 2001 to allow HEK293 based on the human adenovirus 5E1 region to be used for vaccine and biopharmaceutical production, and at the Vaccine Cell Substrate Conference in 2004, the use of HEK293 as a drug development cell line was discussed. As of 2016, the US FDA has passed two protein drugs based on HEK293 cells, namely recombinant human factor VIII (ELOCTATE) and recombinant human factor IX (ALPROLIX) developed by Biogen idec. Thanks to the advantages of human HEK293 cells on PTM similar to human own proteins, these two drugs have greatly improved in efficacy, half-life and drug resistance, such as ELOCTATE's half-life of up to 19.7 hours and clinical Phase III results showed that no neutralizing antibodies were detected in the subjects (34.5% of the production of neutralizing antibodies and drug resistance using factor VIII produced by CHO). In addition, other pharmaceutical companies are actively developing recombinant protein drugs based on the HEK293 platform, such as Octapharma's development of long-acting recombinant human factor VIII and recombinant granulocyte colony-stimulating factor (rG-CSF) based on HEK293 cells. The importance of HEK293 in the biopharmaceutical sector is growing. In recent years, protein-based drugs produced by human-derived HEK293 have been approved by the FDA, and are superior to the similar drugs that have been marketed in the past in terms of pharmacodynamics and stability. It is foreseeable that in the future development and production of recombinant protein drugs, HEK293 cells will inevitably become one of the important technology platforms.

In cell culture, glutamine is used on the one hand for energy metabolism of cells and on the other hand for protein synthesis and nucleic acid metabolism. In the absence or low glutamine culture conditions, Glutaminesynthetase (GS) catalyzes the synthesis of glutamate and ammonium ions to produce glutamine for cell metabolism and protein synthesis. Methionine sulfoximine (MSX) is a competitive inhibitor of GS. When MSX binds to the glutamate site of GS, it is phosphorylated by ATP, thereby irreversibly inhibiting GS activity. The GS/MSX screening system is widely used to screen CHO cell-based protein drug engineering cell lines. Usually, the target protein gene and the GS gene are co-transfected into the cell, and the GS gene is used as a screening marker gene to express glutamine synthetase, so that the positive cells can grow under low or no glutamine conditions. Subsequently, cells with high copy and high expression of the GS gene in the cell population were screened by gradually increasing the concentration of MSX. These cells also generally carry a higher copy number of the gene of interest and are highly expressed in the gene of interest. In addition, the engineering cell line constructed by GS/MSX method does not need to add glutamine during culture, which greatly reduces the accumulation of metabolic waste-ammonia in the medium, and has the advantages of easy cultivation, easy quality control, high protein expression and the like. .

Although HEK293 cells are widely recognized in scientific research and pharmaceutical fields, unlike CHO cells, there are currently no commercial cell lines that can be used for efficient exogenous gene amplification and for rapid screening of high protein expression. For example, the Glutamine synthetase/Methionine sulfoximine (GS/MSX) screening system widely used in the CHO platform is insensitive to glutamine and cannot be used because of the high expression of the GS gene by HKE293. It has been found that the GS activity of HEK293 is about 4.8 times that of CHO cells. The MSX concentration of less than 500 μM has no screening ability for HEK293 cells. Even at a high MSX concentration of 1000 μM, the cell screening positive rate is only 26%, and it is impossible. Cell clones with high gene copy number and high protein expression were screened by further increasing the MSX concentration. Construction of a HEK293 cell line that is highly sensitive to glutamine by knocking out or downregulating the GS gene is a viable method for using GS/MSX on HEK293.

Summary of the invention

A first object of the present invention is to provide an sgRNA sequence of a glutamine synthetase (GS) gene having one of the sequences shown in SEQ ID NO. 2-82.

Further, the sgRNA sequence is one selected from the group consisting of the 5' end extension or the 3' end extension or the 1-5 base sequence of the sequence shown in SEQ ID NO. 2-82.

A second object of the present invention is to provide a vector comprising the above sgRNA sequence.

A third object of the present invention is to provide a method for screening a glutamine synthetase-deficient HEK293 cell line, comprising the steps of:

(A) screening for sgRNA sequences that can be used for the HEK293 endogenous GS gene;

(B) HEK293 transiently transfects a plasmid containing the sgRNA sequence of the HEK293 endogenous GS gene obtained by the screening of step (A), and screening for glutamine by comparing MTS cell proliferation assays in which the cells proliferate at high and low glutamine concentrations. Dependent cell line.

Preferably, the method for screening a glutamine synthetase-deficient HEK293 cell line further comprises the step (C) at least one of cell morphology, doubling time, GS protein expression immunoblotting, gene sequencing or glutamine concentration-dependent detection. Method for identifying and screening cell lines;

Preferably, the method for screening a glutamine synthetase-deficient HEK293 cell line further comprises the step (D) glutamine-dependent cell line obtained by acclimation and culture-free suspension culture.

Further, the screening of the sgRNA sequence which can be used for the HEK293 endogenous GS gene in the step (A) specifically comprises the following steps:

(1) constructing a plasmid containing GS-sgRNA;

(2) constructing a plasmid containing an exon fragment of a marker protein and a glutamine synthetase gene which require recombinant repair in a sequence overlapping region;

(3) The plasmid containing GS-sgRNA was co-transfected into HEK293 cells with a plasmid containing the exon fragment of the marker protein and the glutamine synthetase gene which need to be recombinantly repaired in the overlapping region, and the plasmid was repaired by the recombinant repair efficiency of the labeled protein. The efficiency was screened for the sgRNA sequence of the HEK293 endogenous GS gene.

A fourth object of the present invention is to provide a glutamine synthetase-deficient HEK293 cell line which is HEK293GSKO-#2B4 and HEK293GSKO-#3D6, wherein the HEK293GSKO-#2B4 has a GS gene sequence as set forth in SEQ ID NO. The HEK293GSKO-#3D6 has the GS gene gene sequence as shown in SEQ ID NO.

A fifth object of the present invention is to provide use of the glutamine synthetase-deficient HEK293 cell line for expressing a recombinant protein.

A sixth object of the present invention is to provide a method for screening a cell line highly expressing recombinant protein, comprising the steps of:

1 constituting a plasmid containing the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase; the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase may be located on the same plasmid or may be located in different plasmids on;

2 using the glutamine synthetase-deficient HEK293 cell line to transiently transfect the plasmid containing the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase in step 1; if the gene sequence of the recombinant protein of interest is And the gene sequences of glutamine synthetase are located on different plasmids, respectively, and co-transfection of HEK293 cells is required;

3 screening for stably transfected cell populations;

4 Screening of recombinant protein high expression cell lines by stepwise increasing MSX concentration.

Further, the method for screening the stably transfected cell population in step 3 is an antibiotic screening or medium culture for reducing/removing glutamine.

Further, the MSX concentration used by the screening cells in step 4 is increased from 0 μM to 3000 μM.

The invention utilizes the CRISPR/Cas9 system to construct a glutamine synthetase-deficient cell line HEK293-GS-/- based on HEK293 cells, stable passage, adapted to suspension culture, and can be applied to recombinant protein expression. The cell line of the present invention can screen engineering cell lines expressing various recombinant proteins by GS/MSX screening system; and gradually increase the copy number of the target gene in the HEK293-GS-/- genome by MSX stepwise pressurization, thereby further improving the recombinant protein The amount of expression. The cell line constructed based on HEK293-GS-/- can stably express the target protein after multiple passages; the constructed cells can adapt to most commercial serum-free medium; the screened cells themselves express glutamine synthetase high. This greatly simplifies the upstream culture process. HEK293-GS-/- can be applied to research fields such as molecular biology and cell biology, and is also suitable for constructing engineering cells used in biopharmaceutical fields. It has good clinical application prospects and commercial value.

DRAWINGS

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art description will be briefly described below.

Figure 1 is a flow chart showing a method of constructing HEK293 glutamine synthetase-deficient cells;

Figure 2 shows the plasmid map of pShCMV-EGx-GSE(3-8)-xFP;

Figure 3 shows the results of sgRNA shear efficiency analysis;

Figure 4 shows the degree of dependence of cell monoclonal on glutamine;

Figure 5 shows the results of detection of GS protein expression in Example 5 GS-deficient HEK293 single cell clone;

Figure 6 shows the sequencing results of the single cell clone gene of Example 5#2B4 and #3D6;

Figure 7 shows the results of glutamine concentration-dependent detection of Examples 5#2B4 and #3D6;

Figure 8 shows the results of glutamine-dependent detection of cells in the serum-free suspension culture of Example 6;

Figure 9 shows the plasmid map of Example 7 pShCMV-EGFP-IRES-GS;

Figure 10 shows the results of microscopic analysis of the EGFP stably expressing cell line based on GS-deficient HEK293 in Example 7;

Figure 11 shows the results of flow cytometry analysis of EGFP positive cells by MSX pressure screening in Example 7;

Figure 12 shows the pCMV (PacI)-MCS-IRES-EGFP plasmid map;

Figure 13 shows the plasmid map of pShCMV-MCS.

Detailed ways

The invention discloses a method for screening a glutamine synthetase (GS) deficient HEK293 cell line. Those skilled in the art can learn from the contents of this document and appropriately improve the process parameters. It is to be understood that all such alternatives and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The method and product of the present invention have been described by the preferred embodiments, and it is obvious that those skilled in the art can change or appropriately modify and combine the methods described herein to implement and apply the present invention without departing from the spirit, scope and scope of the invention. Invention technology.

The CRISPR/Cas9 system is a powerful gene editing tool discovered in recent years. It uses crRNA (CRISPR-derived RNA) to form a tracrRNA/crRNA complex by base pairing with tracrRNA (trans-activating RNA). This complex guides nuclease. The Cas9 protein cleaves double-stranded DNA at the target site of the gene sequence paired with the crRNA. Zhang Feng laboratory simplified the design of target site by designing sgRNA sequences containing tracrRNA and crRNA sequences. By constructing pX330 plasmid expressing both sgRNA and Cas9 gene, the step of gene knockout was simplified and the knockout efficiency was improved. At present, pX330 plasmid has successfully achieved precise genetic modification on human, mouse, zebrafish and other species. Knocking out the intrinsic GS gene using the CRISPR/Cas9 system is an effective means of obtaining a glutamine high-sensitivity HEK293 cell line.

Based on this, the present application knocks out the GS gene in HEK293 cells using the CRISPR/Cas9 system, thereby obtaining a cell strain highly sensitive to glutamine, and constructing a GS/MSX screening technique based on this cell strain.

In one aspect, the invention provides an sgRNA sequence of a GS gene. The present application is directed to exons 3 to 8 of the GS gene coding region, and knocks out the GS gene in HEK293 using the CRISP/Cas9 system and designs a partial sgRNA sequence.

Wherein the sgRNA sequence of the GS gene has one of the sequences set forth in SEQ ID NO. 2-82.

Further, the sgRNA sequence is one selected from the group consisting of a sequence extending from the 5' end or the 3' end of the sequence shown in SEQ ID NO. 2-82 or shortening by 1-5 bases.

The invention further provides vectors comprising the above sgRNA sequences. The vector is preferably a CRISP/Cas9 system vector, such as pX330. A total of 81 pX330-GS-sgRNA (E3#01-E8#13) vectors based on pX330 were constructed in this application.

The present invention provides a method for screening a glutamine synthetase-deficient HEK293 cell line, which knocks out the HEK293 endogenous GS gene and screens a monoclonal stable cell line by a CRISP/Cas9 system, comprising the following steps:

(A) screening for sgRNA sequences that can be used for the HEK293 endogenous GS gene;

(B) HEK293 transiently transfects a plasmid containing the sgRNA sequence of the HEK293 endogenous GS gene obtained by the screening of step (A), and screening for glutamine by comparing MTS cell proliferation assays in which the cells proliferate at high and low glutamine concentrations. Dependent cell line.

Step (A) of the method for screening glutamine synthetase-deficient HEK293 cell line of the present invention by large-scale screening of sgRNA for HEK293 endogenous GS gene by pShCMV-EGx-GSE(3-8)-xFP series plasmid The sequence specifically includes the following steps:

(1) constructing a plasmid containing GS-sgRNA;

(2) constructing a plasmid containing an exon fragment of a marker protein and a glutamine synthetase gene which require recombinant repair in a sequence overlapping region;

(3) The plasmid containing GS-sgRNA was co-transfected into HEK293 cells with a plasmid containing the exon fragment of the marker protein and the glutamine synthetase gene which need to be recombinantly repaired in the overlapping region, and the plasmid was repaired by the recombinant repair efficiency of the labeled protein. The efficiency was screened for the sgRNA sequence of the HEK293 endogenous GS gene. Wherein the GS-sgRNA-containing plasmid of step (1) is a plasmid containing pX330-containing pX330-GS-sgRNA (E3#01-E8#13) vector based on pX330 as described above.

The labeling protein in the step (2) may be a fluorescent labeling protein, a biotin labeling protein or the like.

In some embodiments, the marker protein of step (2) is a fortified green fluorescent protein, and the plasmid containing the exon fragment of the marker protein and the glutamine synthetase gene is pShCMV-EGx-GSE (3-8) -xFP plasmid.

Step (3) The high-efficiency sgRNA sequence covering the entire GS gene was rapidly identified by co-transfection of five plasmids of pShCMV-EGx-GSE(3-8)-xFP, respectively.

The pShCMV-EGx-GSE(3-8)-xFP plasmid contains two incomplete EGFP gene fragments with homologous regions, and the third, fourth, fifth, sixth, and eighth portions of the GS gene were inserted in the middle. A total of five plasmids were constructed for the exon and its adjacent intron sequences. The pShCMV-EGx-GSE(3-8)-xFP plasmid could not express the correct EGFP protein without green fluorescence when transfected alone, but the Cas9 complex combined with high-efficiency sgRNA could cleave the GS gene between the two EGFP fragments. In the case of an exon sequence, the cell will repair the EGFP gene on the pShCMV-EGx-GSE(3-8)-xFP plasmid by homologous recombination and express an EGFP protein capable of emitting green fluorescence. The present invention can rapidly screen highly efficient sgRNA by co-transfecting pX330-GS-sgRNA (E3#01-E8#13) and pShCMV-EGx-GSE(3-8)-xFP, respectively, and observing the ratio of green fluorescent cells.

Since the frameshift mutation closer to the initiation codon is more likely to cause loss of function of the gene, the present invention preferably uses pX330-GS-sgRNAE3#13, which has the highest exon shear efficiency of the third exon of the GS gene, as a subsequent knockout HEK293 endogenous. Plasmid for the GS gene. It should be pointed out that the 81 sgRNAs involved in the present application can obtain GS gene-deficient HEK293 monoclonal cells by increasing the number of selected cells even if the efficiency is as low as 3% or less.

After transient transfection of HEK293, the plasmid expressing Cas9 and sgRNA will cleave the corresponding genomic sequence according to the sequence of sgRNA, and the cut genome will be homologous recombination or non-homologous end-joining (NHEJ) by homologous recombination. Repair genomic DNA. When cells use NHEJ to repair the genome, they randomly lose the base of the repair site, and the formation of a frameshift mutation ultimately leads to the inability of the protein to be expressed. The shear efficiency of the CRISP/Cas9 system in cell lines is between 20% and 50%. Therefore, a rapid test method is needed to identify whether a single cell clone is a GS-deficient type. GS wild type and defective type have different dependence on glutamine. Under high concentration glutamine culture conditions, GS wild type and defective type have similar growth rate of exogenous glutamine; but under low glutamine culture conditions, The GS-deficient type grows slowly because it cannot synthesize glutamine. Therefore, glutamine synthetase-dependent HEK293 cells can be rapidly identified by comparing the growth rate of the same strain of cells at high and low glutamine concentrations. In the method for screening glutamine synthetase-deficient HEK293 cell line of the present invention, step (B) utilizes MTS cell proliferation assay to rapidly screen glutamine-dependent cell lines by cell proliferation under high and low glutamine concentration, and identify Fourteen GS-deficient HEK293 cells were obtained.

The glutamine sensitive cell strain screened by the MTS cell proliferation assay needs further confirmation by molecular biological methods whether its endogenous GS enzyme is expressed. Method for screening glutamine synthetase-deficient HEK293 cell line according to the present invention (C) at least one of cell morphology, doubling time, GS protein expression immunoblotting, gene sequencing or glutamine concentration-dependent detection The screened cell line was identified for its endogenous GS enzyme expression, and the GS gene knockout HEK293 cell line was determined.

Western blotting can prove whether the GS enzyme is expressed, and sequencing of the target gene fragment of the cell line can finally determine the genotype of the cell line and detect whether the cell is derived from a monoclonal antibody. In the present invention, 9 cells were selected from 14 GS-deficient HEK293 cells by cell morphology, doubling time and the like by immunoblotting, 5 of which were unable to detect GS enzyme expression, and 4 of which additionally expressed GS enzyme. Gene sequencing detection showed that both HEK293GSKO-#2B4 and HEK293GSKO-#3D6 cells showed frameshift mutations in the sgRNA design region, confirming that both cell lines are GS knockout cells.

Further, in the method (D) for screening a glutamine synthetase-deficient HEK293 cell line of the present invention, a glutamine-dependent cell line obtained by acclimation culture in a serum-free suspension culture is used to obtain a GS-deficient HEK293 cell. Adapt to serum-free suspension culture.

The serum-free medium may be selected from any of the HEK293 suspension culture serum-free mediums currently provided by the biological reagent company, such as Invitrogen, Hyclone, Lonza, Millipore, Xell, PAN-BIOTECH. In one embodiment, the invention uses a CDM (Hyclone) medium to acclimate HEK293GSKO-#2B4 and HEK293GSKO-#3D6 suspension cultures. The domesticated HEK293GSKO-#2B4 and HEK293GSKO-#3D6 are sensitive to glutamine concentration and cannot grow rapidly at low glutamine concentrations.

Accordingly, the present invention provides a glutamine synthetase-deficient HEK293 cell line, HEK293GSKO-#2B4 and HEK293GSKO-#3D6, wherein the HEK293GSKO-#2B4 has a GS gene sequence as shown in SEQ ID NO. 85, the HEK293GSKO - #3D6 Its GS gene gene sequence is shown in SEQ ID NO.

Further, the present invention also provides the use of the glutamine synthetase-deficient HEK293 cell line for expressing a recombinant protein.

The glutamine-sensitive cell line of the present invention can be used to construct GS/MSX screening technology, which can be widely applied to recombinant protein expression, protein drug development, gene therapy, cell therapy and other life. science field.

The present invention therefore establishes a method for rapid screening of highly expressed recombinant protein cell lines based on such GS-deficient HEK293 cells. The method includes the following steps:

1 constituting a plasmid containing the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase, wherein the gene sequence of the recombinant protein of interest and the gene sequence of the glutamine synthetase may be located on the same plasmid or may be located in different plasmids. a plasmid for constructing a gene sequence containing the gene sequence of the recombinant protein of interest and a glutamine synthetase, or a plasmid for constructing a gene sequence containing the recombinant protein of interest and a plasmid containing a gene sequence of glutamine synthetase;

2 using the glutamine synthetase-deficient HEK293 cell line to transiently transfect the plasmid containing the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase according to step 1, if the gene sequence of the recombinant protein of interest And the gene sequence of glutamine synthetase is located on different plasmids, respectively, and the HEK293 cells need to be co-transfected; that is, the glutamine synthetase-deficient HEK293 cell line is transiently transfected with the target recombinant protein granules as described in step 1. a plasmid having a gene sequence and a gene sequence of glutamine synthetase, or a plasmid co-transfected with the glutamine synthetase-deficient HEK293 cell line containing the gene sequence of the recombinant protein of interest and the glutamine containing the target recombinant protein a plasmid encoding the gene sequence of the enzyme;

3 screening for stably transfected cell populations;

4 Screening of recombinant protein high expression cell lines by stepwise increasing MSX concentration.

In some embodiments, the plasmid of the present invention comprising the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase comprises the following functional elements:

a) Gene sequence of the recombinant protein of interest: This gene sequence may be derived from a mammalian, viral, bacterial, plant or artificially designed sequence, typically encoding a stretch of protein or a functional base sequence. In the embodiment of the present invention, the recombinant protein of interest is green fluorescent protein EGFP, and the GS gene is used as a screening marker to rapidly screen a high expression green fluorescent protein EGFP cell line based on GS enzyme-deficient HEK293 cell HEK293GSKO-#2B4 cells.

b) GS gene sequence: The GS gene expresses glutamine synthetase, which catalyzes the synthesis of glutamine by glutamate and ammonia. The gene sequence may be derived from a mammal such as a human, a monkey, a mouse or the like; it may also be derived from a plant or a bacterium; or may be obtained by gene synthesis or mutation. The human GS gene is used as an example in the embodiment of the present invention.

c) a promoter or other gene sequence that induces a protein expression method: the promoter includes, but is not limited to, CMV, RSV, PGK, SV40, and the like. Other protein expression methods include, but are not limited to, fusion protein expression methods; two or more proteins are expressed on the same mRNA by an IRES sequence; a fusion protein is first expressed by a method such as furin-P2A, and then subjected to self-cleavage and intracellular enzyme modification. Two independent proteins are formed; or the same promoter is shared by exon selective cleavage and the like. The CMV and IRES sequences are used as an example in the described embodiments of the invention.

d) Other common resistance screening marker genes: Such resistance genes can be used for preliminary screening of stable cell lines, such as neomycin resistance gene, hygromycin resistance gene, puromycin (puromycin) resistance gene and the like.

In one embodiment of the present invention, the vector of the plasmid containing the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase is pShCMV-EGFP-IRES-GS (Fig. 9). Its plasmid features include the CMV promoter, the target gene EGFP, the internal ribosome entry site sequence IRES, and the human GS gene. The target protein EGFP and the selection marker gene GS are transcribed on the same mRNA by the same promoter CMV, so that the target protein expression amount can be correlated with the GS selection marker gene. When cells are screened by MSX gradient, cells with high expression of the GS gene will have a higher probability of simultaneously expressing the target gene.

The method for screening a cell line with high expression of a recombinant protein of the present invention is the step 2 of the glutamine synthetase-deficient HEK293 cell line, and the gene sequence containing the recombinant protein of interest and the gene of glutamine synthetase are transiently transfected in step 1 Sequence plasmid. The cell transfection may be chemical transfection such as calcium phosphate precipitation, lipofection, such as PEI, lipofactamine, etc., electroporation or transfection using a viral vector such as lentivirus or AAV virus. In the described embodiments of the invention, the cells are transfected into a calcium phosphate precipitation method.

In other embodiments, the gene sequence of the recombinant protein of the present invention and the gene sequence of the glutamine synthetase may be present in two plasmids, respectively, to construct a plasmid containing the gene sequence of the recombinant protein of interest and a valley containing the same. A plasmid for the gene sequence of a histidine synthase. Then, the glutamine synthetase-deficient HEK293 cell line was transiently co-transfected with the plasmid containing the gene sequence of the recombinant protein of interest and the plasmid containing the gene sequence of glutamine synthetase. A person skilled in the art can understand that the plasmid containing the gene sequence of the recombinant protein of interest contains the gene sequence of the above recombinant protein, the promoter or other gene sequence for inducing protein expression, and functional elements such as common resistance screening marker genes. The plasmid containing the gene sequence of glutamine synthetase contains the above-described GS gene sequence, a gene sequence of a promoter or other method for inducing protein expression, and functional elements such as a common resistance screening marker gene.

Cells that are transiently transfected typically require screening to obtain a stable population of transfected cells containing the recombinant protein of interest. The screening methods include, but are not limited to, screening various cell populations carrying resistance genes using various types of antibiotics, such as screening for positive cells carrying the neomycin resistance gene using neomycine (G418); or utilizing by reducing/removing glutamine medium GS gene culture screens for stable transfected cell populations. In the embodiment of the present invention, the screening method is DMEM medium culture for reducing/removing glutamine.

Further, in the method 4 for screening a cell line highly expressing a recombinant protein of the present invention, the target recombinant protein high expression cell line is screened by gradually increasing the MSX concentration. MSX is an inhibitor of the GS enzyme. A subpopulation of high expression of the GS gene in the cell population can be screened by gradually increasing the concentration of MSX. Preferably, the screening cells use an MSX concentration increasing from 0 [mu]M to 3000 [mu]M. For example, 0 μM, 5 μM, 10 μM, 25 μM, 50 μM, 100 μM, 200 μM, 500 μM, 1000 μM, if necessary, higher MSX concentrations such as 2000 μM, 3000 μM can be used.

The GS-deficient HEK293 cells constructed based on the present invention can be constructed in principle according to the above partial steps of the present invention or other similar methods commonly used in molecular biology to construct a cell line expressing any protein, and a professional trained in molecular biology or cell biology can It is easier to understand and apply the techniques of the present invention, so the expression of other proteins by GS-deficient HEK293 constructed based on the method of the present invention belongs to a similar technique and is also within the scope of this patent.

For a better understanding of the present invention, the embodiments of the present invention will be clearly and completely described in the embodiments of the present invention. It is obvious that the described embodiments are only a part of the embodiments of the present invention, but not all embodiments. . All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts are within the scope of the present invention.

Unless otherwise stated, the reagents involved in the examples of the present invention are all commercially available products, which are all commercially available. All restriction enzymes were purchased from NEB; DMEM medium was purchased from Thermo; non-essential amino acid mixture was purchased from Thermo: 11140076; 0.1 mM glutamine CDM (Hyclone: SH30858.02) was purchased from Hyclone MSX was purchased from Sigma: M5379-500.

Example 1: Designing GS gene sgRNA and constructing CRISP/Cas9 plasmid

(1) Design GS gene sgRNA sequence

By comprehensively comparing the prediction results of various online tools, analyzing the conditions such as the mismatch number, GC content, and out-of-frame score, the third to eighth exon intervals in the coding region of the GS gene ( SEQ ID NO. 1) A total of 81 sgRNA sequences were designed (see Table 1 for specific sequences).

Table 1 GS gene coding region sgRNA sequence

(2) Construction of pX330-GS-sgRNA (E3#01-E8#13) vector

The BbsI cohesive ends were added to the 5' end of the sgRNA sequence of Table 1, and the reverse complement sequence was designed and the corresponding primers were synthesized (Table 2). The synthesized sgRNA forward and reverse complementary primers were dissolved in T4 polynucleotide kinase at a final concentration of 0.5 μM each, catalyzed by T4 Polynucleotide Kinase (NEB: M0201S) to make it Phosphorylation (37 ° C water bath for 30 minutes); then the complementary primer sequences were annealed to double-stranded nucleotides in a PCR machine (reaction procedure was reduced to 1 ° C per minute after 5 min reaction at 95 ° C until down to 25 ° C). A total of 81 sgRNA inserts were prepared in this way.

Table 2 sgRNA forward and reverse complementary primers

sgRNA No.	Forward primer (F)	Reverse complementary primer (R)
E3#01	Caccgcagcaagttcccacttaa	Aaacttaagt gggaacttgc tg
E3#02	Caccgaagtt cccacttaaa taa	Aaacttattt aagtgggaac tt
E3#03	Caccgactta aataaaggca tca	Aaactgatgc ctttatttaa gt
E3#04	Caccgtaaat aaaggcatca agc	Aaacgcttga tgcctttatt ta
E3#05	Caccgtgtac atgtccctgc ctc	Aaacgaggca gggacatgta ca
E3#06	Caccgtgcct cagggtgaga aag	Aaactttctc accctgaggc a
E3#07	Caccgcaggg tgagaaagtc cag	Aaactggact ttctcaccct g
E3#08	Caccgtccag gccatgtata tc	Aaacgatata catggcctgg ac
E3#09	Caccgtgtat atctggatcg atg	Aaacatcgat ccagatatac a
E3#10	Caccgtatct ggatcgatgg tac	Aaacgtacca tcgatccaga ta
E3#11	Caccgatcga tggtactgga ga	Aaactctcca gtaccatcga tc
E3#12	Caccggactg cgctgcaaga cc	Aaacggtctt gcagcgcagt cc
E3#13	Caccgctgca agacccggac cc	Aaacgggtcc gggtcttgca gc
E3#14	Caccggaccc tggacagtga gc	Aaacgctcac tgtccagggt cc
E3#15	Caccgtggac agtgagccca agt	Aaacacttgg gctcactgtc ca
E3#16	Caccgacagt gagcccaagt gtg	Aaacacactt gggctcactg t
E4#01	Caccgagtgg aatttcgatg gc	Aaacgccatc gaaattccac tc
E4#02-01	Caccgctagtactttacagt ctg	Aaacagactgtaaagtactag
E4#02-02	Caccgccagtactttacagt ctg	Aaacagactgtaaagtactgg
E4#03	Caccgacagt gacatgtatc tcg	Aaacgagata catgtcactg t
E4#04	Caccgtgcct gctgccatgt ttc	Aaacgaaaca tggcagcagg ca
E4#05	Caccgtgttt cgggacccct tcc	Aaacggaagg ggtcccgaaa ca
E4#06	Caccgttcgg gaccccttcc gta	Aaactacgga aggggtcccg aa
E4#07	Caccgttccg taaggaccct aac	Aaacgttagg gtccttacgg aa
E4#08	Caccgtaagg accctaacaa gct	Aaacagcttg ttagggtcct ta
E4#09	Caccgtaaca agctggtgtt atg	Aaacataaca ccagcttgtt a
E4#10	Caccgttttc aagtacaatc ga	Aaactcgatt gtacttgaaa ac
E5#01	Caccgatttg aggcacacct gta	Aaactacagg tgtgcctcaa at
E5#02	Caccgttgag gcacacctgt aaa	Aaactttaca ggtgtgcctc aa
E5#03	Caccgacacc tgtaaacgga taa	Aaacttatcc gtttacaggt gt
E5#04	Caccgtaaac ggataatgga ca	Aaactgtcca ttatccgttt ac
E5#05	Caccgtgagc aaccagcacc cc	Aaacggggtg ctggttgctc ac
E5#06	Caccgcaacc agcacccctg gtt	Aaacaaccag gggtgctggt tg
E5#07	Caccgagcac ccctggtttg gca	Aaactgccaa accaggggtg ct
E5#08	Caccgctggt ttggcatgga gca	Aaactgctcc atgccaaacc ag
E5#09	Caccgcagga gtataccctc at	Aaacatgagg gtatactcct gc

E5#10	Caccgaccct catggggaca gat	Aaacatctgt ccccatgagg gt
E5#11	Caccgacaga tgggcacccc tt	Aaacaagggg tgcccatctg tc
E5#12	Caccgatggg cacccctttg gt	Aaacaccaaa ggggtgccca tc
E5#13	Caccgttggt tggccttcca acg	Aaacgttgga aggccaacca a
E5#14	Caccgccttc caacggcttc cc	Aaacgggaag ccgttggaag gc
E5#15	Caccgacggc ttcccagggc ccc	Aaacggggcc ctgggaagcc gt
E6#01	Caccgtatta ctgtggtgtg gga	Aaactcccac accacagtaa ta
E6#02	Caccgggagc agacagagcc ta	Aaactaggct ctgtctgctc cc
E6#03	Caccgcagac agagcctatg gc	Aaacgccata ggctctgtct gc
E6#04	Caccgcctat ggcagggaca tcg	Aaacgatgtc cctgccatag g
E6#05	Caccgatcgt ggaggcccat tac	Aaacgtaatg ggcctccacg at
E6#06	Caccgattac cgggcctgct tgt	Aaacacaagc aggcccggta at
E6#07	Caccgccggg cctgcttgta tgc	Aaacgcatac aagcaggccc gg
E6#08	Caccgcttgt atgctggagt ca	Aaactgactc cagcatacaa gc
E6#09	Caccgatgct ggagtcaaga ttg	Aaacaatctt gactccagca t
E6#10	Caccgttgcg gggactaatg ccg	Aaacggcatt agtccccgca a
E7#01	Caccgtcaga ttggaccttg tga	Aaactcacaa ggtccaatct ga
E7#02	Caccgtgtga aggaatcagc atg	Aaacatgctg attccttcac a
E7#03	Caccgagcat gggagatcat ctc	Aaacgagatg atctcccatg ct
E7#04	Caccgtggga gatcatctct ggg	Aaacccagag atgatctccc a
E7#05	Caccgtttca tcttgcatcg tg	Aaacacgatg caagatgaaa c
E7#06	Caccgtcgtg tgtgtgaaga ctt	Aaacaagtct tcacacacac ga
E7#07	Caccgttgat cctaagccca ttc	Aaacgaatgg gcttaggatc aa
E7#08	Caccgtgatc ctaagcccat tcc	Aaacggaatg ggcttaggat ca
E7#09	Caccgaagcc cattcctggg aac	Aaacgttccc aggaatgggc tt
E7#10	Caccgattcc tgggaactgg aat	Aaacattcca gttcccagga at
E7#11	Caccgggaac tggaatggtg ca	Aaactgcacc attccagttc cc
E7#12	Caccgtacca acttcagcac caa	Aaacttggtg ctgaagttgg ta
E7#13	Caccgacttc agcaccaagg cca	Aaactggcct tggtgctgaa gt
E7#14	Caccgttcag caccaaggcc atg	Aaacatggcc ttggtgctga a
E7#15	Caccgcacca aggccatgcg gg	Aaacccgcat ggccttggtg c
E7#16	Caccggccat gcgggaggag aa	Aaacttctcc tcccgcatgg cc
E8#01	Caccgttgag aaactaagca agc	Aaacgcttgc ttagtttctc aa
E8#02	Caccgtacca catccgtgcc ta	Aaactaggca cggatgtggt ac
E8#03	Caccgaaggg aggcctggac aat	Aaacattgtc caggcctccc tt
E8#04	Caccgacgtc taactggatt cc	Aaacggaatc cagttagacg tc
E8#05	Caccgtgaaa cctccaacat caa	Aaacttgatg ttggaggttt ca
E8#06	Caccgcatca acgacttttc tgc	Aaacgcagaa aagtcgttga tg
E8#07	Caccgatcgt agcgccagca tac	Aaacgtatgc tggcgctacg at
E8#08	Caccgttccc cggactgttg gcc	Aaacggccaa cagtccgggg aa

E8#09	Caccggagaa gaagggttac tt	Aaacaagtaa cccttcttct cc
E8#10	Caccgctctg ccaactgcga ccc	Aaacgggtcg cagttggcag ag
E8#11	Caccgctttt cggtgacaga agc	Aaacgcttct gtcaccgaaa ag
E8#12	Caccgtgtct tctcaatgaa ac	Aaacgtttca ttgagaagac ac
E8#13	Caccgttcca gtacaaaaat taa	Aaacttaatt tttgtactgg aa

The pX330 (addgene: Plasmid #42230) plasmid was digested with BbsI restriction enzyme (NEB: R0539S) at 37 ° C for 15 h, and recovered by agarose gel DNA recovery kit (Tiangen). The recovered linearized pX330 and each sgRNA insert were ligated with T4 DNA ligase, respectively, and the ligated products were transformed into E. coli DH5α competent cells, respectively. The transformed cells were plated on LB plates containing ampicillin (100 μg/ml), cultured at 37 ° C overnight, and the resulting clones were identified by PCR (forward primer: each sgRNA forward primer sequence; reverse primer: 5' CGTAGATGTACTGCCAAGTAG; PCR conditions: 94 ° C for 1 minute, then 94 ° C for 30 seconds - 58 ° C for 30 seconds - 72 ° C for 30 seconds for 30 cycles), positive clones were purified using the Tiangen DNA Mini Kit. A total of 81 plasmids of pX330-GS-sgRNA (E3#01) to pX330-GS-sgRNA (E8#13) were constructed by this method.

Example 2: Construction of pShCMV-EGx-GSE(3-8)-xFP plasmid

(1) Construction of the pShCMV-EGx-MCS-xFP plasmid.

The enhanced green fluorescent protein (EGFP) gene fragment was amplified by PCR using plasmid pCMV(PacI)-MCS-IRES-EGFP (plasmid map shown in Figure 12) as a template. The EGFPfrag1 primers were 5'acagATCGATgccaccATGGTGAGCAAGGGCGAG and 5'CTGggatccgaattcAGTGGTTGTCGGGCAGCAG; the EGFPfrag2 primers were 5'TCACctcgagGCAAGCTGACCCTGAAGTTC and 5'CTACTGagatctTTACTTGTACAGCTCGTCCATG. The PCR reaction was carried out using KAPA HiFi DNA Polymerase at an annealing temperature of 58 ° C for 15 s. The recovered EGFP1 fragment and pShCMV-MCS (the MCS sequence is shown in SEQ ID NO. 83, the plasmid map is shown in Figure 13). The plasmid was digested with ClaI, BamHI, purified by gel, T4 DNA ligase linkage, DH5α competent state. Cell transformation and plasmid DNA miniprep and identification The pShCMV-EGx-MCS plasmid was constructed. The EGFP2 PCR fragment obtained above was inserted into the pShCMV-EGx-MCS plasmid XhoI and BglII restriction sites by similar molecular cloning methods to obtain a plasmid pShCMV-EGx-MCS-xFP plasmid (EGx-MCS-xFP sequence is set as SEQ ID NO. Show). The plasmid was identified by sequencing and designed correctly.

(2) Five detection plasmids of pShCMV-EGx-GSE(3-8)-xFP were constructed.

The genomic DNA of HEK293 was extracted by phenol chloroform method and used as a PCR template. The primer sequence shown in Table 3 was used to amplify the human glutamine synthetase gene third (GS#E3F-GS#E3R) by touch down PCR. (GS#E4F-GS#E4R), five (GS#E5F-GS#E5R), six to seven (GS#E6&7F-GS#E6&7R), and part eight (GS#E8F-GS#E8R) exon fragments. The PCR conditions were such that the annealing temperature was lowered from 62 ° C to 52 ° C, 1 ° C / cycle, 10 cycles, then decreased from 52 ° C to 48 ° C, 35 cycles. The obtained five PCR fragments were ligated into the BamHI and HindIII restriction sites of the plasmid pShCMV-EGx-MCS-xFP, respectively, and pShCMV-EGx-GSE3-xFP, pShCMV-EGx-GSE4-xFP, pShCMV-EGx-GSE5 were constructed. Five plasmids of -xFP, pShCMV-EGx-GSE(6&7)-xFP, pShCMV-EGx-GSE8-xFP, the map is shown in Figure 2, and verified by sequencing.

Table 3 Primer sequences

Example 3: Rapid sgRNA efficiency detection

16 samples of pX330-GS-sgRNA (E3#01) to (E3#16) and pShCMV-EGx-GS E3-xFP plasmid; pX330-GS-sgRNA (E4#01) to (E4#10) and pShCMV - EGx-GSE4-xFP plasmid contains 10 samples (including E4#2-1 and E4#2-2 and other mass ratios); pX330-GS-sgRNA (E5#01) to (E3#15) and pShCMV -EGx-GSE5-xFP plasmid total 15 samples; pX330-GS-sgRNA (E6#01) to (E6#10) and pX330-GS-sgRNA (E7#01) to (E7#16) and pShCMV-EGx- A total of 26 samples of GSE(6&7)-xFP plasmid; 13 samples of pX330-GS-sgRNA (E8#01) to (E8#13) and pShCMV-EGx-GSE8-xFP plasmid were co-transfected by calcium phosphate coprecipitation HEK293 cells. The pX330 plasmid containing no sgRNA sequence and pShCMV-EGx-GSE3-xFP, pShCMV-EGx-GSE4-xFP, pShCMV-EGx-GSE5-xFP, pShCMV-EGx-GSE(6&7)-xFP, pShCMV-EGx-GSE8, respectively Five plasmids of -xFP were co-transfected as a negative control. The experimental steps are as follows:

(1) HEK293 cells were cultured in a 12-well plate with high glucose DMEM complete medium (containing 10% calf serum and 4 mM glutamine), at 37 ° C, 5% CO ₂ to 60% monolayer;

(2) 4 μg of pX330 plasmid and 0.5 μg of pShCMV-EGx-GS(3-8)-xFP plasmid were diluted into 220 μl of deionized water, and 30 μl of 2M calcium chloride and 250 μl of 2×HEPES buffer were added to the bottom and the liquid surface, respectively. Liquid and mixed by bubble method;

(3) After standing at room temperature for 15 minutes, accelerate the mixing and slowly add 100 μl of the DNA mixture to each well of the cells;

(4) The transfected cells were cultured in a 37 ° C, 5% CO ₂ incubator for 48 hours, photographed with a fluorescence microscope and analyzed for the green fluorescence ratio by software.

Experimental Results As shown in Figure 3, most of the designed sgRNAs can mediate Cas9 cleavage of the corresponding pShCMV-EGx-GS(3-8)-xFP plasmid containing the third to eighth exons of the GS gene, and The luminescent EGFP gene was formed by intracellular homologous recombination repair with a shear efficiency between 2% and 38% with an average of 13.8%.

To simplify the subsequent work of constructing GS-deficient HEK293 cells, the present invention employed a pX330-GS-sg RNAE3#13 plasmid near the GS gene initiation codon and tested for a shear efficiency of 35% for subsequent experiments. It is inferred from the experimental principle that the sgRNA detected by the present invention can be constructed in principle according to the following method to construct a corresponding GS-deficient HEK293 cell line.

Example 4: Construction and screening of GS-deficient HEK293 cell line

(1) Plasmid amplification and purification.

The pX330-GS-sgRNAE3#13 plasmid was transferred to DH5α competent cells and plated overnight, and the monoclonals were selected and inoculated in 800 ml of LB (containing 100 μg/ml ampicillin) for 24 hours. The obtained bacterial liquid is purified by an alkali lysis method and a cesium chloride density gradient centrifugation method to prepare high-purity DNA.

(2) transient transfection of HEK293 with pX330-GS-sgRNAE3#13 plasmid

HEK293 cells were cultured in 60 mm culture dishes with high glucose DMEM complete medium (containing 10% calf serum and 4 mM glutamine) at 37 ° C, 5% CO ₂ to 60% monolayer; 5 μg pX330-GS- The sgRNAE3#13 plasmid was diluted into 220 μl of deionized water, and 30 μl of 2M calcium chloride and 250 μl of 2×HEPES buffer were added to the bottom and the liquid surface, respectively, and mixed by bubble method; after standing for 15 minutes at room temperature, the DNA was accelerated and mixed. The mixture was all added to the cells; after incubation for 8 hours at 37 ° C in a 5% CO ₂ cell incubator, fresh medium was replaced.

(3) HEK293 monoclonal cells were obtained by limiting dilution method.

HEK293 cells transfected with pX330-GS-sgRNAE3#13 plasmid were further cultured for 48 hours at 37 ° C in a 5% CO ₂ cell incubator, and the cells were trypsinized, and the digested cells were 0.8 per well. The cells were seeded in 16 96-well plates. After standing for 2 hours, the cells without cells or more than two cells were excluded by microscopic observation. After continuing to culture for 8 days, after the growth was slow and the cell morphology was uneven, the qualified cells were subcultured into 4 24-well plates.

(4) Screening of glutamine-dependent cell lines by MTS cell proliferation assay

When the cells in the four 24-well plates grew to more than 50% full plate, trypsinize, take half of the cells in a new 25-well plate, and inoculate the remaining cells in an average of 4 96-well plate wells. Two wells were cultured in GlnLow at low glutamine concentration (DMEM was added with 10% calf serum, non-essential amino acid mixture Thermo: 11140076 and 0.1 mM glutamine); the other two wells were cultured at high glutamine concentration GlnHigh (DMEM) 10% calf serum, non-essential amino acid mixture Thermo: 11140076 and 4 mM glutamine) were added and co-cultured for 72 hours. After 72 hours of incubation, 20 μl of MTS reagent (Promega: G3581) was added to each well for 2 hours, and OD values of 490 nm and 630 nm were read and the degree of glutamine dependence of each cell clone was calculated by the following formula. The results are shown in Figure 4.

As shown in Figure 4, the cell monoclonal dependence on glutamine dependence ranged from 0.00% to 86.21%, with an average of 23.61% and a standard deviation of 20.26%. A total of 14 high glutamine-dependent cells were screened based on the mean plus one standard deviation of 43.87%, and the screening ratio was 15.6%. By observing the cell morphology and growth state of 14 single cell clones, 9 cell clones #1A5, #1C4, #2A1, #2B2, #2B4, #2D5, #3B4, #3C2 and #3D6 were selected for subsequent experiments. .

Example 5: Detection of GS-deficient HEK293 monoclonal cells GS protein expression, gene sequencing, and dependence on glutamine concentration.

(1) GS-deficient HEK293 single-cell clone GS protein expression assay.

The 9 glutamine-dependent HEK293 single cell clones and HEK293 primordial cells were screened with high glucose DMEM complete medium (containing 10% calf serum and 4 mM glutamine), 37 ° C, 5% CO ₂ environment. Cultivate to nearly 100% overgrown. The medium was removed and 500 μl of 1×PAGE loading buffer was added and the cells were scraped with a cell scraper to 1.5 ml EP tubes. The samples were treated in boiling water for 10 minutes and then 20 μl were loaded per well in a PAGE gel. After the end of the electrophoresis, the protein was transferred to a NC (PALL No. P/N66485) membrane, and after blocking, the primary mouse-anti-hGS (BD: 610517) and mouse-anti-hactin β (abcam: ab8224) were incubated for 1 hour. After washing, the secondary antibody goat-anti-mouse IgG (Thermo: A16072) was incubated and ECL (Tanon: 180-501) was developed, and the results are shown in Fig. 5.

The results showed that #1A5, #1C4, #2A1, #2B2, #2B4 could not detect GS protein expression completely; #2D5, #3B4, #3C2 and #3D6 had a small amount of GS protein expression; HEK293 primordial cells had high content of GS protein. The results of actinβ showed that the sample loading was uniform. In order to reduce the amount of subsequent experimental work, #2B4 and #3D6 were randomly selected to complete the subsequent experiments.

(2) #2B4 and #3D6 single cell clone gene sequencing detection

#2B4 and #3D6 were grown as above to a 60 mm culture dish to nearly 100% overfill. The cells were scraped with a cell scraper and centrifuged to remove the supernatant. Resuspend the cells to 500 μl lysis buffer (100 mM NaCl, 10 mM Tris-Cl (pH 8.0), 25 mM EDTA (pH 8.0), 0.5% SDS, 0.2 mg/ml proteinaseK and 100 μg/ml RNaseA) at 55 ° C incubator Incubate for 2 hours. After the reaction, the genomic DNA was purified by a phenol chloroform DNA extraction method. Using genomic DNA as a template, GS#E3F and GS#E3R were primers, by touch down PCR (conditional annealing temperature decreased from 62 ° C to 52 ° C, 1 ° C / cycle, 10 cycles, then decreased from 52 ° C to 48 °C, 35 cycles) Amplification of the third exon fragment of the #2B4 and #3D6GS genes. The obtained E3 fragment was ligated into the BamHI and HindIII restriction sites of the plasmid pShCMV-MCS. The ligation product was transferred into Escherichia coli DH5α, smeared and cultured overnight. Five bacterial colonies were randomly selected from each cell for sequencing. The sequencing results are shown in Fig. 6.

The results showed that the five #2B4 colonies tested lacked the 7 bases of CCCTGGA in the third exon of GS, and the frameshift variant could not express the correct GS protein. Of the 5 #3D6 samples, 4 samples also showed that the GS third exon lacked the CCCTGGA sequence to form a frameshift mutation, and one sample showed a lack of an A base mutation before the CCCTGGA sequence. This mutation was also a frameshift. mutation. The GS protein was not expressed in both #3D6 mutations.

(3) #2B4 and #3D6 for glutamine concentration dependent detection.

Each cell of #2B4, #3D6 and HEK293 was seeded at 0.5×10 ⁶ cells/dish in 5 plates of 35 mm culture dish and added with high glucose DMEM complete medium (containing 10% calf serum and 1X non-essential amino acid mixture). Five different concentrations of glutamine at 0 μM, 50 μM, 100 μM, 200 μM and 2 mM were cultured for 6 days at 37 ° C in a 5% CO ₂ atmosphere. The results of staining with removal of the medium and addition of crystal violet (Biotech E607309-0100) are shown in FIG.

The results showed that #2B4 and #3D6 cells could not grow at a low glutamine concentration of 0 to 200 μM, but the growth state of the original HEK293 was substantially the same after adding a sufficient amount of glutamine (2 mM) to the medium. The original HEK293 cells can grow even under GS gene-free conditions even in the absence of glutamine.

Example 6: Domestication #2B4 and #3D6 cells were adapted to serum-free suspension culture

(1) Serum-free suspension culture and domestication

The adherently cultured HEK293GSKO-#2B4 and HEK293GSKO-#3D6 were trypsinized and diluted in 20 ml of CDM (Hyclone: SH30858.02) medium supplemented with 4 mM glutamine at a final concentration of 0.5×10 ⁶ cells/mL. Then, it was cultured in a constant temperature shaker at 37 ° C, 5% CO ₂ and a rotation speed of 160 rpm. After the cell density reached 3 × 10 ⁶ cells/ml, the supernatant was centrifuged, and again inoculated in the same medium at a concentration of 0.5 × 10 ⁶ cells/ml to continue the culture and continuously cultured for 5 passages in the same manner.

(2) Glutamine-dependent detection of cells after serum-free suspension culture and acclimation

HEK293GSKO-#2B4, HEK293GSKO-#3D6 and HEK293 adapted to serum-free suspension culture were inoculated at a concentration of 0.5×10 ⁶ cells/ml in CDM medium containing 0.4 mM or 4 mM glutamine, respectively, and then placed at 37 ° C. The culture was carried out in a constant temperature shaker of 5% CO ₂ at a rotation speed of 160 rpm. The number of viable cells was sampled every 24 hours, and the results are shown in Fig. 8.

The results showed that under low glutamine conditions (0.4 mM), HEK293GSKO-#2B4 and HEK293GSKO-#3D6 could reach a maximum of 1.46×10 ⁶ cells/ml, while HEK293 cells expressing GS could grow to 3.09×10 ⁶ cells/ Ml; at high glutamine concentration (4 mM), HEK293GSKO-#2B4 viable cell concentration can reach 5.08×10 ⁶ cells/ml, HEK293GSKO-#3D6 live cell concentration can reach 3.46×10 ⁶ cells/ml and HEK293 live cell concentration (4.25 × 10 ⁶ cells / ml) is equivalent. This result demonstrates that GS-deficient HEK293 cells after acclimatization in serum-free suspension culture still have glutamine-dependent properties.

Example 7: Construction of recombinant protein expression cell line with HEK293GSKO-#2B4 cells

(1) Construction of an expression vector.

The pShCMV-EGFP-IRES-GS plasmid (Fig. 9) and the negative control plasmid pShCMV-EGFP were separately transferred to DH5α competent cells for plating overnight, and the monoclonal clones were selected and inoculated in 800 ml LB (containing 100 μg/ml ampicillin). 24 hours. The obtained bacterial liquid is purified by an alkali lysis method and a cesium chloride density gradient centrifugation method to prepare high-purity DNA.

(2) Cell transfection.

HEK293GSKO-#2B4 cells were cultured in 60 mm culture dishes with high glucose DMEM complete medium (containing 10% calf serum and 4 mM glutamine) at 37 ° C, 5% CO ₂ to 60% monolayer; 5 μg pShCMV -EGFP-IRES-GS plasmid and negative control plasmid pShCMV-EGFP plasmid were diluted into 220 μl of deionized water, and 30 μl of 2M calcium chloride and 250 μl of 2×HEPES buffer were added to the bottom and the liquid surface, respectively, and mixed by bubble method; room temperature After standing for 15 minutes, the mixture was accelerated and the DNA mixture was all added to the cells; after incubation for 8 hours at 37 ° C in a 5% CO ₂ cell incubator, fresh medium was replaced.

(3) Cell screening.

After 48 hours of transfection, the cells were washed twice with PBS, and the medium was changed to DMEM (addition of 10% calf serum and 1 x non-essential amino acid mixture) to continue the culture without glutamine medium. When the cells were 80% full, they were digested with trypsin and plated at a concentration of 2 x 10 ⁶ cells per 100 mm dish. After 3 consecutive cultures, it was observed by fluorescence microscopy that the fluorescence ratio of HEK293GSKO-#2B4 cells transfected with pShCMV-EGFP-IRES-GS plasmid decreased first and then gradually increased, and the cells grew slowly on glutamine-free medium after transfection. With a large number of floating dead cells, the cell growth rate gradually recovered after the second generation, the EGFP positive proportion gradually increased, and the fluorescence intensity increased slightly. The proportion of pShCMV-EGFP transfected with negative control cells gradually decreased, and the cell growth rate gradually decreased with a large number of dead cells and there was no improvement (see Figure 10).

(4) Gradually increase the MSX concentration screening.

HEK293GSKO-#2B4 cells transfected with pShCMV-EGFP-IRES-GS plasmid and fully adapted to glutamine-free culture conditions were sequentially screened under 5 μM MSX, 10 μM MSX, 25 μM MSX, 50 μM MSX. The cells were cultured for 3 to 5 passages at each MSX screening concentration, and each screening pressure was comprehensively judged by indicators such as cell growth rate, cell morphology, EGFP fluorescence ratio, and EGFP fluorescence intensity. Cells were cultured in 100mm petri dishes, grown to 80% of each full plate, and digested with trypsin at 2 × 10 ⁶ cells / dish replated. The cells were sampled at different screening stages and analyzed by flow cytometry. The results are shown in Figure 11.

The results showed that the EGFP positive ratio and the single cell fluorescence intensity increased rapidly after increasing the MSX screening pressure, and the EGFP high expression population appeared in the population after 50 μM MSX screening. The proportion of this population increased rapidly after the MSX screening pressure increased.

Claims (11)

1. The sgRNA sequence of the GS gene is characterized by having one of the sequences set forth in SEQ ID NO. 2-82.
2. The sgRNA sequence according to claim 1, which is one selected from the group consisting of the sequence of 5' or 3' of the sequence of SEQ ID NO. 2-82 extending or shortening by 1-5 bases.
3. A vector comprising the sgRNA sequence of claim 1.
4. A method for screening a glutamine synthetase-deficient HEK293 cell line, comprising the steps of:

   (A) screening for sgRNA sequences that can be used for the HEK293 endogenous GS gene;

   (B) HEK293 transiently transfects a plasmid containing the sgRNA sequence of the HEK293 endogenous GS gene obtained by the screening of step (A), and screening for glutamine by comparing MTS cell proliferation assays in which the cells proliferate at high and low glutamine concentrations. Dependent cell line.
5. The method according to claim 4, further comprising the step (C) identifying the screening cell by at least one of cell morphology, doubling time, GS protein expression immunoblotting, gene sequencing or glutamine concentration-dependent detection. Strain.
6. The method according to claim 4 or 5, further comprising the step (D) culturing the domesticated glutamine-dependent cell strain in serum-free suspension culture.
7. The method according to any one of claims 4-6, wherein the screening of the sgRNA sequence useful for the HEK293 endogenous GS gene in the step (A) comprises the following steps:

   (1) constructing a plasmid containing GS-sgRNA;

   (2) constructing a plasmid containing an exon fragment of a marker protein and a glutamine synthetase gene which require recombinant repair in a sequence overlapping region;

   (3) The plasmid containing GS-sgRNA was co-transfected into HEK293 cells with a plasmid containing the exon fragment of the marker protein and the glutamine synthetase gene which need to be recombinantly repaired in the overlapping region, and the plasmid was repaired by the recombinant repair efficiency of the labeled protein. The efficiency was screened for the sgRNA sequence of the HEK293 endogenous GS gene.
8. A glutamine synthetase-deficient HEK293 cell line characterized by HEK293GSKO-#2B4 and HEK293GSKO-#3D6, wherein the HEK293GSKO-#2B4 has a GS gene sequence as shown in SEQ ID NO. 85, the HEK293GSKO - #3D6 Its GS gene gene sequence is shown in SEQ ID NO.
9. Use of the glutamine synthetase-deficient HEK293 cell line of claim 8 for expression of a recombinant protein.
10. A method for screening a cell line expressing a high expression recombinant protein, comprising the steps of:

    1 constituting a plasmid containing the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase, wherein the gene sequence of the recombinant protein of interest and the gene sequence of the glutamine synthetase may be located on the same plasmid or may be located in different plasmids. on;

    2 using the glutamine synthetase-deficient HEK293 cell line to transiently transfect the plasmid containing the gene sequence of the recombinant protein of interest and the gene sequence of glutamine synthetase according to step 1, if the gene sequence of the recombinant protein of interest And the gene sequences of glutamine synthetase are located on different plasmids, respectively, and co-transfection of HEK293 cells is required;

    3 screening for stably transfected cell populations;

    4 Screening of recombinant protein high expression cell lines by stepwise increasing MSX concentration.
11. The method according to claim 10, wherein the step of screening the stably transfected cell population is the antibiotic screening or the medium for culturing/removing glutamine; and the step 4 is to screen the cells for MSX. The concentration is increased from 0 μM to 3000 μM.

Images