WO2019093585A1 - 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 - Google Patents

다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 Download PDF

Info

Publication number
WO2019093585A1
WO2019093585A1 PCT/KR2018/001509 KR2018001509W WO2019093585A1 WO 2019093585 A1 WO2019093585 A1 WO 2019093585A1 KR 2018001509 W KR2018001509 W KR 2018001509W WO 2019093585 A1 WO2019093585 A1 WO 2019093585A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
dexamethasone
multiple myeloma
treatment
prognosis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/001509
Other languages
English (en)
French (fr)
Inventor
정연준
민창기
정승현
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Catholic University of Korea
Original Assignee
Industry Academic Cooperation Foundation of Catholic University of Korea
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Catholic University of Korea filed Critical Industry Academic Cooperation Foundation of Catholic University of Korea
Publication of WO2019093585A1 publication Critical patent/WO2019093585A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to a biomarker for predicting the prognosis for the treatment of lenalidomide and dexamethasone in patients with multiple myeloma, and more particularly to a biomarker for predicting prognosis for the treatment of multiple myeloma with lenalidomide and dexamethasone, a biomarker composition for predicting the prognosis for the treatment of dexamethasone, a composition for predicting prognosis for the treatment of lenalidomide and dexamethasone in a multiple myeloma patient comprising a primer or a probe specifically binding to the biomarker, A kit for predicting prognosis for the treatment of lenalidomide and dexamethasone in a multiple myeloma patient comprising a primer or a probe specifically binding to a marker, a method for providing information on prognosis prediction for the treatment of lenalidomide and dexamethasone, and For the treatment of len
  • Multiple myeloma is a blood cancer that occurs in plasma cells and is found in bone marrow. Multiple myeloma causes a group of plasma cells, or myeloma cells, to make and proliferate tumors and increase the number of plasma cells beyond the baseline. Because plasma cells circulate extensively in the body, they have the potential to affect many bones in the human body and can therefore cause compression fractures, bone dissolution and related pain. Multiple myeloma can affect bone, immune system, kidney, and the number of red blood cells in individuals and can cause serious health problems. Common symptoms include bone pain, fatigue, and helplessness. Multiple myeloma is a rare cancer, with about 20,000 cases in the United States each year and about 114,000 cases worldwide.
  • Treatment of multiple myeloma is a combination of various drugs, and treatment of lenalidomide and dexamethasone in various combinations of therapies is a standard for the treatment of relapsed / refractory multiple myeloma.
  • it is essential to identify pathways that are the source of therapy resistance or recurrence and identify biomarkers for therapeutic response and prognosis prediction, as the disease continues.
  • Recent miRNAs have been proposed as circulating invasive prognostic factors for multiple myeloma, including recurrence, which can complement traditional invasive tumor cell tests by bone marrow biopsy.
  • circulating miRNA markers associated with the treatment of lenalidomide and dexamethasone have not been studied.
  • Studies on circulating miRNA markers can improve outcome outcomes and choice of treatment options in clinical outcomes. Therefore, the inventors of the present invention investigated the expression of serum miRNA in patients undergoing lenalidomide and dexamethasone treatment to determine the prognosis for the treatment of lenalidomide and dexamethasone in patients with multiple myeloma The marker was confirmed, and the present invention was completed.
  • the present inventors examined miRNA expression in sera from patients with good prognosis and patients with poor prognosis among patients who were treated with lenalidomide and dexamethasone to identify miRNAs having a difference between the two patients , And biomarkers for predicting prognosis for treatment of lanalidomide and dexamethasone in patients with multiple myeloma.
  • the biomarker composition of the present invention may include miR-193a and miR-26a.
  • the miR-193a of the present invention is miR-193a-5p; MiR-26a is miR-26a-5p; MiR-29c is miR-29c-3p; MiR-30b is miR-30b-5p; MiR-30c is miR-30c-5p; And miR-331 may be miR-331-3p.
  • the biomarker composition for predicting prognosis of the present invention may be any one or more of those selected from the group consisting of cytogenetics, symptomatic multiple myeloma stage, hemoglobin, WBC and calcium concentration , ≪ / RTI >
  • Another object of the present invention is to provide a primer or a probe that specifically binds to any one or more genes selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR- And a kit for predicting prognosis for the treatment of lenalidomide and dexamethasone in a patient with multiple myeloma.
  • the kit of the present invention may be characterized as comprising miR-193a and miR-26a.
  • the miR-193a of the present invention is miR-193a-5p; MiR-26a is miR-26a-5p; MiR-29c is miR-29c-3p; MiR-30b is miR-30b-5p; MiR-30c is miR-30c-5p; And miR-331 may be miR-331-3p.
  • the biomarker composition for predicting prognosis of the present invention may be any one or more of those selected from the group consisting of cytogenetics, symptomatic multiple myeloma stage, hemoglobin, WBC and calcium concentration , ≪ / RTI >
  • Another object of the present invention is to provide a method of treating a patient suffering from multiple myeloma who has been treated with lanaridomide and dexamethasone, comprising the steps of: selecting from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR- Determining the level of expression of any one or more of the genes; And
  • the gene of the present invention may be characterized as comprising miR-193a and miR-26a.
  • the miR-193a of the present invention is miR-193a-5p; MiR-26a is miR-26a-5p; MiR-29c is miR-29c-3p; MiR-30b is miR-30b-5p; MiR-30c is miR-30c-5p; And miR-331 may be miR-331-3p.
  • Methods for measuring the miRNA expression level of the present invention include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA) , Northern blotting, miRNA sequencing, a PCR array, and a DNA chip.
  • the measurement may be performed using at least one selected from the group consisting of DNA sequencing, Northern blotting, miRNA sequencing, PCR array and DNA chip.
  • One of the miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR-331 from the multiple myeloma patient sample treated with the lenalidomide and dexamethasone of the present invention Measuring the expression level of the above gene; (ISS stage), hemoglobin, leukocyte (WBC), and calcium from samples of multiple myeloma patients treated with lanalidomide and dexamethasone, either of which are selected from the group consisting of cytogenetics, symptomatic multiple myeloma stage Measuring one or more clinical values; Further comprising the mRNA expression level of said gene; And comparing the clinical value with a good control sample of the treatment of lanaridomide and dexamethasone; As shown in FIG.
  • Methods for providing information useful for predicting prognosis for the treatment of lenalidomide and dexamethasone in patients with multiple myeloma as described above include cytogenetics, symptoms from multiple myeloma patient samples treated with lanalidomide and dexamethasone (ISS) stage, hemoglobin, leukocyte (WBC), and calcium concentration in a patient in need of such treatment.
  • ISS lanalidomide and dexamethasone
  • WBC leukocyte
  • Another object of the present invention is to provide a primer or a probe that specifically binds to any one or more genes selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR- And to provide a composition for predicting prognosis for the treatment of lenalidomide and dexamethasone in multiple myeloma patients.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR-331 from a multiple myeloma patient sample treated with lanalidomide and dexamethasone Measuring the expression level of the gene; Comparing the miRNA expression level of the gene with a good control sample of the prognosis of treatment with lanalidomide and dexamethasone; And administering a therapeutic agent for multiple myeloma other than lenalidomide and dexamethasone when the miRNA expression level of the gene is low, comparing the miRNA expression level of the gene with a good prognosis control sample. And provides a method for predicting and treating prognosis for treatment of nullidomide and dexamethasone.
  • Another object of the present invention is to provide a method of treating a patient suffering from multiple myeloma comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR-
  • the present invention provides the use of the above-mentioned biomarker composition for use in a method for diagnosing the prognosis prediction for the treatment of lenalidomide and dexamethasone.
  • the present invention relates to a biomarker for prediction of prognosis for the treatment of lenalidomide and dexamethasone in a multiple myeloma patient.
  • the biomarker of the present invention and five clinical variables (chromosome abnormality data, symptomatic multiple myeloma stage, hemoglobin, Leukocyte, and calcium), with the effect of increasing the sensitivity and specificity of the prognosis for the treatment of lanalidomide and dexamethasone.
  • Figure 1 is a Kaplan-Meier curve graph of overall survival (time to progession) by miRNA expression levels.
  • Figure 2 is a Kaplan-Meier curve graph for overall survival (OS) by miRNA expression levels.
  • FIG. 3 shows the scores of each patient according to the expression levels of miRNAs in order to investigate the effect of miRNA on the prognosis, and the converted scores were used to calculate the overall time to progession or OS (overall survival) Respectively.
  • FIG. 4 is a graph showing the ROC curve of the LdTRP model with five clinical parameters (chromosomal abnormalities, symptomatic multiple myeloma stage, hemoglobin, leukocyte and calcium) and two miRNAs (miR-26a-5p and miR-193a-5p) ROC curve graph of the constructed LdTRP model, clinical variables (green) and miRNA (blue).
  • the present inventors examined the expression of miRNAs in the serum of patients with good prognosis and patients with poor prognosis among patients who were treated with lenalidomide and dexamethasone, The present inventors completed the present invention by identifying miRNAs and confirming biomarkers for predicting prognosis for treatment of lanalidomide and dexamethasone in patients with multiple myeloma.
  • the present invention provides a method for the treatment of lenalidomide and dexamethasone in a patient with multiple myeloma of any one or more genes selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR- Thereby providing a biomarker composition.
  • the nucleotide sequence of the miRNA of the present invention is shown in Table 1 below.
  • the gene of the present invention may be characterized as comprising miR-193a and miR-26a.
  • the miR-193a of the present invention is miR-193a-5p; MiR-26a is miR-26a-5p; MiR-29c is miR-29c-3p; MiR-30b is miR-30b-5p; MiR-30c is miR-30c-5p; And miR-331 may be miR-331-3p, and the nucleotide sequence of the miRNA of the present invention is shown in Table 2 below.
  • biomarker composition for predicting prognosis is selected from the group consisting of cytogenetics, symptomatic multiple myeloma stage (ISS stage), hemoglobin, white blood cell (WBC) and calcium concentration And may further comprise a composition.
  • chromosomal abnormalities include (1) hypodiploidy or chromosome 13 deletion in a bone marrow chromosome assay that analyzes the chromosomal aberration and structural abnormality in a progenitor cell during cleavage, (2) t (4; 14), t (14; 16) or chromosome 17 in the high risk group.
  • the bone marrow chromosome assay can be measured by a general test.
  • the symptomatic multiple myeloma stage (ISS stage) is a standard for dividing symptomatic multiple myeloma by stage 1, stage 2 and stage 3 in the international stage system.
  • the criteria are shown in Table 3 below.
  • the following measurements of serum albumin and ⁇ 2 -microglobulin can be measured by a general test method.
  • the serum levels of hemoglobin, leukocyte, and calcium can be measured by a general blood test. Serum Thrombopoietin and clinical indices are used as predictors of disease progression in multiple myeloma patients (Korean Journal of Diagnostic Radiology, 29, ), But is not limited thereto.
  • the one or more genes may be used independently or in combination as biomarkers for prediction of prognosis for the treatment of lenalidomide and dexamethasone in patients with multiple myeloma.
  • the present invention relates to a method for screening for a multiresponse gene comprising a primer or a probe specifically binding to any one or more genes selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR- Provides kits for predicting prognosis for the treatment of lanalidomide and dexamethasone in patients with myeloma.
  • the kit of the present invention may be characterized as comprising miR-193a and miR-26a.
  • the miR-193a of the present invention is miR-193a-5p; MiR-26a is miR-26a-5p; MiR-29c is miR-29c-3p; MiR-30b is miR-30b-5p; MiR-30c is miR-30c-5p; And miR-331 may be miR-331-3p, and the nucleotide sequence of the miRNA of the present invention is shown in Table 2 above.
  • biomarker composition for predicting prognosis is selected from the group consisting of cytogenetics, symptomatic multiple myeloma stage (ISS stage), hemoglobin, white blood cell (WBC) and calcium concentration And may further comprise a composition.
  • the sample may be at least one selected from the group consisting of tissue, cell, whole blood, serum, and plasma.
  • the gene of the present invention may be characterized as comprising miR-193a and miR-26a.
  • the miR-193a of the present invention is miR-193a-5p; MiR-26a is miR-26a-5p; MiR-29c is miR-29c-3p; MiR-30b is miR-30b-5p; MiR-30c is miR-30c-5p; And miR-331 may be miR-331-3p, and the nucleotide sequence of the miRNA of the present invention is shown in Table 2 above.
  • the control group may be a good prognosis for the treatment of lenalidomide and dexamethasone.
  • the response to lenalidomide and dexamethasone is CR (complete response) or VGPR (very good partial response).
  • the therapeutic response of lenalidomide and dexamethasone is PR response, MR (minimal response), SD (stable disease), or PD (progressive disease).
  • the therapeutic response of lanalidomide and dexamethasone is assessed by the International Myeloma Working Group (IMWG) and the European Group for Blood and Marrow (EBMT).
  • Methods for measuring miRNA expression levels include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA) But is not limited to, one or more selected from the group consisting of Northern blotting, miRNA sequencing, PCR array, and DNA chip.
  • RPA RNase protection assay
  • Methods for providing information useful in predicting the prognosis for the treatment of lenalidomide and dexamethasone in patients with multiple myeloma include cytogenetics from multiple myeloma patient samples treated with lanalidomide and dexamethasone, (ISS) stage, hemoglobin, leukocyte (WBC), and calcium concentration.
  • the method of the present invention may further comprise the step of measuring one or more clinical values selected from the group consisting of a myeloma stage (ISS stage), hemoglobin,
  • chromosomal abnormalities include (1) hypodiploidy or chromosome 13 deletion in a bone marrow chromosome assay that analyzes the chromosomal aberration and structural abnormality in a progenitor cell during cleavage, (2) t (4; 14), t (14; 16) or chromosome 17 in the high risk group.
  • the symptomatic multiple myeloma stage (ISS stage) is a standard for dividing symptomatic multiple myeloma by stage 1, stage 2 and stage 3 in the international stage system. The criteria are shown in Table 3 above.
  • the serum levels of thrombopoietin and clinical indices were used as predictors of disease progression in patients with multiple myeloma (Korean Journal of Diagnostic Radiology, 29, 1, 2009; Lee, Jaejin et al., 3) , But is not limited thereto.
  • the present invention also relates to a method of treating a patient suffering from multiple myeloma which has been treated with lanaridomide and dexamethasone, which comprises administering to the patient a compound selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR- Measuring the expression level of the above gene; Comparing the miRNA expression level of the gene with a good control sample of the prognosis of treatment with lanalidomide and dexamethasone; And administering a therapeutic agent for multiple myeloma other than lenalidomide and dexamethasone when the miRNA expression level of the gene is low, comparing the miRNA expression level of the gene with a good prognosis control sample. And provides a method for predicting and treating prognosis for treatment of nullidomide and dexamethasone.
  • the therapeutic agents for multiple myeloma other than lanalidomide and dexamethasone include vancristine, doxorubicin, and liposomal doxorubicin, which are types of alkylating agents, melphalan, cyclophosphamide and other cytotoxic drugs, prednisone, immunomodulatory drugs (IMIDs) But are not limited to, thalidomide, pomalidomide, and bortezomib, carfilzomib, ixazomib, which are proteasome inhibitor (PI) classes.
  • PI proteasome inhibitor
  • the present invention also relates to a method of treating a patient suffering from multiple myeloma which has been treated with lanaridomide and dexamethasone, which comprises administering to the patient a compound selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR- Measuring the expression level of the above gene; Comparing the miRNA expression level of the gene with a good control sample of the prognosis of treatment with lanalidomide and dexamethasone; And administering the lenalidomide and dexamethasone when the miRNA expression level of the gene is equal to or higher than the miRNA expression level of the gene compared to a good control sample of the treatment of lanalidomide and dexamethasone
  • the prognosis for treatment of lenalidomide and dexamethasone in patients with multiple myeloma is predicted and treated.
  • the present invention also relates to a method for screening for a multivalent or multifunctional antibody comprising a primer or a probe specifically binding to any one or more genes selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR- A composition for predicting prognosis for the treatment of lanaridomide and dexamethasone in a myeloma patient can be provided.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a compound selected from the group consisting of miR-193a, miR-26a, miR-29c, miR-30b, miR-30c and miR-331 in a biological sample isolated from the therapeutic multiple myeloma population of lanaridomide and dexamethasone
  • the use of the above-described biomarker composition for use in a method for diagnosing prognosis prediction for the treatment of lanalidomide and dexamethasone by measuring the level of any one or more genes can be provided.
  • the 100 patients with multiple myeloma were given weekly lenalidomide 25 mg once a day and 40 mg dexamethasone 1 day on days 1-21 of each 28-day cycle.
  • Serum samples from 38 of the 100 patients were collected, and TaqMan Low Density miRNA Array (TLDA) was performed and the predictive markers for lenalidomide and dexamethasone prognosis were identified in patients with multiple myeloma.
  • TLDA TaqMan Low Density miRNA Array
  • TLDA TaqMan Low Density miRNA Array
  • miRNAs were extracted from patient serum using TaqMan miRNA ABC Purification Kit. The extracted miRNAs were converted to cDNA using megaplex reverse transcription kit. Then, the amount of cDNA was amplified using Megaplex PreAmp Primers Human Pool A and TaqMan PreAmp Master Mix.
  • Real-time PCR reaction was performed by adding the amplified product to TaqMan Low Density miRNA Array (TLDA).
  • Raw data analysis of real-time PCR was performed using the ExpressionSuite program and the amplification values (Ct values) of each miRNA were obtained. For the analysis of TLDA, the amplified values were corrected with miR-320 and the expression values of each miRNA were measured by applying the 2- ⁇ Ct method.
  • the median follow-up period of 38 patients with multiple myeloma was 15.6 months (range: 0.4 ⁇ 33.6) from the beginning of treatment with Len-dex.
  • the 2-year progression time (overall survival) and overall survival rate (OS) were 22.7% and 64.2% Respectively.
  • the expression levels of 19 miR-26a-5p, miR-29c-3p, and miR-30b-5p genes in 19 patients with good prognosis and 19 patients with poor prognosis were compared , miR-30c-5p, miR-193a-5p, and miR-331-3p) were significantly decreased in patients with poor prognosis.
  • real-time PCR was performed on 26 patients with good prognosis and 36 patients with poor prognosis, and it was confirmed that expression was significantly decreased in all six miRNAs.
  • a machine learning algorithm analysis was performed to develop a prognostic prediction model for the treatment of lenalidomide and dexamethasone in patients with multiple myeloma. This analysis included 18 clinical variables and the 6 miRNAs, and the clinical variables were used under IRB approval for data measured in the patient care process.
  • the support vector machine (SVM) was applied to the machine learning algorithm, resulting in a total of 2,468,732 variable combinations.
  • the model showing the best predictive power among these variable combinations consists of five clinical variables (chromosome aberration data, ISS stage, hemoglobin, WBC and calcium) and two miRNAs (miR-26a-5p and miR-193a-5p) , And this was defined as the Len-dex treatment response prediction (LdTRP) model of treatment with lanalidomide and dexamethasone.
  • LdTRP Len-dex treatment response prediction

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 다발성 골수종 환자에서 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료에 대한 예후 예측용 바이오 마커에 관한 발명으로, 보다 상세하게는 다발성 골수종 환자에서 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료에 대한 예후 예측용 바이오 마커, 상기 바이오마커에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 조성물, 상기 바이오 마커 에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트, 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측의 정보제공방법, 및 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측 및 치료방법을 제공한다.

Description

다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커
본 출원은 2017년 11월 08일 출원된 대한민국 특허출원 제 10-2017-0148052호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 다발성 골수종 환자에서 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료에 대한 예후 예측용 바이오 마커에 관한 발명으로, 보다 상세하게는 다발성 골수종 환자에서 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료에 대한 예후 예측용 바이오 마커 조성물, 상기 바이오 마커에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 조성물, 상기 바이오 마커에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트, 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측의 정보제공방법, 및 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측 및 치료방법을 제공한다.
다발성골수종(Multiple myeloma)은 형질세포(plasma cells)에서 발생하는 혈액 암으로 골수에서 발견된다. 다발성골수종은 일단의 형질 세포, 또는 골수종 세포들이 종양을 만들고 증식하며 형질세포의 수를 기준치보다 증가시킨다. 형질세포가 체내를 광범위하게 순환하기 때문에 이들은 인체의 많은 뼈들에 영향을 미칠 수 있는 잠재력을 지녔으며, 따라서 압박골절, 뼈 용해 및 관련 통증을 유발할 수 있다. 다발성골수종은 뼈와 면역체계, 신장 및 개인의 적혈구 수에 영향을 미쳐 심각한 건강 문제를 야기할 수 있으며, 통상적인 증상으로는 뼈 통증과 피로, 무력감 등이 있다. 다발성골수종은 희귀암의 일종으로 매년 미국에서 약 2만 건, 세계적으로 11만 4000건이 발생한다.
다발성 골수종을 치료는 다양한 약물을 혼합하여 치료하는데, 치료제의 다양한 조합중에 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료는 재발성/불응성 다발성 골수종 치료의 표준이다. 그러나 다발성 골수종 환자는 치료에도 불구하고, 병이 계속 진행되기 때문에 치료 저항성 또는 재발의 근원인 경로를 발견하고 치료 반응 및 예후 예측을 위한 바이오 마커를 확인하는 것이 필수적이다. 최근 골수 생검에 의한 전통적인 침윤성 종양 세포 검사를 보완 할 수 잇는 재발을 포함한 다발성 골수종에 대한 순환 침윤성 예후 인자로서 순환하는 miRNA가 제안되었다. 그러나 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료와 관련된 순환 miRNA 마커는 연구되지 않았다. 순환 miRNA 마커에 대한 연구는 임상 결과에서 치료 결과 예측 및 치료 옵션 선택을 향상 시킬 수 있다. 따라서 본 발명의 연구자들은 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료를 받는 환자에서 혈청 miRNA의 발현을 조사하여, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커를 확인하고, 본 발명을 완성하였다.
본 발명자들은 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료를 받은 환자 중에 예후가 좋은 환자와 예후가 나쁜 환자의 혈청에서 miRNA의 발현을 조사하여 상기 두 환자의 차이가 있는 miRNA를 확인하여, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커를 확인하여 본 발명을 완성하였다.
본 발명의 목적은 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 조성물를 제공하는 것이다 .
본 발명의 상기 바이오 마커 조성물은 miR-193a 및 miR-26a를 포함하는 것을 특징으로 할 수 있다.
본 발명의 상기 miR-193a는 miR-193a-5p; 상기 miR-26a는 miR-26a-5p; 상기 miR-29c는 miR-29c-3p; 상기 miR-30b는 miR-30b-5p; 상기 miR-30c는 miR-30c-5p; 및 상기 miR-331는 miR-331-3p일 수 있다.
본 발명의 상기 예후 예측용 바이오 마커 조성물은 염색체이상 (cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 조성물을 추가로 더 포함할 수 있다.
본 발명의 또 다른 목적은 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트를 제공하는 것이다.
본 발명의 상기 키트는 miR-193a 및 miR-26a를 포함하는 것을 특징으로 할 수 있다.
본 발명의 상기 miR-193a는 miR-193a-5p; 상기 miR-26a는 miR-26a-5p; 상기 miR-29c는 miR-29c-3p; 상기 miR-30b는 miR-30b-5p; 상기 miR-30c는 miR-30c-5p; 및 상기 miR-331는 miR-331-3p일 수 있다.
본 발명의 상기 예후 예측용 바이오 마커 조성물은 염색체이상 (cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 조성물을 추가로 더 포함할 수 있다.
본 발명의 또 다른 목적은 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계; 및
상기 유전자의 miRNA 발현 수준을 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하는 단계;
를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법을 제공하는 것이다.
본 발명의 상기 유전자는 miR-193a 및 miR-26a를 포함하는 것을 특징으로 할 수 있다.
본 발명의 상기 miR-193a는 miR-193a-5p; 상기 miR-26a는 miR-26a-5p; 상기 miR-29c는 miR-29c-3p; 상기 miR-30b는 miR-30b-5p; 상기 miR-30c는 miR-30c-5p; 및 상기 miR-331는 miR-331-3p일 수 있다.
본 발명의 상기 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하에 대한 예후가 좋지 않은 것으로 판단할 수 있다.
본 발명의 상기 miRNA 발현 수준을 측정하는 방법은 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR (Real-time RT-PCR), RNase 보호 분석법 (RPA; RNase protection assay), 노던 블랏팅 (Northern blotting), miRNA 시퀀싱 (miRNA sequencing), PCR 어레이 (PCR array) 및 DNA 칩으로 이루어진 군으롭부터 선택되는 어느 하나 이상을 이용하여 측정하는 것을 특징으로 할 수 있다.
본 발명의 상기 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계; 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 염색체이상 자료(cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘으로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 단계; 를 추가로 더 포함하여 상기 유전자의 mRNA 발현 수준; 및 상기 임상 수치를 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하는 단계; 를 더 포함할 수 있다.
상기 서술한 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법에 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 염색체이상 자료(cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 단계를 추가로 더 포함 할 수 있다.
본 발명의 또 다른 목적은 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 조성물을 제공하는 것이다.
본 발명은 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계; 상기 유전자의 miRNA 발현 수준을 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하는 단계; 및 상기 유전자의 miRNA 발현 수준을 예후가 좋은 대조군 시료와 비교하여 상기 유전자의 miRNA 발현 수준이 낮은 경우에 레날리도마이드 및 덱사메타손 이외의 다발성 골수종 치료제를 투여하는 단계;를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측 및 치료하는 방법을 제공한다.
본 발명의 또 다른 목적은 레날리도마이드 및 덱사메타손의 치료 다발성 골수종 개체에서 분리된 생물학적 시료에서 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하여 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측을 진단하는 방법에 사용하기 위한, 상기 서술한 바이오 마커 조성물의 용도를 제공하는 것이다.
본 발명은 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커에 관한 발명으로, 본 발명의 바이오마커 및 5개의 임상 변수 (염색체 이상 자료, 증후성 다발골수종 단계, 혈색소, 백혈구 및 칼슘)의 수치를 가지고 레날리도마이드 및 덱사메타손의 치료에 대한 예후의 민감도, 특이성 정확도가 증가하는 효과가 있다.
도 1은 miRNA 발현 수준에 의한 전체 생존률(time to progession; 진행 시간)에 대한 Kaplan-Meier 곡선 그래프 결과이다.
도 2은 miRNA 발현 수준에 의한 OS(overall survival; 전반적인 생존)에 대한 Kaplan-Meier 곡선 그래프 결과이다.
도 3은 예후에 미치는 miRNA의 효과를 탐색하기 위해 miRNA의 발현 수준에 따라 각 환자의 점수를 매긴 뒤, 환산한 점수를 전체 생존률(time to progession; 진행 시간) 또는 OS(overall survival; 전반적인 생존)으로 계산한 결과이다.
도 4은 LdTRP 모델의 ROC 곡선 5 가지 임상 변수 (염색체 이상 자료, 증후성 다발골수종 단계, 혈색소, 백혈구 및 칼슘)와 2 개의 miRNA (miR-26a-5p 및 miR-193a-5p) (적색)로 구성된 LdTRP 모델, 임상 변수 (녹색) 및 miRNA(파란색)의 ROC 곡선 그래프이다.
이하, 본 발명을 보다 상세히 설명한다.
상술한 바와 같이, 본 발명자들은 레날리도마이드(lenalidomide) 및 덱사메타손(dexamethasone)의 치료를 받은 환자 중에 예후가 좋은 환자와 예후가 나쁜 환자의 혈청에서 miRNA의 발현을 조사하여 상기 두 환자군의 차이가 있는 miRNA를 확인하여, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커를 확인하여 본 발명을 완성하였다.
본 발명은 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 바이오 마커 조성물을 제공한다.
본 발명의 상기 miRNA의 염기서열은 하기 표1과 같다.
miRNA 염기서열
miR-193a CGAGGAUGGGAGCUGAGGGCUGGGUCUUUGCGGGCGAGAUGAGGGUGUCGGAUCAACUGGCCUACAAAGUCCCAGUUCUCGGCCCCCG
miR-26a GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGUUACUUGCACGGGGACGC
miR-29c AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGA
miR-30b ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUGGA
miR-30c AGAUACUGUAAACAUCCUACACUCUCAGCUGUGGAAAGUAAGAAAGCUGGGAGAAGGCUGUUUACUCUUUCU
miR-331 GAGUUUGGUUUUGUUUGGGUUUGUUCUAGGUAUGGUCCCAGGGAUCCCAGAUCAAACCAGGCCCCUGGGCCUAUCCUAGAACCAACCUAAGCUC
본 발명의 상기 유전자는 miR-193a 및 miR-26a를 포함하는 것을 특징으로 할 수 있다.
본 발명의 상기 miR-193a는 miR-193a-5p; 상기 miR-26a는 miR-26a-5p; 상기 miR-29c는 miR-29c-3p; 상기 miR-30b는 miR-30b-5p; 상기 miR-30c는 miR-30c-5p; 및 상기 miR-331는 miR-331-3p일 수 있으며, 본 발명의 상기 miRNA의 염기서열은 하기 표2와 같다.
miRNA 염기서열
miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
miR-26a-5p UUCAAGUAAUCCAGGAUAGGCU
miR-29c-3p UAGCACCAUUUGAAAUCGGUUA
miR-30b-5p UGUAAACAUCCUACACUCAGCU
miR-30c-5p UGUAAACAUCCUACACUCUCAGC
miR-331-3p GCCCCUGGGCCUAUCCUAGAA
상기 예후 예측용 바이오 마커 조성물은 염색체이상 (cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 조성물을 추가로 더 포함할 수 있다.
상기 염색체 이상는 (1) 분열중기세포에서 염색체의 수적, 구조적 이상을 분석하는 골수 염색체 검사법에서 hypodiploidy 또는 13번 염색체 결실이 있거나, (2) 형광동소보합법을 사용하여 t(4;14), t(14;16) 또는 17번 염색체 단완결실이 있는 경우 고위험군으로 정의하였다. 상기 골수 염색체 검사법은 일반적인 검사를 통해 측정할 수 있다.
증후성 다발골수종 단계 (ISS stage)은 국제병기분류 체계에서 1단계, 2단계 및 3단계로 증후성 다발골수종을 나눈 기준이다. 기준은 하기 표 3와 같다. 하기의 혈청 알부민의 측정 및 β2-microglobulin의 측정은 일반적인 검사 방법을 통해 측정할 수 있다.
단계 기준
stage 1 β2-microglobulin(β2M) 3.5mg/L, 혈청 알부민 ≥3.5 g/dL
stage 2 β2M 3.5 mg/L 및 혈청 알부민 3.5 g/dL; 또는 β2M ≥3.5 mg/L 및 5.5 mg/L
stage 3 β2M ≥ 5.5m g/L
혈색소, 백혈구 및 칼슘 농도는 일반혈액 검사를 통해 측정할 수 있으며, 다발성골수종 환자에서 질병 진행 예측인자로서 혈청 Thrombopoietin과 임상지표 분석 (대한진단검사의학회지 제29권 제1호 2009; 이재진 외 3인)의 개시를 참고 할 수 있으나 이에 제한되는 것은 아니다.
상기 하나 이상의 유전자는 독립적 또는 병합으로 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커로 사용할 수 있다.
더불어 본 발명은 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트를 제공한다.
본 발명의 상기 키트는 miR-193a 및 miR-26a를 포함하는 것을 특징으로 할 수 있다.
본 발명의 상기 miR-193a는 miR-193a-5p; 상기 miR-26a는 miR-26a-5p; 상기 miR-29c는 miR-29c-3p; 상기 miR-30b는 miR-30b-5p; 상기 miR-30c는 miR-30c-5p; 및 상기 miR-331는 miR-331-3p일 수 있으며, 본 발명의 상기 miRNA의 염기서열은 상기 표2와 같다.
상기 예후 예측용 바이오 마커 조성물은 염색체이상 (cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 조성물을 추가로 더 포함할 수 있다.
또한 본 발명은 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계; 및 상기 유전자의 miRNA 발현 수준을 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하는 단계; 를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법을 제공한다.
상기 시료는 조직, 세포, 전혈, 혈청 및 혈장으로 이루어진 군으로부터 선택되는 어느 하나 이상 일 수 있다.
본 발명의 상기 유전자는 miR-193a 및 miR-26a를 포함하는 것을 특징으로 할 수 있다.
본 발명의 상기 miR-193a는 miR-193a-5p; 상기 miR-26a는 miR-26a-5p; 상기 miR-29c는 miR-29c-3p; 상기 miR-30b는 miR-30b-5p; 상기 miR-30c는 miR-30c-5p; 및 상기 miR-331는 miR-331-3p일 수 있으며, 본 발명의 상기 miRNA의 염기서열은 상기 표2와 같다.
상기 miR-193a-5p, miR-26a-5p, miR-29c-3p, miR-30b-5p, miR-30c-5p 및 miR-331-3p으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준이 예후가 좋은 대조군 시료와 비교했을 때 낮게 측정되면 치료에 대한 예후가 좋지 않은 것으로 판단할 수 있다. 상기 대조군은 레날리도마이드 및 덱사메타손의 치료에 대한 예후가 좋은 환자일 수 있다.
상기 예후가 좋은 환자는 레날리도마이드 및 덱사메타손의 치료 반응성이 CR (complete response) 또는 VGPR (very good partial response) 이고, 예후가 좋지 않은 환자는 레날리도마이드 및 덱사메타손의 치료 반응성이 PR (partial response), MR (minimal response), SD (stable disease), 또는 PD (progressive disease) 일 수 있으나, 이에 제한되는 것은 아니다. 레날리도마이드 및 덱사메타손의 치료 반응성은 IMWG (International Myeloma Working Group)과 EBMT (European Group for Blood and Marrow)의 기준을 통해 평가된다.
상기 miRNA 발현 수준을 측정하는 방법은 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR (Real-time RT-PCR), RNase 보호 분석법 (RPA; RNase protection assay), 노던 블랏팅 (Northern blotting), miRNA 시퀀싱 (miRNA sequencing), PCR 어레이 (PCR array) 및 DNA 칩으로 이루어진 군으로부터 선택되는 어느 하나 이상을 이용하여 측정할 수 있으나, 이에 제한되는 것은 아니다.
상기 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법에 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 염색체이상 자료(cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 단계를 추가로 더 포함할 수 있다.
상기 염색체 이상는 (1) 분열중기세포에서 염색체의 수적, 구조적 이상을 분석하는 골수염색체 검사법에서 hypodiploidy 또는 13번 염색체 결실이 있거나, (2) 형광동소보합법을 사용하여 t(4;14), t(14;16) 또는 17번 염색체 단완결실이 있는 경우 고위험군으로 정의하였다.
증후성 다발골수종 단계 (ISS stage)은 국제병기분류 체계에서 1단계, 2단계 및 3단계로 증후성 다발골수종을 나눈 기준이다. 기준은 상기 표 3과 같다.
혈색소, 백혈구 및 칼슘은 일반혈액 검사를 통해 측정할 수 있으며, 다발성골수종 환자에서 질병 진행 예측인자로서 혈청 Thrombopoietin과 임상지표 분석 (대한진단검사의학회지 제29권 제1호 2009; 이재진 외 3인)의 개시를 참고 할 수 있으나 이에 제한되는 것은 아니다.
또한 본 발명은 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계; 상기 유전자의 miRNA 발현 수준을 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하는 단계; 및 상기 유전자의 miRNA 발현 수준을 예후가 좋은 대조군 시료와 비교하여 상기 유전자의 miRNA 발현 수준이 낮은 경우에 레날리도마이드 및 덱사메타손 이외의 다발성 골수종 치료제를 투여하는 단계;를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측 및 치료하는 방법을 제공한다.
상기 레날리도마이드 및 덱사메타손 이외의 다발성 골수종 치료제는 Alkylating agents 종류인, melphalan, cyclophosphamide, 다른 화학항암제(Other cytotoxic drugs) 종류인 vincristine, doxorubicin, and liposomal doxorubicin, 스테로이드 종류인 prednisone, Immunomodulatory drugs (IMiDs) 종류인 thalidomide, pomalidomide, proteasome inhibitors (PI) 종류인 bortezomib, carfilzomib, ixazomib 등 일 수 있으나, 이에 제한되지는 않는다.
또한 본 발명은 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계; 상기 유전자의 miRNA 발현 수준을 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하는 단계; 및 상기 유전자의 miRNA 발현 수준을 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하여 상기 유전자의 miRNA 발현 수준이 같거나 높을 경우에 레날리도마이드 및 덱사메타손을 투여하는 단계;를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측 및 치료하는 방법을 제공한다.
또한 본 발명은 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 조성물을 제공할 수 있다.
또한 본 발명은 레날리도마이드 및 덱사메타손의 치료 다발성 골수종 개체에서 분리된 생물학적 시료에서 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 수준을 측정하여 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측을 진단하는 방법에 사용하기 위한, 상기 서술한 바이오 마커 조성물의 용도를 제공할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자에서 샘플 채취
100명의 다발성 골수종 환자를 대상으로 실험을 진행하였다. 상기 100명의 다발성 골수종 환자에게 각 28 일주기의 1-21일에 1일 1회 레날리도마이드 25mg 및 덱사메타손 1일 40mg을 매주 섭취하게 하였다. 상기 100명의 환자들 중 38명의 혈청을 채취하여, TaqMan Low Density miRNA Array (TLDA)를 수행하고 다발성 골수종 환자에게 레날리도마이드 및 덱사메타손 예후 예측 마커를 발굴하였다. 나머지 62명의 다발성 골수종 환자 시료는 TLDA에서 도출된 miRNA의 검증에 사용되었다.
실험예 1. 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 마커 발굴
상기 38명의 다발성 골수종 환자를 대상으로 TaqMan Low Density miRNA Array (TLDA)를 통한 miRNA 발현량 측정을 위해 381개의 miRNA들로 구성된 PCR 어레이를 사용하다. 우선 TaqMan miRNA ABC Purification Kit를 이용하여 환자의 혈청에서 miRNA를 추출하였으며, 추출된 miRNA는 megaplex reverse transcription kit를 이용하여 cDNA로 변환하였다. 이후 Megaplex PreAmp Primers Human Pool A와 TaqMan PreAmp Master Mix를 이용하여 cDNA의 양을 증폭하였으며, 이 증폭 산물을 TaqMan Low Density miRNA Array (TLDA)에 넣어 real-time PCR 반응을 수행하였다. Real-time PCR의 원자료 (raw data) 분석은 ExpressionSuite 프로그램을 이용하였으며, 이를 통해 각 miRNA들의 증폭값 (Ct value) 를 얻어냈다. TLDA의 분석을 위해 miR-320으로 증폭값을 보정하였으며, 2-ΔΔCt 방법을 적용하여 각 miRNA들의 발현값을 측정하였다.
상기 38명의 다발성 골수종 환자들의 추적 기간 중앙값은 Len-dex 치료 시작부터 15.6 개월 (범위 : 0.4 ~ 33.6)이었고, 2 년간의 진행 시간 (전체 생존률)과 전체 생존율 (OS)은 각각 22.7 %와 64.2 % 였다. 38명의 환자들 중, 19명의 좋은 예후를 가진 환자와 19명의 나쁜 예후를 가진 환자들의 발현값을 비교한 결과, 6개 miRNA (miR-26a-5p, miR-29c-3p, miR-30b-5p, miR-30c-5p, miR-193a-5p, miR-331-3p) 발현이 나쁜 예후를 가진 환자군에서 유의하게 감소되어있음을 확인하였다. 본 결과를 검증하기 위하여 독립된 26명의 좋은 예후를 가진 환자와 36명의 나쁜 예후를 가진 환자들을 대상으로 real-time PCR을 수행하였으며, 6개 miRNA 모두 유의하게 발현이 감소되어 있음을 확인하였다.
또한, 6 개의 miRNA의 낮은 발현은 질병 진행 시간이 더 짧았던 것과 유의 한 관련이 있었다 (miR-26a-5p, P = 0.002, miR-29c-3p, P = 0.021, miR-30b-5p, P = 0.001, miR-30c-5p = 0.002, miR-193a-5p, P = 0.032, miR-331-3p, P = 0.032) (도 1). 전체 생존률에 관해서는, 4 개의 miRNA의 발현이 낮으면 전체 생존률의 빈도가 낮았다 (miR-30b-5p, P = 0.008, miR-30c-5p, P = 0.031, miR-193a-5p, P = 0.033, miR-331-3p, P = 0.013) (도 2). 상기 결과를 바탕으로, 예후에 미치는 miRNA의 부가 효과를 탐색하기 위해 각 miRNA에 대한 최적의 컷오프 (cutoff)를 기반으로 점수 1은 발현 감소, 0은 발현 증가로 환자들의 점수를 수치화했다. 높은 점수를 갖는 환자군 (점수 합계 3 이상)은 낮은 점수를 갖는 환자군 (점수 합 <3)에 비해 유의하게 짧은 질병 진행 시간 및 불량한 전체 생존율을 나타냈다 (P = 4.2x10-4 및 P = 6.6x10-5) (도 3).
실험예 2. 발성/ 불응성 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측 모델 개발
다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측 모델을 개발하기 위해 기계학습알고리즘 분석을 수행하였다. 본 분석은 18개의 임상변수 및 상기 6개의 miRNA를 포함하며, 임상 변수들은 환자 진료과정에서 측정된 자료들을 IRB 승인 하에 사용되었다. 기계학습알고리즘은 서포트벡터머신 (SVM, support vector machine) 방식을 적용하였으며, 이를 통해 총 2,468,732개의 변수 조합이 구성되었다. 이 변수 조합들 중 가장 우수한 예측 능력을 보여주는 모델은 5개의 임상변수 (염색체이상 자료, ISS 단계, 헤모글로빈, WBC 및 칼슘) 및 2개의 miRNA (miR-26a-5p 및 miR-193a-5p)로 구성되며, 이를 레날리도마이드 및 덱사메타손의 치료의 예후 예측 (LdTRP, Len-dex treatment response prediction) 모델로 정의하였다. 상기 LdTRP 모델 (도 4)의 예후 예측 능력은 AUC (area under curve) 0.933으로, 임상 변수 (도4)만으로 구성된 예후 예측 모델 (AUC=0.670) 및 miRNA (도4)만으로 구성된 예후 예측 모델 (AUC=0.675)에 비해 우수한 성능을 나타냈다. 또한 LdTRP의 역치값 (threshold)를 0.53으로 설정한 경우에서 민감도, 특이도 및 정확도는 각각 90.0 %, 77.8 %, 85.4 %였다.

Claims (16)

  1. miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 조성물.
  2. 제 1항에 있어서,
    상기 바이오 마커 조성물은 miR-193a 및 miR-26a를 포함하는 것을 특징으로 하는, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 조성물.
  3. 제 1항에 있어서,
    상기 miR-193a는 miR-193a-5p;
    상기 miR-26a는 miR-26a-5p;
    상기 miR-29c는 miR-29c-3p;
    상기 miR-30b는 miR-30b-5p;
    상기 miR-30c는 miR-30c-5p; 및
    상기 miR-331는 miR-331-3p인,
    다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 조성물.
  4. 제 1항 내지 제 3항 중 어느 한 항에 있어서,
    상기 예후 예측용 바이오 마커 조성물은 염색체이상 (cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 조성물을 추가로 더 포함하는, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 조성물.
  5. miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트.
  6. 제 5항에 있어서,
    상기 키트는 miR-193a 및 miR-26a를 포함하는 것을 특징으로 하는, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트.
  7. 제 5항에 있어서,
    상기 miR-193a는 miR-193a-5p;
    상기 miR-26a는 miR-26a-5p;
    상기 miR-29c는 miR-29c-3p;
    상기 miR-30b는 miR-30b-5p;
    상기 miR-30c는 miR-30c-5p; 및
    상기 miR-331는 miR-331-3p인,
    다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트.
  8. 제 5항 내지 제 7항 중 어느 한 항에 있어서, 상기 예후 예측용 키트는 염색체이상 (cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 조성물을 추가로 더 포함하는, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 키트.
  9. 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계; 및
    상기 유전자의 miRNA 발현 수준을 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교하는 단계;
    를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법.
  10. 제 9항에 있어서,
    상기 유전자는 miR-193a 및 miR-26a를 포함하는 것을 특징으로 하는, 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법.
  11. 제 9항에 있어서,
    상기 miR-193a는 miR-193a-5p;
    상기 miR-26a는 miR-26a-5p;
    상기 miR-29c는 miR-29c-3p;
    상기 miR-30b는 miR-30b-5p;
    상기 miR-30c는 miR-30c-5p; 및
    상기 miR-331는 miR-331-3p인,
    다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법.
  12. 제 9항에 있어서,
    상기 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준이 레날리도마이드 및 덱사메타손의 치료의 예후가 좋은 대조군 시료와 비교했을 때 낮게 측정되면 치료에 대한 예후가 좋지 않은 것으로 판단하는 것을 특징으로 하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법.
  13. 제 9항에 있어서,
    상기 miRNA 발현 수준을 측정하는 방법은 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR (Real-time RT-PCR), RNase 보호 분석법 (RPA; RNase protection assay), 노던 블랏팅 (Northern blotting), miRNA 시퀀싱 (miRNA sequencing), PCR 어레이 (PCR array) 및 DNA 칩으로 이루어진 군으로부터 선택되는 어느 하나 이상을 이용하여 측정하는 것을 특징으로 하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법.
  14. 제 9항에 있어서,
    레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 환자 시료로부터 염색체이상 자료(cytogenetics), 증후성 다발골수종 단계 (ISS stage), 혈색소 (hemoglobin), 백혈구 (WBC) 및 칼슘 농도로 이루어진 군으로부터 선택되는 어느 하나 이상의 임상 수치를 측정하는 단계를 추가로 더 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측에 유용한 정보를 제공하는 방법.
  15. miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 조성물.
  16. 레날리도마이드 및 덱사메타손의 치료를 받은 다발성 골수종 개체에서 분리된 생물학적 시료에서 miR-193a, miR-26a, miR-29c, miR-30b, miR-30c 및 miR-331으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현 수준을 측정하여 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측을 진단하는 방법에 사용하기 위한, 제 1항 내지 제 4항 중 어느 한 항의 바이오 마커 조성물의 용도.
PCT/KR2018/001509 2017-11-08 2018-02-05 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커 Ceased WO2019093585A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0148052 2017-11-08
KR1020170148052A KR102083956B1 (ko) 2017-11-08 2017-11-08 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커

Publications (1)

Publication Number Publication Date
WO2019093585A1 true WO2019093585A1 (ko) 2019-05-16

Family

ID=66438495

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/001509 Ceased WO2019093585A1 (ko) 2017-11-08 2018-02-05 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커

Country Status (2)

Country Link
KR (1) KR102083956B1 (ko)
WO (1) WO2019093585A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3976058A4 (en) * 2019-06-03 2023-07-19 Carmel-Haifa University Economic Corporation Ltd. TREATMENT OF HEAD AND NECK CANCER IN HUMAN

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150313932A1 (en) * 2014-04-14 2015-11-05 Dana-Farber Cancer Institute, Inc. Composition and method for treating a hematological malignancy
US20150322529A1 (en) * 2012-11-02 2015-11-12 Dana-Farber Cancer Institute, Inc. Compositions And Methods For Diagnosis, Prognosis And Treatment Of Hematological Malignanicies

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150322529A1 (en) * 2012-11-02 2015-11-12 Dana-Farber Cancer Institute, Inc. Compositions And Methods For Diagnosis, Prognosis And Treatment Of Hematological Malignanicies
US20150313932A1 (en) * 2014-04-14 2015-11-05 Dana-Farber Cancer Institute, Inc. Composition and method for treating a hematological malignancy

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHUNG, Y.-J. ET AL.: "(67P) Developing a Prediction Model for Response to Lenalidomide Treatment in Refractory/relapsed Multiple Myeloma Patients", ANNALS OF ONCOLOGY, vol. 28, no. Suppl. 5, 18 September 2017 (2017-09-18), XP055606924, DOI: 10.1093/annonc/mdx361.062 *
JUNG, S.-H. ET AL.: "Circulating MicroRNA Expression Can Predict the Outcome of Lenalidomide Plus Low-dose Dexamethasone Treatment in Patients with Refractory/relapsed Multiple Myeloma", HAEMATOLOGICA, vol. 102, no. 11, 3 August 2017 (2017-08-03) - November 2017 (2017-11-01), pages 1 - 12, XP055606843 *
MATEOS, M.-V. ET AL.: "Lenalidomide Plus Dexamethasone versus Observation in Patients with High-risk Smouldering Multiple Myeloma (QuiRedex): Long-term Follow-up of a Randomised, Controlled, Phase 3 Trial", THE LANCET ONCOLOGY, vol. 17, 2016, pages 1127 - 1136, XP029663508, DOI: doi:10.1016/S1470-2045(16)30124-3 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3976058A4 (en) * 2019-06-03 2023-07-19 Carmel-Haifa University Economic Corporation Ltd. TREATMENT OF HEAD AND NECK CANCER IN HUMAN

Also Published As

Publication number Publication date
KR102083956B1 (ko) 2020-04-23
KR20190052397A (ko) 2019-05-16

Similar Documents

Publication Publication Date Title
CN103003447B (zh) 用于确定样品中存在或不存在不同非整倍性的方法
Betensky et al. Clonal evolution and clinical significance of copy number neutral loss of heterozygosity of chromosome arm 6p in acquired aplastic anemia
CN114736968A (zh) 血浆游离dna甲基化标志物在肺癌早筛中的用途以及肺癌早筛装置
CN108676879A (zh) 特异甲基化位点作为乳腺癌分子分型诊断标志物的应用
WO2020209590A1 (ko) 신경교종의 진단 또는 예후 예측용 조성물 및 이에 관한 정보를 제공하는 방법
CN111004849B (zh) 检测cdh1基因的多个位点突变的引物、方法和试剂盒
US20200188356A1 (en) Novel Circular RNA Biomarkers for Heart Failure
CN108300787A (zh) 特异甲基化位点作为乳腺癌早期诊断标志物的应用
Huang et al. Identification of a serum exosome-derived lncRNA‒miRNA‒mRNA ceRNA network in patients with endometriosis
CN108441560B (zh) 一种位于cep128基因的与放疗引起的放射性脑损伤相关的snp标志物及其应用
WO2018135464A1 (ja) 次世代シーケンサーを用いた迅速な遺伝子検査方法
CN108715893A (zh) 一组与放疗引起的放射性脑损伤相关的snp标志物及其应用
WO2021172863A1 (ko) 알츠하이머병에 대한 분자 진단 테스트
WO2024019556A1 (ko) Krt32 유전자의 dna 메틸화 변화를 이용한 알츠하이머병 치매 예측진단 마커
CN110714066A (zh) 一种检测诊断角膜营养不良致病基因的dna文库及其应用
WO2024019555A1 (ko) Atp2c1 유전자의 dna 메틸화 변화를 이용한 알츠하이머병 치매진단 마커
WO2023211004A1 (ko) 간암 진단용 조성물
CN104946751B (zh) BRCA1基因g.41244291delT突变及其在乳腺癌辅助诊断中的应用
Ameen et al. Investigating the association between vitamin D and anti-thyroid peroxidase antibodies in hypothyroid Iraqi patients
JP7821416B2 (ja) アトピー性皮膚炎の診断方法
WO2022103027A1 (ko) 자궁경부암의 급성 종양 반응 진단용 바이오 마커 및 이의 용도
US20140011696A1 (en) Bap1 mutational analysis in determining susceptibility to, prognosis of, and treatment of melanocytic neoplasia
KR102083956B1 (ko) 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커
WO2021172864A1 (ko) 유전자의 후성학적 메틸화 변화를 이용한 알츠하이머병의 진단 및 예측
WO2016013807A1 (ko) 표적 항암 치료제에 대한 감수성 예측 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18876960

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18876960

Country of ref document: EP

Kind code of ref document: A1