WO2019078684A2 - Marker tmem43 for sensorineural hearing loss diagnosis, and use thereof - Google Patents

Marker tmem43 for sensorineural hearing loss diagnosis, and use thereof Download PDF

Info

Publication number
WO2019078684A2
WO2019078684A2 PCT/KR2018/012442 KR2018012442W WO2019078684A2 WO 2019078684 A2 WO2019078684 A2 WO 2019078684A2 KR 2018012442 W KR2018012442 W KR 2018012442W WO 2019078684 A2 WO2019078684 A2 WO 2019078684A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotide sequence
mutation
tmem43
genomic dna
polynucleotide
Prior art date
Application number
PCT/KR2018/012442
Other languages
French (fr)
Korean (ko)
Other versions
WO2019078684A3 (en
WO2019078684A9 (en
Inventor
최병윤
오두이
이창준
장민우
오수진
Original Assignee
서울대학교병원
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교병원, 한국과학기술연구원 filed Critical 서울대학교병원
Publication of WO2019078684A2 publication Critical patent/WO2019078684A2/en
Publication of WO2019078684A3 publication Critical patent/WO2019078684A3/en
Publication of WO2019078684A9 publication Critical patent/WO2019078684A9/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • compositions for the diagnosis of sensory neural deafness disorders for detecting genetic mutations for detecting genetic mutations, methods for detecting mutations in the genome to provide information about the diagnosis of sensory neural deafness, methods for predicting the prognosis for wort transplantation in patients with sensory nerve impairment
  • the present invention relates to a method for detecting a mutation of a genome to provide information for predicting a prognosis for a woW transplantation of a sensory neuron deaf hearing patient, and a sensory neuronal hearing loss disease model.
  • Congenital hearing loss occurs in about 3 out of 1,000 neonates, and more than 50% is known to be caused by genetic factors. Hereditary hearing loss is congenital and occurs from birth. There are many types of hearing loss, but the most common is sensorineural hearing loss (SNHL).
  • SNHL sensorineural hearing loss
  • Sensory nerve impairment refers to hearing loss caused by an abnormality in the function of detecting the sound of the cochlea or of an auditory nerve or a central nervous system that transmits a stimulation by sound to the brain. Sensory nerve impairment is classified into syndrome and non-syndrome according to the symptoms. Syndrome Sensory nerve impairment refers to the clinical symptoms or symptoms of other organs other than those caused by abnormal function of inner ear. It accounts for 30% of hereditary hearing loss, and over 300 types of syndromic hearing loss have been reported to date. Because it is easily classified as a characteristic symptom or anomaly, the causative gene can be easily traced in patients with the same cause.
  • Non-syndrome Sensory-nerve impairment refers to cases in which there are no abnormal symptoms or symptoms of other organs other than internal dysfunction, and only hearing impairment. It accounts for 70% of hereditary deafness, has a variety of causative genes, and strategic genetic diagnosis is required based on clinical information such as type of hearing loss, genetic type, and so on. Non-syndromic hearing loss is known to occur in 80% of genetic forms, 17% of dominant inheritance, 2 to 3% of X-linked, and 1% of mitochondrial hereditary genetic patterns.
  • Sensory nerve impairment is a common sensory neural deafness problem in the outer ear cells of the wah and auditory neuropathy in the inner ear cells of the wah or in the nerve itself.
  • auditory neuropathy exhibits an unidirectional or cochlear microphonic (CM) action, but no auditory brainstem response or very abnormal findings. Auditory neuropathy occurs sporadically in many patients, but may also be genetic. In autosomal dominant inheritance pattern, progressive hearing loss is present and accompanied by peripheral neuropathy. The autosomal recessive inheritance pattern generally presents with severe hearing loss in infancy and does not accompany peripheral neuropathy.
  • CM cochlear microphonic
  • compositions for the diagnosis of sensory neural deafness comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting a TMEM43 mutation.
  • Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the confirmed nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA.
  • Another aspect is the use of a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene to detect a TMEM43 mutation, or a polynucleotide comprising its complementary polynucleotide, ≪ / RTI >
  • Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA.
  • identifying a nucleotide sequence of a genomic DNA isolated from an individual and comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA.
  • Another aspect provides a sensory neural deafness disorder model comprising TMEM43 mutations.
  • compositions for the diagnosis of sensory neural deafness comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting a TMEM43 mutation.
  • Transmembrane protein 43 is a protein that functions to maintain the nuclear membrane structure by forming a protein complex in the inner nuclear membrane.
  • the TMEM43 may be a protein encoded by the TMEM43 gene.
  • GenBank Accession No. A polypeptide comprising the amino acid sequence of NP_077310.1 or a polypeptide comprising the amino acid sequence of SEQ ID NO: 1.
  • the TMEM43 gene includes a polynucleotide including a nucleotide sequence encoding the amino acid sequence of TMEM43, a polynucleotide including a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, A polynucleotide comprising a nucleotide sequence of NM_024334, a nucleotide sequence of NM_024334.2, or a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 2.
  • the position and sequence of the mutation can be easily confirmed using the registration number.
  • the specific sequence corresponding to the number registered in the UCSC genome browser or GenBank may change over time. It will be apparent to those of ordinary skill in the art that the scope of the present invention also affects the altered sequence.
  • the TMEM 43 may be expressed in the inner ear.
  • the TMEM 43 may be expressed in inner ear hair cells or supporting cells around the inner hair cells.
  • the TMEM 43 may be one that promotes spontaneous activity in the developing inner ear and induces survival and maturation of the auditory source cells prior to the onset of auditory evoked potentials.
  • the sensory neural deafness refers to hearing loss caused by an abnormality in the function of sensing the sound of the cochlea or of an auditory nerve or a central nervous system which transmits a stimulation by sound to the brain.
  • the sensory neural deafness may be non-syndromic sensorineural hearing loss (NS-SNHL).
  • Non-syndromic sensory neural deafness refers to hearing loss that does not exhibit abnormal symptoms or symptoms of other organs other than abnormal inner ear function.
  • the sensory neural deafness may be an auditory neuropathy.
  • the auditory neuropathy is a hearing disorder caused by a disorder in the synchrony of action potentials occurring in the auditory nerve fibers in the auditory stimulus.
  • the auditory neuropathy is an auditory neuropathy, Pathologically, the function of the outer hair cell is preserved and is due to the abnormalities of the inner hair cell and the auditory transmission pathway through the type 1 auditory nerve cell.
  • polynucleotide refers to a nucleotide polymer of any length, which polynucleotide can be used interchangeably with nucleic acids, or oligonucleotides.
  • the polynucleotide may specifically bind to the nucleotide sequence of the target region. Using the specific binding characteristics of such polynucleotides, it is possible to effectively isolate a target gene or a fragment thereof containing a target region from a mixture.
  • the polynucleotides may be singular or plural and may be in the form of a single strand or a double strand.
  • the polynucleotide may also be modified so that the sugar, base or phosphate site of a natural nucleotide, an analogue of a natural nucleotide, or a natural nucleotide, as well as being composed of a natural nucleotide, may be modified so long as it has a property of being hybridizable with a complementary nucleotide by hydrogen bonding (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)), and nucleotides selected from the group consisting of .
  • the polynucleotide may be DNA or RNA.
  • contiguous nucleotide sequence refers to two or more contiguous nucleotide sequences.
  • complementary means having complementarity enough to selectively hybridize to the nucleotide sequence under any particular hybridization or annealing conditions.
  • the polynucleotide may be a primer or a probe.
  • the primer or probe may be a nucleotide sequence perfectly complementary to the nucleotide sequence, but a nucleotide sequence that is substantially complementary may be used so long as it does not specifically interfere with hybridization .
  • the primer or the probe may have a modified nucleotide sequence within a range that does not interfere specifically with hybridization with respect to the nucleotide sequence of the target region.
  • primer means a single strand of oligonucleotides that can act as a starting point in the polymerization of a nucleotide by a polymerase.
  • the appropriate length of the primer may vary depending on various factors, for example, temperature and use of the primer.
  • the primer may have a length of 5 to 100 nt, 5 to 70 nt, 10 to 50 nt, or 15 to 30 nt.
  • the shorter the length of the primer the more stable hybridization complex can be formed with the template at a lower annealing temperature.
  • the primer is economical and has a size optimized for gene mutation detection.
  • the design of the primer can be easily carried out by a conventional technician with reference to the nucleotide sequence of the target region to be amplified. For example, it can be designed using a commercially available program for primer design. Examples of commercially available programs for primer design include the PRIMER 3 program.
  • the primer may further comprise a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, a peptide nucleic acid or an intercalating agent. Further, it may further comprise a labeling substance that emits fluorescence, phosphorescence, or radioactivity.
  • the fluorescent labeling substance may be VIC, NED, FAM, PET, or a combination thereof.
  • the labeling substance may be labeled at the 5 ' end of the polynucleotide.
  • the radioactive labeling substance may be incorporated into the amplification product through a PCR reaction using a polymerase chain reaction (PCR) in which a radioactive isotope such as 32 P or 35 S is added.
  • PCR polymerase chain reaction
  • the primers can be used for allele-specific PCR, PCR extension analysis, PCR-single strand conformation polymorphism (PCR-SSCP), TaqMan method and sequencing. have.
  • probe means a polynucleotide that is capable of sequence-specifically binding to a complementary polynucleotide strand.
  • the probe may have a length of 5 to 100 nt, 10 to 90 nt, 15 to 80 nt, 20 to 70 nt, or 30 to 50 nt. If the length of the probe is less than 10 nt, the accuracy for capturing the target area is low, and if the length is more than 100 nt, the synthesis cost is increased. Therefore, the probe is economical and has a size optimized for gene mutation detection.
  • the probe may be, for example, selected from the group consisting of a perfect match probe consisting of a sequence complementary to the nucleotide sequence of the target region and a probe having a sequence completely complementary to all nucleotide sequences except for the mutation position .
  • the probe may be used in hybridization methods such as microarray, Southern blotting, dynamic allele-specific hybridization, and DNA chip.
  • the microarray is used in a manner known in the art, for example, a group of probes or probes immobilized on a plurality of divided regions on a substrate.
  • the substrate can be any suitable rigid or semi-rigid support, such as a membrane, filter, chip, slide, wafer, fiber, magnetic bead or non-magnetic bead, gel, tubing, Microparticles, and capillaries.
  • the probe or a complementary probe thereof may be used in a method capable of hybridizing with a nucleic acid obtained from an individual and measuring the hybridization degree obtained therefrom.
  • gene refers to a structural unit that determines genetic information, and includes a structural gene having information for determining the base sequence of the protein's amino acid sequence or functional RNA (tRNA, rRNA, etc.), and / For example, a promoter, a repressor, an operator, and the like.
  • gene is understood to mean a single stranded side comprising a nucleotide sequence that is transcribed to produce a product of the gene.
  • the " nucleotide sequence of a gene &quot may be a nucleotide sequence that controls the expression of a nucleotide sequence and / or a structural gene contained in a single strand containing a nucleotide sequence to be transcribed to produce a product of the gene.
  • exon refers to a region containing information on the synthesis of a protein in the DNA sequence, for example, a nucleic acid molecule encoding part or all of the expressed protein.
  • the mutation may be one having a variation of the nucleotide sequence relative to the standard genomic DNA.
  • the mutation of the nucleotide sequence may include one or more nucleotide sequence substitution, insertion, duplication, and deletion (insertion and deletion: also referred to as 'InDel') with respect to the standard genomic DNA, , Translocation, and the like.
  • the substitution of the one or more nucleotide sequences may be, for example, a single nucleotide variant (SNV).
  • the mutation may be an autosomal dominant mutation.
  • the mutation may be a mutation of the exon region of the TMEM43 gene, for example, the 12th exon region.
  • the mutation may be the c.C1114T mutation in the nucleotide sequence of the TMEM43 gene.
  • the mutation may be a mutation of c.C1114T in the nucleotide sequence of SEQ ID NO: 2.
  • the mutation c.C1114T in the nucleotide sequence of SEQ ID NO: 2 is a mutation in which the cytidine (C), which is the 1114th nucleotide from the 5 'end of SEQ ID NO: 2 in the polynucleotide including the nucleotide sequence of SEQ ID NO: 2, Lt; / RTI >
  • the mutation may be the p.R372X mutation in the amino acid sequence of the TMEM43 protein.
  • the mutation may be a p.R372X mutation in the amino acid sequence of SEQ ID NO: 1.
  • the p.R372X mutation in the amino acid sequence of SEQ ID NO: 1 is a mutation in which the arginine (R), which is the 372nd amino acid from the N terminus of SEQ ID NO: 1, is deleted by the termination codon in the polypeptide comprising the amino acid sequence of SEQ ID NO: have.
  • a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting the TMEM43 mutation is a polynucleotide comprising a single nucleotide sequence at the polynucleotide comprising the nucleotide sequence of SEQ ID NO: Or a polynucleotide capable of detecting the 1114th nucleotide from the 5'end of SEQ ID NO: 2.
  • the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 may be the same or complementary to the polynucleotide comprising the 5'-end to the 1114-th nucleotide of SEQ ID NO: 2, which is a single nucleotide mutation position. If one single-stranded polynucleotide is associated with the risk of developing a sensory neural deafness disorder, the polynucleotide complementary to the single-stranded polynucleotide may naturally be associated with the risk of developing a sensory neural deafness disorder.
  • the composition may comprise a single-stranded polynucleotide and / or a polynucleotide having a nucleotide sequence complementary thereto, which is associated with the risk of developing a sensory neural deafness disorder with one particular nucleotide sequence.
  • compositions for the diagnosis of sensory neuron deafness disorder comprising a polypeptide for specifically detecting a polypeptide in which some amino acids of TMEM43 have been lost to detect TMEM43 mutation.
  • the composition may include a polypeptide capable of detecting the amino acid deletion position in the TMEM43 protein.
  • the composition may include a polypeptide capable of detecting the 372nd amino acid from the N-terminus of SEQ ID NO: 1, which is an amino acid deletion position in a polypeptide comprising the amino acid sequence of SEQ ID NO: 1.
  • Amino acid mutations may be due to nonsense mutation mutations.
  • a nonsense mutation refers to a change in which one or more nucleotides are changed to termination codons, thereby no longer producing amino acids.
  • the polypeptide may specifically bind to the 372nd amino acid from the N-terminus of SEQ ID NO: 1, which is the position at which the amino acid terminates and disappears in the polypeptide comprising the amino acid sequence of SEQ ID NO: 1.
  • the 372nd amino acid may be a polynucleotide encoding the 1114th nucleotide from the 5'end of SEQ ID NO: 2
  • the polypeptide may be a polynucleotide encoding the nucleotide 1114th from the 5'end of SEQ ID NO: 2
  • And may be one capable of detecting the resulting amino acid sequence.
  • the polypeptide may be an antibody or an antigen-binding fragment, and may be singular or plural.
  • the antibody may be one which is not only an entire antibody form but also contains a functional fragment of an antibody molecule.
  • the whole antibody is a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond.
  • a functional fragment of an antibody molecule means a fragment having an antigen-binding function.
  • the polypeptide may be prepared by immunocytochemistry and immunohistochemistry, radioimmunoassays, enzyme linked immunoabsorbent assay (ELISA), immunoblotting, Farr assay, immunoprecipitation, Aggregation, erythrocyte aggregation, an ascending method, an immunodiffusion method, a counter-current electrophoresis method, a single radical immunodiffusion method, an immunochromatography method, a protein chip and an immunofluorescence method. That is, a method capable of measuring the binding of an antigen to an antibody.
  • ELISA enzyme linked immunoabsorbent assay
  • kits for a sensory neuron deafness disorder comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting the TMEM43 mutation.
  • the kit may comprise a polynucleotide capable of detecting the 1114th nucleotide from the 5'end of SEQ ID NO: 2, which is a single nucleotide mutation position in a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2.
  • polynucleotide having the same or complementary sequence as the polynucleotide comprising the 5'-end to the 1114-th nucleotide of SEQ ID NO: 2, which is a single nucleotide mutation position in the polynucleotide including the nucleotide sequence of SEQ ID NO: 2 have.
  • the kit may, for example, comprise the polynucleotide and the constructs necessary for its particular use. And the reagent necessary for the method of use thereof together with the polynucleotide.
  • the kit may further comprise a known material required for hybridization of the polynucleotide with the nucleic acid.
  • the kit may be a kit for specifically amplifying the nucleotide sequence of the target region and diagnosing the sensory neuron deafness disorder of the individual through the presence or absence of the amplification product. Or a kit for hybridizing the polynucleotide or a probe derived therefrom with a nucleic acid in a sample and diagnosing the risk of developing an individual's sensory neural deafness disorder from the hybridization result.
  • the kit may further comprise a reagent, buffer, buffer, cofactor, and / or substrate necessary for hybridization of the nucleic acid.
  • a reagent necessary for PCR amplification for example, a buffer, a DNA polymerase, a DNA polymerase cofactor, and dNTPs.
  • the kit may further include instructions for use to amplify the target region, and may be produced from a number of separate packaging or compartments containing the reagent components described above.
  • the target region is amplified in the amplification reaction using the specific primer and the target region is not amplified in the amplification reaction using the non-specific primer, May include an explanation of the result determination, including an explanation of determining that an associated target region or variation is present and determining the risk of developing the sensory neural deafness disorder of the subject from the result.
  • Another aspect provides a diagnostic kit for a sensory neuron deafness disorder comprising a polypeptide for specifically detecting a polypeptide in which some amino acids of TMEM43 have been deleted to detect the TMEM43 mutation.
  • kits comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, one or more of which is suitable for the method of assaying a polypeptide for determining the level of expression of the 372nd amino acid- Other components or devices may be included.
  • the expression level of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 is determined by measuring the presence and the expression level of the polypeptide or protein expressed in the gene and comparing the expression level of the polypeptide comprising the amino acid sequence of SEQ ID NO: Can be used to confirm the expression level of the gene or the amount of the protein.
  • the kit may optionally comprise a secondary antibody and a labeling substrate.
  • Another aspect provides a vector comprising a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation of TMEM43.
  • the vector may comprise a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation in the amino acid sequence of SEQ ID NO:
  • the vector means the carrier of the polynucleotide.
  • the polynucleotide may be in a vector that is a suitable expression system, for example, an expression vector.
  • a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation in the amino acid sequence of SEQ ID NO: 1 may be operably linked to a promoter.
  • operably linked means a functional linkage between an array of nucleic acid expression control sequences, for example, an array of promoter, signal sequence, or transcription factor binding sites and other nucleic acid sequences, Regulate transcription and / or translation of other nucleic acid sequences.
  • Promoters that can be used in the expression vector are those capable of regulating the transcription of the nucleotide sequence by working in an animal cell such as a mammalian cell, such as a promoter derived from a mammalian virus and / or a promoter derived from the genome of a mammalian cell . ≪ / RTI > For example, cytomegalo virus (CMV) promoter, late adenovirus promoter, vaccinia virus 7.5K promoter, SV40 promoter, HSV tk promoter, RSV promoter, EF1 alpha promoter, metallothionein promoter, or Beta-actin promoter.
  • the vector may comprise an available polyadenylation sequence.
  • the backbone may be selected as necessary from various vectors suitable for expression of the polynucleotide.
  • pCMV6-Entry pHY92 vector, pRC CMV vector, pIRES2-EGFP vector, SV40 vector, papilomavirus vector, YIp5 vector, YCpl9 vector, Absteinvear virus vector, pMSG vector, pMAMneo- , PSECTag2B vector, or yT &
  • a vector for example, pCMV6-Entry, pHY92 vector, pRC CMV vector, pIRES2-EGFP vector, SV40 vector, papilomavirus vector, YIp5 vector, YCpl9 vector, Absteinvear virus vector, pMSG vector, pMAMneo- , PSECTag2B vector, or yT & A vector.
  • a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation of TMEM43 inserted in the pCMV6-Entry vector may be produced by methods known in the art, such as position directed mutagenesis and polymerase chain reaction have.
  • Another aspect provides a sensory neural deafness disorder model comprising TMEM43 mutations.
  • the model may be a transformation having a TMEM43 mutation.
  • transformant means a transformed cell or a transformed animal into which a gene encoding one or more desired proteins has been introduced.
  • the transformed animal refers to an animal that continuously expresses TMEM43 having the p.R372X mutation.
  • the transformed animal may comprise a mutation of the nucleotide sequence of the exon region of the TMEM43 gene.
  • the transformed animal may be one which comprises the c.C1114T mutation in the nucleotide sequence of the TMEM43 gene.
  • the transformed animal may be an animal that constantly expresses TMEM43 with the p.R372X mutation integrated into the animal's chromosome by injecting the animal's gene encoding the TMEM43 with the p.R372X mutation into the embryo.
  • the gene coding for the TMEM43 having the p.R372X mutation may be a somatic cell or a germ cell of a transformed animal, or a genome of a somatic cell and a germ cell.
  • the transformed animal can be obtained by microinjecting the vector into fertilized or embryonic stem cells (ES cells) (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et et al., EMBO J., 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., et al., Virology, 52: 456 (1973) , Gene, 10: 87 (1980)), DEAE-dextran treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 (1985)), retroviral infection and gene bend al., Proc. Natl. Acad. Sci., 87: 9568-9572 (1990)).
  • ES cells fertilized or embryonic stem cells
  • ES cells fertilized or embryonic stem cells
  • Ca phosphate precipitation method Graham, FL et et al., EMBO J., 1: 841 (1982)
  • the transgenic animal may be transiently transfected with a nucleic acid encoding a nucleic acid encoding a nucleic acid encoding a nucleic acid encoding a nucleic acid molecule selected from the group consisting of programmable nuclease such as zinc finger nuclease (ZFN), transcriptional activator-like effector nuclease (TALEN), CRISPR / Cas, or CRISPR / And the like.
  • ZFN zinc finger nuclease
  • TALEN transcriptional activator-like effector nuclease
  • CRISPR / Cas CRISPR / Cas
  • CRISPR / And the like programmable nuclease
  • the transformed animal is further provided with a step of delivering a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation of the TMEM43 to a fertilized egg or embryonic stem cell followed by preparing a fertilized animal, Transplanting into the uterus of an animal, raising the animal so that the embryo is born as a baby, obtaining offspring to select whether expression of the p.R372X mutation of TMEM43 is to be performed.
  • the transformed animal may be a mouse, rat, cow, horse, pig, sheep, goat, dog, cat, or the like, including but not limited to various mammals other than humans.
  • the transformed cell refers to a cell that continuously expresses TMEM43 having the p.R372X mutation.
  • the cells may be somatic cells or germ cells, or somatic cells and germ cells.
  • the transfected cells may be prepared by a known method for introducing the vector into cells, and may be prepared by a suitable standard technique, for example, microinjection, calcium phosphate precipitation, electroporation, liposome -Mediated transfection, DEAE-dextran treatment, retroviral infection, and gene bombardment, and the like.
  • the vector of circular form can be introduced into a linear vector form by cutting with appropriate restriction enzymes.
  • the transformant since the transformant continuously expresses the TMEM43 having the p.R372X mutation, it may be one used for screening a therapeutic agent for hearing loss or a therapeutic method. Screening for the therapeutic agent for sensory neural damage is performed by adding a test substance to be analyzed to a transformant that continuously expresses TMEM43 having a p.R372X mutation, and further comprising the step of analyzing the degree of treatment or alleviation of sensory nerve impairment in the transformant And evaluating the quality of the image.
  • the addition of the test substance to be analyzed to the transformed cells or the transformed animal can be carried out by various methods known to those of ordinary skill in the art.
  • Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the confirmed nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA.
  • the method comprises identifying the nucleotide sequence of the genomic DNA isolated from the subject.
  • the subject refers to an object for predicting the risk of developing sensory neural deafness.
  • the subject may be a subject suspected of having or developing a sensory neural deafness disorder.
  • the subject may be a vertebrate animal, a mammal, a human ( Homo sapiens ), a mouse, a rat, a cow, a horse, a pig, a sheep, a goat, a dog, a cat and the like.
  • the human being may be Asian or Korean. &Quot; Subject " and " patient " are used interchangeably herein.
  • the genomic DNA isolated from an individual in the method may be a genomic DNA isolated from a biological sample or a fragment thereof.
  • the biological sample may be a blood sample, tissue, urine, mucus, saliva, tear, plasma, serum, sputum, spinal fluid, pleural effusion, aspiration nipple, lymphatic fluid, airway fluid, Intracranial fluid, ascites fluid, cystic tumor fluid, positive fluid, or a combination thereof.
  • the biological sample may be one comprising a purely isolated nucleic acid, a crude nucleic acid, a cell lysate comprising a nucleic acid, or a cell free nucleic acid.
  • the method of separating the genomic DNA from the biological sample can be performed by a conventional nucleic acid separation method.
  • Identifying the nucleotide sequence of the genomic DNA in the above method means determining the nucleotide at the target region or each position in the chromosome.
  • the nucleotide sequencing method of a known nucleic acid can directly determine the nucleotide at the target region or at each position in the chromosome.
  • the nucleotide sequence determination method may include a ginger (or dideoxy) sequencing method or a germ-gilbert (chemical cleavage) method.
  • the nucleotide sequence of the target region can be determined by hybridizing the probe with the polynucleotide of interest and analyzing the result of hybridization.
  • the degree of hybridization can be confirmed, for example, by marking a detectable label on the target nucleic acid, detecting the hybridized target nucleic acid, or confirming it by an electrical method or the like.
  • a single base primer extension (SBE) method can be used.
  • the nucleotide sequence determination method may also include the next generation base sequencing.
  • next generation sequencing " (NGS) involves fragmenting a full-length genome in a chip-based and PCR-based paired end format, Sequencing. By next-generation nucleotide sequencing, a large amount of nucleotide sequence data can be generated for a sample to be analyzed within a short time.
  • the method may include fragmenting the isolated genomic DNA to an arbitrary size. Such fragmentation can be performed by methods known to those of ordinary skill in the art. For example, genomic DNA can be fragmented by using ultrasonic waves.
  • the method may include fragmenting the genomic DNA, and ligation of sequences for amplification at both ends of the fragmented genomic DNA.
  • a sequence for the amplification for example, a paired-end tag, a universal tag, or the like can be appropriately selected and performed by a person skilled in the art.
  • the method may comprise obtaining a separated genomic DNA and a hybridization product of the polynucleotide in the composition.
  • the method may be to obtain a hybridization product of a polynucleotide contained in the composition and a fragment of a genomic DNA having a nucleotide sequence of a target region targeted by the polynucleotide.
  • the hybridization can be accomplished by contacting the composition with isolated genomic DNA.
  • the hybridization can be carried out by known methods. For example, by incubating the genomic DNA isolated from the polynucleotide in a buffer known to be appropriate for the hybridization of the nucleic acid. Hybridization can be performed at an appropriate temperature.
  • Suitable temperatures for hybridization may be, for example, from about 40 ⁇ C to about 80 ⁇ C, from about 50 ⁇ C to about 75 ⁇ C, from about 60 ⁇ C to about 70 ⁇ C, or from about 62 ⁇ C to about 67 ⁇ C.
  • the hybridization temperature is not limited thereto, and can be appropriately selected according to the nucleotide sequence and the length of the polynucleotide contained in the composition.
  • the hybridization time can be, for example, from 1 hour to 12 hours (overnight).
  • the method may further include, after obtaining the hybridization product of the separated genomic DNA and the polynucleotide in the composition, separating the separated genomic DNA and the hybridization product of the polynucleotide before identifying the nucleotide sequence of the separated genomic DNA Step < / RTI >
  • the separation may be by using a moiety for separation or purification attached to the polynucleotide.
  • the separation or purification may be carried out by a substance or a magnetic field that specifically binds to the moiety.
  • the method comprises using the isolated hybridized product or separated genomic DNA as a template, sequencing amplification sequences at both ends of the template, and using a universal primer complementary to the sequence for amplification as a primer And amplifying the isolated hybridized product or the separated genomic DNA by PCR using the hybridization product.
  • the amplified product can be used to confirm the nucleotide sequence.
  • the method comprises comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the variation of the genomic DNA.
  • the term " reference neucleotide sequence" may be a human genomic sequence that does not contain a mutation that is referenced for mutation confirmation.
  • the standard nucleotide sequence may be the nucleotide sequence of the reference genome, for example, the nucleotide sequence of a human gene, specifically NCBI37.1 or UCSC hg19 (GRCh37), published in the database of the Institute of Biotechnology Information, .
  • the comparison between the nucleotide sequence of the genomic DNA and the standard nucleotide sequence can be performed using various known sequence comparative analysis programs such as Maq, Bowtie, SOAP and GSNAP.
  • the method may further comprise, when the mutation of the genomic DNA is confirmed, determining that the subject belongs to a high-risk group having a sensory neural deafness disorder. That is, the individual can be diagnosed as having sensory neural deafness.
  • the risk group refers to a group predicted or diagnosed as having an increased probability of developing a sensory neural deafness disorder compared to a group having a standard nucleotide sequence or a normal group.
  • Another aspect is the use of a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene to detect a TMEM43 mutation, or a polynucleotide comprising its complementary polynucleotide, ≪ / RTI >
  • the prognosis for wahoo implantation in patients with sensory nerve impairment means predicting whether speech can be understood during wah-wedge surgery or whether speech can be better understood after wahoo implantation. For example, it may be to predict whether the auditory brainstem response will normally appear.
  • the patient with sensory neuralgic hearing loss having the above mutation has abnormality in the supporting cells around the inner or inner hair cell, and there is no problem in the conduction of the auditory nerve. Therefore, the prognosis of the wah operation can be expected to be positive.
  • Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA.
  • identifying a nucleotide sequence of a genomic DNA isolated from an individual and comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA.
  • Identifying a nucleotide sequence of the genomic DNA isolated from the subject; And comparing the confirmed nucleotide sequence of the genomic DNA with a standard nucleotide sequence to confirm the mutation of the genomic DNA is as described above.
  • Providing information for predicting the prognosis of the wah-graft operation in the patients with sensory-nerve impairment means predicting whether the speech will be understood during the wah-graft operation or whether the speech will be better understood after the wah-graft operation . For example, it may be to predict whether the auditory brainstem response will normally appear.
  • the mutation of the TMEM43 gene can be analyzed with high sensitivity and accuracy, and the sensory nerve impairment can be efficiently diagnosed based on the analysis result.
  • FIGS. 1A and 1B show the process of confirming the genealogy and the TMEM43 mutation to which members of the cohort SB162 belong.
  • Figure 2 shows the result of confirming the organ in which TMEM43 is expressed in mouse.
  • FIG. 3 shows the results of confirming the expression of TMEM43 in the inner ear of 4 to 5 days old and 20 days old mice.
  • FIG. 4 shows the results of confirming the expression pattern of TMEM43 in the inner ear of 4-day, 15-day, and 20-day-old mice.
  • Figure 5 shows the process for constructing a transformed animal having the p.R372X mutation of TMEM43.
  • Auditorin means TMEM43.
  • Figure 6 shows the results for the 2, 7, and 13 months of TMEM43 + / + and TMEM43 + / tm1Cby An image of a transcriptional micrograph showing the inner border cell and the border cell in the reticular lamina of mouse hair cells.
  • green and pale green represent inner boundary cells
  • orange and yellow represent boundary cells, respectively.
  • Figure 7 shows the results of the 6 and 9 month old TMEM43 + / + and TMEM43 + / tm1Cby And the average ABR threshold for 4, 8, 16, and 32 kHz in the mouse. Auditorin means TMEM43.
  • 8A to 8H show the results of confirming the function of TMEM43 using cell patch clamp technology in CHO-K1 cells expressing TMEM43.
  • Example 1 From patients with sensory nerve impairment TMEM43 p. R372X Detection of mutation and confirmation of sensory neural deafness in animal model with p.R372X mutation of TMEM43
  • SB162 a family tree was isolated by autosomal dominant inheritance method of adult onset type progressive auditory neuropathy based on standardized hearing test or family history data. Compared with normal subjects (290), subjects (291, 284, and 304) who were affected by auditory neuropathy decreased their susceptibility to sound at Pure Tone Average (PTA) (DPOAE) or cochlear microphonic potential (CM), which has a complete absence of Auditory Brainstem Responses (ABRs) and is impaired in the Speech Discrimination Score (SDS) It was normal.
  • PTA Pure Tone Average
  • CM cochlear microphonic potential
  • adult auditory neuropathy In a total of 1,100 households, 780 households with hearing impairments, 15 families selected adult auditory neuropathy households. In the case of adult auditory neuropathy, the age at onset was secondarily selected for families with a language acquisition period. Based on clinical features, electrophysiologic findings, and genetic diagnosis in the candidate gene pool, adult auditory neuropathy was then classified into three types:
  • Type 1 If known to be caused by a known hearing loss gene (eg DIAPH3)
  • E-ABR electro-evoked auditory brainstem response
  • Target exome sequencing was performed on the 3p25-26 region from the linkage analysis for 4 subjects (SB162-284, 289, 290, 291) and the candidate variants were listed.
  • a mutation with a minor allele frequency of less than 1% was identified in ESP6500 and 1000G.
  • the dbSNP which is not a flagged dbSNP, is filtered, leaving a variation that matches the genetic pattern.
  • 622 species of normal control were used to eliminate Korean specific mutations. Genome level log2 ratios for chromosome 3 were examined.
  • Sequencing leads were aligned to the human reference genome (hg19) using BWA v 0.7.5 and SAMTOOLS v 0.1.18, and sorted, indexed, rearranged, and duplicated using CATK v 2.4-7 and Picard v 1.93 .
  • the mutation was named using the GATK Unified Genotyper and the mutation was reaffirmed. Variations were annotated using ANNOVAR. Thereafter, the final candidate variation of the household was confirmed by Sanger sequencing.
  • Candidate mutations were filtered by the variation of the coding region (synonymous variant) and the noncoding region.
  • FIGS. 1A and 1B show the process of confirming the genealogy and the TMEM43 mutation to which members of the cohort SB162 belong. After the filtering process based on the dbSNP database, allele frequency, and genetic pattern, and mutations of R372X in TMEM43 were detected as heterozygotes, the number of mutations identified in the process of selecting mutations of genes is shown in Table 3 below.
  • the p.R372X mutation is presumed to be inherited as autosomal dominant. In addition, the p.R372X mutation was not detected in the chromosomes of the Korean control group with normal hearing.
  • 129Sv / Ev mice were anesthetized with pentobarbital sodium (50 mg / kg).
  • pentobarbital sodium 50 mg / kg.
  • TRIZOL ® Gaithersburg, MD, USA
  • RNeasy kits using (Qiagen, Valencia, USA), the entire cochlea (cochlea) (P1 ), Heart (P120), eyes (P42), brain (P28), kidney (P28), and liver (P28).
  • cDNA was synthesized using oligo dT primer and extracted RNA. Polymerase chain reaction (PCR) was performed using the synthesized cDNA and a specific primer set specific for TMEM43 and Gapdh.
  • the PCR conditions were as follows: 95 ° C for 2 minutes, 95 20 sec at 55 ° C, 10 sec at 55 ° C, and 35 min at 70 ° C and 5 min at 72 ° C.
  • the amplification product (15 ⁇ l) was electrophoresed on 2% agarose gel and visualized with ethidium bromide.
  • TMEM43 forward primer 5'-CTTCCTGGAACGGCTGAG-3 '(SEQ ID NO: 3) and TMEM43 reverse primer 5'-CACCAGCCTTCCTTCATTCT-3' (SEQ ID NO: 4)
  • Gapdh forward Primer 5'-ACCACAGTCCATGCCATCAC-3 ')
  • Gapdh reverse primer 5'-CACCACCCTGTTGCTGTAGCC-3' (SEQ ID NO: 6).
  • FIG. 2 shows the result of confirming the organ in which TMEM43 is expressed in mouse. As shown in FIG. 2, it can be seen that TMEM43 is expressed in the inner ear cochlea.
  • NH 2 mouse TMEM43 - Rabbit polyclonal anti-serum (AbClon) that instructs the terminal was produced.
  • Peptide sequences are as NH 2 -SRKEHVKVTSE-COOH (SEQ ID NO: 7).
  • the primary antibodies were rabbit anti-TMEM43 monoclonal antibody (1: 500, Abcam, Ab184164), Rabbit anti-TMEM43 polyclonal antibody (1: 100, Novus, Cat # NBP1-84132, Littleton, USA 80120) (1: 500, Abcam, ab125096), mouse anti-calretinin monoclonal antibody (1: 500, Millipore, MAB1568), gut polychlorinated anti-Na + , K + ATPase- ⁇ 3 antibody (NKA, 1: 250, Santa Cruz, SC-16052) and mouse monoclonal anti-CTBP2 antibody (1: 500, BD Transduction Laboratories, 612044) were used. Secondary antibodies were diluted 1: 1000 with donkey or life technologies.
  • the tissue sample was mounted on a glass slide using a Fluorsave reagent (Calbiochem, 345789), covered with a coverslip, and a microscope sample was made. Images were obtained from a microscope sample using an epifluorescence microscope and a confocal laser scanning microscope (LSM710, Zeiss).
  • FIG. 3 shows the results of confirming the expression of TMEM43 in the inner ear of 4 to 5 days old and 20 days old mice. As shown in FIG. 3, it can be seen that TMEM43 is expressed in supporting cells around the inner hair cells.
  • FIG. 4 shows the results of confirming the expression pattern of TMEM43 in the inner ear of 4-day, 15-day, and 20-day-old mice. As shown in Fig. 4, TMEM43 in mouse is expressed in inner ear, and it is constantly expressed in supporting cells around inner ear embryonic cell even when time passes. In addition, the expression pattern of TMEM43 was consistent with the pattern of spontaneous activity (not shown).
  • a mouse model of TMEM43 -R372X knock-in (C57BL / 6J; 129S-TMEM43 tm1Cby ) mouse model was constructed using a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) method.
  • FIG. 5 shows the process for constructing a transformed animal having the p.R372X mutation of TMEM43.
  • arginine (R) was replaced with a stop codon at position 372 of the TMEM43 protein (gene ID: NM_028766).
  • gRNA was constructed. Two gRNA candidates located close to the mutation site ( TMEM43 gRNA1: 5'- TTAGAGCAGCCCACAGCGGT CGG- 3 '(SEQ ID NO: 8); TMEM43 gRNA2: 5'-CCGATTAGAGCAGCCCACAG CGG- 3 '(SEQ ID NO: 9)) was evaluated.
  • CCG represents a PAM (Protospacer Adjacent Motif) sequence.
  • SURVEYOR assay was performed using the SURVEYOR Mutation Detection Kit (IDT) according to the manufacturer's instructions. Based on the identified gRNAs, a single stranded oligodeoxynucleotide donor (ssODN) was designed and synthesized. The 160 bp donor DNA contains two homologous arms flanking the mutation (C- > T) introduced in exon 12 corresponding to the 1114 position of the TMEM43 gene. In addition, additional mutations corresponding to the second termination codon were introduced to prevent the repaired genome from being retargeted by the Cas9 complex.
  • IDT SURVEYOR Mutation Detection Kit
  • C57BL / 6J embryos Sixty-two C57BL / 6J embryos were injected via the cytoplasm with a CRISPR cocktail containing ssODN donor, gRNA transcript TMEM43, and Cas9 mRNA. Of the 62 embryos, 49 embryos were selected for screening and transplanted into two CD1 mice. All females were pregnant and gave birth to nine litters of F0. Female F0 was crossed with wild-type male C57BL / 6J mice, F1 was obtained, and germline transmission of germ cells was confirmed. For all mice, the presence or absence of a point mutation at the target site was analyzed by PCR and sequencing.
  • genomic DNA was extracted from the tail of about 1 mm to about 2 mm using DNeasy ® blood & tissue kit (Qiagen, Hilden, Germany). Using 5 ⁇ l of genomic DNA, 25 mM MgCl 2 , 2 mM of dNTPs, 10 pM of primer, and 0.02 U of TOYOBO KOD Hot Start DNA polymerase (Invitrogen / Life Technologies, Billerica, Massachusetts, USA) The PCR conditions were as follows: 95 ° C for 2 minutes, followed by 95 ° C for 20 seconds, 59 ° C for 10 seconds, and 72 ° C for 10 seconds and 72 ° C for 10 minutes.
  • primer sequences were as follows: a forward primer 5'-ccacagTGGACTGGTTTCCT-3 '(SEQ ID NO: 10), and a reverse primer 5'-GGCTTCACTCCAGCTTTTTG-3' 11).
  • the size of the amplified product by the primer sequence is about 213 bp.
  • the amplified product was confirmed by Sanger sequencing (Macrogen Inc., Seoul, KOR).
  • tissue sample was prepared using osmium tetroxide - thiocarbohydrazide method and observed with a scanning electron microscope.
  • the tissue samples were then dehydrated in an ethanol solution with a concentration gradient, dried and platinum coated using a sputter coater (E1030; Hitachi, Tokyo, Japan).
  • the surface of the Corti organ was captured with a cold field emission SEM (SU8220, Hitachi, Tokyo, Japan) operating at 10 or 15 kV.
  • Microscopic images were obtained using ImageJ software (National Institutes of Health, http://rsbweb.nih.gov/ij/).
  • Figure 6 shows the results for the 2, 7, and 13 months of TMEM43 + / + and TMEM43 + / tm1Cby
  • green and pale green represent inner boundary cells
  • orange and yellow represent boundary cells, respectively.
  • TMEM43 + / tm1Cby The area of the inner border cells and the border cells of the mouse is decreased as compared with that of the inner border cells and the border cells of wild type mice. It is expected that as the inner border cells and border cells shrink and decrease, the auditory nerve transposition is suppressed.
  • ABR was performed in an anechoic room. Mice were treated with 0.1 mg levomepromazin chlorhydrate and about 3.5 mg ketamine chlorhydrate was intravenously administered to 15 g mice by intraperitoneal injection. The ABR collected and analyzed the response to a short tone burst calibrated in the range of 4 to 32 kHz. Electroencephalograms were recorded via stainless steel electrodes under the vertices and ipsilateral mastoids using a standard digital averaging system. At all sound levels, 500 responses to tone bursts were synchronous averaging. ABRs greater than the threshold consisted of waves of regular intervals (I to IV).
  • the tone burst level varies from 10 dB to 120 dB SPL peak-equivalent, while the ABR threshold was obtained at the minimum stimulation level required to generate at least one repeatable wave IV 40.3 mV.
  • Figure 7 shows the mean ABR threshold for 4, 8, 16, and 32 kHz in TMEM43 + / + and TMEM43 + / tm1Cby mice at 6 and 9 months of age. As shown in Fig. 7, TMEM43 + / tm1Cby The mouse shows that the ABR threshold is higher than the wild type ABR threshold.
  • TMEM43 The function of TMEM43 was confirmed using a cell patch-clamp technique.
  • Cell patch clamp technology is known as a method of measuring electrical signals.
  • An electrode in a glass micropipette can measure the electrical signal from one cell.
  • the characteristic of the ion channel developed in the cell can be known.
  • human TMEM43 was expressed in Chinese hamster ovary (CHO-K1) cells and membrane current was measured under voltage clamp.
  • FIG. 8 shows the results of confirming the function of TMEM43 using cell patch clamp technology in CHO-K1 cells expressing TMEM43.
  • CHO-K1 cells in which TMEM43 protein is almost not expressed do not pass an electric signal, but CHO-K1 cells expressing TMEM43 protein transmit electric signals (Fig. 8A).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Environmental Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to marker TMEM43 for sensorineural hearing loss diagnosis, and a use thereof. Specifically, the present invention relates to: a composition for diagnosing sensorineural hearing loss containing a polynucleotide, which includes a continuous nucleotide sequence that is selected from among nucleotide sequences in an exon region of the TMEM43 gene in order to enable the detection of mutations of the TMEM43 gene, or a complementary polynucleotide thereof; and a method for detecting the mutation of genomic DNA in order to provide information for diagnosis. A kit or composition according to an aspect may be used to analyze the mutation of the TMEM43 gene with high sensitivity and accuracy, and sensorineural hearing loss may be efficiently diagnosed on the basis of the results of such an analysis.

Description

감각신경성 난청 진단을 위한 마커 TMEM43 및 그의 용도Marker TMEM43 for diagnosing sensory neural deafness and uses thereof
유전자 변이를 검출하기 위한 감각신경성 난청 질환의 진단용 조성물, 감각신경성 난청 질환의 진단에 관한 정보를 제공하기 위하여 유전체의 변이를 검출하는 방법, 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 조성물, 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 정보를 제공하기 위하여 유전체의 변이를 검출하는 방법, 및 감각신경성 난청 질환 모델에 관한 것이다. Compositions for the diagnosis of sensory neural deafness disorders for detecting genetic mutations, methods for detecting mutations in the genome to provide information about the diagnosis of sensory neural deafness, methods for predicting the prognosis for wort transplantation in patients with sensory nerve impairment The present invention relates to a method for detecting a mutation of a genome to provide information for predicting a prognosis for a woW transplantation of a sensory neuron deaf hearing patient, and a sensory neuronal hearing loss disease model.
선천성 난청(Congenital hearing loss)은 신생아 1,000명 중 3명 정도의 빈도로 발생하며, 50% 이상이 유전적 요인에 의한 것으로 알려져 있다. 유전성 난청은 선천성으로 출생 후부터 나타나는데 난청 형태는 여러 종류이나 이 중 감각신경성 난청(Sensorineural Hearing Loss: SNHL)이 가장 흔하다. Congenital hearing loss occurs in about 3 out of 1,000 neonates, and more than 50% is known to be caused by genetic factors. Hereditary hearing loss is congenital and occurs from birth. There are many types of hearing loss, but the most common is sensorineural hearing loss (SNHL).
감각신경성 난청은 달팽이관의 소리를 감지하는 기능에 이상이 생기거나 소리에 의한 자극을 뇌로 전달하는 청신경 또는 중추신경계의 이상으로 발생하는 난청을 말한다. 감각신경성 난청은 증상에 따라서 증후군과 비증후군으로 분류되는데, 증후군 감각신경성 난청은 내이 기능 이상에 의한 것 이외의 다른 기관의 임상적 증상 또는 증후를 가지고 있는 경우를 의미한다. 이는 유전성 난청의 30%를 차지하고, 현재까지 300종류 이상의 증후군 난청이 보고되어 있다. 특징적인 증상이나 기형으로 쉽게 분류되므로 같은 원인을 갖는 환자들에서 원인 유전자를 용이하게 추적할 수 있다. 비증후군 감각신경성 난청은 내이 기능 이상 이외의 다른 기관의 이상 증상 또는 증후를 보이지 않는 경우를 의미하며, 청각 장애만을 나타낸다. 유전성 난청의 70%를 차지하고, 원인 유전자가 다양하여 난청의 유형, 유전 형태 등의 임상적 정보들을 토대로 전략적인 유전 진단이 요구된다. 비증후군 난청은 유전 형태에 의해서 80%가 열성 유전, 17%가 우성 유전, 2 내지 3%가 X-연관, 그리고 1%가 미토콘드리아 유전으로 발생하게 되는 것으로 알려져 있다. 감각신경성 난청은 와우의 외 유모 세포에 문제가 있는 일반적인 감각신경성 난청과 와우의 내 유모 세포나 신경자체 등에 문제가 있는 청각신경병증(auditory neuropathy)이 있다. 따라서, 청각신경병증은 이음향방출 또는 와우마이크로폰(cochlear microphonic: CM) 작용은 나타나지만, 청성뇌간반응은 나타나지 않거나 매우 비정상적인 소견을 보인다. 청각신경병증은 많은 환자에서 산발적(sporadic)으로 발생하지만 유전적인 경우도 있다. 상염색체 우성 유전(autosomal dominant inheritance pattern)인 경우 진행성 난청의 양상을 보이고 말초신경병증을 동반하는 경우가 많다. 상염색체 열성 유전(autosomal recessive inheritance pattern)의 경우 일반적으로 영아기에 고도난청을 보이고 말초신경병증을 동반하지 않는다. 알려진 원인 유전자 결함은 미엘린 단백질 제로(myelin protein zero: MPZ), 말단 미엘린 단백질 22(peripheral myelin protein: PMP22), 그리고 오토페를린(otoferlin: OTOF) 유전자 변이 등이 있다. Sensory nerve impairment refers to hearing loss caused by an abnormality in the function of detecting the sound of the cochlea or of an auditory nerve or a central nervous system that transmits a stimulation by sound to the brain. Sensory nerve impairment is classified into syndrome and non-syndrome according to the symptoms. Syndrome Sensory nerve impairment refers to the clinical symptoms or symptoms of other organs other than those caused by abnormal function of inner ear. It accounts for 30% of hereditary hearing loss, and over 300 types of syndromic hearing loss have been reported to date. Because it is easily classified as a characteristic symptom or anomaly, the causative gene can be easily traced in patients with the same cause. Non-syndrome Sensory-nerve impairment refers to cases in which there are no abnormal symptoms or symptoms of other organs other than internal dysfunction, and only hearing impairment. It accounts for 70% of hereditary deafness, has a variety of causative genes, and strategic genetic diagnosis is required based on clinical information such as type of hearing loss, genetic type, and so on. Non-syndromic hearing loss is known to occur in 80% of genetic forms, 17% of dominant inheritance, 2 to 3% of X-linked, and 1% of mitochondrial hereditary genetic patterns. Sensory nerve impairment is a common sensory neural deafness problem in the outer ear cells of the wah and auditory neuropathy in the inner ear cells of the wah or in the nerve itself. Thus, auditory neuropathy exhibits an unidirectional or cochlear microphonic (CM) action, but no auditory brainstem response or very abnormal findings. Auditory neuropathy occurs sporadically in many patients, but may also be genetic. In autosomal dominant inheritance pattern, progressive hearing loss is present and accompanied by peripheral neuropathy. The autosomal recessive inheritance pattern generally presents with severe hearing loss in infancy and does not accompany peripheral neuropathy. Known causes of gene defects include myelin protein zero (MPZ), peripheral myelin protein (PMP22), and otoferlin (OTOF) gene mutations.
감각신경성 난청 질환은 실제로 상당한 유병률을 가지고 있을 것으로 예상되나 특히 성인의 경우 정확한 진단의 부재로 미진단 사례가 많을 것으로 예상된다. 또한, 현재까지 일부 난청 유전자가 연구되었으나, TMEM43의 변이와 감각신경성 난청과의 관계에 대하여는 보고된 바가 전혀 없다. 이러한 배경 하에서, 본 발명자들은 감각신경성 난청 질환을 진단하기 위한 마커를 찾기 위해 노력한 결과, TMEM43의 변이를 이용하여 감각신경성 난청을 진단할 수 있음을 확인함으로써 본 발명을 완성하였다.Sensory neurogenic hearing loss is expected to have a considerable prevalence, but adults are expected to have many diagnoses due to lack of accurate diagnosis. In addition, some hearing loss genes have been studied so far, but no relation has been reported between TMEM43 mutations and sensory nerve deafness. Under these circumstances, the present inventors have made efforts to find markers for diagnosing sensory neuronal deafness, and as a result, The present inventors have completed the present invention by confirming that it is possible to diagnose sensory nerve impairment by using mutations.
일 양상은 TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 감각신경성 난청 질환의 진단용 조성물을 제공한다. One aspect provides a composition for the diagnosis of sensory neural deafness comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting a TMEM43 mutation.
다른 양상은 개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계; 및 상기 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계를 포함하는 감각신경성 난청 질환의 진단에 관한 정보를 제공하기 위하여 유전체 DNA의 변이를 검출하는 방법을 제공한다.Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the confirmed nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA. A method for detecting the mutation of the genomic DNA to provide information on the diagnosis of the sensory neuron deafness disorder .
다른 양상은 TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 조성물을 제공한다.Another aspect is the use of a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene to detect a TMEM43 mutation, or a polynucleotide comprising its complementary polynucleotide, ≪ / RTI >
다른 양상은 개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계; 및 상기 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계를 포함하는 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 정보를 제공하기 위하여 유전체 DNA의 변이를 검출하는 방법을 제공한다. Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA. In order to provide information for predicting the prognosis for the wahoo implantation in a patient with sensory nerve impairment, Thereby providing a method for detecting the mutation of DNA.
다른 양상은 TMEM43 변이를 포함하는 감각신경성 난청 질환 모델을 제공한다.Another aspect provides a sensory neural deafness disorder model comprising TMEM43 mutations.
일 양상은 TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 감각신경성 난청 질환의 진단용 조성물을 제공한다. One aspect provides a composition for the diagnosis of sensory neural deafness comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting a TMEM43 mutation.
막관통 단백질 43(transmembrane protein 43: TMEM43)은 내부 핵막에서 단백질 복합체를 조직함으로써 핵막 구조체를 유지하는 기능을 하는 단백질이다. 상기 TMEM43은 인간의 경우, TMEM43 유전자에 의해 암호화되는 단백질인 것일 수 있다. TMEM43은 인간의 경우, GenBank Accession No. NP_077310.1의 아미노산 서열을 포함하는 폴리펩티드 또는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드인 것일 수 있다. 상기 TMEM43 유전자는 인간의 경우, 상기 TMEM43의 아미노산 서열을 암호화하는 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드, 서열번호 1의 아미노산 서열을 암호화하는 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드, GenBank Accession No. NM_024334, NM_024334.2의 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드, 또는 서열번호 2의 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드인 것일 수 있다. Transmembrane protein 43 (TMEM43) is a protein that functions to maintain the nuclear membrane structure by forming a protein complex in the inner nuclear membrane. In the case of human TMEM43, the TMEM43 may be a protein encoded by the TMEM43 gene. In the case of human TMEM43, GenBank Accession No. A polypeptide comprising the amino acid sequence of NP_077310.1 or a polypeptide comprising the amino acid sequence of SEQ ID NO: 1. In the case of human, the TMEM43 gene includes a polynucleotide including a nucleotide sequence encoding the amino acid sequence of TMEM43, a polynucleotide including a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, A polynucleotide comprising a nucleotide sequence of NM_024334, a nucleotide sequence of NM_024334.2, or a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 2.
통상의 기술자라면 상기 등록번호를 이용하여 변이의 위치 및 서열을 용이하게 확인할 수 있을 것이다. UCSC genome browser 또는 GenBank에 등록되어 있는 번호에 해당하는 구체적인 서열은 시간이 지남에 따라 다소 변경될 수 있다. 본 발명의 범위가 상기 변경된 서열에도 미치는 것은 통상의 기술자에게 자명할 것이다. As a conventional technician, the position and sequence of the mutation can be easily confirmed using the registration number. The specific sequence corresponding to the number registered in the UCSC genome browser or GenBank may change over time. It will be apparent to those of ordinary skill in the art that the scope of the present invention also affects the altered sequence.
상기 TMEM43은 내이에서 발현되는 것일 수 있다. 상기 TMEM43은 내이 내 내 유모 세포(inner hair cell) 또는 내 유모 주변의 지지세포(supporting cell)에서 발현되는 것일 수 있다. 상기 TMEM43은 발달되는(developing) 내이에서 자발적 활동(spontaneous activity)을 촉진시켜, 청각 발생 이전에 청신경원 세포의 생존과 성숙을 유도하는 것일 수 있다. The TMEM 43 may be expressed in the inner ear. The TMEM 43 may be expressed in inner ear hair cells or supporting cells around the inner hair cells. The TMEM 43 may be one that promotes spontaneous activity in the developing inner ear and induces survival and maturation of the auditory source cells prior to the onset of auditory evoked potentials.
상기 감각신경성 난청은 달팽이관의 소리를 감지하는 기능에 이상이 생기거나 소리에 의한 자극을 뇌로 전달하는 청신경 또는 중추신경계의 이상으로 발생하는 난청을 의미한다. 상기 감각신경성 난청은 비증후군 감각신경성 난청(Non Syndromal sensorineural hearing loss: NS-SNHL)일 수 있다. 상기 비증후군 감각신경성 난청은 내이 기능 이상 이외의 다른 기관의 이상 증상 또는 증후를 보이지 않는 난청을 의미한다. 상기 감각신경성 난청은 청각신경병증인 것일 수 있다. 청각신경병증은 소리 자극에 대해 청신경 섬유에서 발생하는 활동 전위의 동시성(synchrony)에 장애가 발생하여 유발되는 난청 질환으로서, 이음향방출이나 와우마이크로폰 작용은 나타나지만, 청성뇌간반응은 나타나지 않거나 매우 비정상적인 소견을 보이며, 병리학적으로는 외 유모 세포의 기능은 보존되어 있으면서, 내 유모 세포와 제1형 청신경세포를 통한 청각 전달로의 이상에 기인한다. The sensory neural deafness refers to hearing loss caused by an abnormality in the function of sensing the sound of the cochlea or of an auditory nerve or a central nervous system which transmits a stimulation by sound to the brain. The sensory neural deafness may be non-syndromic sensorineural hearing loss (NS-SNHL). Non-syndromic sensory neural deafness refers to hearing loss that does not exhibit abnormal symptoms or symptoms of other organs other than abnormal inner ear function. The sensory neural deafness may be an auditory neuropathy. The auditory neuropathy is a hearing disorder caused by a disorder in the synchrony of action potentials occurring in the auditory nerve fibers in the auditory stimulus. The auditory neuropathy is an auditory neuropathy, Pathologically, the function of the outer hair cell is preserved and is due to the abnormalities of the inner hair cell and the auditory transmission pathway through the type 1 auditory nerve cell.
용어 "폴리뉴클레오티드"는 임의의 길이를 지닌 뉴클레오티드 폴리머를 의미하며, 상기 폴리뉴클레오티드는 핵산, 또는 올리고뉴클레오티드와 상호교환적으로 사용할 수 있다. 상기 폴리뉴클레오티드는 표적 영역의 뉴클레오티드 서열과 특이적으로 결합하는 것일 수 있다. 이러한 폴리뉴클레오티드의 특이적 결합 특성을 이용하여, 혼합물로로부터 표적 영역을 포함하는 표적 유전자 또는 그의 단편을 효과적으로 분리할 수 있다. The term " polynucleotide " refers to a nucleotide polymer of any length, which polynucleotide can be used interchangeably with nucleic acids, or oligonucleotides. The polynucleotide may specifically bind to the nucleotide sequence of the target region. Using the specific binding characteristics of such polynucleotides, it is possible to effectively isolate a target gene or a fragment thereof containing a target region from a mixture.
상기 폴리뉴클레오티드는 단수개 또는 복수개인 것일 수 있고, 단일 가닥 또는 이중 가닥의 형태인 것일 수 있다. 상기 폴리뉴클레오티드는 또한, 상보적인 뉴클레오티드와 수소 결합에 의하여 혼성화될 수 있는 성질을 갖는 것이면, 천연 뉴클레오티드로 구성된 것뿐만 아니라, 천연 뉴클레오티드, 천연 뉴클레오티드의 유사체, 천연 뉴클레오티드의 당, 염기 또는 인산 부위가 변형되어 있는 뉴클레오티드 및 이들 조합으로 이루어진 군으로부터 선택되는 뉴클레오티드를 포함하는 것일 수 있다(Scheit, Nucleotide Analogs, John Wiley, New York(1980); Uhlman 및 Peyman, Chemical Reviews, 90:543-584(1990)). 상기 폴리뉴클레오티드는 DNA 또는 RNA인 것일 수 있다. The polynucleotides may be singular or plural and may be in the form of a single strand or a double strand. The polynucleotide may also be modified so that the sugar, base or phosphate site of a natural nucleotide, an analogue of a natural nucleotide, or a natural nucleotide, as well as being composed of a natural nucleotide, may be modified so long as it has a property of being hybridizable with a complementary nucleotide by hydrogen bonding (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)), and nucleotides selected from the group consisting of . The polynucleotide may be DNA or RNA.
용어 "연속 뉴클레오티드 서열(contiguous nucleotide sequence)"은 인접한 2개 이상의 뉴클레오티드 서열을 의미한다.The term " contiguous nucleotide sequence " refers to two or more contiguous nucleotide sequences.
용어 "상보적(complementary)"은 어떤 특정한 혼성화(hybridization) 또는 어닐링 조건하에서 상기 뉴클레오티드 서열에 선택적으로 혼성화할 수 있을 정도의 상보성을 갖는 것을 의미한다. The term " complementary " means having complementarity enough to selectively hybridize to the nucleotide sequence under any particular hybridization or annealing conditions.
상기 폴리뉴클레오티드는 프라이머 또는 프로브인 것일 수 있다. 상기 프라이머 또는 프로브는, 상기 뉴클레오티드 서열에 완전하게(perfectly) 상보적인 뉴클레오티드 서열이 이용될 수 있으나, 특이적으로 혼성화를 방해하지 않는 범위 내에서 실질적으로(substantially) 상보적인 뉴클레오티드 서열이 이용될 수도 있다. 또한, 상기 프라이머 또는 프로브는, 표적 영역의 뉴클레오티드 서열에 대하여 특이적으로 혼성화를 방해하지 않는 범위 내에서, 변형된 뉴클레오티드 서열을 갖는 것일 수 있다. The polynucleotide may be a primer or a probe. The primer or probe may be a nucleotide sequence perfectly complementary to the nucleotide sequence, but a nucleotide sequence that is substantially complementary may be used so long as it does not specifically interfere with hybridization . In addition, the primer or the probe may have a modified nucleotide sequence within a range that does not interfere specifically with hybridization with respect to the nucleotide sequence of the target region.
용어 "프라이머(primer)"는 중합효소에 의한 뉴클레오티드의 중합 반응에서, 개시점으로 작용할 수 있는 단일 가닥의 올리고뉴클레오티드를 의미한다. 예를 들면, 상기 프라이머는 적합한 온도 및 적합한 완충액 내에서 적합한 조건, 즉, 4종의 다른 뉴클레오시드 트리포스페이트 및 중합효소의 존재 하에서 주형-지시(template-directed) DNA 합성의 개시점으로 작용할 수 있는 단일 가닥의 올리고뉴클레오티드인 것일 수 있다. 프라이머의 적합한 길이는 다양한 인자, 예를 들면, 온도와 프라이머의 용도에 따라 달라질 수 있다. 상기 프라이머는 길이가 5 내지 100nt, 5 내지 70nt, 10 내지 50nt, 또는 15 내지 30nt인 것일 수 있다. 예를 들면, 프라이머의 길이가 짧을수록, 낮은 어닐링(annealing) 온도에서 주형과 충분히 안정된 혼성화 복합체를 형성할 수 있다. 상기 프라이머의 길이가 5nt 미만의 크기를 가질 경우 표적 영역을 캡처하기 위한 정확도가 낮으며, 100nt 초과의 크기를 가질 경우 합성 비용이 증가하는 단점을 갖는다. 따라서 상기 프라이머는 경제적이면서 유전자 변이 검출에 최적화된 크기를 갖는다. 프라이머의 설계는 주어진 증폭하고자 하는 표적 영역의 뉴클레오티드 서열을 참조하여 통상의 기술자에 의해 용이하게 실시할 수 있다. 예를 들면, 상업적으로 구입가능한 프라이머 설계용 프로그램을 사용하여 설계할 수 있다. 상기 상업적으로 구입가능한 프라이머 설계용 프로그램의 예는 PRIMER 3 프로그램이 포함된다. The term " primer " means a single strand of oligonucleotides that can act as a starting point in the polymerization of a nucleotide by a polymerase. For example, the primer can serve as a starting point for template-directed DNA synthesis in the presence of suitable conditions, i.e., four different nucleoside triphosphates and polymerases, at the appropriate temperature and in the appropriate buffer Lt; RTI ID = 0.0 > oligonucleotides < / RTI > The appropriate length of the primer may vary depending on various factors, for example, temperature and use of the primer. The primer may have a length of 5 to 100 nt, 5 to 70 nt, 10 to 50 nt, or 15 to 30 nt. For example, the shorter the length of the primer, the more stable hybridization complex can be formed with the template at a lower annealing temperature. If the length of the primer is less than 5 nt, the accuracy for capturing the target region is low, and if the primer has a size of more than 100 nt, the synthesis cost is increased. Therefore, the primer is economical and has a size optimized for gene mutation detection. The design of the primer can be easily carried out by a conventional technician with reference to the nucleotide sequence of the target region to be amplified. For example, it can be designed using a commercially available program for primer design. Examples of commercially available programs for primer design include the PRIMER 3 program.
상기 프라이머는 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트와 같은 뉴클레오티드 유사체(analogue), 펩티드 핵산(peptide nucleic acid) 또는 삽입 물질(intercalating agent)을 더 포함하는 것일 수 있다. 또한, 형광, 인광 또는 방사성을 발하는 표지 물질을 더 포함하는 것일 수 있다. 상기 형광 표지 물질은 VIC, NED, FAM, PET, 또는 이들의 조합인 것일 수 있다. 상기 표지 물질은 상기 폴리뉴클레오티드의 5' 말단에 표지되는 것일 수 있다. 또한, 방사성 표지 물질은, 32P 또는 35S와 같은 방사성 동위원소가 첨가된 중합효소 연쇄 반응(polymerase chain reaction: PCR)의 반응액을 이용한 PCR 반응을 통해 증폭 산물에 혼입되는 것일 수 있다.The primer may further comprise a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, a peptide nucleic acid or an intercalating agent. Further, it may further comprise a labeling substance that emits fluorescence, phosphorescence, or radioactivity. The fluorescent labeling substance may be VIC, NED, FAM, PET, or a combination thereof. The labeling substance may be labeled at the 5 ' end of the polynucleotide. In addition, the radioactive labeling substance may be incorporated into the amplification product through a PCR reaction using a polymerase chain reaction (PCR) in which a radioactive isotope such as 32 P or 35 S is added.
상기 프라이머는 대립유전자 특이적인 PCR(allele specific PCR), PCR 연장 분석, PCR 단일 가닥 고차 구조 다형성(PCR-single strand conformation polymorphism: PCR-SSCP), TaqMan 방법 및 시퀀싱 등을 이용한 방법에 이용되는 것일 수 있다.The primers can be used for allele-specific PCR, PCR extension analysis, PCR-single strand conformation polymorphism (PCR-SSCP), TaqMan method and sequencing. have.
용어 "프로브(probe)"는 상보적인 폴리뉴클레오티드 가닥에 서열 특이적으로 결합할 수 있는 폴리뉴클레오티드를 의미한다. 상기 프로브는 길이가 5 내지 100nt, 10 내지 90nt, 15 내지 80nt, 20 내지 70nt, 또는 30 내지 50nt인 것일 수 있다. 상기 프로브의 길이가 10nt 미만의 크기를 가질 경우 표적 영역을 캡처하기 위한 정확도가 낮으며, 100nt 초과의 크기를 가질 경우 합성 비용이 증가하는 단점을 갖는다. 따라서 상기 프로브는 경제적이면서 유전자 변이 검출에 최적화된 크기를 갖는다. 상기 프로브는, 예를 들면, 표적 영역의 뉴클레오티드 서열에 완전 상보적인 서열로 이루어진 완전 매치 프로브(perfect match probe) 및 변이 위치를 제외한 모든 뉴클레오티드 서열에 대하여 완전 상보적인 서열을 갖는 프로브로 이루어진 군으로부터 선택되는 것일 수 있다. The term " probe " means a polynucleotide that is capable of sequence-specifically binding to a complementary polynucleotide strand. The probe may have a length of 5 to 100 nt, 10 to 90 nt, 15 to 80 nt, 20 to 70 nt, or 30 to 50 nt. If the length of the probe is less than 10 nt, the accuracy for capturing the target area is low, and if the length is more than 100 nt, the synthesis cost is increased. Therefore, the probe is economical and has a size optimized for gene mutation detection. The probe may be, for example, selected from the group consisting of a perfect match probe consisting of a sequence complementary to the nucleotide sequence of the target region and a probe having a sequence completely complementary to all nucleotide sequences except for the mutation position .
상기 프로브는 혼성화 방법, 예를 들면, 마이크로어레이(microarray), 서던 블로팅, 다이나믹 대립유전자 혼성화(dynamic allele-specific hybridization) 및 DNA 칩 등을 이용한 방법에 이용되는 것일 수 있다. 마이크로어레이는 당해 기술 분야에 알려진 의미로 사용되며, 예를 들면, 기판 상의 복수 개의 구분된 영역에 프로브 또는 프로브의 집단이 고정화되어 있는 것일 수 있다. 상기 기판은 적합한 견고성 또는 반-견고성 지지체로서, 예를 들면, 막, 필터, 칩, 슬라이드, 웨이퍼(wafer), 파이버(fiber), 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함하는 것일 수 있다. 상기 프로브 또는 그에 상보적인 프로브는 개체로부터 수득된 핵산과 혼성화되고 그로부터 얻어지는 혼성화 정도를 측정할 수 있는 방법에 이용되는 것일 수 있다.The probe may be used in hybridization methods such as microarray, Southern blotting, dynamic allele-specific hybridization, and DNA chip. The microarray is used in a manner known in the art, for example, a group of probes or probes immobilized on a plurality of divided regions on a substrate. The substrate can be any suitable rigid or semi-rigid support, such as a membrane, filter, chip, slide, wafer, fiber, magnetic bead or non-magnetic bead, gel, tubing, Microparticles, and capillaries. The probe or a complementary probe thereof may be used in a method capable of hybridizing with a nucleic acid obtained from an individual and measuring the hybridization degree obtained therefrom.
용어 "유전자"는 유전 정보를 결정하는 구조 단위를 의미하며, 단백질의 아미노산 서열 또는 기능 RNA(tRNA, rRNA 등)의 염기 배열을 결정하는 정보를 가지는 구조 유전자, 및/또는 구조 유전자의 발현을 제어하는 조절 유전자, 예를 들면, 프로모터, 억제자(repressor), 작동유전자(operator) 등을 포함하는 것일 수 있다. 본 명세서에서 용어 "유전자"는 유전자의 산물을 생성하기 위해 전사되는 뉴클레오티드 서열을 포함하는 단일 가닥 쪽을 의미하는 것으로 이해된다. 예를 들면 "유전자의 뉴클레오티드 서열"은 유전자의 산물을 생성하기 위해 전사되는 뉴클레오티드 서열을 포함하는 단일 가닥에 포함된 뉴클레오티드 서열 및/또는 구조 유전자의 발현을 제어하는 뉴클레오티드 서열인 것일 수 있다.The term " gene " refers to a structural unit that determines genetic information, and includes a structural gene having information for determining the base sequence of the protein's amino acid sequence or functional RNA (tRNA, rRNA, etc.), and / For example, a promoter, a repressor, an operator, and the like. As used herein, the term " gene " is understood to mean a single stranded side comprising a nucleotide sequence that is transcribed to produce a product of the gene. For example, the " nucleotide sequence of a gene " may be a nucleotide sequence that controls the expression of a nucleotide sequence and / or a structural gene contained in a single strand containing a nucleotide sequence to be transcribed to produce a product of the gene.
용어 "엑손"은 DNA 서열 중 단백질의 합성 정보를 담고 있는 영역으로, 예를 들면 발현된 단백질의 일부 또는 전부를 암호화하는 핵산 분자를 의미한다.The term " exon " refers to a region containing information on the synthesis of a protein in the DNA sequence, for example, a nucleic acid molecule encoding part or all of the expressed protein.
상기 변이는 표준 유전체 DNA에 대하여 뉴클레오티드 서열의 변이를 갖는 것일 수 있다. 상기 뉴클레오티드 서열의 변이는 표준 유전체 DNA에 대하여 하나 이상의 뉴클레오티드 서열의 치환(substitution), 삽입(insertion), 중복(duplication), 결실(deletion)(삽입 및 결실을 Insertion and Deletion: 'InDel'이라고도 함), 전좌(translocation) 등을 포함하는 것일 수 있다. 상기 하나 이상의 뉴클레오티드 서열의 치환은, 예를 들면, 단일 뉴클레오티드 변이(single nucleotide variant: SNV)인 것일 수 있다. The mutation may be one having a variation of the nucleotide sequence relative to the standard genomic DNA. The mutation of the nucleotide sequence may include one or more nucleotide sequence substitution, insertion, duplication, and deletion (insertion and deletion: also referred to as 'InDel') with respect to the standard genomic DNA, , Translocation, and the like. The substitution of the one or more nucleotide sequences may be, for example, a single nucleotide variant (SNV).
상기 변이는 상염색체 우성 변이인 것일 수 있다. 상기 변이는 TMEM43 유전자의 엑손 영역, 예를 들면, 12번째 엑손 영역의 변이인 것일 수 있다. 상기 변이는 TMEM43 유전자의 뉴클레오티드 서열에서 c.C1114T 변이인 것일 수 있다. 상기 변이는 서열번호 2의 뉴클레오티드 서열에서 c.C1114T 변이인 것일 수 있다. 상기 서열번호 2의 뉴클레오티드 서열에서 c.C1114T 변이는 서열번호 2의 뉴클레오티드서열을 포함하는 폴리뉴클레오티드에서 서열번호 2의 5' 말단으로부터 1114번째 뉴클레오티드인 시토신(C)이 티민(T)으로 치환된 변이인 것일 수 있다. The mutation may be an autosomal dominant mutation. The mutation may be a mutation of the exon region of the TMEM43 gene, for example, the 12th exon region. The mutation may be the c.C1114T mutation in the nucleotide sequence of the TMEM43 gene. The mutation may be a mutation of c.C1114T in the nucleotide sequence of SEQ ID NO: 2. The mutation c.C1114T in the nucleotide sequence of SEQ ID NO: 2 is a mutation in which the cytidine (C), which is the 1114th nucleotide from the 5 'end of SEQ ID NO: 2 in the polynucleotide including the nucleotide sequence of SEQ ID NO: 2, Lt; / RTI >
상기 변이는 TMEM43 단백질의 아미노산 서열에서 p.R372X 변이인 것일 수 있다. 상기 변이는 서열번호 1의 아미노산 서열에서 p.R372X 변이인 것일 수 있다. 상기 서열번호 1의 아미노산 서열에서 p.R372X 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드에서 서열번호 1의 N 말단으로부터 372번째 아미노산인 아르기닌(R)이 종결 코돈에 의하여 소실된 변이인 것일 수 있다.The mutation may be the p.R372X mutation in the amino acid sequence of the TMEM43 protein. The mutation may be a p.R372X mutation in the amino acid sequence of SEQ ID NO: 1. The p.R372X mutation in the amino acid sequence of SEQ ID NO: 1 is a mutation in which the arginine (R), which is the 372nd amino acid from the N terminus of SEQ ID NO: 1, is deleted by the termination codon in the polypeptide comprising the amino acid sequence of SEQ ID NO: have.
상기 TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드는, 서열번호 2의 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드에서 단일 뉴클레오티드 변이 위치인 서열번호 2의 5' 말단으로부터 1114번째 뉴클레오티드를 검출할 수 있는 폴리뉴클레오티드인 것일 수 있다. 또는, 서열번호 2의 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드에서 단일 뉴클레오티드 변이 위치인 서열번호 2의 5' 말단으로부터 1114번째 뉴클레오티드를 포함하는 폴리뉴클레오티드와 그 서열이 동일하거나 상보적인 것일 수 있다. 하나의 단일 가닥 폴리뉴클레오티드가 감각신경성 난청 질환의 발병 위험과 연관되어 있는 경우, 상기 단일 가닥 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드도 당연히 감각신경성 난청 질환의 발병 위험과 연관되어 있는 것으로 판단할 수 있다. 따라서, 상기 조성물은 하나의 특정한 뉴클레오티드 서열을 가진 감각신경성 난청 질환의 발병 위험과 연관되어 있는 단일 가닥 폴리뉴클레오티드 및/또는 그에 상보적인 뉴클레오티드 서열을 가진 폴리뉴클레오티드를 포함하는 것일 수 있다.A polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting the TMEM43 mutation is a polynucleotide comprising a single nucleotide sequence at the polynucleotide comprising the nucleotide sequence of SEQ ID NO: Or a polynucleotide capable of detecting the 1114th nucleotide from the 5'end of SEQ ID NO: 2. Alternatively, the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 may be the same or complementary to the polynucleotide comprising the 5'-end to the 1114-th nucleotide of SEQ ID NO: 2, which is a single nucleotide mutation position. If one single-stranded polynucleotide is associated with the risk of developing a sensory neural deafness disorder, the polynucleotide complementary to the single-stranded polynucleotide may naturally be associated with the risk of developing a sensory neural deafness disorder. Thus, the composition may comprise a single-stranded polynucleotide and / or a polynucleotide having a nucleotide sequence complementary thereto, which is associated with the risk of developing a sensory neural deafness disorder with one particular nucleotide sequence.
다른 양상은 TMEM43 변이를 검출하기 위하여 TMEM43의 일부 아미노산이 소실된 폴리펩티드를 특이적으로 검출하기 위한 폴리펩티드를 포함하는 감각신경성 난청 질환의 진단용 조성물을 제공한다. Another aspect provides a composition for the diagnosis of sensory neuron deafness disorder comprising a polypeptide for specifically detecting a polypeptide in which some amino acids of TMEM43 have been lost to detect TMEM43 mutation.
상기 조성물은 TMEM43 단백질에서 아미노산 결실 위치를 검출할 수 있는 폴리펩티드를 포함하는 것일 수 있다. 상기 조성물은 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드에서 아미노산 결실 위치인 상기 서열번호 1의 N 말단으로부터 372번째 아미노산을 검출할 수 있는 폴리펩티드를 포함하는 것일 수 있다. The composition may include a polypeptide capable of detecting the amino acid deletion position in the TMEM43 protein. The composition may include a polypeptide capable of detecting the 372nd amino acid from the N-terminus of SEQ ID NO: 1, which is an amino acid deletion position in a polypeptide comprising the amino acid sequence of SEQ ID NO: 1.
아미노산 변이는 넌센스 변이(nonsense mutation) 변이에 의한 것일 수 있다. 넌센스 변이는 하나 이상의 뉴클레오티드가 바뀌어 종결코돈이 됨으로써, 아미노산을 더이상 생성하지 않는 변경을 의미한다. Amino acid mutations may be due to nonsense mutation mutations. A nonsense mutation refers to a change in which one or more nucleotides are changed to termination codons, thereby no longer producing amino acids.
상기 폴리펩티드는 상기 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드에서 아미노산 종결 및 소실되는 위치인 상기 서열번호 1의 N 말단으로부터 372번째 아미노산과 특이적으로 결합하는 것일 수 있다. 상기 372번째 아미노산은 서열번호 2의 5' 말단으로부터 1114번째 뉴클레오티드를 포함하는 폴리뉴클레오티드를 암호화한 것 일 수 있고, 상기 폴리펩티드는 서열번호 2의 5' 말단으로부터 1114번째 뉴클레오티드인 C가 T로 치환되어 생성된 아미노산 서열을 검출할 수 있는 것일 수 있다. The polypeptide may specifically bind to the 372nd amino acid from the N-terminus of SEQ ID NO: 1, which is the position at which the amino acid terminates and disappears in the polypeptide comprising the amino acid sequence of SEQ ID NO: 1. The 372nd amino acid may be a polynucleotide encoding the 1114th nucleotide from the 5'end of SEQ ID NO: 2, and the polypeptide may be a polynucleotide encoding the nucleotide 1114th from the 5'end of SEQ ID NO: 2, And may be one capable of detecting the resulting amino acid sequence.
상기 폴리펩티드는 항체 또는 항원 결합 단편인 것일 수 있고, 단수개 또는 복수개인 것일 수 있다. 항체는 전체 항체 형태일 뿐 아니라 항체 분자의 기능적인 단편을 포함하는 것일 수 있다. 전체 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조이며 각각의 경쇄는 중쇄와 다이설파이드 결합으로 연결되어 있다. 항체 분자의 기능적인 단편이란 항원 결합 기능을 보유하고 있는 단편을 의미한다.The polypeptide may be an antibody or an antigen-binding fragment, and may be singular or plural. The antibody may be one which is not only an entire antibody form but also contains a functional fragment of an antibody molecule. The whole antibody is a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond. A functional fragment of an antibody molecule means a fragment having an antigen-binding function.
상기 폴리펩티드는 면역세포화학 및 면역조직화학, 방사선 면역분석법(radio immunoassays), 효소 결합 면역분석법(Enzyme Linked Immunoabsorbent assay: ELISA), 면역블롯(immunoblotting), 파아르 분석법(Farr assay), 면역침강, 라텍스 응집, 적혈구 응집, 비탁계법, 면역확산법, 카운터-전류 전기영동법, 단일 라디칼 면역확산법, 면역크로마토그래피법, 단백질 칩 및 면역형광법 등을 이용한 방법에 이용되는 것일 수 있다. 즉 항원과 항체의 결합을 측정할 수 있는 방법에 이용될 수 있다. The polypeptide may be prepared by immunocytochemistry and immunohistochemistry, radioimmunoassays, enzyme linked immunoabsorbent assay (ELISA), immunoblotting, Farr assay, immunoprecipitation, Aggregation, erythrocyte aggregation, an ascending method, an immunodiffusion method, a counter-current electrophoresis method, a single radical immunodiffusion method, an immunochromatography method, a protein chip and an immunofluorescence method. That is, a method capable of measuring the binding of an antigen to an antibody.
다른 양상은 TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 감각신경성 난청 질환의 진단용 키트를 제공한다. 상기 키트는 서열번호 2의 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드에서 단일 뉴클레오티드 변이 위치인 서열번호 2의 5' 말단으로부터 1114번째 뉴클레오티드를 검출할 수 있는 폴리뉴클레오티드를 포함하는 것일 수 있다. 또는, 서열번호 2의 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드에서 단일 뉴클레오티드 변이 위치인 서열번호 2의 5' 말단으로부터 1114번째 뉴클레오티드를 포함하는 폴리뉴클레오티드와 그 서열이 동일하거나 상보적인 폴리뉴클레오티드를 포함하는 것일 수 있다.Another aspect provides a diagnostic kit for a sensory neuron deafness disorder comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting the TMEM43 mutation. The kit may comprise a polynucleotide capable of detecting the 1114th nucleotide from the 5'end of SEQ ID NO: 2, which is a single nucleotide mutation position in a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2. Or a polynucleotide having the same or complementary sequence as the polynucleotide comprising the 5'-end to the 1114-th nucleotide of SEQ ID NO: 2, which is a single nucleotide mutation position in the polynucleotide including the nucleotide sequence of SEQ ID NO: 2 have.
상기 키트는, 예를 들면, 상기 폴리뉴클레오티드와 그의 특정 용도에 필요한 구성들을 포함하는 것일 수 있다. 상기 폴리뉴클레오티드와 함께 그의 사용 방법에 필요한 시약을 포함하는 것일 수 있다. 상기 키트는 상기 폴리뉴클레오티드가 핵산과 혼성화하는데 요구되는 알려진 물질을 더 포함하는 것일 수 있다. 상기 키트는 표적 영역의 뉴클레오티드 서열을 특이적으로 증폭하고, 증폭 산물의 존재 유무를 통하여, 개체의 감각신경성 난청 질환을 진단하기 위한 키트인 것일 수 있다. 또는 상기 폴리뉴클레오티드 또는 그로부터 유래된 프로브를 시료 중의 핵산과 혼성화시키고, 그 혼성화 결과로부터 개체의 감각신경성 난청 질환의 발병 위험을 진단하기 위한 키트일 수 있다. 예를 들면, 상기 핵산의 혼성화에 필요한 시약, 버퍼, 버퍼, 보조인자, 및/또는 기질을 더 포함하는 것일 수 있다. 또한 상기 키트가 PCR 증폭 과정에 적용되는 경우 선택적으로, PCR 증폭에 필요한 시약, 예를 들면, 완충액, DNA 중합효소, DNA 중합효소보조인자 및 dNTPs를 포함하는 것일 수 있다. 또한, 상기 키트는 표적 영역을 증폭하기 위하여 사용하기 위한 설명서를 더 포함할 수 있으며, 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다. 상기 사용 설명서는 예를 들면, 상기 특이적 프라이머를 사용한 증폭 반응에서 표적 영역이 증폭되고, 상기 비특이적 프라이머를 사용한 증폭 반응에서 표적 영역이 증폭되지 않는 경우, 증폭에 사용된 시료 중에서 감각신경성 난청 질환과 연관된 표적 영역 또는 변이가 존재하는 것으로 결정하고, 그 결과로부터 개체의 감각신경성 난청 질환의 발병 위험을 결정하는 것에 대한 설명을 포함한, 결과 판정에 대한 설명을 포함하는 것일 수 있다.The kit may, for example, comprise the polynucleotide and the constructs necessary for its particular use. And the reagent necessary for the method of use thereof together with the polynucleotide. The kit may further comprise a known material required for hybridization of the polynucleotide with the nucleic acid. The kit may be a kit for specifically amplifying the nucleotide sequence of the target region and diagnosing the sensory neuron deafness disorder of the individual through the presence or absence of the amplification product. Or a kit for hybridizing the polynucleotide or a probe derived therefrom with a nucleic acid in a sample and diagnosing the risk of developing an individual's sensory neural deafness disorder from the hybridization result. For example, it may further comprise a reagent, buffer, buffer, cofactor, and / or substrate necessary for hybridization of the nucleic acid. In addition, when the kit is applied to the PCR amplification process, it may optionally contain a reagent necessary for PCR amplification, for example, a buffer, a DNA polymerase, a DNA polymerase cofactor, and dNTPs. In addition, the kit may further include instructions for use to amplify the target region, and may be produced from a number of separate packaging or compartments containing the reagent components described above. For example, in the case where the target region is amplified in the amplification reaction using the specific primer and the target region is not amplified in the amplification reaction using the non-specific primer, May include an explanation of the result determination, including an explanation of determining that an associated target region or variation is present and determining the risk of developing the sensory neural deafness disorder of the subject from the result.
상기 폴리뉴클레오티드 및 변이에 대하여는 전술한 바와 같다.The above polynucleotides and mutations are as described above.
다른 양상은 TMEM43 변이를 검출하기 위하여 TMEM43의 일부 아미노산이 소실된 폴리펩티드를 특이적으로 검출하기 위한 폴리펩티드를 포함하는 감각신경성 난청 질환의 진단용 키트를 제공한다. Another aspect provides a diagnostic kit for a sensory neuron deafness disorder comprising a polypeptide for specifically detecting a polypeptide in which some amino acids of TMEM43 have been deleted to detect the TMEM43 mutation.
상기 키트는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드 또는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드에서 372번째 아미노산이 소실된 폴리펩티드의 발현 수준을 측정하기 위한, 폴리펩티드의 분석 방법에 적합한 하나 또는 그 이상의 다른 구성 성분 또는 장치가 포함되는 것일 수 있다. 상기 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 발현 수준을 측정하는 것은 유전자에서 발현되는 폴리펩티드 또는 단백질의 존재 여부와 발현 정도를 확인하는 과정으로서, 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드와 특이적으로 결합하는 폴리펩티드를 이용하여 유전자의 발현양 또는 단백질의 양을 확인할 수 있다. 상기 키트가 면역 분석에 적용되는 경우, 선택적으로, 이차 항체 및 표지의 기질을 포함하는 것일 수 있다. Said kit comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, one or more of which is suitable for the method of assaying a polypeptide for determining the level of expression of the 372nd amino acid- Other components or devices may be included. The expression level of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 is determined by measuring the presence and the expression level of the polypeptide or protein expressed in the gene and comparing the expression level of the polypeptide comprising the amino acid sequence of SEQ ID NO: Can be used to confirm the expression level of the gene or the amount of the protein. If the kit is applied to immunoassay, it may optionally comprise a secondary antibody and a labeling substrate.
상기 폴리펩티드 및 변이에 대하여는 전술한 바와 같다.The above polypeptides and mutations are as described above.
다른 양상은 TMEM43의 p.R372X 변이를 암호화하는 뉴클레오티드 서열로 이루어진 폴리뉴클레오티드를 포함하는 벡터를 제공한다. 상기 벡터는 서열번호 1의 아미노산 서열에서 p.R372X 변이를 암호화하는 뉴클레오티드 서열로 이루어진 폴리뉴클레오티드를 포함하는 것일 수 있다. 벡터는 폴리뉴클레오티드의 운반체를 의미한다. 상기 폴리뉴클레오티드는 적합한 발현 시스템인 벡터, 예를 들면, 발현 벡터 내에 존재하는 것일 수 있다. 상기 벡터에서, 서열번호 1의 아미노산 서열에서 p.R372X 변이를 암호화하는 뉴클레오티드 서열로 이루어진 폴리뉴클레오티드는 프로모터에 동작 가능하게 연결되어 있는 것일 수 있다. 용어 "동작 가능하게 연결된"은 핵산 발현 조절 서열, 예를 들면, 프로모터, 시그널 서열, 또는 전사 조절인자 결합 위치의 어레이와 다른 핵산 서열 사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다. 상기 발현 벡터에서 이용 가능한 프로모터는 동물세포, 예를 들면, 포유동물세포에서 작동하여 뉴클레오티드 서열의 전사를 조절할 수 있는 것으로서, 포유동물 바이러스로부터 유래된 프로모터 및/또는 포유동물 세포의 유전체로부터 유래된 프로모터를 포함하는 것일 수 있다. 예를 들면, 사이토메갈로 바이러스 프로모터(cytomegalo virus: CMV) 프로모터, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, HSV의 tk 프로모터, RSV 프로모터, EF1 알파 프로모터, 메탈로티오닌 프로모터, 또는 베타-액틴 프로모터인 것일 수 있다. 상기 벡터는 이용 가능한 폴리아데닐화 서열을 포함하는 것일 수 있다. 상기 벡터에서 백본은 상기 폴리뉴클레오티드의 발현에 적합한 다양한 벡터로부터 필요에 따라 선택된 것일 수 있다. 예를 들면, pCMV6-Entry, pHY92 벡터, pRC CMV 벡터, pIRES2-EGFP 벡터, SV40 벡터, 파필로마 바이러스 벡터, YIp5 벡터, YCpl9 벡터, 엡스테인-바 바이러스 벡터, pMSG 벡터, pMAMneo-5 벡터, 배큘로바이러스 pDSVE 벡터, pSecTag2B 벡터 또는 yT&A 벡터인 것일 수 있다. 예를 들면, pCMV6-Entry 벡터에 삽입되어 있는 TMEM43의 p.R372X 변이를 암호화하는 뉴클레오티드 서열로 이루어진 폴리뉴클레오티드는 위치 지향 돌연변이와 중합효소 연쇄 반응과 같은 당해 기술분야에 공지된 방법으로 제작되는 것일 수 있다. Another aspect provides a vector comprising a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation of TMEM43. The vector may comprise a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation in the amino acid sequence of SEQ ID NO: The vector means the carrier of the polynucleotide. The polynucleotide may be in a vector that is a suitable expression system, for example, an expression vector. In this vector, a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation in the amino acid sequence of SEQ ID NO: 1 may be operably linked to a promoter. The term " operably linked " means a functional linkage between an array of nucleic acid expression control sequences, for example, an array of promoter, signal sequence, or transcription factor binding sites and other nucleic acid sequences, Regulate transcription and / or translation of other nucleic acid sequences. Promoters that can be used in the expression vector are those capable of regulating the transcription of the nucleotide sequence by working in an animal cell such as a mammalian cell, such as a promoter derived from a mammalian virus and / or a promoter derived from the genome of a mammalian cell . ≪ / RTI > For example, cytomegalo virus (CMV) promoter, late adenovirus promoter, vaccinia virus 7.5K promoter, SV40 promoter, HSV tk promoter, RSV promoter, EF1 alpha promoter, metallothionein promoter, or Beta-actin promoter. The vector may comprise an available polyadenylation sequence. In this vector, the backbone may be selected as necessary from various vectors suitable for expression of the polynucleotide. For example, pCMV6-Entry, pHY92 vector, pRC CMV vector, pIRES2-EGFP vector, SV40 vector, papilomavirus vector, YIp5 vector, YCpl9 vector, Absteinvear virus vector, pMSG vector, pMAMneo- , PSECTag2B vector, or yT & A vector. For example, a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation of TMEM43 inserted in the pCMV6-Entry vector may be produced by methods known in the art, such as position directed mutagenesis and polymerase chain reaction have.
다른 양상은 TMEM43 변이를 포함하는 감각신경성 난청 질환 모델을 제공한다.Another aspect provides a sensory neural deafness disorder model comprising TMEM43 mutations.
상기 모델은 TMEM43 변이를 갖는 형질전환체인 것일 수 있다. The model may be a transformation having a TMEM43 mutation.
용어 "형질전환체"는 하나 이상의 목적 단백질을 암호화하는 유전자가 도입된 형질전환된 세포 또는 형질전환된 동물을 의미한다. 상기 형질전환된 동물은 p.R372X 변이를 갖는 TMEM43를 지속적으로 발현하는 동물을 의미한다. 상기 형질전환된 동물은 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열의 변이를 포함하는 것일 수 있다. 상기 형질전환된 동물은 TMEM43 유전자의 뉴클레오티드 서열에서 c.C1114T 변이를 포함하는 것일 수 있다.The term " transformant " means a transformed cell or a transformed animal into which a gene encoding one or more desired proteins has been introduced. The transformed animal refers to an animal that continuously expresses TMEM43 having the p.R372X mutation. The transformed animal may comprise a mutation of the nucleotide sequence of the exon region of the TMEM43 gene. The transformed animal may be one which comprises the c.C1114T mutation in the nucleotide sequence of the TMEM43 gene.
상기 형질전환된 동물은 p.R372X 변이를 갖는 TMEM43를 암호화하는 동물의 유전자를 수정란에 주입하여 동물의 염색체 내로 통합되어 p.R372X 변이를 갖는 TMEM43를 지속적으로 발현하는 동물인 것일 수 있다. 상기 p.R372X 변이를 갖는 TMEM43를 암호화하는 유전자는 형질전환된 동물의 체세포 또는 생식세포, 또는 체세포 및 생식세포의 유전체에 삽입된 것일 수 있다. 상기 형질전환된 동물은 상기 벡터를 수정난 또는 배아줄기세포(Embryonic Stem Cell, ES 세포)에 미세주입법(Capecchi, M.R., Cell, 22:479(1980)), 칼슘 포스페이트 침전법(Graham, F.L. et al., Virology, 52:456(1973)), 전기천공법(Neumann, E. et al., EMBO J., 1:841(1982)), 리포좀-매개 형질감염법(Wong, T.K. et al., Gene, 10:87(1980)), DEAE-덱스트란 처리법(Gopal, Mol. Cell Biol., 5:1188-1190(1985)), 레트로바이러스 감염(retroviral infection) 및 유전자 밤바드먼트(Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572(1990)) 등의 방법으로 전달하여 제작되는 것일 수 있다. The transformed animal may be an animal that constantly expresses TMEM43 with the p.R372X mutation integrated into the animal's chromosome by injecting the animal's gene encoding the TMEM43 with the p.R372X mutation into the embryo. The gene coding for the TMEM43 having the p.R372X mutation may be a somatic cell or a germ cell of a transformed animal, or a genome of a somatic cell and a germ cell. The transformed animal can be obtained by microinjecting the vector into fertilized or embryonic stem cells (ES cells) (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et et al., EMBO J., 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., et al., Virology, 52: 456 (1973) , Gene, 10: 87 (1980)), DEAE-dextran treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 (1985)), retroviral infection and gene bend al., Proc. Natl. Acad. Sci., 87: 9568-9572 (1990)).
상기 형질전환된 동물은 유전자 가위 (programmable nuclease), 예를 들면, 징크 핑거 뉴클레아제 (zinc finger nuclease : ZFN), TALEN (transcriptional activator-like effector nuclease), CRISPR/ Cas, 또는 CRISPR/ Cpf1 등의 방법으로 전달하여 제작되는 것일 수 있다. 상기 형질전환된 동물은 상기 TMEM43의 p.R372X 변이를 암호화하는 뉴클레오티드 서열로 이루어진 폴리뉴클레오티드를 수정란 또는 배아줄기세포에 전달하는 단계에 이어, 가임신된 동물을 준비하는 단계, 상기 수정란을 가임신된 동물의 자궁에 이식하는 단계, 상기 수정란이 새끼로 태어나도록 동물을 기르는 단계, 자손을 수득하여 TMEM43의 p.R372X 변이의 발현 여부를 선별하는 단계를 수행하여 수득할 수 있다. 상기 형질전환된 동물은 인간을 제외한 다양한 포유류를 포함하며, 이에 제한되는 것인 아니나, 마우스, 래트, 소, 말, 돼지, 양, 염소, 개, 고양이 등일 수 있다.The transgenic animal may be transiently transfected with a nucleic acid encoding a nucleic acid encoding a nucleic acid encoding a nucleic acid encoding a nucleic acid encoding a nucleic acid molecule selected from the group consisting of programmable nuclease such as zinc finger nuclease (ZFN), transcriptional activator-like effector nuclease (TALEN), CRISPR / Cas, or CRISPR / And the like. The transformed animal is further provided with a step of delivering a polynucleotide consisting of a nucleotide sequence encoding the p.R372X mutation of the TMEM43 to a fertilized egg or embryonic stem cell followed by preparing a fertilized animal, Transplanting into the uterus of an animal, raising the animal so that the embryo is born as a baby, obtaining offspring to select whether expression of the p.R372X mutation of TMEM43 is to be performed. The transformed animal may be a mouse, rat, cow, horse, pig, sheep, goat, dog, cat, or the like, including but not limited to various mammals other than humans.
상기 형질전환된 세포는 p.R372X 변이를 갖는 TMEM43를 지속적으로 발현하는 세포를 의미한다. 상기 세포는 체세포 또는 생식세포, 또는 체세포 및 생식세포인 것일 수 있다. 상기 형질전환된 세포는 상기 벡터를 세포 내로 도입하기 위한 공지의 방법을 이용할 수 있으며, 당해 기술 분야에서 공지된 바와 같이 적합한 표준 기술, 예들 들면, 미세주입법, 칼슘 포스페이트 침전법, 전기천공법, 리포좀-매개 형질감염법, DEAE-덱스트란 처리법, 레트로바이러스 감염 및 유전자 밤바드먼트 등을 이용할 수 있으며, 이로 제한되지 않는다. 이 때 원형의 벡터를 적절한 제한효소로 절단하여 선형의 벡터 형태로 도입할 수 있다.The transformed cell refers to a cell that continuously expresses TMEM43 having the p.R372X mutation. The cells may be somatic cells or germ cells, or somatic cells and germ cells. The transfected cells may be prepared by a known method for introducing the vector into cells, and may be prepared by a suitable standard technique, for example, microinjection, calcium phosphate precipitation, electroporation, liposome -Mediated transfection, DEAE-dextran treatment, retroviral infection, and gene bombardment, and the like. At this time, the vector of circular form can be introduced into a linear vector form by cutting with appropriate restriction enzymes.
상기 형질전환체는 p.R372X 변이를 갖는 TMEM43를 지속적으로 발현하므로, 감각신경성 난청 치료제 또는 치료 방법을 스크리닝하는데 이용되는 것일 수 있다. 상기 감각신경성 난청 치료제를 스크리닝하는 것은, p.R372X 변이를 갖는 TMEM43를 지속적으로 발현하는 형질전환체에 분석하고자 하는 시험 물질을 가하는 단계, 상기 형질전환체에서 감각신경성 난청의 치료 또는 경감 정도를 분석 및 평가하는 단계를 포함하는 것일 수 있다. 형질전환된 세포 또는 형질전환된 동물에 분석하고자 하는 시험 물질을 가하는 것은, 통상의 기술자에게 공지된 다양한 방법으로 실시할 수 있다. Since the transformant continuously expresses the TMEM43 having the p.R372X mutation, it may be one used for screening a therapeutic agent for hearing loss or a therapeutic method. Screening for the therapeutic agent for sensory neural damage is performed by adding a test substance to be analyzed to a transformant that continuously expresses TMEM43 having a p.R372X mutation, and further comprising the step of analyzing the degree of treatment or alleviation of sensory nerve impairment in the transformant And evaluating the quality of the image. The addition of the test substance to be analyzed to the transformed cells or the transformed animal can be carried out by various methods known to those of ordinary skill in the art.
다른 양상은 개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계; 및 상기 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계를 포함하는 감각신경성 난청 질환의 진단에 관한 정보를 제공하기 위하여 유전체 DNA의 변이를 검출하는 방법을 제공한다. Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the confirmed nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA. A method for detecting the mutation of the genomic DNA to provide information on the diagnosis of the sensory neuron deafness disorder .
상기 방법은 개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계를 포함한다.The method comprises identifying the nucleotide sequence of the genomic DNA isolated from the subject.
상기 개체는 감각신경성 난청 질환의 발병 위험을 예측하기 위한 대상을 의미한다. 상기 개체는 감각신경성 난청 질환이 발병하거나 또는 발병한 것으로 의심되는 대상인 것일 수 있다. 상기 개체는 척추동물, 포유동물, 인간(Homo sapiens), 마우스, 래트, 소, 말, 돼지, 양, 염소, 개, 고양이 등을 포함하는 것일 수 있다. 예를 들면, 상기 인간은 아시아계 인, 또는 한국인일 수 있다. "개체" 및 "환자"는 본 명세서에서 상호교환적으로 사용된다.The subject refers to an object for predicting the risk of developing sensory neural deafness. The subject may be a subject suspected of having or developing a sensory neural deafness disorder. The subject may be a vertebrate animal, a mammal, a human ( Homo sapiens ), a mouse, a rat, a cow, a horse, a pig, a sheep, a goat, a dog, a cat and the like. For example, the human being may be Asian or Korean. &Quot; Subject " and " patient " are used interchangeably herein.
상기 방법에서 개체로부터 분리된 유전체 DNA는 생물학적 시료로부터 분리된 유전체 DNA 또는 그의 단편일 수 있다. 상기 생물학적 시료는 혈액, 조직, 소변, 점액, 타액, 눈물, 혈장, 혈청, 객담, 척수액, 흉수, 유두 흡인물, 림프액, 기도액, 장액, 비뇨생식관액, 모유, 림프계 체액, 정액, 뇌척수액, 기관계내 체액, 복수, 낭성 종양 체액, 양수액 또는 이들의 조합인 것일 수 있다. 생물학적 시료는 순수하게 분리된 핵산, 조 분리된 핵산, 핵산을 포함하는 세포 파쇄물, 또는 세포 유리 핵산을 포함하는 것일 수 있다. 생물학적 시료로부터 유전체 DNA를 분리하는 방법은 통상의 핵산 분리 방법에 의하여 수행될 수 있다. The genomic DNA isolated from an individual in the method may be a genomic DNA isolated from a biological sample or a fragment thereof. The biological sample may be a blood sample, tissue, urine, mucus, saliva, tear, plasma, serum, sputum, spinal fluid, pleural effusion, aspiration nipple, lymphatic fluid, airway fluid, Intracranial fluid, ascites fluid, cystic tumor fluid, positive fluid, or a combination thereof. The biological sample may be one comprising a purely isolated nucleic acid, a crude nucleic acid, a cell lysate comprising a nucleic acid, or a cell free nucleic acid. The method of separating the genomic DNA from the biological sample can be performed by a conventional nucleic acid separation method.
상기 방법에서 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계는 염색체 내 표적 영역 또는 각 위치에서의 뉴클레오티드를 결정하는 것을 의미한다. 예를 들면, 알려진 핵산의 뉴클레오티드 시퀀싱 방법(sequencing method)에 의하여 염색체 내 표적 영역 또는 각 위치에서의 뉴클레오티드를 직접적으로 결정할 수 있다. 뉴클레오티드 서열 결정 방법은 생거(또는 디데옥시) 시퀀싱 방법 또는 막삼-길버트(화학 절단) 방법을 포함하는 것일 수 있다. 또한, 프로브를 대상 폴리뉴클레오티드와 혼성화시키고, 혼성화 결과를 분석함으로써, 표적 영역의 뉴클레오티드 서열을 결정할 수 있다. 혼성화 정도는 예를 들면, 검출 가능한 표지를 대상 핵산에 표지하고, 혼성화된 대상 핵산을 검출함으로써 확인되거나, 전기적 방법 등에 의하여 확인될 수 있다. 또한, 단일 염기 연장(single base primer extension: SBE) 방법이 이용될 수 있다. 뉴클레오티드 서열 결정 방법은 또한, 차세대 염기 시퀀싱을 포함하는 것일 수 있다. 용어 "차세대 염기시퀀싱(next generation sequencing: NGS)은 칩(Chip)기반 그리고 PCR 기반 쌍-말단(paired end) 형식으로 전장 유전체를 조각내고, 상기 조각을 화학적인 반응(hybridization)에 기초하여 초고속으로 시퀀싱을 수행하는 기술을 의미한다. 차세대 염기시퀀싱에 의해 짧은 시간 내에 분석 대상이 되는 시료에 대해 대량의 염기서열 데이터를 생성할 수 있다.Identifying the nucleotide sequence of the genomic DNA in the above method means determining the nucleotide at the target region or each position in the chromosome. For example, the nucleotide sequencing method of a known nucleic acid can directly determine the nucleotide at the target region or at each position in the chromosome. The nucleotide sequence determination method may include a ginger (or dideoxy) sequencing method or a germ-gilbert (chemical cleavage) method. In addition, the nucleotide sequence of the target region can be determined by hybridizing the probe with the polynucleotide of interest and analyzing the result of hybridization. The degree of hybridization can be confirmed, for example, by marking a detectable label on the target nucleic acid, detecting the hybridized target nucleic acid, or confirming it by an electrical method or the like. In addition, a single base primer extension (SBE) method can be used. The nucleotide sequence determination method may also include the next generation base sequencing. The term " next generation sequencing " (NGS) involves fragmenting a full-length genome in a chip-based and PCR-based paired end format, Sequencing. By next-generation nucleotide sequencing, a large amount of nucleotide sequence data can be generated for a sample to be analyzed within a short time.
상기 방법은 분리된 유전체 DNA를 임의의 크기로 단편화(fragmentation)하는 단계를 포함하는 것일 수 있다. 상기 단편화는 통상의 기술자에게 알려져 있는 방법에 의해 수행될 수 있다. 예를 들면, 초음파의 사용에 의해 유전체 DNA를 단편화할 수 있다. 상기 방법은 상기 유전체 DNA를 단편화한 후, 단편화된 유전체 DNA의 양 말단에 증폭을 위한 서열을 리게이션(ligation)시키는 단계를 포함하는 것일 수 있다. 상기 증폭을 위한 서열, 예를 들면, 쌍-말단 태그(paired-end tag), 유니버설 태그(universal tag) 등의 리게이션 방법은 통상의 기술자가 적절히 선택하여 수행할 수 있다.The method may include fragmenting the isolated genomic DNA to an arbitrary size. Such fragmentation can be performed by methods known to those of ordinary skill in the art. For example, genomic DNA can be fragmented by using ultrasonic waves. The method may include fragmenting the genomic DNA, and ligation of sequences for amplification at both ends of the fragmented genomic DNA. A sequence for the amplification, for example, a paired-end tag, a universal tag, or the like can be appropriately selected and performed by a person skilled in the art.
상기 방법은 분리된 유전체 DNA와 상기 조성물 중의 상기 폴리뉴클레오티드의 혼성화 산물을 얻는 단계를 포함하는 것일 수 있다. 상기 방법은 상기 조성물 중에 포함된 폴리뉴클레오티드와 상기 폴리뉴클레오티드가 표적으로 하는 표적 영역의 뉴클레오티드 서열을 갖는 유전체 DNA의 단편의 혼성화 산물을 얻는 것일 수 있다. 상기 혼성화는 상기 조성물을 분리된 유전체 DNA과 접촉시킴으로써 달성될 수 있다. 상기 혼성화는 알려진 방법에 의해 수행될 수 있다. 예를 들면, 핵산의 혼성화에 적절한 것으로 알려진 버퍼 중에서 상기 폴리뉴클레오티드와 분리된 유전체 DNA를 인큐베이션함으로써 수행될 수 있다. 혼성화는 적절한 온도에서 수행될 수 있다. 혼성화에 적절한 온도는 예를 들면, 약 40℃ 내지 약 80℃, 약 50℃ 내지 약 75℃, 약 60℃ 내지 약 70℃, 또는 약 62℃ 내지 약 67℃인 것일 수 있다. 또한, 혼성화 온도는 이에 제한되지 않고, 상기 조성물 중에 포함된 폴리뉴클레오티드의 뉴클레오티드 서열 및 길이에 따라 적절하게 선택될 수 있다. 혼성화 시간은 예를 들면, 1 시간 내지 12시간(밤새) 동안일 수 있다. The method may comprise obtaining a separated genomic DNA and a hybridization product of the polynucleotide in the composition. The method may be to obtain a hybridization product of a polynucleotide contained in the composition and a fragment of a genomic DNA having a nucleotide sequence of a target region targeted by the polynucleotide. The hybridization can be accomplished by contacting the composition with isolated genomic DNA. The hybridization can be carried out by known methods. For example, by incubating the genomic DNA isolated from the polynucleotide in a buffer known to be appropriate for the hybridization of the nucleic acid. Hybridization can be performed at an appropriate temperature. Suitable temperatures for hybridization may be, for example, from about 40 째 C to about 80 째 C, from about 50 째 C to about 75 째 C, from about 60 째 C to about 70 째 C, or from about 62 째 C to about 67 째 C. In addition, the hybridization temperature is not limited thereto, and can be appropriately selected according to the nucleotide sequence and the length of the polynucleotide contained in the composition. The hybridization time can be, for example, from 1 hour to 12 hours (overnight).
상기 방법은 분리된 유전체 DNA와 상기 조성물 중의 상기 폴리뉴클레오티드의 혼성화 산물을 얻는 단계 후, 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계 전에, 상기 분리된 유전체 DNA와 상기 폴리뉴클레오티드의 혼성화 산물을 분리하는 단계를 포함하는 것일 수 있다. 상기 분리는 폴리뉴클레오티드에 부착된 분리 또는 정제를 위한 모이어티를 이용하는 것일 수 있다. 상기 분리 또는 정제는 모이어티에 특이적으로 결합하는 물질 또는 자기장에 의해 이루어질 수 있다.The method may further include, after obtaining the hybridization product of the separated genomic DNA and the polynucleotide in the composition, separating the separated genomic DNA and the hybridization product of the polynucleotide before identifying the nucleotide sequence of the separated genomic DNA Step < / RTI > The separation may be by using a moiety for separation or purification attached to the polynucleotide. The separation or purification may be carried out by a substance or a magnetic field that specifically binds to the moiety.
상기 방법은 상기 분리된 혼성화 산물 또는 분리된 유전체 DNA를 주형으로 하고, 상기 주형의 양 말단에 증폭을 위한 서열을 리게이션하고, 상기 증폭을 위한 서열에 상보적인 유니버설 프라이머(universal primer)를 프라이머로서 사용하여 PCR하여, 상기 분리된 혼성화 산물 또는 분리된 유전체 DNA를 증폭하는 단계를 포함하는 것일 수 있다. 상기 증폭된 산물을 이용하여 뉴클레오티드 서열을 확인할 수 있다.The method comprises using the isolated hybridized product or separated genomic DNA as a template, sequencing amplification sequences at both ends of the template, and using a universal primer complementary to the sequence for amplification as a primer And amplifying the isolated hybridized product or the separated genomic DNA by PCR using the hybridization product. The amplified product can be used to confirm the nucleotide sequence.
상기 방법은 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계를 포함한다. 용어 "표준 뉴클레오티드 서열(reference neucleotide sequence)"은 변이 확인을 위해 참조가 되는, 변이를 포함하지 않는 인간 유전체 서열인 것일 수 있다. 표준 뉴클레오티드 서열은, 참조 유전체의 뉴클레오티드 서열, 예를 들면, 미국 국립보건원 산하 생물공학정보연구소의 데이터베이스에 게시된 인간 유전자의 뉴클레오티드 서열, 구체적으로, NCBI37.1 또는 UCSC hg19(GRCh37)인 것일 수 있다. 상기 유전체 DNA의 뉴클레오티드 서열과 표준 뉴클레오티드 서열 간의 비교는 공지된 다양한 서열 비교 분석프로그램, 예를 들면 Maq, Bowtie, SOAP, GSNAP 등을 이용하여 수행할 수 있다.The method comprises comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the variation of the genomic DNA. The term " reference neucleotide sequence " may be a human genomic sequence that does not contain a mutation that is referenced for mutation confirmation. The standard nucleotide sequence may be the nucleotide sequence of the reference genome, for example, the nucleotide sequence of a human gene, specifically NCBI37.1 or UCSC hg19 (GRCh37), published in the database of the Institute of Biotechnology Information, . The comparison between the nucleotide sequence of the genomic DNA and the standard nucleotide sequence can be performed using various known sequence comparative analysis programs such as Maq, Bowtie, SOAP and GSNAP.
상기 방법은 상기 유전체 DNA의 변이가 확인된 경우, 상기 개체를 감각신경성 난청 질환 발병의 확률이 높은 위험군에 속하는 것으로 결정하는 단계를 포함하는 것일 수 있다. 즉, 개체가 감각신경성 난청 질환을 갖는 것으로 진단할 수 있다. 상기 위험군은 표준 뉴클레오티드 서열을 갖고 있는 군 또는 정상인 군에 비하여 감각신경성 난청 질환 발병의 확률이 증가되어 있는 것으로 예측 또는 진단된 군을 의미한다. The method may further comprise, when the mutation of the genomic DNA is confirmed, determining that the subject belongs to a high-risk group having a sensory neural deafness disorder. That is, the individual can be diagnosed as having sensory neural deafness. The risk group refers to a group predicted or diagnosed as having an increased probability of developing a sensory neural deafness disorder compared to a group having a standard nucleotide sequence or a normal group.
상기 변이에 대하여는 전술한 바와 같다. The above variation is as described above.
다른 양상은 TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 조성물을 제공한다. Another aspect is the use of a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene to detect a TMEM43 mutation, or a polynucleotide comprising its complementary polynucleotide, ≪ / RTI >
상기 감각신경성 난청 환자의 와우 이식수술에 대한 예후는 예측하는 것은, 와우 이식수술 시 말소리를 이해할 수 있을 것인지 또는 와우 이식수술 후에 말소리를 더 잘 이해할 수 있을 것인지 예측하는 것을 의미한다. 예를 들면, 청성뇌간반응이 정상적으로 나타나게 될 것인지를 예측하는 것일 수 있다. 상기 변이를 갖는 감각신경성 난청 환자는 내 유모 세포 또는 내 유모 세포 주변의 지지세포에 이상을 갖는 것이고, 청신경 전도에 문제가 없을 것이므로, 와우 이식수술 시 예후가 긍정적일 것으로 예측될 수 있다. The prognosis for wahoo implantation in patients with sensory nerve impairment means predicting whether speech can be understood during wah-wedge surgery or whether speech can be better understood after wahoo implantation. For example, it may be to predict whether the auditory brainstem response will normally appear. The patient with sensory neuralgic hearing loss having the above mutation has abnormality in the supporting cells around the inner or inner hair cell, and there is no problem in the conduction of the auditory nerve. Therefore, the prognosis of the wah operation can be expected to be positive.
상기 변이, 폴리뉴클레오티드, 감각신경성 난청에 대하여는 전술한 바와 같다.The above mutations, polynucleotides, and sensory nerve impairment are as described above.
다른 양상은 개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계; 및 상기 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계를 포함하는 감각신경성 난청 환자의 와우이식수술에 대한 예후를 예측하기 위한 정보를 제공하기 위하여 유전체 DNA의 변이를 검출하는 방법을 제공한다. Another aspect includes identifying a nucleotide sequence of a genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA. In order to provide information for predicting the prognosis for the wahoo implantation in a patient with sensory nerve impairment, Thereby providing a method for detecting the mutation of DNA.
개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계; 및 상기 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계는 전술한 바와 같다.Identifying a nucleotide sequence of the genomic DNA isolated from the subject; And comparing the confirmed nucleotide sequence of the genomic DNA with a standard nucleotide sequence to confirm the mutation of the genomic DNA is as described above.
상기 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 정보를 제공하는 것은, 와우 이식수술 시 말소리를 이해할 수 있을 것인지 또는 와우 이식수술 후에 말소리를 더 잘 이해할 수 있을 것인지 예측하는 것을 의미한다. 예를 들면, 청성뇌간반응이 정상적으로 나타나게 될 것인지를 예측하는 것일 수 있다. Providing information for predicting the prognosis of the wah-graft operation in the patients with sensory-nerve impairment means predicting whether the speech will be understood during the wah-graft operation or whether the speech will be better understood after the wah-graft operation . For example, it may be to predict whether the auditory brainstem response will normally appear.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다.All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined.
일 양상에 따른 조성물 또는 키트를 이용하여 TMEM43 유전자의 변이를 높은 민감도와 정확도로 분석할 수 있으며, 이러한 분석 결과를 바탕으로 감각신경성 난청을 효율적으로 진단할 수 있다.Using the composition or kit according to one aspect, the mutation of the TMEM43 gene can be analyzed with high sensitivity and accuracy, and the sensory nerve impairment can be efficiently diagnosed based on the analysis result.
도 1a 및 도 1b는 코호트(SB162)의 구성원이 속한 가계도 및 TMEM43 변이를 확인한 과정을 나타낸다.FIGS. 1A and 1B show the process of confirming the genealogy and the TMEM43 mutation to which members of the cohort SB162 belong.
도 2는 마우스에서 TMEM43이 발현되는 기관을 확인한 결과이다. Figure 2 shows the result of confirming the organ in which TMEM43 is expressed in mouse.
도 3은 4 내지 5일령, 및 20일령 마우스의 내이에서 TMEM43이 발현되는 것을 확인한 결과이다.FIG. 3 shows the results of confirming the expression of TMEM43 in the inner ear of 4 to 5 days old and 20 days old mice.
도 4는 4일령, 15일령, 및 20일령 마우스의 내이에서 TMEM43의 발현 양상을 확인한 결과이다. FIG. 4 shows the results of confirming the expression pattern of TMEM43 in the inner ear of 4-day, 15-day, and 20-day-old mice.
도 5는 TMEM43의 p.R372X 변이를 갖는 형질전환된 동물을 제작하는 과정을 나타낸다. Auditorin은 TMEM43를 의미한다.Figure 5 shows the process for constructing a transformed animal having the p.R372X mutation of TMEM43. Auditorin means TMEM43.
도 6은 2, 7, 및 13 개월령 TMEM43+/+ 및 TMEM43+/ tm1Cby 마우스 유모 세포의 세망판(reticular lamina)에서 내부 경계 세포(inner border cell) 및 경계 세포(border cell)를 나타낸 주사 전사 현미경 이미지이다. 여기서, 녹색 및 연녹색은 내부 경계 세포를 나타내고, 주황색 및 노랑색은 각각 경계 세포를 나타낸다. Figure 6 shows the results for the 2, 7, and 13 months of TMEM43 + / + and TMEM43 + / tm1Cby An image of a transcriptional micrograph showing the inner border cell and the border cell in the reticular lamina of mouse hair cells. Here, green and pale green represent inner boundary cells, and orange and yellow represent boundary cells, respectively.
도 7은 6 및 9개월령의 TMEM43+/+ 및 TMEM43+/ tm1Cby 마우스에서 4, 8, 16, 및 32 kHz에 대한 평균 ABR 임계값을 나타낸다. Auditorin은 TMEM43를 의미한다.Figure 7 shows the results of the 6 and 9 month old TMEM43 + / + and TMEM43 + / tm1Cby And the average ABR threshold for 4, 8, 16, and 32 kHz in the mouse. Auditorin means TMEM43.
도 8a 내지 8h는 TMEM43을 발현시킨 CHO-K1 세포에서 세포 패치 클램프 기술을 이용하여 TMEM43의 기능을 확인한 결과이다.8A to 8H show the results of confirming the function of TMEM43 using cell patch clamp technology in CHO-K1 cells expressing TMEM43.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.
실시예Example 1. 감각신경성 난청 환자로부터  1. From patients with sensory nerve impairment TMEM43의TMEM43 p. p. R372XR372X 변이 검출 및 TMEM43의 p.R372X 변이를 갖는 동물 모델에서 감각신경성 난청 확인 Detection of mutation and confirmation of sensory neural deafness in animal model with p.R372X mutation of TMEM43
1. 실험 개체 선택1. Select experiment object
본 연구는 분당 서울대학교 병원의 심의위원회로부터 승인을 받아 수행하였다(IRB-B-1007-105-402 및 IRBYH-0905-041-281). This study was approved by the deliberation committee of Seoul National University Bundang Hospital (IRB-B-1007-105-402 and IRBYH-0905-041-281).
청각신경병증의 유전적 원인을 조사하기 위해, 표준화된 청력검사 또는 가족력 데이터를 바탕으로 성인 발병형 진행성 청각신경병증을 상염색체 우성 유전 방식으로 분리한 가계도(SB162)을 확인하였다. 정상 피험자(290)와 비교했을 때, 청각신경병증의 영향을 받는 피험자(291, 284, 304)는, 순음 청력도(Pure Tone Average: PTA)에서 소리에 대한 감수성이 감퇴하고, 언어 구별 점수 (Speech discrimination Score: SDS)에서 손상 인식되고, 청성뇌간반응(Auditory Brainstem Respons: ABR)의 완전한 부재를 갖고, 변조 이음향방출(distortion product otoacoustic emissions: DPOAE) 또는 달팽이관 마이크로폰(Cochlea microphonic potential: CM)은 정상이었다. In order to investigate the genetic cause of auditory neuropathy, a family tree (SB162) was isolated by autosomal dominant inheritance method of adult onset type progressive auditory neuropathy based on standardized hearing test or family history data. Compared with normal subjects (290), subjects (291, 284, and 304) who were affected by auditory neuropathy decreased their susceptibility to sound at Pure Tone Average (PTA) (DPOAE) or cochlear microphonic potential (CM), which has a complete absence of Auditory Brainstem Responses (ABRs) and is impaired in the Speech Discrimination Score (SDS) It was normal.
구체적으로, 난청 가계 780 가계, 총 1100명에서, 15 가계의 성인 청각신경병증 가계를 1차적으로 선별하였다. 성인 청각신경병증의 경우, 발병 연령이 언어 습득기 이후인 가계를 2차적으로 선별하였다. 이어서, 임상 양상, 전기생리학적 소견, 및 후보 유전자 풀(pool)에서 유전진단을 토대로, 성인 청각신경병증을 하기의 3가지 유형으로 분류하였다.Specifically, in a total of 1,100 households, 780 households with hearing impairments, 15 families selected adult auditory neuropathy households. In the case of adult auditory neuropathy, the age at onset was secondarily selected for families with a language acquisition period. Based on clinical features, electrophysiologic findings, and genetic diagnosis in the candidate gene pool, adult auditory neuropathy was then classified into three types:
- 유형 1: 기 알려진 난청 유전자가 원인인 경우(예를 들면, DIAPH3)- Type 1: If known to be caused by a known hearing loss gene (eg DIAPH3)
- 유형 2: 기 알려진 난청 유전자에서 원인 유전자를 찾지 못하고, 전기자극 청성뇌간반응(Electrically evoked　auditory brainstem response:E-ABR)이 존재하는 경우- Type 2: If the cause gene is not found in the known hearing loss gene and there is an electro-evoked auditory brainstem response (E-ABR)
- 유형 3: 기 알려진 난청 유전자에서 원인 유전자를 찾지 못하고, 전기자극 청성뇌간반응이 존재하지 않는 경우- Type 3: If the causative gene is not found in the known hearing loss gene and there is no electrical stimulation of the auditory brainstem response
2. 분자 유전 스크리닝 2. Molecular genetic screening
감각신경성 난청과 연관된 후보 변이를 스크리닝하기 위하여, 다음과 같이 수행하였다. To screen for candidate variants associated with sensory nerve impairment, we performed the following.
4명의 피험자(SB162-284, 289, 290, 291)에 대한 연계 분석으로부터 3p25-26 영역에 대하여 표적 엑솜 시퀀싱을 수행하고, 후보 변이체를 나열하였다. ESP6500과 1000G에서 1 % 미만의 소수 대립 유전자 빈도를 갖는 변이를 확인하였다. 유전 패턴이 일치하는 변이를 남겨두고, 플래깅(flagged) dbSNP 아닌 dbSNP는 필터링하였다. 이어서, 622종의 정상 대조군을 이용하여, 한국인 특이적인 공통 변이를 제거하였다. 염색체 3에 대한 게놈 수준 log2 비율을 조사하였다. Target exome sequencing was performed on the 3p25-26 region from the linkage analysis for 4 subjects (SB162-284, 289, 290, 291) and the candidate variants were listed. A mutation with a minor allele frequency of less than 1% was identified in ESP6500 and 1000G. The dbSNP, which is not a flagged dbSNP, is filtered, leaving a variation that matches the genetic pattern. Subsequently, 622 species of normal control were used to eliminate Korean specific mutations. Genome level log2 ratios for chromosome 3 were examined.
동시에, 표적 엑솜 시퀀싱에서 변이가 발견되지 않거나 가계 내의 환자수가 많아서 멘델 유전으로 예상되는 경우를 분석하기 위하여, 4명의 피험자(SB162-284, 289, 290, 291)에 대하여 전체 엑솜 시퀀싱(Whole exome sequencing: WES)을 수행하였다. 감각신경성 난청을 보인 피험자로부터 전혈을 추출하고, SureSelect Human All Exon 키트 V3(Agilent, Santa Clara, CA, USA)를 사용하여 전체 엑솜 시퀀싱을 수행하였다. 또한 101 염기쌍 말단 판독을 갖는 HiSeq 2000(Illumina, San Diego, CA, USA)를 사용하여 시퀀싱하였다. 바이오인포매틱스 분석은 Whole-exome sequencing reveals diverse modes of inheritance in sporadic mild to moderate sensorineural hearing loss in a pediatric population. Genet Med 17: 901-911에 기재된 바와 같이 수행하였다. 시퀀싱 리드는 BWA v 0.7.5 및 SAMTOOLS v 0.1.18을 이용하여 인간 참조 유전체(hg19)에 정렬하였고, CATK v 2.4-7 및 Picard v 1.93을 이용하여 정렬, 색인화, 재배치, 및 중복을 표시하였다. GATK Unified Genotyper를 이용하여 변이를 명명하였고, 변이를 재확인하였다. ANNOVAR를 이용하여 변이를 어노테이션하였다. 이 후, 상기 가계의 최종 후보 변이를 생거 시퀀싱(Sanger sequencing)으로 확인하였다. At the same time, total exome sequencing was performed on four subjects (SB162-284, 289, 290, 291) in order to analyze the cases in which mutation was not found in the target exome sequencing, : WES) was performed. Whole blood was extracted from subjects with sensorineural hearing loss and the entire exome sequencing was performed using the SureSelect Human All Exon Kit V3 (Agilent, Santa Clara, Calif., USA). And sequenced using HiSeq 2000 (Illumina, San Diego, Calif., USA) with a 101 base pair reading. Bioinformatics analysis has shown that whole-exome sequencing reveals diverse modes of inheritance in sporadic mild to moderate sensorineural hearing loss in a pediatric population. Genet Med 17: 901-911. Sequencing leads were aligned to the human reference genome (hg19) using BWA v 0.7.5 and SAMTOOLS v 0.1.18, and sorted, indexed, rearranged, and duplicated using CATK v 2.4-7 and Picard v 1.93 . The mutation was named using the GATK Unified Genotyper and the mutation was reaffirmed. Variations were annotated using ANNOVAR. Thereafter, the final candidate variation of the household was confirmed by Sanger sequencing.
후보 변이는 코딩 영역의 동의 변이(synonymous variant)와 비코딩 영역의 변이로 필터링하였다. 1 % 미만의 소수 대립 유전자 빈도를 갖는 변이를 엑솜 시퀀싱 프로젝트 Exome Sequencing Project 6500 : ESP6500), 1000 게놈 프로젝트(1000 Genome Project: 1000G), 엑솜 집합 컨소시움(The Exome Aggregation Consortium : ExAC), 및 81 명의 한국인 개체의 엑솜에 대한 데이터 베이스에 기초하여 선별하였다. 이어서, 리드 뎁스가 10X 이상이면서 유전형 품질 점수가 20 이상인, 동형 접합형 변이 및 복합 이형 접합형 변이(homozygous variants and compound heterozygote variants)를 선별하였다. 최종적으로, 임상적으로 의미가 없는 dbSNP ID의 변이를 제외하고, ANSD 표현형과 공-분리(co-segregation)된 20 종의 후보 변이를 확인하였다. 4명의 가족에 대하여 WES를 수행한 후, 14명의 다른 가족에 대하여 분리 분석(segregation study)을 수행하고, TMEM43의 p.R372X를 최종적으로 선별하였다.Candidate mutations were filtered by the variation of the coding region (synonymous variant) and the noncoding region. The Exome Sequencing Project 6500: ESP6500), the 1000 Genome Project (1000G), the Exome Aggregation Consortium (ExAC), and 81 Koreans with a minor allele frequency of less than 1% Based on the database of exome of the individual. Subsequently, homozygous variants and compound heterozygous variants were selected, with a lead depth of at least 10X and a genotype quality score of 20 or greater. Finally, we identified 20 candidate variants co-segregated with the ANSD phenotype, except for clinically meaningless dbSNP ID variants. After performing WES for 4 families, segregation study was performed on 14 other families and p.R372X of TMEM43 was finally selected.
유전자gene GenbankIDGenbankID ChrChr 엑손Exon 뉴클레오티드Nucleotides 아미노산amino acid SB162SB162 -284*-284 * 289* 289 * 290* 290 * 291* 291 * 304 304 305 305 306 306 307 307 308 308
+ + ++ -- ++ ++ -- ++ ++ --
DTX3LNM_138287 DTX3L NM_138287 chr3chr3 1One c.G83Ac.G83A p.S28Np.S28N ++ ++ -- ++ - //- // -- ++ ++ --
MAP2K1NM_002755 MAP2K1 NM_002755 chr15chr15 1010 c.A1062Cc.A1062C p.Q354Hp.Q354H ++ ++ -- ++ -//- // -- -- -- --
KIAA1614NM_020950 KIAA1614 NM_020950 chr1chrl 55 c.G2514Tc.G2514T p.E838Dp.E838D ++ ++ -- ++ ++ -- ++ -//- // --
PARD3BNM_057177 PARD3B NM_057177 chr2chr2 1111 c.A1594Cc.A1594C p.I532Lp.I532L ++ ++ -- ++ -//- // -- ++ -- ++
HDLBPNM_001243900 HDLBP NM_001243900 chr2chr2 2121 c.G2728Ac.G2728A p.G910Sp.G910S ++ ++ -- ++ ++ -- -//- // -- --
CILPNM_003613 CILP NM_003613 chr15chr15 55 c.C448Gc.C448G p.R150Gp.R150G ++ ++ -- ++ -//- // -- -- -- --
CRYABNM_001885 CRYAB NM_001885 chr11chr11 1One c.T79Ac.T79A p.F27Ip.F27I ++ ++ -- ++ -//- // -- -- -- --
ZFPM1NM_153813 ZFPM1 NM_153813 chr16chr16 1010 c.C1645Gc.C1645G p.L549Vp.L549V ++ ++ -- ++ -//- // -- ++ -- ++
MIDNNM_177401 MIDN NM_177401 chr19chr19 55 c.C401Tc.C401T p.S134Lp.S134L ++ ++ -- ++ ++ -- ++ -//- // ++
INO80NM_017553 INO80 NM_017553 chr15chr15 66 c.A623Gc.A623G p.K208Rp.K208R ++ ++ -- ++ -//- // -- -- -- --
DOK3NM_001144875 DOK3 NM_001144875 chr5chr5 22 c.C8Tc.C8T p.P3Lp.P3L ++ ++ -- ++ -//- // ++ -- -- --
TBCENM_001079515 TBCE NM_001079515 chr1chrl 99 c.T794Cc.T794C p.I265Tp.I265T ++ ++ -- ++ -//- // -- ++ -- --
TMEM43NM_024334 TMEM43 NM_024334 chr3chr3 1212 c.C1114Tc.C1114T p.R372Xp.R372X ++ ++ -- ++ ++ -- ++ ++ --
MAML1NM_014757 MAML1 NM_014757 chr5chr5 55 c.C2338Tc.C2338T p.H780Yp.H780Y ++ ++ -- ++ -//- // ++ -- -- --
ADCK3NM_020247 ADCK3 NM_020247 chr1chrl 66 c.C818Tc.C818T p.A273Vp.A273V ++ ++ -- ++ -//- // -- ++ -- --
MYO5CNM_018728 MYO5C NM_018728 chr15chr15 2929 c.A3620Cc.A3620C p.E1207Ap.E1207A ++ ++ -- ++ -//- // -- -- -- --
EPC1NM_001272004 EPC1 NM_001272004 chr10chr10 44 c.T572Cc.T572C p.I191Tp.I191T ++ ++ -- ++ ++ -- ++ ++ --
P4HA2NM_001017973 P4HA2 NM_001017973 chr5chr5 22 c.T80Cc.T80C p.I27Tp.I27T ++ ++ -- ++ -//- // -- ++ ++ --
KIAA1024LNM_001257308 KIAA1024L NM_001257308 chr5chr5 1One c.T160Gc.T160G p.S54Ap.S54A ++ ++ -- ++ -//- // -- ++ ++ --
ARID1BNM_017519 ARID1B NM_017519 chr6chr6 1One c.1029_1030insGCGc.1029_1030insGCG p.A343delinsAAp.A343delinsAA ++ ++ -- ++ -//- // ++ -- -- --
유전자gene GenbankIDGenbankID ChrChr 엑손Exon 뉴클레오티드Nucleotides 아미노산amino acid 309 309 310 310 324 324 325 325 331 331 332 332 333 333 355 355 369 369
-- -- -- -- ++ ++ ++ -- --
DTX3LNM_138287 DTX3L NM_138287 chr3chr3 1One c.G83Ac.G83A p.S28Np.S28N ++ ++ -- -- ++ ++ -- -- --
MAP2K1NM_002755 MAP2K1 NM_002755 chr15chr15 1010 c.A1062Cc.A1062C p.Q354Hp.Q354H -- -- ++ ++ -- -- ++ -- --
KIAA1614NM_020950 KIAA1614 NM_020950 chr1chrl 55 c.G2514Tc.G2514T p.E838Dp.E838D ++ -- -- -- ++ ++ -- -- --
PARD3BNM_057177 PARD3B NM_057177 chr2chr2 1111 c.A1594Cc.A1594C p.I532Lp.I532L -- -- ++ ++ -- -- -- -- --
HDLBPNM_001243900 HDLBP NM_001243900 chr2chr2 2121 c.G2728Ac.G2728A p.G910Sp.G910S -- -- -- -- -- -- -- -- --
CILPNM_003613 CILP NM_003613 chr15chr15 55 c.C448Gc.C448G p.R150Gp.R150G -- -- ++ ++ -- -- ++ -- --
CRYABNM_001885 CRYAB NM_001885 chr11chr11 1One c.T79Ac.T79A p.F27Ip.F27I -- -- -- -- -- -- -- -- --
ZFPM1NM_153813 ZFPM1 NM_153813 chr16chr16 1010 c.C1645Gc.C1645G p.L549Vp.L549V -- -- -- -- -- -- ++ -- --
MIDNNM_177401 MIDN NM_177401 chr19chr19 55 c.C401Tc.C401T p.S134Lp.S134L ++ -- ++ -- ++ -- -- -- --
INO80NM_017553 INO80 NM_017553 chr15chr15 66 c.A623Gc.A623G p.K208Rp.K208R -- -- -- -- -- -- ++ -- --
DOK3NM_001144875 DOK3 NM_001144875 chr5chr5 22 c.C8Tc.C8T p.P3Lp.P3L ++ ++ -- -- ++ -- ++ -- --
TBCENM_001079515 TBCE NM_001079515 chr1chrl 99 c.T794Cc.T794C p.I265Tp.I265T ++ -- ++ ++ ++ ++ ++ -- --
TMEM43NM_024334 TMEM43 NM_024334 chr3chr3 1212 c.C1114Tc.C1114T p.R372Xp.R372X -- -- -- -- ++ ++ ++ -- --
MAML1NM_014757 MAML1 NM_014757 chr5chr5 55 c.C2338Tc.C2338T p.H780Yp.H780Y ++ ++ -- -- ++ -- ++ -- --
ADCK3NM_020247 ADCK3 NM_020247 chr1chrl 66 c.C818Tc.C818T p.A273Vp.A273V ++ -- -- -- ++ ++ -- -- --
MYO5CNM_018728 MYO5C NM_018728 chr15chr15 2929 c.A3620Cc.A3620C p.E1207Ap.E1207A -- -- -- -- -- -- ++ -- --
EPC1NM_001272004 EPC1 NM_001272004 chr10chr10 44 c.T572Cc.T572C p.I191Tp.I191T -- -- -- -- ++ ++ -//- // -- --
P4HA2NM_001017973 P4HA2 NM_001017973 chr5chr5 22 c.T80Cc.T80C p.I27Tp.I27T ++ -- -- -- ++ ++ -- -- --
KIAA1024LNM_001257308 KIAA1024L NM_001257308 chr5chr5 1One c.T160Gc.T160G p.S54Ap.S54A ++ -- -- -- ++ ++ -- -- --
ARID1BNM_017519 ARID1B NM_017519 chr6chr6 1One c.1029_1030insGCGc.1029_1030insGCG p.A343delinsAAp.A343delinsAA -- -- -- -- -- -- ++ -- --
(+: 질병의 영향을 받음)도 1a 및 도 1b는 코호트(SB162)의 구성원이 속한 가계도 및 TMEM43 변이를 확인한 과정을 나타낸다. dbSNP 데이터베이스, 대립 유전자 빈도, 및 유전 패턴에 기초한 필터링 과정 이후, 및 TMEM43에서 R372X의 변이가 이형접합체로 검출되었으며, 유전자의 변이를 선별하는 과정에서 확인된 변이의 수를 하기 표 3에 나타내었다. (+: Affected by disease) FIGS. 1A and 1B show the process of confirming the genealogy and the TMEM43 mutation to which members of the cohort SB162 belong. After the filtering process based on the dbSNP database, allele frequency, and genetic pattern, and mutations of R372X in TMEM43 were detected as heterozygotes, the number of mutations identified in the process of selecting mutations of genes is shown in Table 3 below.
번호number 단계step 변이의 수Number of mutations
1One Raw SNVRaw SNV 12963271296327
22 Annotated variantsAnnotated variants 12963271296327
33 Exonic and splicing variantsExonic and splicing variants 3270532705
44 After elimination of synonymous SNVAfter elimination of synonymous SNV 1611816118
55 With allele frequency of<1%With allele frequency of <1% 38183818
66 Not registered in dbSNP+ Flagged SNPNot registered in dbSNP + Flagged SNP 10371037
77 Inheritance pattern matchedInheritance pattern matched 2121
88 Phase or segregation checkedPhase or segregation checked 1One
상기 p.R372X 변이는 상염색체 우성으로 유전된 것으로 추정된다. 또한, 상기 p.R372X 변이는 정상 청력을 갖는 한국인 대조군의 염색체에서는 검출되지 않았다.The p.R372X mutation is presumed to be inherited as autosomal dominant. In addition, the p.R372X mutation was not detected in the chromosomes of the Korean control group with normal hearing.
3. 3. TMEM43의TMEM43 발현 위치(localization) 분석 Analysis of localization
(3.1) 다양한 마우스조직에서의 TMEM43 발현 확인(3.1) Expression of TMEM43 in various mouse tissues
129Sv/Ev 마우스를 펜토바르비탈 소듐(pentobarbital sodium)으로 마취하였다(50 mg/kg). 표적 인자의 mRNA 발현 수준을 확인하기 위하여, 제조사의 지시에 따라, TRIZOL®(Gibco BRL, Gaithersburg, MD, USA) 및 RNeasy 키트(Qiagen, Valencia, USA)를 이용하여, 전체 달팽이관(cochlea)(P1), 심장(P120), 눈(P42), 뇌(P28), 신장(P28), 및 간(P28)에서 총 RNA를 추출하였다. 이어서, 올리고 dT 프라이머 및 추출된 RNA를 이용하여 cDNA를 합성하였다. 합성된 cDNA와 TMEM43 및 Gapdh에 특이적인 프라이머 세트를 이용하여, 중합효소 연쇄반응(polymerase chain reaction: PCR)을 수행하였으며, 이 때의 PCR 조건은 다음과 같다: 95℃에서 2분, 이어서, 95℃에서 20초, 55℃에서 10초, 및 70℃에서 10초로 35회, 72℃에서 5분. 증폭 산물(15 ㎕)를 2%의 아가로스 젤에서 전기영동하고 에티디움 브로미드(ethidium bromide)로 가시화하였다. 이 때, TMEM43 및 Gapdh 특이적인 프라이머 서열은 다음과 같다: TMEM43 정방향 프라이머 : 5'-CTTCCTGGAACGGCTGAG-3' (서열번호 3) 및 TMEM43 역방향 프라이머 5'-CACCAGCCTTCCTTCATTCT-3' (서열번호 4), Gapdh 정방향 프라이머: 5'- ACCACAGTCCATGCCATCAC-3') (서열번호 5) 및 Gapdh 역방향 프라이머: 5'-CACCACCCTGTTGCTGTAGCC-3' (서열번호 6).129Sv / Ev mice were anesthetized with pentobarbital sodium (50 mg / kg). In order to confirm the mRNA expression level of the target factor, according to the manufacturer's instructions, TRIZOL ® (Gibco BRL, Gaithersburg, MD, USA) and RNeasy kits using (Qiagen, Valencia, USA), the entire cochlea (cochlea) (P1 ), Heart (P120), eyes (P42), brain (P28), kidney (P28), and liver (P28). Next, cDNA was synthesized using oligo dT primer and extracted RNA. Polymerase chain reaction (PCR) was performed using the synthesized cDNA and a specific primer set specific for TMEM43 and Gapdh. The PCR conditions were as follows: 95 ° C for 2 minutes, 95 20 sec at 55 ° C, 10 sec at 55 ° C, and 35 min at 70 ° C and 5 min at 72 ° C. The amplification product (15 μl) was electrophoresed on 2% agarose gel and visualized with ethidium bromide. The primer sequences specific for TMEM43 and Gapdh are as follows: TMEM43 forward primer: 5'-CTTCCTGGAACGGCTGAG-3 '(SEQ ID NO: 3) and TMEM43 reverse primer 5'-CACCAGCCTTCCTTCATTCT-3' (SEQ ID NO: 4), Gapdh forward Primer: 5'-ACCACAGTCCATGCCATCAC-3 ') (SEQ ID NO: 5) and Gapdh reverse primer: 5'-CACCACCCTGTTGCTGTAGCC-3' (SEQ ID NO: 6).
도 2는 마우스에서 TMEM43이 발현되는 기관을 확인한 결과이다. 도 2에 나타난 바와 같이, TMEM43은 내이 내 달팽이관에서 발현되는 것을 알 수 있다.Figure 2 shows the result of confirming the organ in which TMEM43 is expressed in mouse. As shown in FIG. 2, it can be seen that TMEM43 is expressed in the inner ear cochlea.
(3.2) 마우스 내이에서 (3.2) In the mouse inner ear TMEM43TMEM43 발현 분석 Expression analysis
마우스 TMEM43의 NH2-말단에 대하여 지시되는 래빗 폴리클로날 항혈청(AbClon)을 제작하였다. 펩티드 서열은 NH2-SRKEHVKVTSE-COOH (서열번호 7)와 같다. 1차 항체는 래빗 항-TMEM43 모노클로날 항체(1:500, Abcam, Ab184164), 래빗 항-TMEM43 폴리클로날 항체(1:100, Novus, Cat#NBP1-84132, Littleton, USA 80120), 마우스 항-mCherry 모노클로날(1:500, Abcam, ab125096), 마우스 항-칼레티닌(calretinin) 모노클로날 항체(1:500, Millipore, MAB1568), 고트 폴리클로날 항-Na+, K+-ATPase-α3 항체(NKA, 1:250, Santa Cruz, SC-16052), 및 마우스 모노클로날 항-CtBP2 항체(1:500, BD Transduction Laboratories, 612044)를 사용하였다. 이차 항체는 돈키 또는 고트(life technologies)에서 제작된 것을 1:1000으로 희석하여 사용하였다. NH 2 mouse TMEM43 - Rabbit polyclonal anti-serum (AbClon) that instructs the terminal was produced. Peptide sequences are as NH 2 -SRKEHVKVTSE-COOH (SEQ ID NO: 7). The primary antibodies were rabbit anti-TMEM43 monoclonal antibody (1: 500, Abcam, Ab184164), Rabbit anti-TMEM43 polyclonal antibody (1: 100, Novus, Cat # NBP1-84132, Littleton, USA 80120) (1: 500, Abcam, ab125096), mouse anti-calretinin monoclonal antibody (1: 500, Millipore, MAB1568), gut polychlorinated anti-Na + , K + ATPase-α3 antibody (NKA, 1: 250, Santa Cruz, SC-16052) and mouse monoclonal anti-CTBP2 antibody (1: 500, BD Transduction Laboratories, 612044) were used. Secondary antibodies were diluted 1: 1000 with donkey or life technologies.
마우스 내이(C57BL/6, P9 및 P15)를 차가운 4%의 파라포름알데히드에서 약 1시간 동안 고정하였다. 달팽이관(Cochlear turns)을 절개하고 5%의 고트 혈청 및 0.25%의 트리톤(Triton)X-100를 함유하는 인산염 완충 식염수를 포함하는 블로킹/투과 버퍼(blocking/permeabilizing buffer)에서 인큐베이션하여, 조직 샘플을 제작하였다. 이어서, 상기 조직 샘플을 1차 항체와 4 oC에서 밤새 인큐베이션하고, 3회 세척한 후, 형광 물질이 결합된 2차 항체와 1시간 동안 실온에서 인큐베이션하였다. 이어서, 상기 조직 샘플을 블로킹/투과 버퍼로 세척하고, 인산염 완충 식염수로 세척하였다. Fluorsave 시약(Calbiochem, 345789)을 이용하여 상기 조직 샘플을 유리 슬라이드에 마운팅하고, 커버슬립(coverslip)으로 덮은 뒤, 현미경 샘플을 제작하였다. 도립 형광(epifluorescence) 현미경 및 공초점 레이저 주사(a confocal laser scanning) 현미경(LSM710, Zeiss)을 사용하여 현미경 샘플에서 이미지를 수득하였다. Mouse inner ear (C57BL / 6, P9 and P15) were fixed in cold 4% paraformaldehyde for about 1 hour. Cochlear turns were incised and incubated in a blocking / permeabilizing buffer containing phosphate buffered saline containing 5% goto serum and 0.25% Triton X-100 to remove tissue samples Respectively. The tissue sample was then incubated with primary antibody and 4 &lt; RTI ID = 0.0 &gt; o C overnight, washed three times, and then incubated with the secondary antibody conjugated to the fluorescent material for 1 hour at room temperature. The tissue samples were then washed with blocking / permeable buffer and washed with phosphate buffered saline. The tissue sample was mounted on a glass slide using a Fluorsave reagent (Calbiochem, 345789), covered with a coverslip, and a microscope sample was made. Images were obtained from a microscope sample using an epifluorescence microscope and a confocal laser scanning microscope (LSM710, Zeiss).
도 3은 4 내지 5일령, 및 20일령 마우스의 내이에서 TMEM43이 발현되는 것을 확인한 결과이다. 도 3에 나타난 바와 같이, TMEM43은 내유모 세포 주변의 지지세포에서 발현되는 것을 알 수 있다. 도 4는 4일령, 15일령, 및 20일령 마우스의 내이에서 TMEM43의 발현 양상을 확인한 결과이다. 도 4에 나타낸 바와 같이, 마우스에서 TMEM43은 내이에서 발현되고, 시간이 경과하는 경우에도 내이 내 내유모 세포 주변의 지지세포에서 지속적으로 발현되는 것을 알 수 있다. 또한, TMEM43의 발현 양상은 자발적 활동의 양상과 일치하는 소견을 보였다 (미도시). FIG. 3 shows the results of confirming the expression of TMEM43 in the inner ear of 4 to 5 days old and 20 days old mice. As shown in FIG. 3, it can be seen that TMEM43 is expressed in supporting cells around the inner hair cells. FIG. 4 shows the results of confirming the expression pattern of TMEM43 in the inner ear of 4-day, 15-day, and 20-day-old mice. As shown in Fig. 4, TMEM43 in mouse is expressed in inner ear, and it is constantly expressed in supporting cells around inner ear embryonic cell even when time passes. In addition, the expression pattern of TMEM43 was consistent with the pattern of spontaneous activity (not shown).
4. 4. TMEM43이TMEM43 결핍된 마우스 및  Deficient mice and TMEM43의TMEM43 p. p. R372XR372X 변이를 갖는 형질전환 마우스(transgenic mouse) 제작 및 표현형 분석 Transgenic mice with mutations and phenotypic analysis
(4.1) (4.1) CRISPRCRISPR // Cas9Cas9 기술을 이용한  Using technology TMEM43이TMEM43 결핍된( Deficient TMEM43TMEM43 knockinknockin ) 마우스 및 TMEM43의 p.R372X 변이를 갖는 마우스 제작) Mouse and a mouse having the p.R372X mutation of TMEM43
TMEM43-R372X 넉-인(Knock-in)(C57BL/6J;129S-TMEM43tm1Cby) 마우스 모델을 크리스퍼(Clustered Regularly Interspaced Short Palindromic Repeats: CRISPR) 방법을 이용하여 제작하였다. A mouse model of TMEM43 -R372X knock-in (C57BL / 6J; 129S-TMEM43 tm1Cby ) mouse model was constructed using a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) method.
도 5는 TMEM43의 p.R372X 변이를 갖는 형질전환된 동물을 제작하는 과정을 나타낸다. 상기 모델에서, TMEM43 단백질(유전자 ID: NM_028766)의 372 위치에서 아르기닌(Arginine: R)을 종결코돈으로 치환하였다. 오프 타겟 프로파일(off-target profile) 및 변이 위치까지의 거리를 기준으로, gRNA를 제작하였다. 변이 위치에 근접하게 위치한 두 gRNA 후보(TMEM43 gRNA1: 5’- TTAGAGCAGCCCACAGCGGTCGG -3’ (서열번호 8); TMEM43 gRNA2: 5’- CCGATTAGAGCAGCCCACAGCGG -3’ (서열번호 9))를 평가하였다. CCG는 PAM(Protospacer Adjacent Motif) 서열을 나타낸다.Figure 5 shows the process for constructing a transformed animal having the p.R372X mutation of TMEM43. In this model, arginine (R) was replaced with a stop codon at position 372 of the TMEM43 protein (gene ID: NM_028766). Based on the off-target profile and the distance to the mutation site, gRNA was constructed. Two gRNA candidates located close to the mutation site ( TMEM43 gRNA1: 5'- TTAGAGCAGCCCACAGCGGT CGG- 3 '(SEQ ID NO: 8); TMEM43 gRNA2: 5'-CCGATTAGAGCAGCCCACAG CGG- 3 '(SEQ ID NO: 9)) was evaluated. CCG represents a PAM (Protospacer Adjacent Motif) sequence.
gRNA 활성을 측정하기 위하여, 제조사의 지시에 따라, SURVEYOR 변이 검출 키트(IDT)를 사용하여, SURVEYOR 분석을 수행하였다. 확인된 gRNAs에 근거하여, 단일 가닥 올리고 데옥시 뉴클레오티드 공여체(single stranded oligodeoxynucleotide donor: ssODN)를 설계하고 합성하였다. 160bp의 공여체 DNA는 TMEM43 유전자의 1114 위치에 상응하는 엑손 12에 도입된 변이(C->T)에 인접(flanking)하는 두 상동성 암(arm)을 포함한다. 또한, 수선된 게놈이 Cas9 복합체에 의해 재표적화되는 것을 방지하기 위해, 두번째 종결 코돈에 상응하는 추가적인 변이를 도입하였다. 62개의 C57BL/6J 배아에 ssODN 공여체, gRNA 전사 TMEM43, 및 Cas9 mRNA를 포함하는 CRISPR 칵테일을 세포질을 통해 주입하였다. 62개의 배아 중에서 49개의 배아를 스크리닝하여 선별하고, 2 마리의 CD1 마우스에 이식하였다. 모든 암컷은 임신하여, 9마리의 새끼 F0을 출산하였다. 암컷 F0를 야생형 수컷 C57BL/6J 마우스와 교배시키고, F1를 얻은 후, 생식세포의 유전전달 (germline transmission) 여부를 확인하였다. 모든 마우스에서 대하여, 표적 위치에서 점 돌연변이(point mutation)가 존재하는지 여부를 PCR 및 시퀀싱을 통하여 분석하였다. 유전형을 확인하기 위하여, DNeasy® 혈액 & 조직 키트(Qiagen, Hilden, Germany)를 이용하여 약 1mm 내지 약 2mm의 꼬리에서 게놈 DNA를 추출하였다. 게놈 DNA(5 ㎕), 25 mM의 MgCl2,2 mM의 dNTPs, 10 pM의 프라이머, 및 0.02 U의 TOYOBO KOD Hot Start DNA 중합효소(Invitrogen/Life Technologies, Billerica, Massachusetts, USA)를 이용하여, PCR을 수행하였으며, 이 때의 PCR 조건은 다음과 같다: 95℃에서 2분, 이어서, 95℃에서 20초, 59℃에서 10초, 및 72℃에서 10초로 35회, 72℃에서 10분. 이 때, 넉-인 대립인자의 존재를 확인하기 위한, 프라이머 서열은 다음과 같다: 정방향 프라이머 5'-ccacagTGGACTGGTTTCCT-3' (서열번호 10), 및 역방향 프라이머 5'-GGCTTCACTCCAGCTTTTTG-3' (서열번호 11). 상기 프라이머 서열에 의한 증폭 산물의 크기는 약 213bp이다. 증폭된 산물은 생거 시퀀싱으로 재확인하였다(Macrogen Inc., Seoul, KOR).To measure gRNA activity, SURVEYOR assay was performed using the SURVEYOR Mutation Detection Kit (IDT) according to the manufacturer's instructions. Based on the identified gRNAs, a single stranded oligodeoxynucleotide donor (ssODN) was designed and synthesized. The 160 bp donor DNA contains two homologous arms flanking the mutation (C- &gt; T) introduced in exon 12 corresponding to the 1114 position of the TMEM43 gene. In addition, additional mutations corresponding to the second termination codon were introduced to prevent the repaired genome from being retargeted by the Cas9 complex. Sixty-two C57BL / 6J embryos were injected via the cytoplasm with a CRISPR cocktail containing ssODN donor, gRNA transcript TMEM43, and Cas9 mRNA. Of the 62 embryos, 49 embryos were selected for screening and transplanted into two CD1 mice. All females were pregnant and gave birth to nine litters of F0. Female F0 was crossed with wild-type male C57BL / 6J mice, F1 was obtained, and germline transmission of germ cells was confirmed. For all mice, the presence or absence of a point mutation at the target site was analyzed by PCR and sequencing. To confirm the genotype, genomic DNA was extracted from the tail of about 1 mm to about 2 mm using DNeasy ® blood & tissue kit (Qiagen, Hilden, Germany). Using 5 μl of genomic DNA, 25 mM MgCl 2 , 2 mM of dNTPs, 10 pM of primer, and 0.02 U of TOYOBO KOD Hot Start DNA polymerase (Invitrogen / Life Technologies, Billerica, Massachusetts, USA) The PCR conditions were as follows: 95 ° C for 2 minutes, followed by 95 ° C for 20 seconds, 59 ° C for 10 seconds, and 72 ° C for 10 seconds and 72 ° C for 10 minutes. In order to confirm the presence of a knock-in allele, primer sequences were as follows: a forward primer 5'-ccacagTGGACTGGTTTCCT-3 '(SEQ ID NO: 10), and a reverse primer 5'-GGCTTCACTCCAGCTTTTTG-3' 11). The size of the amplified product by the primer sequence is about 213 bp. The amplified product was confirmed by Sanger sequencing (Macrogen Inc., Seoul, KOR).
(4.2) (4.2) TMEM43의TMEM43 p. p. R372XR372X 변이를 갖는 형질전환 마우스  Transgenic mice with mutations SEMSEM 분석 analysis
2, 7 및 13개월령의 TMEM43+/+ 및 TMEM43+/ tm1Cby 마우스에서 달팽이관(cochleae)을 분리하고, 2.5%의 글루타르알데히드(glutaraldehyde)를 함유하는 0.1 M의 소듐 카코딜레이트 버퍼(sodium cacodylate buffer)(pH 7.4)에 희석된 2%의 파라포름알데히드 용액에서, 상온에서 1시간 동안 고정시켰다. 골 낭(bony capsule)을 절개하고, 외측벽(lateral wall), 라이스너 막(Reissner's membrane) 및 덮개막(tectorial membrane)를 제거하였다. 코르티 기관을 절개하고, 0.1 M의 소듐 카코디레이트(sodium cacodylate) 버퍼(pH 7.4), 2mM의 칼슘 클로리드, 2.5%의 글루타르알데히드 및 3.5%의 수크로스를 함유하는 용액에서, 4℃에서 밤새 고정시켰다. 조직을 고정시킨 후, 오스뮴 테트록시드-티오카보하이드라지드(osmium tetroxide - thiocarbohydrazide) 방법을 이용하여 조직 샘플을 제작하고 주사 전자 현미경으로 관찰하였다. 이어서, 상기 조직 샘플을 농도 구배를 갖는 에탄올 용액에서 탈수(dehydrate) 시키고, 건조시키고, 스퍼터 코팅 장치(sputter coater)를 사용하여 백금 코팅하였다(E1030; Hitachi, Tokyo, Japan). 코르티 기관의 표면을 10 또는 15 kV로 작동하는 냉전계방출 주사 전사 현미경(cold-field emission SEM)(SU8220, Hitachi, Tokyo, Japan)으로 캡쳐하였다. 현미경 이미지는 ImageJ 소프트웨어(National Institutes of Health, http://rsbweb.nih.gov/ij/)를 이용하여 수득하였다. 2, 7 and 13 months of TMEM43 + / + and TMEM43 + / tm1Cby Cochleae were isolated from the mice and cultured in a 2% paraformaldehyde solution diluted in 0.1 M sodium cacodylate buffer (pH 7.4) containing 2.5% glutaraldehyde , And fixed at room temperature for 1 hour. The bony capsule was dissected and the lateral wall, Reissner's membrane, and tectorial membrane were removed. The Corti organ was dissected and incubated at 4 ° C in a solution containing 0.1 M sodium cacodylate buffer (pH 7.4), 2 mM calcium chloride, 2.5% glutaraldehyde and 3.5% sucrose Fixed overnight. After the tissue was fixed, a tissue sample was prepared using osmium tetroxide - thiocarbohydrazide method and observed with a scanning electron microscope. The tissue samples were then dehydrated in an ethanol solution with a concentration gradient, dried and platinum coated using a sputter coater (E1030; Hitachi, Tokyo, Japan). The surface of the Corti organ was captured with a cold field emission SEM (SU8220, Hitachi, Tokyo, Japan) operating at 10 or 15 kV. Microscopic images were obtained using ImageJ software (National Institutes of Health, http://rsbweb.nih.gov/ij/).
도 6은 2, 7, 및 13 개월령 TMEM43+/+ 및 TMEM43+/ tm1Cby 마우스 유모 세포의 세망판(reticular lamina)에서 내부 경계 세포(inner border cell) 및 경계 세포(border cell)를 나타낸 주사 전사 현미경 이미지이다. 여기서, 녹색 및 연녹색은 내부 경계 세포를 나타내고, 주황색 및 노랑색은 각각 경계 세포를 나타낸다. 도 6에 나타낸 바와 같이, TMEM43+/ tm1Cby 마우스의 내부 경계 세포 및 경계 세포의 면적이 야생형 마우스의 내부 경계 세포 및 경계 세포의 면적에 비하여 감소되어 있음을 알 수 있다. 내부 경계 세포 및 경계 세포가 수축 및 감소됨에 따라, 청신경 전위가 억제되어 있는 것으로 예상된다.Figure 6 shows the results for the 2, 7, and 13 months of TMEM43 + / + and TMEM43 + / tm1Cby An image of a transcriptional micrograph showing the inner border cell and the border cell in the reticular lamina of mouse hair cells. Here, green and pale green represent inner boundary cells, and orange and yellow represent boundary cells, respectively. As shown in Fig. 6, TMEM43 + / tm1Cby The area of the inner border cells and the border cells of the mouse is decreased as compared with that of the inner border cells and the border cells of wild type mice. It is expected that as the inner border cells and border cells shrink and decrease, the auditory nerve transposition is suppressed.
(4.3) (4.3) TMEM43의TMEM43 p. p. R372XR372X 변이를 갖는 형질전환 마우스  Transgenic mice with mutations ABRABR 분석 analysis
ABR는 무향실(anechoic room)에서 수행하였다. 마우스에 레보테프로마진 클로히드레이트(levomepromazin chlorhydrate) 0.1 mg을 투여하고, 케타민 클로히드레이트(ketamine chlorhydrate) 약 3.5mg를 15g의 마우스에 복강주사(intraperitoneal injection)로 투여하여 마취시켰다. ABR은 4 내지 32 kHz의 범위에서 교정된 짧은 톤 버스트(short tone burst)에 대한 응답을 수집하여 분석하였다. 뇌전도(electroencephalogram)는 표준 디지털 평균 시스템(standard digital averaging system)을 이용하여 정수리(vertex)와 동측성 꼭지돌기(ipsilateral mastoid)의 피하에서 스테인레스 스틸 전극을 통해 기록하였다. 모든 사운드 레벨에서, 톤 버스트에 대한 500 응답을 동기적 평균화(synchronous averaging)하였다. 임계값보다 큰 ABR은 규칙적인 간격의 파동으로 구성되었다 (I 내지 IV). 톤 버스트 수준은 10dB 내지 120dB SPL 피크 등가(peak-equivalent)에서 변화하는 반면, ABR 임계값은 적어도 하나의 반복가능한 파동(wave) IV 40.3 mV를 생성하는데 필요한 최소 자극 수준으로 수득하였다. 도 7은 6 및 9개월령의 TMEM43+/+ 및 TMEM43+/tm1Cby 마우스에서 4, 8, 16, 및 32 kHz에 대한 평균 ABR 임계값을 나타낸다. 도 7에 나타낸 바와 같이, TMEM43+/ tm1Cby 마우스는 ABR 임계값이 야생형의 ABR 임계값에 비하여 높은 것을 알 수 있다. ABR was performed in an anechoic room. Mice were treated with 0.1 mg levomepromazin chlorhydrate and about 3.5 mg ketamine chlorhydrate was intravenously administered to 15 g mice by intraperitoneal injection. The ABR collected and analyzed the response to a short tone burst calibrated in the range of 4 to 32 kHz. Electroencephalograms were recorded via stainless steel electrodes under the vertices and ipsilateral mastoids using a standard digital averaging system. At all sound levels, 500 responses to tone bursts were synchronous averaging. ABRs greater than the threshold consisted of waves of regular intervals (I to IV). The tone burst level varies from 10 dB to 120 dB SPL peak-equivalent, while the ABR threshold was obtained at the minimum stimulation level required to generate at least one repeatable wave IV 40.3 mV. Figure 7 shows the mean ABR threshold for 4, 8, 16, and 32 kHz in TMEM43 + / + and TMEM43 + / tm1Cby mice at 6 and 9 months of age. As shown in Fig. 7, TMEM43 + / tm1Cby The mouse shows that the ABR threshold is higher than the wild type ABR threshold.
5. 5. TMEM43의TMEM43 특징 확인 Identify features
세포 패치 클램프 기술(cell patch-clamp technique)을 이용하여 TMEM43의 기능을 확인하였다. 세포 패치 클램프 기술은 전기 신호를 측정하는 방법으로 알려져 있다. 유리 마이크로 피펫 (micropipette) 안의 전극을 통해 세포 하나에서 오는 전기 신호를 측정할 수 있다. 전압을 조절하여 그에 따른 전류를 측정하여 세포에 발현된 이온 통로의 특징을 알 수 있다. 실험 조건에 따라 마이크로 피펫 안과 세포 밖의 이온 농도를 조절할 수 있고 약을 처리하거나 pH를 변화시키며 이온 통로의 특징을 파악할 수 있다. The function of TMEM43 was confirmed using a cell patch-clamp technique. Cell patch clamp technology is known as a method of measuring electrical signals. An electrode in a glass micropipette can measure the electrical signal from one cell. By controlling the voltage and measuring the current according to the voltage, the characteristic of the ion channel developed in the cell can be known. Depending on the experimental conditions, it is possible to control the ion concentration of the micropipette and the extracellular space, to characterize the ion channel by treating the drug or changing the pH.
구체적으로, 중국 햄스터 난소(CHO-K1) 세포에서 인간 TMEM43을 발현시키고, 전압 클램프 하에서 막 전류를 측정하였다. Specifically, human TMEM43 was expressed in Chinese hamster ovary (CHO-K1) cells and membrane current was measured under voltage clamp.
도 8은 TMEM43을 발현시킨 CHO-K1 세포에서 세포 패치 클램프 기술을 이용하여 TMEM43의 기능을 확인한 결과이다.FIG. 8 shows the results of confirming the function of TMEM43 using cell patch clamp technology in CHO-K1 cells expressing TMEM43.
TMEM43 단백질이 거의 발현되어 있지 않은 CHO-K1 세포는 전기 신호가 흐르지 않지만, TMEM43 단백질을 발현시킨 CHO-K1 세포는 전기 신호를 전달한다(도 8a).CHO-K1 cells in which TMEM43 protein is almost not expressed do not pass an electric signal, but CHO-K1 cells expressing TMEM43 protein transmit electric signals (Fig. 8A).
세포 내의 K+ 이온을 제거하고 세포 밖의 Na+ 이온을 제거하면 전류가 줄어든다. 따라서, TMEM43을 통해 세포 밖의 Na+ 이온과 세포 안의 K+ 이온이 동시에 흐르는 것을 알 수 있다. 또한 이 경우 이온 통로를 통해 움직이는 이온에 의한 평형전위도 바뀌는 것으로 보아 TMEM43 는 이온의 움직임을 조절하는 이온통로로 고려할 수 있다(도 8b). 반복 실험을 통한 전류 크기와 평형전위 크기의 평균값은 측정한 결과는 도 8c 및 8d에 나타내었다. Removal of K + ions in the cells and removal of extracellular Na + ions reduces the current. Therefore, it can be seen that Na + ions outside the cells and K + ions inside the cells simultaneously flow through the TMEM43. In this case, the equilibrium potential due to the ions moving through the ion channel also changes, so that TMEM43 can be considered as an ion path for controlling the movement of ions (Fig. 8B). The average values of the current magnitude and the equilibrium potential magnitude through the repeated experiment are shown in Figs. 8c and 8d.
추가로, 비선택적 양이온 통로 억제제인 GdCl3를 처리한 경우(도 8e 및 8f)와 세포 밖 pH를 낮춘 경우(도 8g 및 8h), TMEM43 이온 통로가 막히는 것으로 보아, TMEM43은 세포 밖 pH를 감지하는 비선택적 양이온 통로인 것을 알 수 있다.In addition, when the non-selective cation channel inhibitor, GdCl 3 (FIGS. 8 e and 8 f) and the extracellular pH were lowered (FIGS. 8 g and 8 h), the TMEM43 ion channel was clogged, Which is a non-selective cation passage.

Claims (21)

  1. TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 감각신경성 난청 질환의 진단용 조성물. A polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof for detecting the TMEM43 mutation.
  2. 청구항 1에 있어서, 상기 변이는 표준 유전체 DNA에 대하여 뉴클레오티드 서열의 변이를 포함하는 것인 진단용 조성물. 2. The diagnostic composition of claim 1, wherein the mutation comprises a variation of the nucleotide sequence relative to standard DNA.
  3. 청구항 2에 있어서, 상기 뉴클레오티드 서열의 변이는 표준 유전체 DNA에 대하여 하나 이상의 뉴클레오티드 서열의 치환, 삽입, 결실, 또는 전좌를 포함하는 것인 진단용 조성물. 3. The diagnostic composition of claim 2, wherein the variation of the nucleotide sequence comprises substitution, insertion, deletion, or translocation of one or more nucleotide sequences relative to standard DNA.
  4. 청구항 1에 있어서, 상기 변이는 서열번호 1의 아미노산 서열에서 p.R372X, 또는 서열번호 2의 뉴클레오티드 서열에서 c.C1114T인 것인 진단용 조성물. The diagnostic composition of claim 1, wherein said mutation is p.R372X in the amino acid sequence of SEQ ID NO: 1, or c.C1114T in the nucleotide sequence of SEQ ID NO: 2.
  5. 청구항 1에 있어서, 상기 폴리뉴클레오티드는 길이가 10 내지 100개의 뉴클레오티드인 것인 진단용 조성물. The diagnostic composition of claim 1, wherein the polynucleotide is from 10 to 100 nucleotides in length.
  6. 청구항 1에 있어서, 상기 감각신경성 난청 질환은 청각신경병증(auditory neuropathy)인 것인 진단용 조성물. The diagnostic composition of claim 1, wherein the sensory neuron deafness disorder is auditory neuropathy.
  7. 개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계; 및 Identifying a nucleotide sequence of the genomic DNA isolated from the subject; And
    상기 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계를 포함하는 감각신경성 난청 질환의 진단에 관한 정보를 제공하기 위하여 유전체 DNA의 변이를 검출하는 방법.Comparing the confirmed nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA, and detecting the mutation of the genomic DNA.
  8. 청구항 7에 있어서, 상기 유전체 DNA의 변이는 표준 유전체 DNA에 대하여 뉴클레오티드 서열의 변이를 포함하는 것인 방법.8. The method of claim 7, wherein the variation of the genomic DNA comprises a variation of a nucleotide sequence relative to a standard genomic DNA.
  9. 청구항 8에 있어서, 상기 뉴클레오티드 서열의 변이는 표준 유전체 DNA에 대하여 하나 이상의 뉴클레오티드 서열의 치환, 삽입, 결실, 또는 전좌를 포함하는 것인 방법.9. The method of claim 8, wherein the variation of the nucleotide sequence comprises substitution, insertion, deletion, or translocation of one or more nucleotide sequences to standard DNA.
  10. 청구항 7에 있어서, 상기 변이는 서열번호 2의 뉴클레오티드 서열에서 c.C1114T인 것인 방법. The method according to claim 7, wherein the mutation is c.C1114T in the nucleotide sequence of SEQ ID NO: 2.
  11. TMEM43 변이를 검출하기 위하여 TMEM43 유전자의 엑손 영역의 뉴클레오티드 서열로부터 선택된 연속 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 조성물. A composition for predicting a prognosis for a transplantation of a sensory neural deaf person comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene to detect the TMEM43 mutation or a complementary polynucleotide thereof.
  12. 청구항 11에 있어서, 상기 변이는 표준 유전체 DNA에 대하여 뉴클레오티드 서열의 변이를 포함하는 것인 진단용 조성물. 12. The diagnostic composition of claim 11, wherein the mutation comprises a variation of the nucleotide sequence relative to standard DNA.
  13. 청구항 12에 있어서, 상기 뉴클레오티드 서열의 변이는 표준 유전체 DNA에 대하여 하나 이상의 뉴클레오티드 서열의 치환, 삽입, 결실, 또는 전좌를 포함하는 것인 진단용 조성물. 13. The diagnostic composition of claim 12, wherein the variation of the nucleotide sequence comprises substitution, insertion, deletion, or translocation of one or more nucleotide sequences relative to standard DNA.
  14. 청구항 11에 있어서, 상기 변이는 서열번호 1의 아미노산 서열에서 p.R372X, 또는 서열번호 2의 뉴클레오티드 서열에서 c.C1114T인 것인 진단용 조성물. 12. The diagnostic composition according to claim 11, wherein the mutation is p.R372X in the amino acid sequence of SEQ ID NO: 1 or c.C1114T in the nucleotide sequence of SEQ ID NO:
  15. 청구항 11에 있어서, 상기 폴리뉴클레오티드는 길이가 10 내지 100개의 뉴클레오티드인 것인 진단용 조성물. 12. The diagnostic composition of claim 11, wherein the polynucleotide is from 10 to 100 nucleotides in length.
  16. 청구항 11에 있어서, 상기 감각신경성 난청 질환은 청각신경병증(auditory neuropathy)인 것인 진단용 조성물. 12. The diagnostic composition of claim 11, wherein the sensory neuron deafness disorder is auditory neuropathy.
  17. 개체로부터 분리된 유전체 DNA의 뉴클레오티드 서열을 확인하는 단계; 및 Identifying a nucleotide sequence of the genomic DNA isolated from the subject; And
    상기 유전체 DNA의 확인된 뉴클레오티드 서열을 표준 뉴클레오티드 서열과 비교하여, 상기 유전체 DNA의 변이를 확인하는 단계를 포함하는 감각신경성 난청 환자의 와우 이식수술에 대한 예후를 예측하기 위한 정보를 제공하기 위하여 유전체 DNA의 변이를 검출하는 방법.Comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA; providing genomic DNA to provide information for predicting the prognosis for a wart operation in a patient with sensory- / RTI &gt;
  18. 청구항 17에 있어서, 상기 유전체 DNA의 변이는 표준 유전체 DNA에 대하여 뉴클레오티드 서열의 변이를 포함하는 것인 방법.18. The method of claim 17, wherein the variation of the genomic DNA comprises a variation of a nucleotide sequence relative to a standard genomic DNA.
  19. 청구항 18에 있어서, 상기 뉴클레오티드 서열의 변이는 표준 유전체 DNA에 대하여 하나 이상의 뉴클레오티드 서열의 치환, 삽입, 결실, 또는 전좌를 포함하는 것인 방법.19. The method of claim 18, wherein the variation of the nucleotide sequence comprises substitution, insertion, deletion, or translocation of one or more nucleotide sequences relative to the standard genomic DNA.
  20. 청구항 17에 있어서, 상기 변이는 서열번호 2의 뉴클레오티드 서열에서 c.C1114T인 것인 방법. The method according to claim 17, wherein the mutation is c.C1114T in the nucleotide sequence of SEQ ID NO: 2.
  21. TMEM43 변이를 포함하는 감각신경성 난청 질환 동물 모델.Animal models of sensory neural deafness including TMEM43 mutations.
PCT/KR2018/012442 2017-10-19 2018-10-19 Marker tmem43 for sensorineural hearing loss diagnosis, and use thereof WO2019078684A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170135863A KR102058624B1 (en) 2017-10-19 2017-10-19 Marker TMEM43 for diagnosing sensorineural hearing loss and uses thereof
KR10-2017-0135863 2017-10-19

Publications (3)

Publication Number Publication Date
WO2019078684A2 true WO2019078684A2 (en) 2019-04-25
WO2019078684A3 WO2019078684A3 (en) 2019-06-27
WO2019078684A9 WO2019078684A9 (en) 2019-08-08

Family

ID=66173412

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/012442 WO2019078684A2 (en) 2017-10-19 2018-10-19 Marker tmem43 for sensorineural hearing loss diagnosis, and use thereof

Country Status (2)

Country Link
KR (1) KR102058624B1 (en)
WO (1) WO2019078684A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022032151A1 (en) * 2020-08-07 2022-02-10 University Of Miami Treatment of sensorineural deafness

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102326582B1 (en) 2020-05-15 2021-11-16 사회복지법인 삼성생명공익재단 Marker for diagnosing hearing impairment and deafness and use thereof
JP2024516749A (en) * 2021-04-30 2024-04-16 ソウル ナショナル ユニバーシティ ホスピタル Method for predicting the effectiveness of cause-specific treatment for sensorineural hearing loss and diagnostic kit used therefor

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022032151A1 (en) * 2020-08-07 2022-02-10 University Of Miami Treatment of sensorineural deafness

Also Published As

Publication number Publication date
KR102058624B1 (en) 2020-01-22
WO2019078684A3 (en) 2019-06-27
KR20190043845A (en) 2019-04-29
WO2019078684A9 (en) 2019-08-08

Similar Documents

Publication Publication Date Title
US20220205045A1 (en) Raf1 fusions
Beetz et al. Exome sequencing identifies a REEP1 mutation involved in distal hereditary motor neuropathy type V
Hildebrand et al. DFNA8/12 caused by TECTA mutations is the most identified subtype of nonsyndromic autosomal dominant hearing loss
US10875930B2 (en) PIK3C2G fusions
Mackay et al. Exome sequencing identifies a missense variant in EFEMP1 co-segregating in a family with autosomal dominant primary open-angle glaucoma
WO2019078684A2 (en) Marker tmem43 for sensorineural hearing loss diagnosis, and use thereof
Bonnet et al. Biallelic nonsense mutations in the otogelin-like gene (OTOGL) in a child affected by mild to moderate hearing impairment
JP5686335B2 (en) Diagnostic marker and method for amyotrophic lateral sclerosis, model animal that develops amyotrophic lateral sclerosis, and model cell
Tapia del Fierro et al. SMCHD1 has separable roles in chromatin architecture and gene silencing that could be targeted in disease
Collin et al. Mid-frequency DFNA8/12 hearing loss caused by a synonymous TECTA mutation that affects an exonic splice enhancer
Marchal et al. Misregulation of mitotic chromosome segregation in a new type of autosomal recessive primary microcephaly
Ryu et al. Identification of a novel splicing mutation within SLC17A8 in a Korean family with hearing loss by whole-exome sequencing
JP2008237204A (en) Diseased model animal, cell, tissue, orchis, animal for mating, method for producing germ cell, germ cell, cultured cell, screening method, medicinal composition, pregnacy-diagnosing kit, detection method, polynucleotide, polypeptide, and antibody
WO2009094713A1 (en) Diagnosis and treatment of sensory defect
Liang et al. A novel variant in the CDH23 gene is associated with non-syndromic hearing loss in a Chinese family
Cheng et al. Novel, pathogenic insertion variant of GSDME associates with autosomal dominant hearing loss in a large Chinese pedigree
Priyadarshi et al. The risks of RELN polymorphisms and its expression in the development of otosclerosis
Redfield et al. PKHD1L1, A Gene Involved in the Stereocilia Coat, Causes Autosomal Recessive Nonsyndromic Hearing Loss
Pau et al. Hush puppy: a new mouse mutant with pinna, ossicle, and inner ear defects
JP4905901B2 (en) Diagnosis and treatment of autism with CD38
RU2380423C2 (en) Method for manifestation of alzheimer&#39;s disease
Chiereghin Unravelling the Genetic Bases of Hearing Loss: Functional Characterisation of Pathogenic Variants and Novel Candidate Genes Identified by Whole-Exome Sequencing
Young et al. Sonic Hedgehog Intron Variant Associated With an Unusual Pediatric Cortical Cataract
Odeh et al. Characterization of two transgene insertional mutations at pirouette, a mouse deafness locus
Manyisa et al. A monoallelic variant in REST is associated with non-syndromic autosomal dominant hearing impairment in a South African family. Genes. 2021

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18868594

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18868594

Country of ref document: EP

Kind code of ref document: A2