WO2019079781A2 - METHODS OF TREATING HEPATITIS B TYPE INFECTIONS - Google Patents

METHODS OF TREATING HEPATITIS B TYPE INFECTIONS Download PDF

Info

Publication number
WO2019079781A2
WO2019079781A2 PCT/US2018/056801 US2018056801W WO2019079781A2 WO 2019079781 A2 WO2019079781 A2 WO 2019079781A2 US 2018056801 W US2018056801 W US 2018056801W WO 2019079781 A2 WO2019079781 A2 WO 2019079781A2
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
hbv
nucleotides
sequence
antisense strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/056801
Other languages
English (en)
French (fr)
Other versions
WO2019079781A3 (en
Inventor
Martin KOSER
Marc Abrams
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dicerna Pharmaceuticals Inc
Original Assignee
Dicerna Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=66173915&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2019079781(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to PE2020000748A priority Critical patent/PE20220561A1/es
Priority to LTEPPCT/US2018/056801T priority patent/LT3684377T/lt
Priority to MX2020004060A priority patent/MX2020004060A/es
Priority to CR20200163A priority patent/CR20200163A/es
Priority to HRP20230023TT priority patent/HRP20230023T1/hr
Priority to IL274040A priority patent/IL274040B2/en
Priority to CN201880068102.3A priority patent/CN111372593B/zh
Priority to CN202410274712.6A priority patent/CN118185936A/zh
Priority to RS20230047A priority patent/RS64001B1/sr
Priority to FIEP18868404.7T priority patent/FI3684377T3/fi
Priority to SI201830840T priority patent/SI3684377T1/sl
Priority to EP18868404.7A priority patent/EP3684377B1/en
Priority to UAA202002978A priority patent/UA128786C2/uk
Priority to BR112020007476-4A priority patent/BR112020007476A2/pt
Priority to EP22201680.0A priority patent/EP4197544A1/en
Priority to IL282881A priority patent/IL282881B2/en
Priority to IL319113A priority patent/IL319113A/en
Priority to JP2020521880A priority patent/JP7353276B2/ja
Priority to DK18868404.7T priority patent/DK3684377T3/da
Application filed by Dicerna Pharmaceuticals Inc filed Critical Dicerna Pharmaceuticals Inc
Priority to AU2018351649A priority patent/AU2018351649B2/en
Priority to ES18868404T priority patent/ES2936863T3/es
Priority to SG11202003488WA priority patent/SG11202003488WA/en
Priority to KR1020207013967A priority patent/KR102783206B1/ko
Priority to CA3078960A priority patent/CA3078960A1/en
Priority to IL312809A priority patent/IL312809B2/en
Priority to RU2020116369A priority patent/RU2780021C2/ru
Priority to MA50264A priority patent/MA50264B1/fr
Priority to PL18868404.7T priority patent/PL3684377T3/pl
Priority to MYPI2020001980A priority patent/MY201698A/en
Publication of WO2019079781A2 publication Critical patent/WO2019079781A2/en
Publication of WO2019079781A3 publication Critical patent/WO2019079781A3/en
Priority to US16/790,986 priority patent/US10799524B2/en
Priority to PH12020550591A priority patent/PH12020550591A1/en
Anticipated expiration legal-status Critical
Priority to CONC2020/0005135A priority patent/CO2020005135A2/es
Priority to US16/922,033 priority patent/US11052105B2/en
Priority to US16/922,007 priority patent/US11052104B2/en
Priority to US17/318,864 priority patent/US11273173B2/en
Priority to US17/649,781 priority patent/US12564601B2/en
Priority to JP2023151506A priority patent/JP7645323B2/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52Purines, e.g. adenine
    • A61K31/522Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/02Inorganic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/05Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0337Animal models for infectious diseases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533Halogen

Definitions

  • the present application relates to oligonucleotides and uses thereof, particularly uses relating to the treatment of hepatitis B infection.
  • RNA interference (RNAi) technology offers the potential for pharmacologically intervention.
  • HBsAg hepatitis B surface antigen
  • S three related polypeptides called S, M, and L encoded by overlapping open reading frames (ORF).
  • ORF open reading frames
  • the smallest envelope protein is S with 226 amino acids, called the S-ORF.
  • M and L are produced from upstream translation initiation sites and add 55 and 108 amino acids, repectively, to S.
  • HBV S, M, and L glycoproteins are found in the viral envelope of intact, infectious HBV virions, named Dane particles, and all three are produced and secreted in a vast excess that forms non-infectious subviral spherical and filamentous particles (both referred to as decoy particles) found in the blood of chronic HBV patients.
  • decoy particles non-infectious subviral spherical and filamentous particles
  • aspects of the disclosure relate to improved oligonucleotide-based compositions and related methods for treating HBV infection in a subject.
  • the disclosure relates to the development of potent oligonucleotides that produce durable knockdown of HBV surface antigen (HBsAg) expression.
  • the oligonucleotide induce RNA interference (RNAi) -mediated recognition and destruction of mRNA which encodes all forms of HBsAg in hepatocytes.
  • RNAi RNA interference
  • Oligonucleotides are provided herein designed to target an expansive set of HBsAg transcripts encoded by HBV genomes across all known genotypes.
  • oligonucleotides disclosed herein that target HBsAg transcripts in hepatocytes can produce a stable reduction in HBsAg expression with high specificity that persists for an extended period of time (e.g., greater than 7 weeks to several months) following administration to a subject (See, e.g., Examples 1 and 3).
  • targeting of HBsAg expression using oligonucleotides disclosed herein results in reduction of pre-genomic RNA (pgRNA) and other viral life cycle intermediates.
  • pgRNA pre-genomic RNA
  • RNAi oligonucleotides disclosed herein can knockdown HBsAg mRNA transcripts that originate from either cccDNA or integrated virus.
  • targeting of HBsAg expression using oligonucleotides disclosed herein reduces expression of all HBV proteins (with the exception of HBx), namely HBcAg, HBeAg, and HBV Polymerase, resulting in cytosolic retention of HBV core protein.
  • clearance of circulating HBsAg resulting from the mRNA knockdown using methods provided herein is clinically advantageous because it enables breaking of HBV immune tolerance caused by high levels of circulating HBsAg in CHB patients. Reactivation of immune system activity against HBV infection is believed to be a cornerstone of achieving functional cure, defined as permanent seroclearance of HBsAg.
  • oligonucleotides targeting HBsAg transcripts alone also achieves effective inhibition of HBV replication and gene expression, which provides a new therapeutic approach to treating HBV infections.
  • HSB(s)-219 precursors prevent nuclear localization of HBV Core Antigen (HBcAg).
  • HBV-X or both genes simultaneously does not prevent HBcAg nuclear localization.
  • Preclinical data strongly suggest that the inhibition of nuclear core localization caused by S-targeting RNAi therapy results in significantly improved duration of HBsAg suppression.
  • lack of nuclear localization of HBcAg in patients has been shown to correlate to favorable responses to antiviral therapy.
  • Some aspects of the present disclosure provide oligonucleotides for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide comprising an antisense strand of 19 to 30 nucleotides in length, wherein the antisense strand comprises a region of complementarity to a sequence of HBsAg mRNA as set forth in
  • the oligonucleotide further comprises a sense strand of
  • sense strand comprises a region of complementarity to a sequence as set forth in UUNUUGUGAGGAUUN (SEQ ID NO: 2). In some embodments, the sense strand comprises a region of complementarity to a sequence as set forth in 5'- UUAUUGUGAGGAUUNUUGUC (SEQ ID NO: 3).
  • the antisense strand comprises a sequence as set forth in UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 4). In some embodments, the antisense strand consists of a sequence as set forth in UUAUUGUGAGGAUUCUUGUCGG (SEQ ID NO: 5). In some embodments, the antisense strand consists of a sequence as set forth in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1).
  • the sense strand comprises a sequence as set forth in
  • the sense strand comprises a sequence as set forth in
  • the sense strand consists of a sequence as set forth in
  • the sense strand consists of a sequence as set forth in
  • oligonucleotides for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA comprising a sense strand forming a duplex region with an antisense strand, wherein the sense strand comprises a sequence as set forth in
  • each of the antisense strand and the sense strand comprises one or more 2'-fluoro and 2'-0-methyl modified nucleotides and at least one phosphorothioate linkage, wherein the 4 '-carbon of the sugar of the 5'- nucleotide of the antisense strand comprises a phosphate analog, and wherein the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moiety.
  • GalNAc N-acetylgalactosamine
  • oligonucleotides for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA comprising a sense strand forming a duplex region with an antisense strand
  • the sense strand comprises a sequence as set forth in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8) and comprising 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17, 2'-0-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36, and at least one phosphorothioate internucleotide linkage, wherein the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moiety; and the antisense strand comprises a sequence as set forth in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 8 and comprising 2'-fluoro modified nucleotides at
  • the antisense strand comprises five phosphorothioate linkages between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22.
  • the 5 '-nucleotide of the antisense strand has the following structure:
  • one or more of the nucleotides of the -G AAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.
  • each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.
  • the - GAAA- motif comprises the structure:
  • L represents a bond, click chemistry handle, or a linker of 1 to 20, inclusive, consecutive, covalently bonded atoms in length, selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene, substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, and combinations thereof; and
  • X is a O, S, or N.
  • L is an acetal linker.
  • X is O.
  • the -GAAA- sequence comprises the structure:
  • the sense strand comprises at its 3 '-end a stem-loop set forth as: S 1-L-S2, wherein Si is complementary to S2, and wherein L forms a loop between Si and S2 of up to 6 nucleotides in length.
  • L is a tetraloop.
  • L forms a loop between S i and S2 of 4 nucleotides in length.
  • L comprises a sequence set forth as GAAA.
  • up to 4 nucleotides of L of the stem-loop are each conjugated to a separate GalNAc.
  • the oligonucleotide comprises at least one modified nucleotide.
  • the modified nucleotide comprises a 2'-modification.
  • the 2 '-modification is a modification selected from: 2'-aminoethyl, 2'- fluoro, 2'-0-methyl, 2'-0-methoxyethyl, and 2'-deoxy-2'-fluoro-P-d-arabinonucleic acid.
  • all of the nucleotides of the oligonucleotide are modified nucleotides.
  • the oligonucleotide comprises at least one modified internucleotide linkage.
  • the at least one modified internucleotide linkage is a phosphorothioate linkage.
  • the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog.
  • At least one nucleotide of the oligonucleotide is conjugated to a targeting ligand.
  • the targeting ligand is a N- acetylgalactosamine (GalNAc) moiety.
  • compositions comprising an oligonucleotide of any one of the preceding claims and an counterion, and compositions comprising an oligonucleotide of any one of the preceding claims and a pharmaceutically acceptable carrier.
  • hepatitis B virus HB V
  • Other aspects of the present disclosure provide methods of reducing expression of hepatitis B virus (HB V) surface antigen in a cell, the method comprising delivering to the cell an oligonucleotide described herein.
  • the cell is a hepatocyte.
  • the cell is in vivo.
  • the cell is in vitro.
  • B virus (HBV) infection in a subject comprising administering to the subject an oligonucleotide of or a composition described herein.
  • Methods of treating HBV infection in a subject comprising administering to the subject an RNAi oligonucleotide that selectively targets HBsAg mRNA, wherein the RNAi oligonucleotide is administered in the absence of treatment with an RNAi oligonucleotide targeting a non-surface antigen encoding HBV mRNA transcript.
  • Methods of treating HBV infection in a subject comprising administering to the subject an RNAi oligonucleotide that selectively targets HBsAg mRNA, wherein the subject is not administered an RNAi oligonucleotide that selectively targets HBxAg mRNA transcript.
  • the method further comprises administering to the subject an effective amount of Entecavir.
  • oligonucleotides for reducing expression of hepatitis B virus surface antigen (HBsAg) mRNA comprising a sense strand forming a duplex region with an antisense strand, wherein:
  • the sense strand comprises a sequence as set forth in
  • GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8) and comprising 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17, 2'-0-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36, and one
  • each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety, wherein the -GAAA- sequence comprises the structure:
  • the antisense strand comprises a sequence as set forth in
  • UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 5.1) and comprising 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19, 2'-0-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22, and five phosphorothioate internucleotide linkages between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4 '-carbon of the sugar of the 5 '-nucleotide of the antisense strand has the following structure:
  • composition comprising the oligonucleotide is also provided.
  • the composition further comprises Na+ counterions.
  • hepatitis B virus HBV
  • the method comprising delivering to the oligonucleotide or the composition.
  • the cell is a hepatocyte.
  • the cell is in vivo.
  • the cell is in vitro.
  • Methods of treating a hepatitis B virus (HBV) infection in a subject comprising administering to the subject the oligonucleotide or the composition. In some embodiments, the method further comprises administering to the subject an effective amount of Entecavir.
  • HBV hepatitis B virus
  • FIG. 1 shows an example of an RNAi target site on a schematic representation of the organization of the HBV genome.
  • FIG. 2 shows single dose evaluation of an oligonucleotide for reducing
  • FIG. 3 is a graphical representation of plasma HBsAg levels over time during a specified dosing regimen with an HBsAg-targeting oligonucleotide. As shown in this example, the oligonucleotide demonstrated preclinical potency and maintained decreased levels well beyond the dosing period.
  • FIG. 4 shows graphs depicting the results of HBsAg mapping in HeLa cells using a reporter assay.
  • An unmodified siRNA targeting position 254 of the HBV genome was used as a positive control at the specified concentrations.
  • a commercially available Silencer siRNA from Thermo Fisher served as the negative control for these experiments. Error bars represent the SEM.
  • FIG. 5 shows a genotype conservation comparison showing that the designed mismatch in the HBsAg-targeting oligonucleotide, HBV-219, increases coverage across HBV genotypes.
  • FIG. 6 illustrates a vector designed for psiCHECK2 reporter assays using
  • HBV Genotype A as a prototype sequence.
  • FIG. 7 shows several examples of oligonucleotides designed to evaluate the effects of introducing mismatches. Oligonucleotide sequences for parent and mismatch strands are shown aligned and with mismatch positions in boxes. The corresponding reporter sequences used in psiCHECK2 reporter assays are further depicted.
  • FIG. 8 shows a single-dose titration plot for an oligonucleotide evaluated in mismatch studies, which demonstrates that a mismatch in the guide strand is tolerated in vivo.
  • FIG. 9 shows an in vivo dose titration plot demonstrating that incorporation of a mismatch into an HBsAg-targeting oligonucleotide does not adversely affect in vivo potency.
  • FIG. 10 shows an example of an HBsAg-targeting oligonucleotide (HBV(s)-
  • FIG. 11 A depicts immunohistochemical staining results detecting the subcellular distribution of HBV core antigen (HBcAg) in hepatocytes.
  • FIG. 1 IB depicts RNA sequencing results mapping detected RNA transcript sequences against the HBV pgRNA.
  • FIG. 12A depicts a time course of HBsAg mRNA expression following treatment with the HBV(s)-219 oligonucleotide precursor HBV(s)-219P2 targeting HBsAg mRNA compared with vehicle control and an RNAi oligonucleotide targeting HBxAg mRNA in a hydrodynamic injection (HDI) model of HBV.
  • HBV(s)-219 oligonucleotide precursor HBV(s)-219P2 targeting HBsAg mRNA compared with vehicle control and an RNAi oligonucleotide targeting HBxAg mRNA in a hydrodynamic injection (HDI) model of HBV.
  • HDI hydrodynamic injection
  • FIG. 12B depicts a time course of HBsAg mRNA expression following treatment with the HBV(s)-219 oligonucleotide precursor HBV(s)-219P2 targeting HBsAg mRNA compared with vehicle control and an RNAi oligonucleotide targeting HBxAg mRNA in an AAV-HBV model.
  • FIG. 13 shows immunohistochemical staining results showing the subcellular distribution of HBcAg in hepatocytes obtained from AAV-HBV model and HDI model of HBV following treatment with the HBV(s)-219 oligonucleotide targeting HBsAg mRNA compared with vehicle control and an RNAi oligonucleotide targeting HBxAg mRNA
  • FIGs. 14A-14D show antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-
  • mice in a PXB-HBV model.
  • Cohorts of 9 mice were given 3 weekly doses of either 0 or 3 mg/kg of HBV(s)-219Pl in PBS, administered subcutaneously.
  • Six mice from each cohort were analyzed by non-terminal mandibular cheek bleeds at each of the time points indicated (FIGs. 14A and 14B) for serum HBsAg and serum HBV DNA.
  • Day 28 starting from the first dose of HBV(s)-219Pl
  • all remaining mice were euthanized and liver biopsies were collected for hepatic HBV DNA (FIG. 14C) and hepatic cccDNA (FIG. 14D) by RT-qPCR.
  • FIGs. 15A-15C show that HBV(s)-219 precursor 2 (HBV(s)-219P2) potentiates the antiviral activity of entecavir.
  • HBV(s)-219 precursor 2 HBV(s)-219P2
  • HBV DNA Circulating viral load
  • FIG. 15A Plasma HBsAg leval was measured by ELISA (FIG. 15B).
  • Liver HBV mRNA and pgRNA levels were measured by qPCR (FIG. 15C). The results show clear addive effects with combination therapy.
  • ETV therapy alone shows no efficacy agains circulating HBsAg or liver viral RNAs.
  • the antiviral activity of HBV(s)-219P2 as measured by HBsAb or HBV RNA is not impacted by codosing of ETV.
  • BLOD means "below limit of detection.”
  • FIGs. 16A-16B show a comparison of HBsAg suppression activity of GalNac conjugated oligonucleotide targeting the S antigen (HBV(s)-219P2) or the X antigen
  • FIG. 16A shows the location of RNAi target site in HBV genome affects HBsAg recovery kinetics in HBV-expressing mice.
  • FIG. 16B shows plasma HBsAg level2 weeks post-dose (left panel) and 9 weeks pose-dose (right panel), indicating that targeting the HBVX coding region, either alone or in combination with HBV(s)-219P2, results in shorter duration of activity. Individual animal data was shown. Several data points (lighest grey circles) were below limit of detection.
  • FIGs. 17A- 17C show the subcellular location of HBV core antigen (HBcAg) in HBV-expressing mice treated with HBV(s)-219P2, GalXC-HBVX or a 1: 1 combination.
  • FIG. 17A shows representative hepatocytes in liver sections obtained at weeks 1, 2, 6, 9, and 13 post administration and stained for HBcAg.
  • FIG. 17C shows subcellular distribution of HBcAg in hepatocytes obtained at weeks 2, 3, and 9 post administration of an alternative RNAi oligo targeting either the S antigen and the X antigen.
  • FIG. 18 shows the dose by cohort information for a study designed to evaluate the safety and tolerability of HBV(s)-219 in healthy patients and the therapeutic efficacy of HBV(s)-219 in HBV patients.
  • FIGs. 19A- 19B shows the chemical structure of HBV(s)-219 and HBV(s)-
  • FIG. 19A Chemical structure for HBV(s)-219.
  • FIG. 19B Chemical structure for HBV(s)-219P2.
  • the disclosure provides potent oligonucleotides that are effective for reducing HBsAg expression in cells, particularly liver cells (e.g., hepatocytes) for the treatment of HBV infections.
  • HBsAg targeting oligonucleotides provided herein are designed for delivery to selected cells of target tissues (e.g. , liver hepatocytes) to treat HBV infection in those tissues.
  • the disclosure provides methods of treating HBV infection that involve selectively reducing HBV surface antigen gene expression in cells (e.g., cells of the liver).
  • Administering As used herein, the terms “administering” or
  • ASGPR Asialoglycoprotein receptor
  • ASGPR a bipartite C-type lectin formed by a major 48 kDa (ASGPR-1) and minor 40 kDa subunit (ASGPR-2).
  • ASGPR is primarily expressed on the sinusoidal surface of hepatocyte cells and has a major role in binding, internalization, and subsequent clearance of circulating glycoproteins that contain terminal galactose or N-acetylgalactosamine residues (asialoglycoproteins).
  • Complementary refers to a structural relationship between two nucleotides (e.g. , on two opposing nucleic acids or on opposing regions of a single nucleic acid strand), or between two sequences of nucleotides, that permits the two nucleotides, or two sequences of nucleotides, to form base pairs with one another.
  • a purine nucleotide of one nucleic acid that is complementary to a pyrimidine nucleotide of an opposing nucleic acid may base pair together by forming hydrogen bonds with one another.
  • complementary nucleotides can base pair in the Watson-Crick manner or in any other manner that allows for the formation of stable duplexes.
  • two nucleic acids may have regions of multiple nucleotides that are complementary with each other so as to form regions of complementarity, as described herein.
  • deoxyribonucleotide refers to a nucleotide having a hydrogen in place of a hydroxyl at the 2' position of its pentose sugar as compared with a ribonucleotide.
  • a modified deoxyribonucleotide is a deoxyribonucleotide having one or more modifications or substitutions of atoms other than at the 2' position, including modifications or substitutions in or of the sugar, phosphate group or base.
  • Double-stranded oligonucleotide refers to an oligonucleotide that is substantially in a duplex form.
  • complementary base-pairing of duplex region(s) of a double- stranded oligonucleotide is formed between antiparallel sequences of nucleotides of covalently separate nucleic acid strands.
  • complementary base-pairing of duplex region(s) of a double- stranded oligonucleotide is formed between antiparallel sequences of nucleotides of nucleic acid strands that are covalently linked.
  • complementary base- pairing of duplex region(s) of a double- stranded oligonucleotide is formed from a single nucleic acid strand that is folded (e.g. , via a hairpin) to provide complementary antiparallel sequences of nucleotides that base pair together.
  • a double-stranded oligonucleotide comprises two covalently separate nucleic acid strands that are fully duplexed with one another.
  • a double- stranded oligonucleotide comprises two covalently separate nucleic acid strands that are partially duplexed, e.g., having overhangs at one or both ends.
  • a double-stranded oligonucleotide comprises antiparallel sequences of nucleotides that are partially complementary, and thus, may have one or more mismatches, which may include internal mismatches or end
  • duplex in reference to nucleic acids (e.g., oligonucleotides), refers to a structure formed through complementary base-pairing of two antiparallel sequences of nucleotides.
  • Excipient refers to a non-therapeutic agent that may be included in a composition, for example, to provide or contribute to a desired consistency or stabilizing effect.
  • Hepatocyte As used herein, the term “hepatocyte” or “hepatocytes” refers to cells of the parenchymal tissues of the liver. These cells make up approximately 70-85% of the liver's mass and manufacture serum albumin, fibrinogen, and the prothrombin group of clotting factors (except for Factors 3 and 4). Markers for hepatocyte lineage cells may include, but are not limited to: transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor la (Hnfla), and hepatocyte nuclear factor 4a (Hnf4a).
  • Ttr transthyretin
  • Glul glutamine synthetase
  • Hnfla hepatocyte nuclear factor la
  • Hnf4a hepatocyte nuclear factor 4a
  • Markers for mature hepatocytes may include, but are not limited to: cytochrome P450 (Cyp3al l), fumarylacetoacetate hydrolase (Fah), glucose 6-phosphate (G6p), albumin (Alb), and OC2-2F8. See, e.g., Huch et ah, (2013), Nature, 494(7436): 247-250, the contents of which relating to hepatocyte markers is incorporated herein by reference.
  • Hepatitis B Virus refers to a small DNA virus belonging to the Hepadnaviridae family and classified as the type species of the genus Orthohepadnavirus .
  • HBV virus particles comprise an outer lipid envelope and an icosahedral nucleocapsid core composed of protein.
  • the nucleocapsid generally encloses viral DNA and a DNA polymerase that has reverse transcriptase activity similar to retroviruses.
  • the HBV outer envelope contains embedded proteins which are involved in viral binding of, and entry into, susceptible cells.
  • HBV which attacks the liver, has been classified according to at least ten genotypes (A-J) based on sequence.
  • A-J genotypes
  • C genotypes
  • P genes encoded by the genome
  • S genes encoded by the genome
  • HBcAg The core protein is encoded by gene C (HBcAg), and its start codon is preceded by an upstream in-frame AUG start codon from which the pre-core protein is produced.
  • HBeAg is produced by proteolytic processing of the pre-core protein.
  • the DNA polymerase is encoded by gene P.
  • Gene S encodes surface antigen (HBsAg).
  • the HBsAg gene is one long open reading frame but contains three in frame "start" (ATG) codons that divide the gene into three sections, pre-S l, pre-S2, and S. Because of the multiple start codons, polypeptides of three different sizes called large, middle, and small (pre-S l + pre-S2 + S, pre-S2 + S, or S) are produced. These may have a ratio of 1: 1:4 (Heermann et al, 1984).
  • Hepatitis B Virus (HBV) proteins can be organized into several categories and functions. Polymerases function as a reverse transcriptase (RT) to make viral DNA from pregenomic RNA (pgRNA), and also as a DNA-dependent polymerase to make covalently closed circular DNA (cccDNA) from viral DNA. They are covalently attached to the 5' end of the minus strand. Core proteins make the viral capsid and the secreted E antigen. Surface antigens are the hepatocyte internalization ligands, and also the primary component of aviral spherical and filamentous particles. Aviral particles are produced >1000-fold over Dane particles (infectious virions) and may act as immune decoys.
  • RT reverse transcriptase
  • pgRNA pregenomic RNA
  • cccDNA covalently closed circular DNA
  • Core proteins make the viral capsid and the secreted E antigen.
  • Surface antigens are the hepatocyte internalization ligand
  • Hepatitis B virus surface antigen As used herein, the term "hepatitis B virus surface antigen" or "HBsAg” refers to an S-domain protein encoded by gene S (e.g., ORF S) of an HBV genome. Hepatitis B virus particles carry viral nucleic acid in core particles enveloped by three proteins encoded by gene S, which are the large surface, middle surface, and major surface proteins. Among these proteins, the major surface protein is generally about 226 amino acids and contains just the S-domain.
  • gene S e.g., ORF S
  • Hepatitis B virus particles carry viral nucleic acid in core particles enveloped by three proteins encoded by gene S, which are the large surface, middle surface, and major surface proteins. Among these proteins, the major surface protein is generally about 226 amino acids and contains just the S-domain.
  • infection reefs to the pathogenic invasion and/or expansion of microorganisms, such as viruses, in a subject.
  • An infection may be lysogenic, e.g., in which viral DNA lies dormant within a cell.
  • an infection may be lytic, e.g., in which viruses actively proliferates and causing destruction of infected cells.
  • An infection may or may not cause clinically apparent symptoms.
  • An infection may remain localized, or it may spread, e.g., through a subjects blood or lymphatic system.
  • An individual having, for example, an HBV infection can be identified by detecting one or more of viral load, surface antigen (HBsAg), e-antigen (HBeAg), and various other assays for detecting HBV infection known in the art.
  • Assays for detection of HBV infection can involve testing serum or blood samples for the presence of HBsAg and/or HBeAg, and optionally further screening for the presence of one or more viral antibodies (e.g., IgM and/or IgG) to compensate for any periods in which an HBV antigen may be at an undetectable level.
  • Liver inflammation As used herein, the term “liver inflammation” or
  • hepatitis refers to a physical condition in which the liver becomes swollen, dysfunctional, and/or painful, especially as a result of injury or infection, as may be caused by exposure to a hepatotoxic agent. Symptoms may include jaundice (yellowing of the skin or eyes), fatigue, weakness, nausea, vomiting, appetite reduction, and weight loss. Liver inflammation, if left untreated, may progress to fibrosis, cirrhosis, liver failure, or liver cancer.
  • Liver fibrosis As used herein, the term “liver fibrosis” or “fibrosis of the liver” refers to an excessive accumulation in the liver of extracellular matrix proteins, which could include collagens (I, III, and IV), fibronectin, undulin, elastin, laminin, hyaluronan, and proteoglycans resulting from inflammation and liver cell death. Liver fibrosis, if left untreated, may progress to cirrhosis, liver failure, or liver cancer.
  • extracellular matrix proteins which could include collagens (I, III, and IV), fibronectin, undulin, elastin, laminin, hyaluronan, and proteoglycans resulting from inflammation and liver cell death.
  • Liver fibrosis if left untreated, may progress to cirrhosis, liver failure, or liver cancer.
  • loop refers to a unpaired region of a nucleic acid (e.g. , oligonucleotide) that is flanked by two antiparallel regions of the nucleic acid that are sufficiently complementary to one another, such that under appropriate hybridization conditions (e.g. , in a phosphate buffer, in a cells), the two antiparallel regions, which flank the unpaired region, hybridize to form a duplex (referred to as a "stem").
  • a nucleic acid e.g. , oligonucleotide
  • Modified Intemucleotide Linkage refers to a intemucleotide linkage having one or more chemical modifications compared with a reference intemucleotide linkage comprising a phosphodiester bond.
  • a modified nucleotide is a non-naturally occurring linkage.
  • a modified intemucleotide linkage confers one or more desirable properties to a nucleic acid in which the modified intemucleotide linkage is present.
  • a modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc.
  • Modified nucleotide refers to a nucleotide having one or more chemical modifications compared with a corresponding reference nucleotide selected from: adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine
  • a modified nucleotide is a non-naturally occurring nucleotide.
  • a modified nucleotide has one or more chemical modification in its sugar, nucleobase and/or phosphate group.
  • a modified nucleotide has one or more chemical moieties conjugated to a corresponding reference nucleotide.
  • a modified nucleotide confers one or more desirable properties to a nucleic acid in which the modified nucleotide is present.
  • a modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc.
  • a "nicked tetraloop structure" is a structure of a RNAi oligonucleotide characterized by the presence of separate sense (passenger) and antisense (guide) strands, in which the sense strand has a region of complementarity with the antisense strand, and in which at least one of the strands, generally the sense strand, has a tetraloop configured to stabilize an adjacent stem region formed within the at least one strand.
  • Oligonucleotide refers to a short nucleic acid, e.g. , of less than 100 nucleotides in length.
  • An oligonucleotide may be single- stranded or double-stranded.
  • An oligonucleotide may or may not have duplex regions.
  • an oligonucleotide may be, but is not limited to, a small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), dicer substrate interfering RNA (dsiRNA), antisense oligonucleotide, short siRNA, or single-stranded siRNA.
  • a double- stranded oligonucleotide is an RNAi oligonucleotide.
  • overhang refers to terminal non-base pairing nucleotide(s) resulting from one strand or region extending beyond the terminus of a complementary strand with which the one strand or region forms a duplex.
  • an overhang comprises one or more unpaired nucleotides extending from a duplex region at the 5' terminus or 3 ' terminus of a double- stranded oligonucleotide.
  • the overhang is a 3 Or 5' overhang on the antisense strand or sense strand of a double-stranded oligonucleotides .
  • Phosphate analog refers to a chemical moiety that mimics the electrostatic and/or steric properties of a phosphate group.
  • a phosphate analog is positioned at the 5' terminal nucleotide of an oligonucleotide in place of a 5 '-phosphate, which is often susceptible to enzymatic removal.
  • a 5' phosphate analog contains a phosphatase-resistant linkage. Examples of phosphate analogs include 5' phosphonates, such as 5' methylenephosphonate (5'-MP) and 5'-(E)-vinylphosphonate (5 '-VP).
  • an oligonucleotide has a phosphate analog at a 4 '-carbon position of the sugar (referred to as a "4 '-phosphate analog") at a 5'- terminal nucleotide.
  • a 4 '-phosphate analog is oxymethylphosphonate, in which the oxygen atom of the oxymethyl group is bound to the sugar moiety (e.g. , at its 4 '-carbon) or analog thereof. See, for example, U.S. Provisional Application numbers 62/383,207, filed on September 2, 2016, and 62/393,401, filed on September 12, 2016, the contents of each of which relating to phosphate analogs are incorporated herein by reference.
  • Reduced expression refers to a decrease in the amount of RNA transcript or protein encoded by the gene and/or a decrease in the amount of activity of the gene in a cell or subject, as compared to an appropriate reference cell or subject.
  • a double- stranded oligonucleotide e.g. , one having an antisense strand that is complementary to an HBsAg mRNA sequence
  • enzymatic activity e.g.
  • reducing expression refers to an act that results in reduced expression of a gene (e.g. , the S gene of an HBV genome).
  • Region of Complementarity refers to a sequence of nucleotides of a nucleic acid (e.g. , a double-stranded oligonucleotide) that is sufficiently complementary to an antiparallel sequence of nucleotides to permit hybridization between the two sequences of nucleotides under appropriate hybridization conditions, e.g. , in a phosphate buffer, in a cell, etc.
  • a nucleic acid e.g. , a double-stranded oligonucleotide
  • Ribonucleotide refers to a nucleotide having a ribose as its pentose sugar, which contains a hydroxyl group at its 2' position.
  • a modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of atoms other than at the 2' position, including modifications or substitutions in or of the ribose, phosphate group or base.
  • RNAi Oligonucleotide refers to either (a) a double stranded oligonucleotide having a sense strand (passenger) and antisense strand (guide), in which the antisense strand or part of the antisense strand is used by the Argonaute 2 (Ago2) endonuclease in the cleavage of a target mRNA or (b) a single stranded oligonucleotide having a single antisense strand, where that antisense strand (or part of that antisense strand) is used by the Ago2 endonuclease in the cleavage of a target mRNA.
  • Ago2 Argonaute 2
  • Strand refers to a single contiguous sequence of nucleotides linked together through intemucleotide linkages (e.g. , phosphodiester linkages, phosphorothioate linkages). In some embodiments, a strand has two free ends, e.g. , a 5 '-end and a 3 '-end.
  • Subject means any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or non-human primate.
  • the terms “individual” or “patient” may be used interchangeably with “subject.”
  • Synthetic refers to a nucleic acid or other molecule that is artificially synthesized (e.g. , using a machine (e.g. , a solid state nucleic acid synthesizer)) or that is otherwise not derived from a natural source (e.g. , a cell or organism) that normally produces the molecule.
  • a machine e.g. , a solid state nucleic acid synthesizer
  • Targeting ligand refers to a molecule (e.g. , a carbohydrate, amino sugar, cholesterol, polypeptide or lipid) that selectively binds to a cognate molecule (e.g. , a receptor) of a tissue or cell of interest and that is conjugatable to another substance for purposes of targeting the other substance to the tissue or cell of interest.
  • a targeting ligand may be conjugated to an oligonucleotide for purposes of targeting the oligonucleotide to a specific tissue or cell of interest.
  • a targeting ligand selectively binds to a cell surface receptor.
  • a targeting ligand when conjugated to an oligonucleotide facilitates delivery of the oligonucleotide into a particular cell through selective binding to a receptor expressed on the surface of the cell and endosomal internalization by the cell of the complex comprising the oligonucleotide, targeting ligand and receptor.
  • a targeting ligand is conjugated to an oligonucleotide via a linker that is cleaved following or during cellular internalization such that the oligonucleotide is released from the targeting ligand in the cell.
  • Tetraloop refers to a loop that increases stability of an adjacent duplex formed by hybridization of flanking sequences of nucleotides. The increase in stability is detectable as an increase in melting temperature (T m ) of an adjacent stem duplex that is higher than the T m of the adjacent stem duplex expected, on average, from a set of loops of comparable length consisting of randomly selected sequences of nucleotides.
  • T m melting temperature
  • a tetraloop can confer a melting temperature of at least 50 °C, at least 55 °C, at least 56 °C, at least 58 °C, at least 60 °C, at least 65 °C or at least 75 °C in 10 mM NaHP0 4 to a hairpin comprising a duplex of at least 2 base pairs in length.
  • a tetraloop may stabilize a base pair in an adjacent stem duplex by stacking interactions.
  • interactions among the nucleotides in a tetraloop include but are not limited to non- Watson-Crick base-pairing, stacking interactions, hydrogen bonding, and contact interactions (Cheong et ah, Nature 1990 Aug.
  • a tetraloop comprises 4 to 5 nucleotides.
  • a tetraloop comprises or consists of three, four, five, or six nucleotides, which may or may not be modified (e.g. , which may or may not be conjugated to a targeting moiety).
  • a tetraloop consists of four nucleotides. Any nucleotide may be used in the tetraloop and standard IUPAC-IUB symbols for such nucleotides may be used as described in Cornish-Bowden (1985) Nucl.
  • the letter “N” may be used to mean that any base may be in that position
  • the letter “R” may be used to show that A (adenine) or G (guanine) may be in that position
  • “B” may be used to show that C (cytosine), G (guanine), or T (thymine) may be in that position.
  • tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al, Proc Natl Acad Sci USA.
  • DNA tetraloops include the d(GNNA) family of tetraloops (e.g., d(GTTA)), the d(GNRA) family of tetraloops, the d(GNAB) family of tetraloops, the d(CNNG) family of tetraloops, and the d(TNCG) family of tetraloops (e.g., d(TTCG)).
  • d(GNNA) family of tetraloops e.g., d(GTTA)
  • d(GNRA) d(GNRA) family of tetraloops
  • d(GNAB) d(GNAB) family of tetraloops
  • d(CNNG) d(CNNG) family of tetraloops
  • d(TNCG) family of tetraloops e.g., d(TTCG)
  • the tetraloop is contained within a nicked tetraloop structure.
  • treat refers to the act of providing care to a subject in need thereof, e.g., through the administration a therapeutic agent (e.g., an
  • treatment involves reducing the frequency or severity of at least one sign, symptom or contributing factor of a condition (e.g. , HBV infection or related condition) experienced by a subject.
  • a condition e.g. , HBV infection or related condition
  • a subject may exhibit symptoms such as yellowing of the skin and eyes (jaundice), dark urine, extreme fatigue, nausea, vomiting and abdominal pain.
  • a treatment provided herein may result in a reduction in the frequency or severity of one or more of such symptoms.
  • HBV infection can develop into one or more liver conditions, such as cirrhosis, liver fibrosis, liver inflammation or liver cancer.
  • a treatment provided herein may result in a reduction in the frequency or severity of, or prevent or attenuate, one or more of such conditions.
  • Oligonucleotide-based inhibitors i. HBV surface antigen targeting
  • oligonucleotide -based inhibitors of HBV surface antigen expression are provided herein that can be used to achieve a therapeutic benefit.
  • oligonucleotides have been developed for reducing expression of HBV surface antigen (HBsAg) to treat HBV infection.
  • Oligonucleotides provided herein are designed to target HBsAg mRNA sequences covering >95% of known HBV genomes across all known genotypes. In some embodiments, such oligonucleotides result in more than 90% reduction of HBV pre-genomic RNA (pgRNA) and HBsAg mRNAs in liver. In some embodiments, the reduction in HBsAg expression persists for an extended period of time following a single dose or treatment regimen.
  • oligonucleotides provided herein are designed so as to have regions of complementarity to HBsAg mRNA for purposes of targeting the transcripts in cells and inhibiting their expression.
  • the region of complementarity is generally of a suitable length and base content to enable annealing of the oligonucleotide (or a strand thereof) to HBsAg mRNA for purposes of inhibiting its expression.
  • the region of complementarity is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 nucleotides in length.
  • an oligonucleotide provided herein has a region of complementarity to HBsAg mRNA that is in the range of 12 to 30 (e.g. , 12 to 30, 12 to 22, 15 to 25, 17 to 21, 18 to 27, 19 to 27, or 15 to 30) nucleotides in length.
  • an oligonucleotide provided herein has a region of complementarity to HBsAg mRNA that is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.
  • oligonucleotides provided herein are designed to target mRNA sequences encoding HBsAg.
  • an oligonucleotide is provided that has an antisense strand having a region of complementarity to a sequence set forth as: ACAANAAUCCUCACAAUA (SEQ ID NO: 1), which N refers to any nucleotide (A, G, T, or C).
  • the oligonucleotide further comprises a sense strand that forms a duplex region with the antisense strand.
  • the sense strand has a region of complementarity to a sequence set forth as: UUNUUGUGAGGAUUN (SEQ ID NO: 2). In some embodiments, the sense strand comprises a region of complementarity to a sequence as set forth in (shown 5' to 3 '): UUAUUGUGAGGAUUNUUGUC (SEQ ID NO: 3).
  • the antisense strand comprises, or consists of, a sequence set forth as: UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 4). In some embodiments, the antisense strand comprises, or consists of, a sequence set forth as:
  • the antisense strand comprises, or consists of, a sequence set forth as:
  • the sense strand comprises, or consists of, a sequence set forth as: ACAANAAUCCUCACAAUAA (SEQ ID NO: 6). In some embodiments, the sense strand comprises, or consists of, a sequence set forth as: GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 7). In some embodiments, the sense strand comprises, or consists of, a sequence set forth as: GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8). In some embodiments, the sense strand comprises, or consists of, a sequence set forth as:
  • an oligonucleotide for reducing expression of HBsAg mRNA comprises a sense strand forming a duplex region with an antisense strand, where the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 6-8.1, and the antisense strand comprises a sequence as set forth in any one of SEQ ID NOs: 4-5.1.
  • the sense strand comprises 2'-fluoro and 2'-0-methyl modified nucleotides and at least one phosphorothioate internucleotide linkage.
  • the sense strand is conjugated to a N-acetylgalactosamine (GalNAc) moiety.
  • the antisense strand comprises 2'-fluoro and 2'-0-methyl modified nucleotides and at least one phosphorothioate internucleotide linkage.
  • the 4 '-carbon of the sugar of the 5 '-nucleotide of the antisense strand comprises a phosphate analog.
  • each of the antisense strand and the sense strand comprises 2 '-fluoro and 2 '-O-methyl modified nucleotides and at least one phosphorothioate internucleotide linkage, where the 4 '-carbon of the sugar of the 5 '-nucleotide of the antisense strand comprises a phosphate analog, and the sense strand is conjugated to a N-acetylgalactosamine (GalNAc) moiety.
  • GalNAc N-acetylgalactosamine
  • a sense strand comprising a sequence as set forth in any one of SEQ ID NOs: 7-8.1 comprises 2'-fluoro modified nucleotides at positions 3, 8-10, 12, 13, and 17. In some embodiments, the sense strand comprises 2'-0-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36. In some embodiments, the sense strand comprises one phosphorothioate internucleotide linkage. In some embodiments, the sense strand comprises a phosphorothioate internucleotide linkage between nucleotides at positions 1 and 2. In some embodiments, the sense strand is conjugated to a N- acetylgalactosamine (GalNAc) moiety.
  • GalNAc N- acetylgalactosamine
  • an antisense strand comprising a sequence as set forth in any one of SEQ ID NOs: 4-5.1 comprises 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19. In some embodiments, the antisense strand comprises 2'-0-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22. In some
  • the antisense strand comprises three phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotides at positions 1 and 2, between nucleotides at positions 2 and 3, between nucleotides at positions 3 and 4, between nucleotides at positions 20 and 21, and between nucleotides at positions 21 and 22. In some embodiments, the 4 '-carbon of the sugar of the 5 '-nucleotide of the antisense strand comprises a phosphate analog. ii. Double-Stranded Oligonucleotides
  • oligonucleotides that are useful for targeting HBsAg mRNA expression in the methods of the present disclosure, including RNAi, antisense, miRNA, etc. Any of the structures described herein or elsewhere may be used as a framework to incorporate or target a sequence described herein. Double-stranded
  • oligonucleotides for targeting HBV antigen expression generally have a sense strand and an antisense strand that form a duplex with one another.
  • the sense and antisense strands are not covalently linked.
  • the sense and antisense strands are covalently linked.
  • double-stranded oligonucleotides for reducing the expression of HBsAg mRNA expression engage RNA interference (RNAi).
  • RNAi oligonucleotides have been developed with each strand having sizes of 19-25 nucleotides with at least one 3' overhang of 1 to 5 nucleotides (see, e.g. , U.S. Patent No.
  • oligonucleotides Longer oligonucleotides have also been developed that are processed by Dicer to generate active RNAi products (see, e.g. , U.S. Patent No. 8,883,996). Further work produced extended double-stranded oligonucleotides where at least one end of at least one strand is extended beyond a duplex targeting region, including structures where one of the strands includes a thermodynamically- stabilizing tetraloop structure (see, e.g. , U.S. Patent Nos.
  • Such structures may include single- stranded extensions (on one or both sides of the molecule) as well as double- stranded extensions.
  • oligonucleotides provided herein are cleavable by
  • oligonucleotides may have an overhang (e.g. , of 1, 2, or 3 nucleotides in length) in the 3' end of the sense strand.
  • oligonucleotides e.g., siRNAs
  • Such oligonucleotides may comprise a 21 nucleotide guide strand that is antisense to a target RNA and a complementary passenger strand, in which both strands anneal to form a 19-bp duplex and 2 nucleotide overhangs at either or both 3' ends. Longer oligonucleotide designs are also available including
  • oligonucleotides having a guide strand of 23 nucleotides and a passenger strand of 21 nucleotides, where there is a blunt end on the right side of the molecule (3 '-end of passenger strand/5 '-end of guide strand) and a two nucleotide 3 '-guide strand overhang on the left side of the molecule (5 '-end of the passenger strand/3 '-end of the guide strand).
  • there is a 21 base pair duplex region See, for example, US9012138, US9012621, and
  • oligonucleotides as disclosed herein may comprise sense and antisense strands that are both in the range of 17 to 26 (e.g., 17 to 26, 20 to 25, 19 to 21 or 21-23) nucleotides in length.
  • the sense and antisense strands are of equal length.
  • a 3' overhang on the sense, antisense, or both sense and antisense strands is 1 or 2 nucleotides in length.
  • the oligonucleotide has a guide strand of 23 nucleotides and a passenger strand of 21 nucleotides, where there is a blunt end on the right side of the molecule (3 '-end of passenger strand/5 '-end of guide strand) and a two nucleotide 3 '-guide strand overhang on the left side of the molecule (5 '-end of the passenger strand/3 '-end of the guide strand). In such molecules, there is a 21 base pair duplex region.
  • a oligonucleotide comprises a 25 nucleotide sense strand and a 27 nucleotide antisense strand that when acted upon by a dicer enzyme results in an antisense strand that is incorporated into the mature RISC.
  • oligonucleotides designs for use with the compositions and methods disclosed herein include: 16-mer siRNAs (see, e.g., Nucleic Acids in Chemistry and Biology. Blackburn (ed.), Royal Society of Chemistry, 2006), shRNAs (e.g., having 19 bp or shorter stems; see, e.g., Moore et al. Methods Mol. Biol. 2010; 629: 141-158), blunt siRNAs (e.g., of 19 bps in length; see: e.g. , Kraynack and Baker, RNA Vol. 12, pl63-176 (2006)),
  • siRNA asymmetrical siRNAs
  • asymmetrical siRNAs see, e.g., Sun et al, Nat. Biotechnol. 26, 1379-1382 (2008)
  • asymmetric shorter-duplex siRNA see, e.g., Chang et al, Mol Ther. 2009 Apr; 17(4): 725-32
  • fork siRNAs see, e.g., Hohjoh, FEBS Letters, Vol 557, issues 1-3; Jan 2004, p 193-198
  • single-stranded siRNAs (Eisner; Nature Biotechnology 30, 1063 (2012))
  • dumbbell- shaped circular siRNAs see, e.g., Abe et al.
  • RNA small internally segmented interfering RNA
  • siRNA small internally segmented interfering RNA
  • an antisense strand of an oligonucleotide may be referred to as a "guide strand.”
  • a guide strand For example, if an antisense strand can engage with RNA- induced silencing complex (RISC) and bind to an Argonaut protein, or engage with or bind to one or more similar factors, and direct silencing of a target gene, it may be referred to as a guide strand.
  • RISC RNA- induced silencing complex
  • a sense strand complementary with a guide strand may be referred to as a "passenger strand.”
  • an oligonucleotide provided herein comprises an antisense strand that is up to 50 nucleotides in length (e.g. , up to 30, up to 27, up to 25, up to 21, or up to 19 nucleotides in length). In some embodiments, an oligonucleotide provided herein comprises an antisense strand that is at least 12 nucleotides in length (e.g. , at least 12, at least 15, at least 19, at least 21, at least 25, or at least 27 nucleotides in length). In some embodiments, an antisense strand of an oligonucleotide disclosed herein is in the range of 12 to 50 or 12 to 30 (e.g.
  • an antisense strand of any one of the oligonucleotides disclosed herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.
  • the antisense strand comprises a region of
  • the antisense strand comprises a sequence as set forth in (shown 5' to 3 '): UGUGAGGAUU (SEQ ID NO: 10). In some embodiments, the antisense strand comprises a sequence as set forth in (shown 5' to 3 '): TGTGAGGATT (SEQ ID NO: 11).
  • an oligonucleotide for reducing expression of HBsAg mRNA can comprise an antisense strand having a region of complementarity to a sequence as set forth in SEQ ID NO: 9, and one or two non-complementary nucleotides at its 3 ' terminus.
  • the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 4-5.1.
  • an oligonucleotide for reducing expression of HBsAg mRNA can comprise an antisense strand that has a region of complementarity to a sequence as set forth in SEQ ID NO: 9, where the antisense strand does not have a sequence as set forth in any one of the following (shown 5' to 3 '): TATTGTGAGGATTCTTGTCA (SEQ ID NO: 12); CGGTATTGTGAGGATTCTTG (SEQ ID NO: 13); TGTGAGGATTCTTGTCAACA (SEQ ID NO: 14); UAUUGUGAGGAUUUUUGUCAA (SEQ ID NO: 15);
  • the antisense strand differs from the nucleotide sequence set forth in SEQ ID NOs: 4, 5, or 5.1 by no more than three nucleotides. b. Sense Strands
  • a double-stranded oligonucleotide may have a sense strand of up to 40 nucleotides in length (e.g. , up to 40, up to 35, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length).
  • an oligonucleotide may have a sense strand of at least 12 nucleotides in length (e.g. , at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides in length).
  • an oligonucleotide may have a sense strand in a range of 12 to 50 (e.g. , 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40, 15 to 36, 15 to 32, 15 to 28, 17 to 21, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40, or 32 to 40) nucleotides in length.
  • an oligonucleotide may have a sense strand of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.
  • a sense strand of an oligonucleotide is longer than 27 nucleotides (e.g. , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides). In some embodiments, a sense strand of an oligonucleotide is longer than 25 nucleotides (e.g. , 26, 27, 28, 29 or 30 nucleotides).
  • a sense strand comprises a stem-loop at its 3 '-end. In some embodiments, a sense strand comprises a stem-loop at its 5 '-end. In some embodiments, a strand comprising a stem loop is in the range of 2 to 66 nucleotides long (e.g. , 2 to 66, 10 to 52, 14 to 40, 2 to 30, 4 to 26, 8 to 22, 12 to 18, 10 to 22, 14 to 26, or 14 to 30 nucleotides long). In some embodiments, a strand comprising a stem loop is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • a stem comprises a duplex of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length.
  • a stem-loop provides the molecule better protection against degradation (e.g. , enzymatic degradation) and facilitates targeting characteristics for delivery to a target cell.
  • a loop provides added nucleotides on which modification can be made without substantially affecting the gene expression inhibition activity of an oligonucleotide.
  • an oligonucleotide is provided herein in which the sense strand comprises (e.g.
  • a stem- loop set forth as: S1-L-S2, in which S i is complementary to S2, and in which L forms a loop between Si and S2 of up to 10 nucleotides in length (e.g. , 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length).
  • a loop (L) of a stem- loop is a tetraloop (e.g. , within a nicked tetraloop structure).
  • a tetraloop may contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. Typically, a tetraloop has 4 to 5 nucleotides.
  • a duplex formed between a sense and antisense strand is at least 12 (e.g. , at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is in the range of 12-30 nucleotides in length (e.g. , 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30 or 21 to 30 nucleotides in length).
  • a duplex formed between a sense and antisense strand is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments a duplex formed between a sense and antisense strand does not span the entire length of the sense strand and/or antisense strand. In some embodiments, a duplex between a sense and antisense strand spans the entire length of either the sense or antisense strands. In certain embodiments, a duplex between a sense and antisense strand spans the entire length of both the sense strand and the antisense strand. d. Oligonucleotide Ends
  • an oligonucleotide comprises sense and antisense strands, such that there is a 3 '-overhang on either the sense strand or the antisense strand, or both the sense and antisense strand.
  • oligonucleotides provided herein have one 5 'end that is thermodynamically less stable compared to the other 5' end.
  • an asymmetry oligonucleotide is provided that includes a blunt end at the 3' end of a sense strand and an overhang at the 3' end of an antisense strand.
  • a 3' overhang on an antisense strand is 1-8 nucleotides in length (e.g. , 1, 2, 3, 4, 5, 6, 7 or 8 nucleotides in length).
  • an oligonucleotide for RNAi has a two nucleotide overhang on the
  • an overhang is a 3 ' overhang comprising a length of between one and six nucleotides, optionally one to five, one to four, one to three, one to two, two to six, two to five, two to four, two to three, three to six, three to five, three to four, four to six, four to five, five to six nucleotides, or one, two, three, four, five or six nucleotides.
  • nucleotides optionally one to five, one to four, one to three, one to two, two to six, two to five, two to four, two to three, three to six, three to five, three to four, four to six, four to five, five to six nucleotides, or one, two, three, four, five or six nucleotides.
  • the overhang is a 5' overhang comprising a length of between one and six nucleotides, optionally one to five, one to four, one to three, one to two, two to six, two to five, two to four, two to three, three to six, three to five, three to four, four to six, four to five, five to six nucleotides, or one, two, three, four, five or six nucleotides.
  • 3' end or 5' end of a sense and/or antisense strand are modified.
  • one or two terminal nucleotides of the 3' end of an antisense strand are modified.
  • the last nucleotide at the 3' end of an antisense strand is modified, e.g. , comprises 2' -modification, e.g. , a 2'-0-methoxyethyl.
  • the last one or two terminal nucleotides at the 3' end of an antisense strand are complementary with the target.
  • the last one or two nucleotides at the 3' end of the antisense strand are not complementary with the target.
  • a double stranded oligonucleotide that has a nicked tetraloop structure at the 3' end sense strand, and two terminal overhang nucleotides at the 3' end of its antisense strand.
  • the two terminal overhang nucleotides are GG.
  • one or both of the two terminal GG nucleotides of the antisense strand is or are not complementary with the target.
  • the 5' end and/or the 3' end of a sense or antisense strand has an inverted cap nucleotide.
  • one or more e.g., 2, 3, 4, 5, 6) modified
  • internucleotide linkages are provided between terminal nucleotides of the 3' end or 5' end of a sense and/or antisense strand. In some embodiments, modified internucleotide linkages are provided between overhang nucleotides at the 3' end or 5' end of a sense and/or antisense strand. e. Mismatches
  • an oligonucleotide may have one or more (e.g. , 1, 2, 3,
  • mismatches between a sense and antisense strand If there is more than one mismatch between a sense and antisense strand, they may be positioned consecutively (e.g. , 2, 3 or more in a row), or interspersed throughout the region of complementarity.
  • the 3'- terminus of the sense strand contains one or more mismatches.
  • two mismatches are incorporated at the 3' terminus of the sense strand.
  • base mismatches or destabilization of segments at the 3 '-end of the sense strand of the oligonucleotide improved the potency of synthetic duplexes in RNAi, possibly through facilitating processing by Dicer.
  • an antisense strand may have a region of
  • a region of complementarity on an oligonucleotide may have up to 1, up to 2, up to 3, up to 4, up to 5, etc. mismatches provided that it maintains the ability to form complementary base pairs with the transcript under appropriate hybridization conditions.
  • a region of complementarity of an oligonucleotide may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches provided that it maintains the ability to form complementary base pairs with HBsAg mRNA under appropriate hybridization conditions.
  • oligonucleotide may be positioned consecutively (e.g. , 2, 3, 4, or more in a row), or interspersed throughout the region of complementarity provided that the oligonucleotide maintains the ability to form complementary base pairs with HBsAg mRNA under appropriate hybridization conditions. iii. Single-Stranded Oligonucleotides
  • an oligonucleotide for reducing HBsAg expression as described herein is single-stranded oligonucleotides having complementarity with HBsAg mRNA.
  • Such structures may include, but are not limited to single- stranded RNAi
  • oligonucleotides are antisense oligonucleotides (ASOs).
  • An antisense oligonucleotide is a single-stranded oligonucleotide that has a nucleobase sequence which, when written in the 5' to 3' direction, comprises the reverse complement of a targeted segment of a particular nucleic acid and is suitably modified (e.g., as a gapmer) so as to induce RNaseH mediated cleavage of its target RNA in cells or (e.g., as a mixmer) so as to inhibit translation of the target mRNA in cells.
  • Antisense oligonucleotides for use in the instant disclosure may be modified in any suitable manner known in the art including, for example, as shown in U.S. Patent No.
  • Oligonucleotides may be modified in various ways to improve or control specificity, stability, delivery, bioavailability, resistance from nuclease degradation, immunogenicity, base-paring properties, RNA distribution and cellular uptake and other features relevant to therapeutic or research use. See, e.g., Bramsen et ah, Nucleic Acids Res., 2009, 37, 2867-2881; Bramsen and Kjems (Frontiers in Genetics, 3 (2012): 1-22).
  • oligonucleotides of the present disclosure may include one or more suitable modifications.
  • a modified nucleotide has a modification in its base (or nucleobase), the sugar (e.g., ribose, deoxyribose), or the phosphate group.
  • oligonucleotides may be delivered in vivo by conjugating them to or encompassing them in a lipid nanoparticle (LNP) or similar carrier.
  • LNP lipid nanoparticle
  • an oligonucleotide is not protected by an LNP or similar carrier, it may be advantageous for at least some of the its nucleotides to be modified. Accordingly, in certain embodiments of any of the oligonucleotides provided herein, all or substantially all of the nucleotides of an oligonucleotide are modified.
  • an oligonucleotide as disclosed herein has a number and type of modified nucleotides sufficient to cause the desired characteristic (e.g., protection from enzymatic degradation, capacity to target a desired cell after in vivo administration, and/or
  • a modified sugar (also referred to herein as a sugar analog) includes a modified deoxyribose or ribose moiety, e.g., in which one or more modifications occur at the 2', 3', 4', and/or 5' carbon position of the sugar.
  • a modified deoxyribose or ribose moiety e.g., in which one or more modifications occur at the 2', 3', 4', and/or 5' carbon position of the sugar.
  • a modified sugar may also include non-natural alternative carbon structures such as those present in locked nucleic acids ("LNA”) (see, e.g., Koshkin et al. (1998), Tetrahedron 54, 3607-3630), unlocked nucleic acids (“UNA”) (see, e.g., Snead et al. (2013), Molecular Therapy - Nucleic Acids, 2, el03), and bridged nucleic acids (“BNA”) (see, e.g., Imanishi and Obika (2002), The Royal Society of Chemistry, Chem. Commun., 1653-1659).
  • LNA locked nucleic acids
  • NDA unlocked nucleic acids
  • BNA bridged nucleic acids
  • Koshkin et al., Snead et al., and Imanishi and Obika are incorporated by reference herein for their disclosures relating to sugar modifications.
  • a nucleotide modification in a sugar comprises a 2'- modification.
  • a 2 '-modification may be 2'-aminoethyl, 2'-fluoro, 2'-0-methyl, 2'-0- methoxyethyl, and 2'-deoxy-2'-fluoro-P-d-arabinonucleic acid.
  • the modification is 2'-fluoro, 2'-0-methyl, or 2'-0-methoxyethyl.
  • a modification in a sugar comprises a modification of the sugar ring, which may comprise modification of one or more carbons of the sugar ring.
  • a modification of a sugar of a nucleotide may comprise a 2'-oxygen of a sugar is linked to a 1 '-carbon or 4'-carbon of the sugar, or a 2'- oxygen is linked to the 1 '-carbon or 4 '-carbon via an ethylene or methylene bridge.
  • a modified nucleotide has an acyclic sugar that lacks a 2'-carbon to 3 '-carbon bond.
  • a modified nucleotide has a thiol group, e.g., in the 4' position of the sugar.
  • the terminal 3 '-end group (e.g., a 3'-hydroxyl) is a phosphate group or other group, which can be used, for example, to attach linkers, adapters or labels or for the direct ligation of an oligonucleotide to another nucleic acid.
  • a 3'-end group e.g., a 3'-hydroxyl
  • the terminal 3 '-end group is a phosphate group or other group, which can be used, for example, to attach linkers, adapters or labels or for the direct ligation of an oligonucleotide to another nucleic acid.
  • 5'-terminal phosphate groups of oligonucleotides enhance the interaction with Argonaut 2.
  • oligonucleotides comprising a 5'- phosphate group may be susceptible to degradation via phosphatases or other enzymes, which can limit their bioavailability in vivo.
  • oligonucleotides include analogs of 5' phosphates that are resistant to such degradation.
  • a phosphate analog may be oxymethylphosphonate, vinylphosphonate, or malonylphosphonate.
  • the 5' end of an oligonucleotide strand is attached to a chemical moiety that mimics the electrostatic and steric properties of a natural 5 '-phosphate group (“phosphate mimic”) (see, e.g., Prakash et al. (2015), Nucleic Acids Res., Nucleic Acids Res. 2015 Mar 31; 43(6): 2993-3011, the contents of which relating to phosphate analogs are incorporated herein by reference). Many phosphate mimics have been developed that can be attached to the 5' end (see, e.g., U.S. Patent No. 8,927,513, the contents of which relating to phosphate analogs are incorporated herein by reference).
  • a hydroxyl group is attached to the 5' end of the oligonucleotide.
  • an oligonucleotide has a phosphate analog at a 4'- carbon position of the sugar (referred to as a "4 '-phosphate analog"). See, for example, U.S. Provisional Application numbers 62/383,207, entitled 4' -Phosphate Analogs and
  • an oligonucleotide provided herein comprises a 4'-phosphate analog at a 5 '-terminal nucleotide.
  • a phosphate analog is an
  • a 4 '-phosphate analog is a thiomethylphosphonate or an aminomethylphosphonate, in which the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is bound to the 4 '-carbon of the sugar moiety or analog thereof.
  • a 4 '-phosphate analog is an oxymethylphosphonate.
  • an oxymethylphosphonate is represented by the formula -0-CH 2 -PO(OH) 2 or -0-CH 2 -PO(OR) 2 , in which R is independently selected from H, CH 3 , an alkyl group, CH 2 CH 2 CN, CH 2 OCOC(CH 3 ) 3 , CH 2 OCH 2 CH 2 Si(CH 3 ) 3 , or a protecting group.
  • the alkyl group is CH 2 CH 3 . More typically, R is independently selected from H, CH 3 , or CH 2 CH 3 .
  • a phosphate analog attached to the oligonucleotide is a methoxy phosphonate (MOP).
  • MOP methoxy phosphonate
  • a phosphate analog attached to the oligonucleotide is a 5' mono-methyl protected MOP.
  • the following uridine nucleotide comprising a phosphate analog may be used, e.g. , at the first position of a guide (antisense) strand:
  • phosphate modifications or substitutions may result in an oligonucleotide that comprises at least one (e.g. , at least 1, at least 2, at least 3 or at least 5) modified intemucleotide linkage.
  • any one of the oligonucleotides disclosed herein comprises 1 to 10 (e.g. , 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3 or 1 to 2) modified intemucleotide linkages.
  • any one of the oligonucleotides disclosed herein comprises 1 to 10 (e.g. , 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3 or 1 to 2) modified intemucleotide linkages.
  • any one of the oligonucleotide comprises 1 to 10 (e.g. , 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3 or 1 to 2) modified intemucleotide linkages.
  • oligonucleotides disclosed herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified
  • a modified intemucleotide linkage may be a phosphorothioate linkage, a phosphorothioate linkage, a phosphotriester linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a phosphoramidite linkage, a phosphonate linkage or a boranophosphate linkage.
  • at least one modified intemucleotide linkage of any one of the oligonucleotides as disclosed herein is a phosphorothioate linkage.
  • oligonucleotides provided herein have one or more modified nucleobases.
  • modified nucleobases also referred to herein as base analogs
  • base analogs are linked at the 1 ' position of a nucleotide sugar moiety.
  • a modified nucleobase is a nitrogenous base. In certain embodiments, a modified nucleobase does not contain a nitrogen atom. See e.g. , U.S. Published Patent Application No. 20080274462. In some embodiments, a modified nucleotide comprises a universal base. However, in certain embodiments, a modified nucleotide does not contain a nucleobase (abasic).
  • a universal base is a heterocyclic moiety located at the
  • nucleotide sugar moiety in a modified nucleotide or the equivalent position in a nucleotide sugar moiety substitution that, when present in a duplex, can be positioned opposite more than one type of base without substantially altering the structure of the duplex.
  • a reference single-stranded nucleic acid e.g., a reference single-stranded nucleic acid
  • a single- stranded nucleic acid containing a universal base forms a duplex with the target nucleic acid that has a lower T m than a duplex formed with the complementary nucleic acid.
  • the single-stranded nucleic acid containing the universal base forms a duplex with the target nucleic acid that has a higher T m than a duplex formed with the nucleic acid comprising the mismatched base.
  • Non-limiting examples of universal-binding nucleotides include inosine, 1- ⁇ -
  • a reversibly modified nucleotide comprises a glutathione- sensitive moiety.
  • nucleic acid molecules have been chemically modified with cyclic disulfide moieties to mask the negative charge created by the intemucleotide diphosphate linkages and improve cellular uptake and nuclease resistance. See U.S. Published Application No. 2011/0294869 originally assigned to Traversa Therapeutics, Inc. ("Traversa"), PCT Publication No. WO 2015/188197 to Solstice Biologies, Ltd.
  • such a reversible modification allows protection during in vivo administration ⁇ e.g., transit through the blood and/or lysosomal/endosomal
  • oligonucleotide will be exposed to nucleases and other harsh environmental conditions ⁇ e.g., pH).
  • nucleases and other harsh environmental conditions e.g., pH.
  • glutathione When released into the cytosol of a cell where the levels of glutathione are higher compared to extracellular space, the modification is reversed and the result is a cleaved oligonucleotide.
  • glutathione sensitive moieties it is possible to introduce sterically larger chemical groups into the oligonucleotide of interest as compared to the options available using irreversible chemical modifications. This is because these larger chemical groups will be removed in the cytosol and, therefore, should not interfere with the biological activity of the oligonucleotides inside the cytosol of a cell.
  • these larger chemical groups can be engineered to confer various advantages to the nucleotide or oligonucleotide, such as nuclease resistance, lipophilicity, charge, thermal stability, specificity, and reduced immunogenicity.
  • the structure of the glutathione- sensitive moiety can be engineered to modify the kinetics of its release.
  • a glutathione-sensitive moiety is attached to the sugar of the nucleotide. In some embodiments, a glutathione- sensitive moiety is attached to the 2'- carbon of the sugar of a modified nucleotide. In some embodiments, the glutathione-sensitive moiety is located at the 5 '-carbon of a sugar, particularly when the modified nucleotide is the 5 '-terminal nucleotide of the oligonucleotide. In some embodiments, the glutathione-sensitive moiety is located at the 3 '-carbon of a sugar, particularly when the modified nucleotide is the 3 '-terminal nucleotide of the oligonucleotide.
  • the glutathione-sensitive moiety comprises a sulfonyl group. See, e.g., U.S. Prov. Appl. No. 62/378,635, entitled Compositions Comprising Reversibly Modified Oligonucleotides and Uses Thereof, which was filed on August 23, 2016, the contents of which are incorporated by reference herein for its relevant disclosures. v. Targeting Ligands
  • oligonucleotides of the disclosure may be desirable to target the oligonucleotides of the disclosure to one or more cells or one or more organs. Such a strategy may help to avoid undesirable effects in other organs, or may avoid undue loss of the oligonucleotide to cells, tissue or organs that would not benefit for the oligonucleotide. Accordingly, in some embodiments, oligonucleotides disclosed herein may be modified to facilitate targeting of a particular tissue, cell or organ, e.g. , to facilitate delivery of the oligonucleotide to the liver. In certain embodiments, oligonucleotides disclosed herein may be modified to facilitate delivery of the oligonucleotide to the hepatocytes of the liver. In some embodiments, an
  • oligonucleotide comprises a nucleotide that is conjugated to one or more targeting ligands.
  • a targeting ligand may comprise a carbohydrate, amino sugar, cholesterol, peptide, polypeptide, protein or part of a protein (e.g. , an antibody or antibody fragment) or lipid.
  • a targeting ligand is an aptamer.
  • a targeting ligand may be an RGD peptide that is used to target tumor vasculature or glioma cells, CREKA peptide to target tumor vasculature or stoma, transferrin, lactoferrin, or an aptamer to target transferrin receptors expressed on CNS vasculature, or an anti-EGFR antibody to target EGFR on glioma cells.
  • the targeting ligand is one or more GalNAc moieties.
  • nucleotides of an oligonucleotide are each conjugated to a separate targeting ligand.
  • 2 to 4 nucleotides of an oligonucleotide are each conjugated to a separate targeting ligand.
  • targeting ligands are conjugated to 2 to 4 nucleotides at either ends of the sense or antisense strand (e.g.
  • ligands are conjugated to a 2 to 4 nucleotide overhang or extension on the 5 Or 3 ' end of the sense or antisense strand) such that the targeting ligands resemble bristles of a toothbrush and the oligonucleotide resembles a toothbrush.
  • an oligonucleotide resembles a toothbrush.
  • oligonucleotide may comprise a stem- loop at either the 5 Or 3 ' end of the sense strand and 1, 2, 3 or 4 nucleotides of the loop of the stem may be individually conjugated to a targeting ligand.
  • oligonucleotide that reduces the expression of HBV antigen to the hepatocytes of the liver of a subject.
  • Any suitable hepatocyte targeting moiety may be used for this purpose.
  • GalNAc is a high affinity ligand for asialoglycoprotein receptor (ASGPR), which is primarily expressed on the sinusoidal surface of hepatocyte cells and has a major role in binding, internalization, and subsequent clearance of circulating glycoproteins that contain terminal galactose or N-acetylgalactosamine residues (asialoglycoproteins).
  • Conjugation (either indirect or direct) of GalNAc moieties to oligonucleotides of the instant disclosure may be used to target these oligonucleotides to the ASGPR expressed on these hepatocyte cells.
  • an oligonucleotide of the instant disclosure is conjugated directly or indirectly to a monovalent GalNAc.
  • the oligonucleotide is conjugated directly or indirectly to more than one monovalent GalNAc (i.e. , is conjugated to 2, 3, or 4 monovalent GalNAc moieties, and is typically conjugated to 3 or 4 monovalent GalNAc moieties).
  • an oligonucleotide of the instant disclosure is conjugated to one or more bivalent GalNAc, trivalent GalNAc, or tetravalent GalNAc moieties.
  • nucleotides of an oligonucleotide are each conjugated to a GalNAc moiety.
  • 2 to 4 nucleotides of the loop (L) of the stem-loop are each conjugated to a separate GalNAc.
  • targeting ligands are conjugated to 2 to 4 nucleotides at either ends of the sense or antisense strand (e.g.
  • ligands are conjugated to a 2 to 4 nucleotide overhang or extension on the 5 Or 3 ' end of the sense or antisense strand) such that the GalNAc moieties resemble bristles of a toothbrush and the oligonucleotide resembles a toothbrush.
  • an oligonucleotide may comprise a stem- loop at either the 5 Or 3 ' end of the sense strand and 1, 2, 3 or 4 nucleotides of the loop of the stem may be individually conjugated to a GalNAc moiety.
  • GalNAc moieties are conjugated to a nucleotide of the sense strand.
  • four GalNAc moieties can be conjugated to nucleotides in the tetraloop of the sense strand, where each GalNAc moiety is conjugated to one nucleotide.
  • an oligonucleotide herein comprises a monovalent
  • GalNac attached to a Guanidine nucleotide referred to as [ademG-GalNAc] or 2'- aminodiethoxymethanol-Guanidine-GalNAc, as depicted below:
  • an oligonucleotide herein comprises a monovalent
  • GalNac attached to an adenine nucleotide, referred to as [ademA-GalNAc] or 2'- aminodiethoxymethanol-Adenine-GalNAc, as depicted below.
  • a targeting ligand is conjugated to a nucleotide using a click linker.
  • an acetal-based linker is used to conjugate a targeting ligand to a nucleotide of any one of the oligonucleotides described herein.
  • Acetal-based linkers are disclosed, for example, in International Patent Application Publication Number WO2016100401 Al, which published on June 23, 2016, and the contents of which relating to such linkers are incorporated herein by reference.
  • the linker is a labile linker. However, in other embodiments, the linker is fairly stable.
  • a loop comprising from 5' to 3 ' the nucleotides GAAA, in which GalNac moieties are attached to nucleotides of the loop using an acetal linker.
  • Such a loop may be present, for example, at positions 27-30 of the molecule shown in FIG. 10.
  • V is an attachment point to the oligonucleotide strand.
  • oligonucleotides can be delivered to a subject or a cellular environment using a formulation that minimizes degradation, facilitates delivery and/or uptake, or provides another beneficial property to the oligonucleotides in the formulation.
  • compositions comprising oligonucleotides (e.g. , single- stranded or double- stranded oligonucleotides) to reduce the expression of HBV antigen (e.g., HBsAg).
  • HBV antigen e.g., HBsAg
  • Such compositions can be suitably formulated such that when administered to a subject, either into the immediate environment of a target cell or systemically, a sufficient portion of the oligonucleotides enter the cell to reduce HBV antigen expression.
  • an oligonucleotide is formulated in buffer solutions such as phosphate-buffered saline solutions, liposomes, micellar structures, and capsids.
  • Formulations of oligonucleotides with cationic lipids can be used to facilitate transfection of the oligonucleotides into cells.
  • cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g. , polylysine) can be used.
  • Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche) all of which can be used according to the manufacturer's instructions.
  • a formulation comprises a lipid nanoparticle.
  • an excipient comprises a liposome, a lipid, a lipid complex, a microsphere, a microparticle, a nanosphere, or a nanoparticle, or may be otherwise formulated for administration to the cells, tissues, organs, or body of a subject in need thereof (see, e.g. , Remington: The Science and Practice of Pharmacy, 22nd edition, Pharmaceutical Press, 2013).
  • formulations as disclosed herein comprise an excipient.
  • an excipient confers to a composition improved stability, improved absorption, improved solubility and/or therapeutic enhancement of the active ingredient.
  • an excipient is a buffering agent (e.g. , sodium citrate, sodium phosphate, a tris base, or sodium hydroxide) or a vehicle (e.g. , a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil).
  • a buffering agent e.g. , sodium citrate, sodium phosphate, a tris base, or sodium hydroxide
  • a vehicle e.g. , a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil.
  • an oligonucleotide is lyophilized for extending its shelf-life and then made into a solution before use (e.g. , administration to a subject).
  • an excipient in a composition comprising any one of the oligonucleotides described herein may be a lyoprotectant (e.g. , mannitol, lactose, polyethylene glycol, or polyvinyl pyrolidone), or a collapse temperature modifier (e.g. , dextran, ficoll, or gelatin).
  • a lyoprotectant e.g. , mannitol, lactose, polyethylene glycol, or polyvinyl pyrolidone
  • a collapse temperature modifier e.g. , dextran, ficoll, or gelatin
  • a pharmaceutical composition is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g. , intravenous, intradermal, subcutaneous, oral (e.g. , inhalation), transdermal (topical), transmucosal, and rectal administration.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition.
  • Sterile injectable solutions can be prepared by incorporating the oligonucleotides in a required amount in a selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • a composition may contain at least about 0.1% of the therapeutic agent (e.g., an oligonucleotide for reducing HBV antigen expression) or more, although the percentage of the active ingredient(s) may be between about 1% and about 80% or more of the weight or volume of the total composition.
  • the therapeutic agent e.g., an oligonucleotide for reducing HBV antigen expression
  • the percentage of the active ingredient(s) may be between about 1% and about 80% or more of the weight or volume of the total composition.
  • Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
  • a cell is any cell that expresses HBV antigen (e.g., hepatocytes, macrophages, monocyte-derived cells, prostate cancer cells, cells of the brain, endocrine tissue, bone marrow, lymph nodes, lung, gall bladder, liver, duodenum, small intestine, pancreas, kidney, gastrointestinal tract, bladder, adipose and soft tissue and skin).
  • HBV antigen e.g., hepatocytes, macrophages, monocyte-derived cells, prostate cancer cells, cells of the brain, endocrine tissue, bone marrow, lymph nodes, lung, gall bladder, liver, duodenum, small intestine, pancreas, kidney, gastrointestinal tract, bladder, adipose and soft tissue and skin.
  • the cell is a primary cell that has been obtained from a subject and that may have undergone a limited number of a passages, such that the cell substantially maintains its natural phenotypic properties.
  • a cell to which the oligonucleotide is delivered is ex vivo or in vitro (i.e., can be delivered to a cell in culture or to an organism in which the cell resides).
  • methods are provided for delivering to a cell an effective amount any one of the oligonucleotides disclosed herein for purposes of reducing expression of HBsAg solely in hepatocytes.
  • oligonucleotides disclosed herein can be introduced using appropriate nucleic acid delivery methods including injection of a solution containing the oligonucleotides, bombardment by particles covered by the oligonucleotides, exposing the cell or organism to a solution containing the oligonucleotides, or electroporation of cell membranes in the presence of the oligonucleotides.
  • appropriate nucleic acid delivery methods including injection of a solution containing the oligonucleotides, bombardment by particles covered by the oligonucleotides, exposing the cell or organism to a solution containing the oligonucleotides, or electroporation of cell membranes in the presence of the oligonucleotides.
  • Other appropriate methods for delivering including injection of a solution containing the oligonucleotides, bombardment by particles covered by the oligonucleotides, exposing the cell or organism to a solution containing the oligonucleotides, or
  • oligonucleotides to cells may be used, such as lipid-mediated carrier transport, chemical- mediated transport, and cationic liposome transfection such as calcium phosphate, and others.
  • the consequences of inhibition can be confirmed by an appropriate assay to evaluate one or more properties of a cell or subject, or by biochemical techniques that evaluate molecules indicative of HBV antigen expression (e.g. , RNA, protein).
  • the extent to which an oligonucleotide provided herein reduces levels of expression of HBV antigen is evaluated by comparing expression levels (e.g. , mRNA or protein levels) of HBV antigen to an appropriate control (e.g. , a level of HBV antigen expression in a cell or population of cells to which an oligonucleotide has not been delivered or to which a negative control has been delivered).
  • an appropriate control level of HBV antigen expression may be a predetermined level or value, such that a control level need not be measured every time.
  • the predetermined level or value can take a variety of forms.
  • a predetermined level or value can be single cut-off value, such as a median or mean.
  • administering results in a reduction in the level of HBV antigen (e.g., HBsAg) expression in a cell.
  • HBV antigen e.g., HBsAg
  • the reduction in levels of HBV antigen expression may be a reduction to 1% or lower, 5% or lower, 10% or lower, 15% or lower, 20% or lower, 25% or lower, 30% or lower, 35% or lower, 40% or lower, 45% or lower, 50% or lower, 55% or lower, 60% or lower, 70% or lower, 80% or lower, or 90% or lower compared with an appropriate control level of HBV antigen.
  • the appropriate control level may be a level of HBV antigen expression in a cell or population of cells that has not been contacted with an oligonucleotide as described herein.
  • the effect of delivery of an oligonucleotide to a cell according to a method disclosed herein is assessed after a finite period of time.
  • levels of HBV antigen may be analyzed in a cell at least 8 hours, 12 hours, 18 hours, 24 hours; or at least one, two, three, four, five, six, seven, fourteen, twenty-one, twenty-eight, thirty-five, forty-two, forty-nine, fifty-six, sixty-three, seventy, seventy-seven, eighty-four, ninety-one, ninety-eight, 105, 112, 119, 126, 133, 140, or 147 days after introduction of the oligonucleotide into the cell.
  • the reduction in the level of HBV antigen e.g., HBV antigen
  • HBsAg expression persists for an extended period of time following administration.
  • a detectable reduction in HBsAg expression persists within a period of 7 to 70 days following administration of an oligonucleotide described herein.
  • the detectable reduction persists within a period of 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, or 10 to 20 days following administration of the oligonucleotide.
  • the detectable reduction persists within a period of 20 to 70, 20 to 60, 20 to 50, 20 to 40, or 20 to 30 days following administration of the oligonucleotide.
  • the detectable reduction persists within a period of 30 to 70, 30 to 60, 30 to 50, or 30 to 40 days following administration of the oligonucleotide. In some embodiments, the detectable reduction persists within a period of 40 to 70, 40 to 60, 40 to 50, 50 to 70, 50 to 60, or 60 to 70 days following administration of the oligonucleotide.
  • a detectable reduction in HBsAg expression persists within a period of 2 to 21 weeks following administration of an oligonucleotide described herein.
  • the detectable reduction persists within a period of 2 to 20, 4 to 20, 6 to 20, 8 to 20, 10 to 20, 12 to 20, 14 to 20, 16 to 20, or 18 to 20 weeks following administration of the oligonucleotide.
  • the detectable reduction persists within a period of 2 to 16, 4 to 16, 6 to 16, 8 to 16, 10 to 16, 12 to 16, or 14 to 16 weeks following administration of the oligonucleotide.
  • the detectable reduction persists within a period of 2 to 12, 4 to 12, 6 to 12, 8 to 12, or 10 to 12 weeks following administration of the oligonucleotide. In some embodiments, the detectable reduction persists within a period of 2 to 10, 4 to 10, 6 to 10, or 8 to 10 weeks following administration of the oligonucleotide.
  • an oligonucleotide is delivered in the form of a transgene that is engineered to express in a cell the oligonucleotides (e.g. , its sense and antisense strands).
  • an oligonucleotide is delivered using a transgene that is engineered to express any oligonucleotide disclosed herein.
  • Transgenes may be delivered using viral vectors (e.g. , adenovirus, retrovirus, vaccinia virus, poxvirus, adeno- associated virus or herpes simplex virus) or non- viral vectors (e.g. , plasmids or synthetic mRNAs).
  • transgenes can be injected directly to a subject. ii. Treatment Methods [000159] Aspects of the disclosure relate to methods for reducing HBsAg expression
  • the methods may comprise administering to a subject in need thereof an effective amount of any one of the oligonucleotides disclosed herein.
  • the present disclosure provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) HBV infection and/or a disease or disorder associated with HBV infection.
  • the disclosure provides a method for preventing in a subject, a disease or disorder as described herein by administering to the subject a therapeutic agent (e.g. , an oligonucleotide or vector or transgene encoding same).
  • a therapeutic agent e.g. , an oligonucleotide or vector or transgene encoding same.
  • the subject to be treated is a subject who will benefit therapeutically from a reduction in the amount of HBsAg protein, e.g. , in the liver.
  • Subjects at risk for the disease or disorder can be identified by, for example, one or a combination of diagnostic or prognostic assays known in the art (e.g. , identification of liver cirrhosis and/or liver inflammation).
  • Administration of a prophylactic agent can occur prior to the detection of or the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in its progression.
  • Methods described herein typically involve administering to a subject an effective amount of an oligonucleotide, that is, an amount capable of producing a desirable therapeutic result.
  • a therapeutically acceptable amount may be an amount that is capable of treating a disease or disorder.
  • the appropriate dosage for any one subject will depend on certain factors, including the subject's size, body surface area, age, the particular composition to be administered, the active ingredient(s) in the composition, time and route of
  • the dosage can be in the range of 0.1 mg/kg to 12 mg/kg.
  • the dosage could also be in the range of 0.5 to 10 mg/kg.
  • the dosage can be in the range of 1.0 to 6.0 mg/kg.
  • the dosage could also be in the range of 3.0 to 5.0 mg/kg.
  • a subject is administered any one of the compositions disclosed herein either enterally (e.g. , orally, by gastric feeding tube, by duodenal feeding tube, via gastrostomy or rectally), parenterally (e.g. , subcutaneous injection, intravenous injection or infusion, intra- arterial injection or infusion, intraosseous infusion, intramuscular injection, intracerebral injection, intracerebroventricular injection, intrathecal), topically (e.g. , epicutaneous, inhalational, via eye drops, or through a mucous membrane), or by direct injection into a target organ (e.g. , the liver of a subject).
  • enterally e.g. , orally, by gastric feeding tube, by duodenal feeding tube, via gastrostomy or rectally
  • parenterally e.g. , subcutaneous injection, intravenous injection or infusion, intra- arterial injection or infusion, intraosseous infusion, intramuscular injection, intracerebral injection, intracerebro
  • oligonucleotides disclosed herein are administered intravenously or subcutaneously.
  • the oligonucleotides of the instant disclosure would typically be administered quarterly (once every three months), bi-monthly (once every two months), monthly, or weekly.
  • the oligonucleotides may be administered every one, two, or three weeks.
  • the oligonucleotides may be administered daily.
  • the subject to be treated is a human or non-human primate or other mammalian subject.
  • Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and animals such as mice, rats, guinea pigs, and hamsters.
  • HBV surface antigen was identified as a target for RNAi-based therapy to treat HBV infection.
  • HBsAg is encoded by three RNA molecules transcribed from a single ORF. Oligonucleotides were designed for purposes of silencing one or more RNA transcripts that contribute to HBsAg assembly (example RNAi target site indicated by "X" in FIG. 1).
  • An HBsAg-targeting oligonucleotide, HBV-254 was designed and evaluated in vitro and in vivo.
  • HBV-254 was selected and designed based on an ability to directly target mRNA transcripts for four HBV RNA species.
  • the HBV-254 duplex oligonucleotide used in the experiments included a sense strand of a sequence as set forth in (shown 5' to 3'):
  • oligonucleotide HBV-254 in HDI-mice was conducted, demonstrating the ability to subcutaneously target HBsAg viral transcript (FIG. 2).
  • HBV-254 systematically reduced HBsAg levels in mice with increasing dosage.
  • Preclinical potency was further evaluated in mice following a QWx3 dosing regimen in which HBV-254 was subcutaneously administered at 3 mg/kg (FIG. 3). The administration points are indicated by arrows in the figure.
  • HBsAg levels were monitored in both oligonucleotide treated and untreated control mice for a period spanning 147 days.
  • HBsAg-targeting oligonucleotides were identified by in vitro screening using a psiCHECK reporter assay with oligonucleotides in unmodified tetraloop form. The results from three different plates are shown in FIG. 4. Each oligonucleotide, including HBV-254, was evaluated at three concentrations (1, 10, and 100 pM) in HeLa cells using the fluorescence-based reporter assay.
  • Example 1 Several of the most potent oligonucleotides evaluated in Example 1 were compared against genome sequences for HBV genotypes A-I. The results of an initial conservation analysis are listed in Table 1. As shown, HBV-219 has relatively low percent conservation across these genomes. However, percent conservation increases significantly (from 66% to 96%) if a mismatch (MM) is introduced at position 15 of the guide strand.
  • MM mismatch
  • a psiCHECK-2 dual-luciferase reporter system was utilized to evaluate the effects of a mismatch at a selected position in each of HBV-217, HBV-219, HBV-254, HBV- 255, and HBV-258.
  • the psiCHECK vector enables monitoring of changes in expression of a target gene fused to a reporter gene, where active RNAi degrades the fusion construct to produce a corresponding decrease in reporter signal.
  • the diagram in FIG. 6 generically depicts the vector utilized in these assays.
  • the parent partial reporter sequence contained 120 base- pair fragments from Genotype A (GenBank: AM282986.1) around target sites of interest in the S ORF.
  • Parent oligonucleotide duplex sequences have 100% homology to the reporter plasmid at corresponding sites shown in FIG. 6, whereas the mismatch oligonucleotide duplex sequences have a single mismatch to the reporter plasmid.
  • Parent and mismatch sequences for the oligonucleotides tested are shown in FIG. 7 aligned to corresponding parent partial reporter sequences.
  • the tested oligonucleotides included the same modification patterns. According to the numbering scheme shown for each oligonucleotide in FIG. 7, modifications were as follows: 5'-Methoxy, Phosphonate-4'-oxy-2'-0-methyluridine at position 1; 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19; 2'-0- methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22; and phosphorothioate internucleotide linkages between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. Mismatched positions were different for each parent and mismatch set, and are shown in boxes in FIG. 7.
  • the psiCHECK2 reporter assays with each oligonucleotide were conducted over a three-day period using a 6-point, 5-fold serial dilution starting at 1 nM transfected in HeLa cells.
  • 10,000 HeLa cells/well (96-well) were seeded in a black-walled, clear bottom plate (80-90% confluent).
  • vector DNA and RNAi molecule were diluted in the appropriate amount of Opti-MEM® I Medium without serum and gently mixed. After gently mixing Lipofectamine® 2000, 0.2 ⁇ ⁇ were diluted into 25 of Opti-MEM® I Medium without serum for each reaction. The dilution was mixed gently and incubated for 5 minutes at room temperature.
  • HBV-219 duplexes showed no loss of activity with a single mismatch at position 15 of the guide strand.
  • HBV(s)-219Pl HBV(s)-219P2
  • mismatch oligonucleotides herein designated HBV(s)-219P2
  • FIG. 9 the single-dose titration plot depicted in FIG. 9, the HBV-219 mismatch oligonucleotide duplex (HBV(s)-219P2) was tolerated in vivo over a 70-day period following administration.
  • FIG. 10 illustrates an example of a modified duplex structure for HBV-219 with the incorporated mismatch (herein designated HBV(s)-219).
  • HBV(s)-219 the sense strand spans nucleotides 1 through 36 and the antisense strand spans oligonucleotides 1 through 22, the latter strand shown numbered in right-to-left orientation.
  • the duplex form is shown with a nick between nucleotides at position 36 in the sense strand and position 1 in the antisense strand.
  • the antisense strand included an incorporated mismatch at position 15. Also as shown, the antisense strand of the duplex included a "GG" overhang spanning positions 21-22.
  • HBV(s)-219 and the two precursors referred to above are shown in Table 4.
  • HBV(s)-219 36/22mer Contains mismatch at position 15 of antisense strand.
  • Methoxy, Phosphonate-4'oxy- 2'-0-methyluridine (MeMOP) is used at position 1 of antisense strand.
  • HBV(s)-219P2 36/22mer Contains mismatch at position 15 of antisense strand.
  • a click chemistry based conjugation incorporates a triazole based GalNAc linker. Fully deprotected 5'- Phosphonate-4'oxy- 2'-0-methyluridine (MOP) is used at position 1 of antisense strand. See FIG. 19B
  • HBV(s)-219Pl 36/22mer Does not contain the mismatch at position 15 of
  • HBV core antigen HBV core antigen
  • RNA sequencing was performed to examine the effects of HBsAg knockdown on overall expression of HBV viral transcripts.
  • Hepatocytes were isolated from HDI mice four days following three, once-weekly doses at 3mg/kg each.
  • Total RNA was extracted from the hepatocytes and subjected to Illumina sequencing using the HiSeq Platform.
  • FIG. 1 IB depicts RNA sequencing results in which detected RNA transcript sequences were mapped against the HBV RNAs.
  • the target site of the HBV(s)-219 and its precursors is also depicted, showing that the oligonucleotide targets pgRNA (3.5kb), S I (2.4kb), and S2 (2.1kb) transcripts.
  • the results show that, compared with vehicle controls, treatment with the HBV(s)- 219P1 resulted in greater than 90% silencing of all HBV viral transcripts.
  • HBV(s)-219Pl oligonucleotide were examined in two different mouse models of HBV - an HDI model, which is cccDNA-dependent, and an AAV model, which is cccDNA independent.
  • a time course (12 weeks) analysis of HBsAg mRNA expression was performed in the context of a treatment involving three once-weekly doses of 3mg/kg with the HBV(s)-219Pl oligonucleotide targeting HBsAg mRNA compared with vehicle control and an RNAi oligonucleotide targeting HBxAg mRNA in the HDI model of HBV (FIG. 12A).
  • the HBV(s)-219Pl oligonucleotide produced a >3.9 log reduction, with a relatively long duration of activity persisting for greater than 7 weeks; whereas by comparsion an HBV(x) targeting oligonucleotide produced about a 3.0 log reduction, that persisted for a shorter duration.
  • RNAi oligonucleotide targeting HBxAg mRNA used in FIGs. 12A and 12B has a sense strand sequence of
  • RNAi oligonucleotide targeting HBxAg is herein designated GalXC-HBVX.
  • oligonucleotides in the HDI model but not in AAV model.
  • HBV(s)-219Pl The antiviral activity of HBV(s)-219Pl was evaluated in the PXB-HBV model, also known in the HBV literature as the chimeric human liver model.
  • This technology is based on grafting human hepatocytes into severely immunocompromised mice, then using a genetic mechanism to poison the host murine hepatocytes (Tateno et al., 2015). This process results in mice containing livers derived from > 70% human tissue, which, unlike wild type mice, can be infected with HBV (Li et al., 2014).
  • the PXB-HBV model serves several purposes in the context of HBV(s)-219 pharmacology: (1) to confirm that the oligonucleotide can engage the human RNAi machinery (RISC) in vivo, (2) to confirm that the GalNAc- targeting ligand configuration can internalize into hepatocytes via human ASGR in vivo, and (3) to confirm efficacy in a true model of HBV infection (as opposed to an engineered model of HBV expression).
  • RISC human RNAi machinery
  • nucleo(s)tide analogs e.g., Entecavir
  • Entecavir nucleo(s)tide analogs
  • RNAi oligonucletoides targeting the S antigen impact both the viral polymerase and HBsAg protein.
  • HBV(s)-219P2 as a monotherapy and combinational treatment with entecavir was explored in an HBV-expressing mouse (HDI model) for antiviral activity.
  • HBV(s)-219P2 Circulating viral load (HBV DNA) was measured by qPCR (FIG. 15 A), plasma HBsAg level was measured by ELISA (FIG. 15B), and liver HBV mRNA and pgRNA levels were measured by qPCR. Clear additive effects were observed with combination therapy with HBV(s)-219P2 and ETV. The results show that ETV therapy alone shows no efficacy against circulating HBsAg or liver viral RNAs. Further, the antiviral activity of HBV(s)-219P2 as measured by HBsAg or HBV RNA is not impacted by codosing of ETV (FIGs. 15B-15C).
  • Monotherapy of a single SC dose of HBV(s)-219P2 on day 0 resulted in dose dependent decreases in in both circulating HBsAg, as well as hepatic viral RNAs.
  • Combination therapy of entecavir dosed 500 ng/kg PO daily for 14 days and a single 1 mg/kg SC dose of HBV(s)-219P2 on day 0 resulted in additive reduction in HBV DNA detected in the plasma by a mean of -2.3 log.
  • HBV-expressing mice (HDI model) were administered HBV(s)-
  • RNAi oligonucleotides and plasma HBsAg level two weeks or nine weeks post dose were monitored.
  • FIG. 16B similar levels of HBsAg suppression were observed 2 weeks after treatment with a single saturating 9 mg/kg SC dose of either HBV(s)-219P2, GalXC-HBVX, or a combination of both.
  • HBV Core Antigen (HBcAg) HBV Core Antigen (HBcAg) was also evaluated in mice receiving HBV(s)-219P2, GalXC-HBVX, or a combination of the two RNAi oligonucleotides.
  • HBV-expressing mice HDI model
  • a single saturating dose 9 mg/kg, s.c.
  • FIG. 17A liver sections were stained for HBcAg; representative hepatocytes are shown.
  • Cohorts treated with HBV(s)-219P2, either as a monotherapy or in combination with GalXC-HBVX, feature nuclear HBcAg. Cohorts treated with only GalXC-HBVS show only cytosolic localization of HBcAg, reported as a favorable prognostic indicator of treatment response (Huang et al. J. Cell. Mol. Med. 2018). The percentage of HBcAg-positive-cells with nuclear staining in each animal is shown in FIG. 17B(n 3/group, 50 cells counted per animal, 2 weeks after dosing).
  • HBV-254 was used in FIG. 17C.
  • the sequence of HBV-254 is described in Example 1.
  • the alternative oligonucleotide targeting HBxAg used in FIG. 17C has a sense strand sequence of GCACCUCUCUUUACGCGGAAGCAGCCGAAAGGCUGC and an antisense sequence of UUCC GCGU A A AG AG AGGUGC GG .
  • RNAi oligonucleotides have different RNAi target sequences in the S or X antigen than the RNAi oligonucleotides used in FIG. 16B. However, they display the same differential effect on plasma level HBcAg, indicating that the effect is specific to targeting the S antigen per se, but not specific the oligonucleotide used.
  • Antisense Strand 5' [MePhos honate-40-mU]-S- ⁇
  • Age 18 (or age of legal consent, whichever is older) to 65 years inclusive, at the time of signing the informed consent.
  • BMI Body mass index
  • a male participant must agree to use contraception, during the treatment period and for at least two weeks after the dose of study intervention and refrain from donating sperm during this period.
  • a female participant is eligible to participate if she is not pregnant, not breastfeeding, and at least one of the following conditions applies: Not a woman of childbearing potential (WOCBP), OR, depending on region; a WOCBP who agrees to follow the contraceptive guidance, beginning at post-screen study enrollment continuing throughout the treatment period and for at least 12 weeks after the dose of study intervention.
  • WOCBP childbearing potential
  • OTC over-the-counter
  • ALT Alanine aminotransferase
  • AST aspartate aminotransferase
  • GTT gamma-glutamyl transferase
  • ALP alkaline phosphatase
  • albumin outside of the reference range at the Screening Visit or on admission (Day -1)
  • HbAlC Hemoglobin AIC
  • Age 18 (or age of legal consent, whichever is older) to 65 years inclusive, at the time of signing the informed consent.
  • Serum ALT > 60 U/L (males) or > 38 U/L (females) (2x ULN by American
  • a male participant must agree to use contraception during the treatment period and for at 12 weeks after the last dose of study intervention and refrain from donating sperm during this period.
  • a female participant is eligible to participate if she is not pregnant, not breastfeeding, and at least one of the following conditions applies: Not a WOCBP OR, depending on region A WOCBP who agrees to follow the contraceptive guidance during the treatment period and for at least 12 weeks after the dose of study intervention.
  • HIV human immunodeficiency virus
  • HCV hepatitis C virus
  • HDV hepatitis delta virus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Inorganic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Professional, Industrial, Or Sporting Protective Garments (AREA)
PCT/US2018/056801 2017-10-20 2018-10-19 METHODS OF TREATING HEPATITIS B TYPE INFECTIONS Ceased WO2019079781A2 (en)

Priority Applications (37)

Application Number Priority Date Filing Date Title
MYPI2020001980A MY201698A (en) 2017-10-20 2018-10-19 Methods for treating hepatitis b infection
AU2018351649A AU2018351649B2 (en) 2017-10-20 2018-10-19 Methods for treating hepatitis B infection
SG11202003488WA SG11202003488WA (en) 2017-10-20 2018-10-19 Methods for treating hepatitis b infection
CR20200163A CR20200163A (es) 2017-10-20 2018-10-19 Oligonucleótidos y composiciones para tratar la infección por hepatitis
HRP20230023TT HRP20230023T1 (hr) 2017-10-20 2018-10-19 Postupci liječenja infekcije hepatitisom b
IL274040A IL274040B2 (en) 2017-10-20 2018-10-19 Methods for treating hepatitis B infection
CN201880068102.3A CN111372593B (zh) 2017-10-20 2018-10-19 治疗乙型肝炎感染的方法
CN202410274712.6A CN118185936A (zh) 2017-10-20 2018-10-19 治疗乙型肝炎感染的方法
RS20230047A RS64001B1 (sr) 2017-10-20 2018-10-19 Metode za lečenje infekcije hepatitisom b
FIEP18868404.7T FI3684377T3 (fi) 2017-10-20 2018-10-19 Menetelmiä hepatiitti b -infektion hoitamiseksi
SI201830840T SI3684377T1 (sl) 2017-10-20 2018-10-19 Postopki zdravljenja okužbe s hepatitisom B
EP18868404.7A EP3684377B1 (en) 2017-10-20 2018-10-19 Methods for treating hepatitis b infection
UAA202002978A UA128786C2 (uk) 2017-10-20 2018-10-19 Олігонуклеотид для лікування інфекції гепатиту в
BR112020007476-4A BR112020007476A2 (pt) 2017-10-20 2018-10-19 métodos para tratamento da infecção por hepatite b
EP22201680.0A EP4197544A1 (en) 2017-10-20 2018-10-19 Methods for treating hepatitis b infection
IL282881A IL282881B2 (en) 2017-10-20 2018-10-19 Methods for treating hepatitis b infection
IL319113A IL319113A (en) 2017-10-20 2018-10-19 Methods of treating hepatitis B infection
JP2020521880A JP7353276B2 (ja) 2017-10-20 2018-10-19 B型肝炎感染の治療方法
DK18868404.7T DK3684377T3 (da) 2017-10-20 2018-10-19 Fremgangsmåder til behandling af hepatitis-b-infektion
PE2020000748A PE20220561A1 (es) 2017-10-20 2018-10-19 Metodos para el tratamiento de infeccion de hepatitis b
ES18868404T ES2936863T3 (es) 2017-10-20 2018-10-19 Métodos para tratar infección por hepatitis B
LTEPPCT/US2018/056801T LT3684377T (lt) 2017-10-20 2018-10-19 Hepatito b infekcijos gydymo būdai
MX2020004060A MX2020004060A (es) 2017-10-20 2018-10-19 Metodos para el tratamiento de infeccion de hepatitis b.
KR1020207013967A KR102783206B1 (ko) 2017-10-20 2018-10-19 B형 간염 감염의 치료 방법
CA3078960A CA3078960A1 (en) 2017-10-20 2018-10-19 Methods for treating hepatitis b infection
IL312809A IL312809B2 (en) 2017-10-20 2018-10-19 Methods for treating hepatitis b infection
RU2020116369A RU2780021C2 (ru) 2017-10-20 2018-10-19 Способы лечения инфекции гепатита в
MA50264A MA50264B1 (fr) 2017-10-20 2018-10-19 Méthodes de traitement des infections de type hépatite b
PL18868404.7T PL3684377T3 (pl) 2017-10-20 2018-10-19 Sposoby leczenia zakażenia wirusem zapalenia wątroby typu b
US16/790,986 US10799524B2 (en) 2017-10-20 2020-02-14 Methods for treating hepatitis B infection
PH12020550591A PH12020550591A1 (en) 2017-10-20 2020-04-17 Methods for treating hepatitis b infection
CONC2020/0005135A CO2020005135A2 (es) 2017-10-20 2020-04-24 Métodos para el tratamiento de infección de hepatitis b
US16/922,033 US11052105B2 (en) 2017-10-20 2020-07-07 Methods for treating hepatitis B infection
US16/922,007 US11052104B2 (en) 2017-10-20 2020-07-07 Methods for treating hepatitis B infection
US17/318,864 US11273173B2 (en) 2017-10-20 2021-05-12 Methods for treating hepatitis B infection
US17/649,781 US12564601B2 (en) 2017-10-20 2022-02-02 Methods for treating hepatitis B infection
JP2023151506A JP7645323B2 (ja) 2017-10-20 2023-09-19 B型肝炎感染の治療方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762575358P 2017-10-20 2017-10-20
US62/575,358 2017-10-20

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/790,986 Continuation US10799524B2 (en) 2017-10-20 2020-02-14 Methods for treating hepatitis B infection

Publications (2)

Publication Number Publication Date
WO2019079781A2 true WO2019079781A2 (en) 2019-04-25
WO2019079781A3 WO2019079781A3 (en) 2019-05-23

Family

ID=66173915

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/056801 Ceased WO2019079781A2 (en) 2017-10-20 2018-10-19 METHODS OF TREATING HEPATITIS B TYPE INFECTIONS

Country Status (30)

Country Link
US (5) US10799524B2 (https=)
EP (2) EP3684377B1 (https=)
JP (2) JP7353276B2 (https=)
KR (1) KR102783206B1 (https=)
CN (2) CN111372593B (https=)
AU (1) AU2018351649B2 (https=)
BR (1) BR112020007476A2 (https=)
CA (1) CA3078960A1 (https=)
CL (1) CL2020001061A1 (https=)
CO (1) CO2020005135A2 (https=)
CR (1) CR20200163A (https=)
DK (1) DK3684377T3 (https=)
ES (1) ES2936863T3 (https=)
FI (1) FI3684377T3 (https=)
HR (1) HRP20230023T1 (https=)
HU (1) HUE061122T2 (https=)
IL (4) IL274040B2 (https=)
LT (1) LT3684377T (https=)
MA (1) MA50264B1 (https=)
MX (1) MX2020004060A (https=)
MY (1) MY201698A (https=)
PE (1) PE20220561A1 (https=)
PH (1) PH12020550591A1 (https=)
PL (1) PL3684377T3 (https=)
PT (1) PT3684377T (https=)
RS (1) RS64001B1 (https=)
SG (1) SG11202003488WA (https=)
SI (1) SI3684377T1 (https=)
UA (1) UA128786C2 (https=)
WO (1) WO2019079781A2 (https=)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021067744A1 (en) * 2019-10-02 2021-04-08 Dicerna Pharmaceuticals, Inc. Chemical modifications of small interfering rna with minimal fluorine content
WO2021122993A1 (en) * 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of saraf inhibitors for treating hepatitis b virus infection
WO2021130266A1 (en) * 2019-12-24 2021-07-01 F. Hoffmann-La Roche Ag Pharmaceutical combination of a therapeutic oligonucleotide targeting hbv and a tlr7 agonist for treatment of hbv
WO2022029209A1 (en) 2020-08-05 2022-02-10 F. Hoffmann-La Roche Ag Oligonucleotide treatment of hepatitis b patients
WO2022223515A3 (en) * 2021-04-19 2022-12-01 Novo Nordisk A/S Compositions and methods for inhibiting nuclear receptor subfamily 1 group h member 3 (nr1h3) expression
US20230123601A1 (en) * 2019-12-24 2023-04-20 Hoffmann-La Roche Inc. Pharmaceutical combination of antiviral agents targeting hbv and/or an immune modulator for treatment of hbv
WO2023083906A2 (en) 2021-11-11 2023-05-19 F. Hoffmann-La Roche Ag Pharmaceutical combinations for treatment of hbv
WO2023093896A1 (zh) * 2021-11-29 2023-06-01 上海舶望制药有限公司 用于抑制乙型肝炎病毒(hbv)蛋白表达的组合物和方法
EP4201947A1 (en) 2021-12-22 2023-06-28 F. Hoffmann-La Roche AG Process for the backbone deprotection of oligonucleotides containing a terminal alkyl phosphonate group
WO2024175111A3 (en) * 2023-02-24 2024-10-03 Suzhou Sanegene Bio Inc. Small interfering rna targeting hbv and uses thereof
EP4265724A4 (en) * 2020-12-18 2025-11-19 Olix Pharmaceuticals Inc ARNI AGENT TO INHIBIT THE EXPRESSION AND USE OF HBV
US12497621B2 (en) 2018-07-13 2025-12-16 Hoffmann-La Roche Inc. Oligonucleotides for modulating RTEL1 expression
US12564601B2 (en) 2017-10-20 2026-03-03 Dicerna Pharmaceuticals, Inc. Methods for treating hepatitis B infection

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3187388A1 (en) * 2020-07-27 2022-02-03 Jin Hong Hbv binding oligonucleotides and methods of use
CN114853829A (zh) * 2021-02-05 2022-08-05 上海拓界生物医药科技有限公司 一种核酸配体、其缀合物、制备方法及用途
CN114621954B (zh) * 2021-04-13 2023-01-31 厦门甘宝利生物医药有限公司 一种抑制乙型肝炎病毒基因表达的rna抑制剂及其应用
WO2023116764A1 (zh) * 2021-12-23 2023-06-29 苏州瑞博生物技术股份有限公司 一种核酸、含有该核酸的组合物与缀合物及其用途
WO2025199466A1 (en) 2024-03-22 2025-09-25 Purdue Research Foundation Liver-specific asialoglycoprotein receptor targeting ligands, conjugates comprising same, and related compositions and methods of use
WO2025242321A1 (en) 2024-05-24 2025-11-27 Glaxosmithkline Intellectual Property (No.3) Limited Novel use

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070254362A1 (en) 2005-09-02 2007-11-01 Nastech Pharmaceutical Company Inc. COMPOSITIONS AND METHODS EMPLOYING UNIVERSAL-BINDING NUCLEOTIDES FOR TARGETING MULTIPLE GENE VARIANTS WITH A SINGLE siRNA DUPLEX
US20080274462A1 (en) 2001-11-07 2008-11-06 Applera Corporation Universal bases for nucleic acid analyses, methods for using universal bases, and kits comprising universal bases
US20090099115A1 (en) 2001-05-18 2009-04-16 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF MYC AND/OR MYB GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010033225A2 (en) 2008-09-22 2010-03-25 Dicerna Pharmaceuticals, Inc. Compositions and methods for the specific inhibition of gene expression by dsrna possessing modifications
WO2011133871A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. 5'-end derivatives
US20110294869A1 (en) 2008-09-23 2011-12-01 Traversa Therapeutics, Inc. Self delivering bio-labile phosphate protected pro-oligos for oligonucleotide based therapeutics and mediating rna interference
US8372968B2 (en) 2000-12-01 2013-02-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8513207B2 (en) 2008-12-18 2013-08-20 Dicerna Pharmaceuticals, Inc. Extended dicer substrate agents and methods for the specific inhibition of gene expression
WO2014088920A1 (en) 2012-12-06 2014-06-12 Merck Sharp & Dohme Corp. Disulfide masked prodrug compositions and methods
US8883996B2 (en) 2007-05-01 2014-11-11 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US8927705B2 (en) 2008-12-18 2015-01-06 Dicerna Pharmaceuticals, Inc. Single stranded extended dicer substrate agents and methods for the specific inhibition of gene expression
US8927513B2 (en) 2009-07-07 2015-01-06 Alnylam Pharmaceuticals, Inc. 5′ phosphate mimics
US9012621B2 (en) 2000-03-30 2015-04-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
WO2015188197A2 (en) 2014-06-06 2015-12-10 Solstice Biologics, Ltd. Polynucleotide constructs having bioreversible and non-bioreversible groups
WO2016077321A1 (en) 2014-11-10 2016-05-19 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
WO2016100401A1 (en) 2014-12-15 2016-06-23 Dicerna Pharmaceuticals, Inc. Ligand-modified double-stranded nucleic acids
WO2016183009A2 (en) 2015-05-08 2016-11-17 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of antithrombin 3 (at3) by double-stranded rna
US9567587B2 (en) 2011-10-25 2017-02-14 Ionis Pharmaceuticals, Inc. Antisense modulation of GCCR expression

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040127446A1 (en) 1992-05-14 2004-07-01 Lawrence Blatt Oligonucleotide mediated inhibition of hepatitis B virus and hepatitis C virus replication
US20030176372A1 (en) 2001-05-04 2003-09-18 Technologie Integrale Ltd Anti-virus agent
EP2305812A3 (en) 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
CN1257284C (zh) 2003-03-05 2006-05-24 北京博奥生物芯片有限责任公司 一种体外阻断乙肝病毒表达的方法
WO2008016391A2 (en) 2006-01-31 2008-02-07 The Board Of Trustees Of The Leland Stanford Junior University Self-complementary parvoviral vectors, and methods for making and using the same
EP2799547B1 (en) * 2006-11-08 2016-12-21 Veritas Bio, LLC In Vivo Delivery of RNA to a Target Cell
EP2164965B1 (en) 2007-05-29 2013-09-11 University Of The Witwatersrand, Johannesburg A primary micro rna expression cassette
KR20120095397A (ko) * 2009-10-16 2012-08-28 글락소 그룹 리미티드 Hbv 안티센스 억제제
WO2012024170A2 (en) 2010-08-17 2012-02-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
PH12019502377A1 (en) * 2011-04-21 2022-11-14 Isis Pharmaceuticals Inc Modulation of hepatitis b virus (hbv) expression
HRP20181564T1 (hr) * 2011-06-30 2018-11-30 Arrowhead Pharmaceuticals, Inc. Pripravci i postupci za inhibiciju ekspresije gena virusa hepatitisa b
CN105189541A (zh) * 2012-12-14 2015-12-23 戴瑟纳制药公司 用于通过双链rna特异性抑制ckap5的方法和组合物
CN103333890B (zh) 2012-12-21 2015-04-15 厦门成坤生物技术有限公司 治疗乙型病毒性肝炎的rna干扰制剂
JP6306750B2 (ja) 2014-03-07 2018-04-04 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft B型肝炎ウイルス感染症の治療および予防のための新規な6−縮合ヘテロアリールジヒドロピリミジン
GB201408623D0 (en) * 2014-05-15 2014-07-02 Santaris Pharma As Oligomers and oligomer conjugates
CN104059916A (zh) 2014-06-17 2014-09-24 湖北医药学院附属太和医院 乙肝病毒特异性的microRNA样siRNA序列及其用途
WO2016030863A1 (en) * 2014-08-29 2016-03-03 Glaxosmithkline Intellectual Property Development Limited Compounds and methods for treating viral infections
KR20180038465A (ko) 2015-08-07 2018-04-16 애로우헤드 파마슈티컬스 인코포레이티드 B형 간염 바이러스 감염에 대한 rnai 치료법
KR20250065735A (ko) 2016-03-14 2025-05-13 에프. 호프만-라 로슈 아게 Pd-l1 발현의 감소를 위한 올리고뉴클레오티드
WO2017211791A1 (en) 2016-06-07 2017-12-14 F. Hoffmann-La Roche Ag Combination therapy of an hbsag inhibitor and a tlr7 agonist
JOP20190015A1 (ar) 2016-08-04 2019-02-04 Arrowhead Pharmaceuticals Inc عوامل (ار ان ايه آي) لعدوى فيروس الالتهاب الكبدي الوبائي ب
HRP20231063T1 (hr) * 2017-10-13 2023-12-22 Novo Nordisk Health Care Ag Postupci i pripravci namijenjeni inhibiranju eksprimiranja ldha
SI3684377T1 (sl) 2017-10-20 2023-05-31 Dicerna Pharmaceuticals, Inc. Postopki zdravljenja okužbe s hepatitisom B
CA3190794A1 (en) 2020-08-05 2022-02-10 Soren Ottosen Oligonucleotide treatment of hepatitis b patients

Patent Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9193753B2 (en) 2000-03-30 2015-11-24 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US9012138B2 (en) 2000-03-30 2015-04-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US9012621B2 (en) 2000-03-30 2015-04-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US8372968B2 (en) 2000-12-01 2013-02-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US20090099115A1 (en) 2001-05-18 2009-04-16 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF MYC AND/OR MYB GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20080274462A1 (en) 2001-11-07 2008-11-06 Applera Corporation Universal bases for nucleic acid analyses, methods for using universal bases, and kits comprising universal bases
US20070254362A1 (en) 2005-09-02 2007-11-01 Nastech Pharmaceutical Company Inc. COMPOSITIONS AND METHODS EMPLOYING UNIVERSAL-BINDING NUCLEOTIDES FOR TARGETING MULTIPLE GENE VARIANTS WITH A SINGLE siRNA DUPLEX
US8883996B2 (en) 2007-05-01 2014-11-11 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
WO2010033225A2 (en) 2008-09-22 2010-03-25 Dicerna Pharmaceuticals, Inc. Compositions and methods for the specific inhibition of gene expression by dsrna possessing modifications
US20110294869A1 (en) 2008-09-23 2011-12-01 Traversa Therapeutics, Inc. Self delivering bio-labile phosphate protected pro-oligos for oligonucleotide based therapeutics and mediating rna interference
US8927705B2 (en) 2008-12-18 2015-01-06 Dicerna Pharmaceuticals, Inc. Single stranded extended dicer substrate agents and methods for the specific inhibition of gene expression
US8513207B2 (en) 2008-12-18 2013-08-20 Dicerna Pharmaceuticals, Inc. Extended dicer substrate agents and methods for the specific inhibition of gene expression
US8927513B2 (en) 2009-07-07 2015-01-06 Alnylam Pharmaceuticals, Inc. 5′ phosphate mimics
WO2011133871A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. 5'-end derivatives
US9567587B2 (en) 2011-10-25 2017-02-14 Ionis Pharmaceuticals, Inc. Antisense modulation of GCCR expression
WO2014088920A1 (en) 2012-12-06 2014-06-12 Merck Sharp & Dohme Corp. Disulfide masked prodrug compositions and methods
WO2015188197A2 (en) 2014-06-06 2015-12-10 Solstice Biologics, Ltd. Polynucleotide constructs having bioreversible and non-bioreversible groups
WO2016077321A1 (en) 2014-11-10 2016-05-19 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
WO2016100401A1 (en) 2014-12-15 2016-06-23 Dicerna Pharmaceuticals, Inc. Ligand-modified double-stranded nucleic acids
WO2016183009A2 (en) 2015-05-08 2016-11-17 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of antithrombin 3 (at3) by double-stranded rna

Non-Patent Citations (33)

* Cited by examiner, † Cited by third party
Title
"Remington: The Science and Practice of Pharmacy", 2013, PHARMACEUTICAL PRESS
ABE ET AL., J AM CHEM SOC, vol. 129, 2007, pages 15108 - 15109
ANTAO ET AL., NUCLEIC ACIDS RES., vol. 19, no. 21, 11 November 1991 (1991-11-11), pages 5901 - 5
BENNETT ET AL.: "Pharmacology of Antisense Drugs", ANNUAL REVIEW OF PHARMACOLOGY AND TOXICOLOGY, vol. 57, pages 81 - 105
BRAMSEN ET AL., NUCLEIC ACIDS RES., vol. 35, no. 17, September 2007 (2007-09-01), pages 5886 - 5897
BRAMSEN ET AL., NUCLEIC ACIDS RES., vol. 37, 2009, pages 2867 - 2881
BRAMSENKJEMS, FRONTIERS IN GENETICS, vol. 3, 2012, pages 1 - 22
CHANG ET AL., MOL THER., vol. 17, no. 4, April 2009 (2009-04-01), pages 725 - 32
CHEONG ET AL., NATURE, vol. 346, no. 6285, 16 August 1990 (1990-08-16), pages 680 - 2
CORNISH-BOWDEN, NUCL. ACIDS RES., vol. 13, 1985, pages 3021 - 3030
DELLINGER ET AL., J. AM. CHEM. SOC., vol. 125, 2003, pages 940 - 950
ELSNER, NATURE BIOTECHNOLOGY, vol. 30, 2012, pages 1063
HAMILTON ET AL., EMBO J., vol. 21, no. 17, 2002, pages 4671 - 4679
HEUSPARDI, SCIENCE, vol. 253, no. 5016, 12 July 1991 (1991-07-12), pages 191 - 4
HOHJOH, FEBS LETTERS, vol. 557, no. 1-3, January 2004 (2004-01-01), pages 193 - 198
HUANG, MOLECULAR THERAPY-NUCLEIC ACIDS, vol. 6, 2017, pages 116 - 132
HUCH ET AL., NATURE, vol. 494, no. 7436, 2013, pages 247 - 250
IMANISHIOBIKA: "Chem. Commun.", 2002, THE ROYAL SOCIETY OF CHEMISTRY, pages: 1653 - 1659
KOSHKIN ET AL., TETRAHEDRON, vol. 54, 1998, pages 3607 - 3630
KRAYNACKBAKER, RNA, vol. 12, 2006, pages l63 - 176
LOAKES ET AL.: "3-Nitropyrrole and 5-nitroindole as universal bases in primers for DNA sequencing and PCR", NUCLEIC ACIDS RES., vol. 23, no. 13, 11 July 1995 (1995-07-11), pages 2361 - 6, XP002109690
LOAKESBROWN: "5-Nitroindole as an universal base analogue", NUCLEIC ACIDS RES., vol. 22, no. 20, 11 October 1994 (1994-10-11), pages 4039 - 43, XP000999195
MATSUI ET AL., MOLECULAR THERAPY, vol. 24, no. 5, May 2016 (2016-05-01), pages 946 - 955
MEADE ET AL., NATURE BIOTECHNOLOGY, vol. 32, 2014, pages 1256 - 1263
MOORE ET AL., METHODS MOL. BIOL., vol. 629, 2010, pages 141 - 158
NAKANO ET AL., BIOCHEMISTRY, vol. 41, no. 48, 2002, pages 14281 - 14292
NUCLEIC ACIDS RES., vol. 43, no. 6, 31 March 2015 (2015-03-31), pages 2993 - 3011
PRAKASH ET AL., NUCLEIC ACIDS RES., vol. 43, no. 6, 2015, pages 2993 - 3011
SHINJI ET AL., NIPPON KAGAKKAI KOEN YOKOSHU, vol. 78, no. 2, 2000, pages 731
SNEAD ET AL., MOLECULAR THERAPY - NUCLEIC ACIDS, vol. 2, 2013, pages el03
SUN ET AL., NAT. BIOTECHNOL., vol. 26, 2008, pages 1379 - 1382
VAN AERSCHOT ET AL.: "An acyclic 5-nitroindazole nucleoside analogue as ambiguous nucleoside", NUCLEIC ACIDS RES., vol. 23, no. 21, 11 November 1995 (1995-11-11), pages 4363 - 70, XP001537631, DOI: 10.1093/nar/23.21.4363
WOESE ET AL., PROC NATL ACAD SCI USA., vol. 87, no. 21, November 1990 (1990-11-01), pages 8467 - 71

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12564601B2 (en) 2017-10-20 2026-03-03 Dicerna Pharmaceuticals, Inc. Methods for treating hepatitis B infection
US12497621B2 (en) 2018-07-13 2025-12-16 Hoffmann-La Roche Inc. Oligonucleotides for modulating RTEL1 expression
CN114761557B (zh) * 2019-10-02 2024-11-15 迪克纳制药公司 具有最小氟含量的小干扰rna的化学修饰
CN114761557A (zh) * 2019-10-02 2022-07-15 迪克纳制药公司 具有最小氟含量的小干扰rna的化学修饰
WO2021067744A1 (en) * 2019-10-02 2021-04-08 Dicerna Pharmaceuticals, Inc. Chemical modifications of small interfering rna with minimal fluorine content
JP2022551269A (ja) * 2019-10-02 2022-12-08 ディセルナ ファーマシューティカルズ インコーポレイテッド 最小フッ素含有量を用いた低分子干渉rnaの化学修飾
WO2021122993A1 (en) * 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of saraf inhibitors for treating hepatitis b virus infection
US20230123601A1 (en) * 2019-12-24 2023-04-20 Hoffmann-La Roche Inc. Pharmaceutical combination of antiviral agents targeting hbv and/or an immune modulator for treatment of hbv
JP2023509870A (ja) * 2019-12-24 2023-03-10 エフ. ホフマン-ラ ロシュ アーゲー Hbvの処置のためのhbvを標的とする治療用オリゴヌクレオチドとtlr7アゴニストとの医薬組合せ
US20230119360A1 (en) * 2019-12-24 2023-04-20 Hoffmann-La Roche Inc. Pharmaceutical combination of a therapeutic oligonucleotide targeting hbv and a tlr7 agonist for treatment of hbv
TWI881004B (zh) * 2019-12-24 2025-04-21 瑞士商赫孚孟拉羅股份公司 用於治療hbv之靶向hbv的治療性寡核苷酸及tlr7促效劑之醫藥組合
WO2021130266A1 (en) * 2019-12-24 2021-07-01 F. Hoffmann-La Roche Ag Pharmaceutical combination of a therapeutic oligonucleotide targeting hbv and a tlr7 agonist for treatment of hbv
JP2023536999A (ja) * 2020-08-05 2023-08-30 エフ. ホフマン-ラ ロシュ アーゲー B型肝炎患者のオリゴヌクレオチド処置
WO2022029209A1 (en) 2020-08-05 2022-02-10 F. Hoffmann-La Roche Ag Oligonucleotide treatment of hepatitis b patients
EP4265724A4 (en) * 2020-12-18 2025-11-19 Olix Pharmaceuticals Inc ARNI AGENT TO INHIBIT THE EXPRESSION AND USE OF HBV
WO2022223515A3 (en) * 2021-04-19 2022-12-01 Novo Nordisk A/S Compositions and methods for inhibiting nuclear receptor subfamily 1 group h member 3 (nr1h3) expression
US11578329B2 (en) 2021-04-19 2023-02-14 Novo Nordisk A/S Compositions and methods for inhibiting nuclear receptor subfamily 1 group H member 3 (NR1H3) expression
WO2023083906A3 (en) * 2021-11-11 2023-07-13 F. Hoffmann-La Roche Ag Pharmaceutical combinations for treatment of hbv
WO2023083906A2 (en) 2021-11-11 2023-05-19 F. Hoffmann-La Roche Ag Pharmaceutical combinations for treatment of hbv
WO2023093896A1 (zh) * 2021-11-29 2023-06-01 上海舶望制药有限公司 用于抑制乙型肝炎病毒(hbv)蛋白表达的组合物和方法
WO2023122728A1 (en) 2021-12-22 2023-06-29 Dicerna Pharmaceuticals, Inc. Process for the backbone deprotection of oligonucleotides containing a terminal alkyl phosphonate group
EP4201947A1 (en) 2021-12-22 2023-06-28 F. Hoffmann-La Roche AG Process for the backbone deprotection of oligonucleotides containing a terminal alkyl phosphonate group
WO2024175111A3 (en) * 2023-02-24 2024-10-03 Suzhou Sanegene Bio Inc. Small interfering rna targeting hbv and uses thereof

Also Published As

Publication number Publication date
KR102783206B1 (ko) 2025-03-20
AU2018351649A1 (en) 2020-04-23
US11052105B2 (en) 2021-07-06
CN111372593B (zh) 2024-03-19
JP7645323B2 (ja) 2025-03-13
EP3684377B1 (en) 2022-12-07
US20200338108A1 (en) 2020-10-29
PL3684377T3 (pl) 2023-04-17
EP4197544A1 (en) 2023-06-21
US20200338109A1 (en) 2020-10-29
CL2020001061A1 (es) 2020-10-30
IL282881B1 (en) 2024-06-01
EP3684377A4 (en) 2020-12-16
UA128786C2 (uk) 2024-10-23
IL312809A (en) 2024-07-01
ES2936863T3 (es) 2023-03-22
JP7353276B2 (ja) 2023-09-29
MY201698A (en) 2024-03-13
WO2019079781A3 (en) 2019-05-23
IL282881B2 (en) 2024-10-01
IL274040A (en) 2020-06-30
MA50264B1 (fr) 2023-03-31
PE20220561A1 (es) 2022-04-13
SG11202003488WA (en) 2020-05-28
IL274040B1 (en) 2024-04-01
US12564601B2 (en) 2026-03-03
FI3684377T3 (fi) 2023-01-31
MA50264A (fr) 2020-07-29
SI3684377T1 (sl) 2023-05-31
HRP20230023T1 (hr) 2023-03-17
IL319113A (en) 2025-04-01
CN111372593A (zh) 2020-07-03
IL312809B1 (en) 2025-04-01
PH12020550591A1 (en) 2021-03-01
KR20200083494A (ko) 2020-07-08
MX2020004060A (es) 2020-07-21
IL312809B2 (en) 2025-08-01
IL274040B2 (en) 2024-08-01
RS64001B1 (sr) 2023-03-31
US20230000895A1 (en) 2023-01-05
US20210283164A1 (en) 2021-09-16
LT3684377T (lt) 2023-03-10
US11052104B2 (en) 2021-07-06
HUE061122T2 (hu) 2023-05-28
JP2023171403A (ja) 2023-12-01
CO2020005135A2 (es) 2020-05-15
CN118185936A (zh) 2024-06-14
BR112020007476A2 (pt) 2020-10-27
CR20200163A (es) 2020-11-02
IL282881A (en) 2021-06-30
RU2020116369A3 (https=) 2022-02-28
RU2020116369A (ru) 2021-11-22
US11273173B2 (en) 2022-03-15
AU2018351649B2 (en) 2025-04-24
US10799524B2 (en) 2020-10-13
US20200171069A1 (en) 2020-06-04
JP2021500025A (ja) 2021-01-07
DK3684377T3 (da) 2023-02-13
CA3078960A1 (en) 2019-04-25
PT3684377T (pt) 2023-01-31
EP3684377A2 (en) 2020-07-29

Similar Documents

Publication Publication Date Title
US12564601B2 (en) Methods for treating hepatitis B infection
US20230119360A1 (en) Pharmaceutical combination of a therapeutic oligonucleotide targeting hbv and a tlr7 agonist for treatment of hbv
US20230123601A1 (en) Pharmaceutical combination of antiviral agents targeting hbv and/or an immune modulator for treatment of hbv
RU2780021C2 (ru) Способы лечения инфекции гепатита в
HK40106696A (zh) 治疗乙型肝炎感染的方法
HK40032229A (en) Methods for treating hepatitis b infection
HK40032229B (zh) 治疗乙型肝炎感染的方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18868404

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3078960

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020521880

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 140050140003002614

Country of ref document: IR

Ref document number: 140050140003002616

Country of ref document: IR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018351649

Country of ref document: AU

Date of ref document: 20181019

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2020/0005135

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2018868404

Country of ref document: EP

Effective date: 20200420

ENP Entry into the national phase

Ref document number: 20207013967

Country of ref document: KR

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: NC2020/0005135

Country of ref document: CO

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18868404

Country of ref document: EP

Kind code of ref document: A2

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020007476

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112020007476

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200415

WWG Wipo information: grant in national office

Ref document number: NC2020/0005135

Country of ref document: CO

WWD Wipo information: divisional of initial pct application

Ref document number: 319113

Country of ref document: IL