WO2009094713A1 - Diagnosis and treatment of sensory defect - Google Patents

Abstract

The present invention relates to methods for the detection and treatment of a sensory neuropathy in a mammal, including a human, comprising screening for a mutation in the Synaptojanin-2 gene or its expression product. More particularly, the present invention provides diagnostic assays and therapeutic targets for hearing impairment or other sensory neuropathies. Animal models of deafness are also provided.

Description

DIAGNOSIS AND TREATMENT OF SENSORY DEFECT

FILING DATA

[0001] This application is associated with and claims priority from Australian Provisional Patent Application No. 2008900381, filed on 29 January 2008, the entire contents of which are incorporated herein by reference.

FIELD

[0002] The present invention relates generally to the detection and treatment of a sensory defect including peripheral neuropathy in a mammal, including a human. More particularly, the present invention provides diagnostic assays and therapeutic targets for hearing impairment and other sensory defects including peripheral neuropathies. Animal models of sensory neuropathies are also provided.

BACKGROUND

[0003] Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.

[0004] Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.

[0005] Hearing impairment is the most common sensory defect in humans, affecting approximately 10% of Australians. Studies have shown that approximately 1 in 1000 infants are born with a level of deafness that will affect their linguistic development and speech perception (McHugh and Friedman, Anat. Rec. A Discov. MoI. Cell Evol. Biol. 288(4):370-3$\, 2006). Hearing loss usually has a negative impact on education, social interactions and career opportunities and is, therefore, associated with major social and financial costs. The impact of hearing loss upon an individual can be quite significant (Yoshinaga-Itano, Otolaryngol Clin. North Am. 32^:1089-1102, 1999; Mohr and Feldman, Int J Technol Assess health Care 7(5^:1120-1135, 2000).

[0006] The degree of hearing loss varies from mild to profound deafness. It can be stable or the hearing loss can progress with time. The deafness can be present at birth or develop late in life. By far the largest group of people with a hearing loss are amongst the elderly, many of whom develop an age-related hearing loss or presbyacusis (Petit, Trends MoI. Med. 12(2):57-64, 2006). Both genetic and environmental factors can cause deafness. Genetic factors are the underlying aetiology of deafness in the majority of children and young people with a hearing loss. It is also known that genetic factors play a significant role in age-related hearing loss. Hearing loss can be associated with other clinical features (syndromic hearing loss) or isolated (non-syndromic hearing loss) [Petersen and Willems, Clin. Genet 69(5):37l-392, 2006].

[0007] There has been significant progress in the area of inherited non-syndromic deafness over the last 10-15 years. More than 40 "deafness" genes - out of a predicted 2-300 genes - have so far been identified. Despite this, little is known about the molecular and cellular basis of hearing loss in humans. This is especially the case in regard to presbyacusis and the genetic factors affecting the impact of environmental insults on hearing (Nance, Ment Retard Dev Disabil Res Rev 9(2) : 109- 119, 2003). Considering that a high proportion of the elderly are afflicted by some level of deafness, further research into the molecular, genetic and cellular features of later-onset hearing loss is crucial in order to understand and prevent this debilitating condition.

[0008] Mutations in genes may be heterozygous or homozygous. A digenic condition is a condition where mutations in two different genes combine to cause disease. On their own the mutations may not cause severe or obvious disease.

[0009] Hearing loss is an example of a condition that combines both environmental and genetic factors. Hearing impairment can result from various environmental factors such as, premature birth, infections (including cytomegalovirus infection during pregnancy) and exposure to excessive loud noise and to ototoxic drugs (which include commonly used aminoglycoside antibiotics and anticancer drugs) [McHugh and Friedman, supra 2006]. It is also probable that the chances of developing deafness at an older age increase if exposed to any, if not all these environmental factors throughout life. The chances would also be dramatically increased if you have an existing genetic susceptibility for deafness.

[0010] Despite the fact that many genes and environmental factors are involved deafness, investigation of the inheritance pattern in individual families with a genetic hearing loss usually reveal simple Mendelian inheritance. Inherited hearing impairment is therefore often classified according to the mode of inheritance. A very high proportion of non- syndromic genetic deafness cases (~80%) show autosomal-recessive inheritance.

Approximately 20% of cases show autosomal dominant inheritance. There has also been some X-chromosome linked and mitochondrial forms documented, but they only constitute a very small percentage of cases (Morton, Ann N Y Acad Sci 630:16-31, 1991).

[0011] There is a need to identify the genetic bases associated with sensory defects including peripheral neuropathies such as deafness to, for example, allow medical and behavioral protocols to be implemented prior to any adverse affects to an individual's development or wellbeing.

- A -

SUMMARY

[0012] Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

[0013] Hearing impairment is the most common sensory defect in humans. A "sensory defect" includes a peripheral neuropathy. Both genetic and environmental factors contribute to sensory neuropathies. The present invention employs animal models to identify genes and genetic regions where a mutation therein is associated with a sensory defect such as hearing loss and other sensory including peripheral neuropathies.

[0014] A particularly useful animal model includes mice mutagenized by N-ethyl-N- nitroso urea (ENU). ENU is an alkylating agent which is highly mutagenic in mouse spermatogonial germ cells. ENU generates random point mutations at a high rate and predominantly in the coding regions of genes. ENU-induced animal models of inherited sensory defects such as hearing loss provide a useful means to screen for potential diagnostic and therapeutic agents. The animal models of the present invention further enable formulation of a "carrier susceptibility matrix" which defines a predisposition to age-related and congenital sensory defects. Such a matrix enables early intervention by, for example, occupational health and safety and therapeutic protocols.

[0015] Using ENU mouse models, genes associated with hearing loss are identified. The genes identified include synapotjanin-2 (Synj2) and/or other genes in the phosphoinositi de- signaling pathway (also referred to herein as the "Synj2 pathway"). A mutation, for example, in Synj2 (e.g. causing an Asn to Lys substitution at position 453) results in a level of age-related deafness and other sensory neuropathies. The mutation may be homozygous or heterozygous and, in either case, may be in association with a mutation in one or more other genes such as TCMI, pendrin, myosin! a, usherin, cadherin23 (cdh23) and/or connexin or other gene associated with a sensory including peripheral neuropathy. [0016] Reference to "connexin" includes any connexin gene such as connexin 26.

[0017] Single or multiple mutations including polymorphisms may occur in one or more genes associated with the sensory neuropathy.

[0018] Alternatively, the mutation may be in another gene of the phosphoinositide signaling pathway. Mammalian equivalents of these genes and in particular human homologs are proposed to be targets for genetic or proteomic assays for sensory neuropathy such as deafness or a predisposition thereto.

[0019] Interactions between Synj2 (or its gene product) and another gene or gene product including cdh23 and/or connexin are also proposed to be targets for diagnostic agents or therapeutic agents.

[0020] Hence, the identification of the selected mutations provides a prognostic indicator of a predisposition for deafness or a clinical diagnosis of deafness or other sensory defects including peripheral neuropathies.

[0021] Reference to "deafness" includes in particular non-syndromic deafness and age- related deafness.

[0022] Early diagnosis also enables implementation of treatment regimes including the use of drugs to compensate genetic mutations, gene therapy as well as behavioral modifications including occupational health and safety protocols.

[0023] Accordingly, the present invention provides a method for identifying a sensory neuropathy in an individual, said method comprising screening for a mutation in a gene or gene expression product associated with the Synaptojanin-2 (Synj2) pathway, which mutation is indicative of a sensory neuropathy or risk of developing same, wherein the presence of the mutation provides an indication of the sensory neuropathy. Another aspect of the present invention is directed to a use of a gene or gene product selected from:

(i) Synj2;

(ii) cdh23;

(iii) a gene in the Synj2 pathway;

(iv) connexin, pendrin, myosin7a, usherin and/or TCMl; and

(v) FIG4, MTMR2, SBF2, FGD4, SPASTI, Synjl and/or ZIN

in the manufacture of a diagnostic assay in the detection or monitoring of a sensory including peripheral neuropathy such as deafness.

[0024] Yet another aspect of the present invention provides a use of an animal model genetically modified to induce a mutation in a gene of the Synj2 pathway associated with a sensory neuropathy in manufacture of a medicament or diagnostic for the treatment or detection of sensory neuropathy.

[0025] A list of abbreviations used herein is provided in Table 1.

Table 1 Abbreviations

[0026] A list of particular "deafness genes" or "deafness regions" and genetic regions associated with sensory neuropathies is provided in Table 2. The term "connexin" includes connexin26 and other connexin genes.

Table 2 Deafness Genes or Regions

Gene or Region synaptojanin2 (Synj2) connexin26 connexin cadherin23 (cdh23) myosin7a pendrin usherin

TMCl

Synjl

FIG4

MTMR2

SBF2

FGD4

SPASTI

ZIN

Region 58.1-60.2 Mb of chromosome 10

Region near Dl 9Mi t41 of chromosome 19

Region 74-90 Mb of chromosome 7 [0027] The present invention is directed to any mutation in Synj2 (or its gene product) associated with deafness or other sensory including peripheral neuropathy. The present invention is also directed to any mutation in Synj2 [heterozygous or homozygous] (or its gene product) associated with deafness, alone or in combination with any mutation(s) in gene(s) associated with deafness such as connexin26, cdh23, pendrin, myosin7a, usherin or TMCl (or their gene products) or a site of interaction between Synj2 and one or more of connexin (including other connexin genes such as connexin26), cdh23, pendrin, usherin, and/or TMCl or genes associated with deafness or other sensory neuropathy. The present invention also encompasses any mutation in any gene in the phosphoinositide signaling pathway (Synj2 pathway) associated or linked with a sensory including peripheral neuropathy. Examples of genes in addition to those listed above include FIG4, MTMR2, SBF2, FGD4, SPASTI, ZIN and Synjl.

[0028] Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO). The SEQ ID NOs correspond numerically to the sequence identifiers <400>l (SEQ ID NO:1), <400>2 (SEQ ED NO:2), etc. A mutation or polymorphism of the nucleotide or amino acid sequence is referred to as "XnY" where nucleotide or amino acid Y replaces the nucleotide or amino acid X at nucleotide or amino acid position n.

[0029] A summary of sequence identifiers used throughout the subject specification is provided in Table 3. Table 3 Summary of sequence identifiers

56 cdh23 reverse

57 cdh23 forward

58 cdh23 reverse

59 cdh23 forward

60 cdh23 reverse

61 Mysoin Vila forward

62 Mysoin Vila reverse

63 Mysoin Vila forward

64 Mysoin Vila reverse

65 Mysoin Vila forward

66 Mysoin Vila reverse

67 Mysoin Vila forward

68 Mysoin Vila reverse

69 Mysoin Vila forward

70 Mysoin Vila reverse

71 Mysoin Vila forward

72 Mysoin Vila reverse

73 Mysoin Vila forward

74 Mysoin Vila reverse

75 Mysoin Vila forward

76 Mysoin Vila reverse

77 Mysoin Vila forward

78 Mysoin Vila reverse

79 Mysoin Vila forward

80 Mysoin Vila reverse

81 Mysoin Vila forward

82 Mysoin Vila reverse

83 Mysoin Vila forward

84 Mysoin Vila reverse 85 W maa Mysaoin Vailaa forwaardmaasBm

86 Mysoin Vila reverse

87 Mysoin Vila forward

88 Mysoin Vila reverse

89 Mysoin Vila forward

90 Mysoin Vila reverse

91 Mysoin Vila forward

92 Mysoin Vila reverse

93 Mysoin Vila forward

94 Mysoin Vila reverse

95 Mysoin Vila forward

96 Mysoin Vila reverse

97 Mysoin Vila forward

98 Mysoin Vila reverse

99 Mysoin Vila forward

100 Mysoin Vila reverse

101 Mysoin Vila forward

102 Mysoin Vila reverse

103 Mysoin Vila forward

104 Mysoin Vila reverse

105 Mysoin Vila forward

106 Mysoin Vila reverse

107 Mysoin Vila forward

108 Mysoin Vila reverse

109 Mysoin Vila forward

110 Mysoin Vila reverse

111 Mysoin Vila forward

112 Mysoin Vila reverse

113 Mysoin Vila forward

BRIEF DESCRIPTION OF THE FIGURES

[0030] Some figures contain color representations or entities. Color photographs are available from the Patentee upon request or from an appropriate Patent Office. A fee may be imposed if obtained from a Patent Office.

[0031] Figure 1 is a photographic representation of the PCT product obtained by tandem PCR of Synj ^'2 Exon 12. Products in the top row are the primary PCR using Guthrie card lysates as templates. Amplification products from nested PCR of Exon 12 are found in the lower row amplified using diluted primary PCR as templates and nested primers.

[0032] Figure 2 shows an representative example of a standard pre-HRM Real-Time PCR amplification of 48 nested PCR samples in duplicates, and the following HRM melt curve. All 96 samples have similar amplification profiles and plateau after 45-46 cycles.

[0033] Figures 3a through c is a graphical representation of Exon with 48 samples in duplicates with one sample showing changed HRM behavor. Graph A shows the normalized melt plot followed by the difference graph and last is the derivative melt curves (dF/dT). In Graph C, only the sample variant (Red) and two WT samples (Blue and Green) are shown.

[0034] Figures 4a through c is a graphical representation of the three normalized HRM plots showing four of the variations identified in Exon 12. Graph A shows the HRM plot of the G1634A (R520H) variation compared to WT, Graph T1676C (M543T) change and Graph C, C 1730T (T552M) + C1695T (N340N) variations.

[0035] Figures 5a through c is a graphical representation of HRM plots with samples carrying SNP's in Exon 15 and 16 and the three different derivative melt curves (dF/dT) in Exon 17 caused by the common T2427C (V784V) polymorphism. DETAILED DESCRIPTION

[0036] The singular forms "a", "an" and "the" include single and plural aspects unless the context clearly indicates otherwise. Thus, for example, reference to "a mutation" includes a single mutation, as well as two or more mutations; reference to "an association" includes a single association or multiple associations; reference to "the invention" includes single or multiple aspects of an invention.

[0037] The invention is predicated in part on the identification of genetic profiles having a statistically significant association with a sensory defect, in particular deafness, and other sensory including peripheral neuropathies. The genetic profile is an indicator of an underlying physiological metabolic or anatomic state that is responsible for or at least exacerbates sensory neuropathy such as hearing loss. By "genetic profiles" is meant that an individual, exhibiting a particular level of sensory neuropathy or who is at risk of developing same, carries at least one mutation at or within one gene associated with or forming part of the phosphoinositide signaling pathway (also referred to herein as the Synj2 pathway) including a gene's 5' or 3' terminal regions, promoter, Exons or introns. The present invention is particularly directed to any mutation in Synj2 (or its gene product) associated with a sensory neuropathy such as deafness. The present invention is also directed to any mutation in Synj2 [heterozygous or homozygous] (or its gene product) associated with a sensory neuropathy such as deafness, in combination with any mutation in genes associated with deafness such as connexin (including any connexin gene such as connexin26), cdh23, TCMI, pendrin, myosin7a or usherin (or their gene products) or a site of interaction between Synj2 and one or more of the genes associated with deafness including connexin26, cdh23, pendrin, myosin7a, usherin and/or TMCl.

[0038] The present invention further contemplates mutations one or more genes selected from Synj2, FIG4, MTMR2, SBF2, GD4, SPASTI, ZIN and Synjl or other genes of the phosphoinositide signaling pathway (i.e. Synj2 pathway) or a combination of mutations in one or more of the above genes (or their gene products). [0039] The genetic profile may be homozygous or heterozygous, a single mutation or multiple mutations, in a single gene or in a panel of genes, which are physiologically, metabolically or anatomically linked to some level of a sensory neuropathy such as hearing impairment. A heterozygous or homozygous mutation in the Synj2 gene may be in combination with another mutation in a gene associated with the sensory neuropathy. A mutation includes and is encompassed by the term "polymorphism" and covers a nucleotide insertion, addition, substitution and deletion as well as a rearrangement or microsatellite.

[0040] A sensory neuropathy includes a peripheral neuropathy such as deafness.

[0041] Reference to "a gene associated with deafness" or "a gene associated with a sensory neuropathy" includes a gene selected from any gene listed in The Hereditary Hearing Loss Homepage (http://webhθl .ua.ac.be/hhh/) as well as any gene in the phosphoinositide signaling pathway including one or more mutations in one or more genes selected from Synj2, Synjl, cdh23, connexin, TCMI, pendrin, myosin7a, usherin, FIG4, MTMR2, SBF2, FGD4, SPASTI or ZIN. The present invention particularly encompasses a mutation in a genetic region listed in Table 2 associated with a sensory neuropathy. The term "connexin" includes any connexin gene such as connexin26.

[0042] In one embodiment, the genetic profile comprises at least one mutation in the murine Synj2 gene (Asn— »Lys at position 453) or its human equivalent. Particular examples of mutations in human Synj2 include G1586C [S504T] in Exon 11; G1634A [R520H] in Exon 12; T1676C [M534T] in Exon 12; G1690 [V539M] in Exon 12; C1695T [N340N] in Exon 12; C1730T [T552M] in Exon 12; G1773A [S562S] in Exon 12; G1785A [S566S] in Exon 12; C1800T [S571S] in Exon-12; C2042G [T656M] in Exon 15 and/or G2253A [D726N] in Exon 16, which are heterozygous mutations. A given gene may also contain more than one mutation or there may be a mutation in two or more genes. Again, it is to be noted that the present invention is directed to any mutation in Synj2 (or its gene product) associated with a sensory neuropathy such as deafness. The present invention is also directed to any mutation in Synj2 [heterozygous or homozygous] (or its gene product) associated with a sensory neuropathy, in combination with any mutation in genes known to be associated with deafness such as connexin 26, cdh23, pendrin, myosin! a, TMCl or usherin (or their gene products) or a site of interaction between Synj2 and one or more genes associated with deafness such as connexin26, connexin, cdh23, pendrin, myosin7a, TMCl or usherin. The present invention further ex tens to a mutation in one or more of FIG4, MTMR2, SBF2, FGD4, SPASTI, ZIN or Synjl or other gene in the phosphoinositide signaling pathway associated with a sensory neuropathy such as deafness. The gene "mysosin7a" may also be referred to as "Myosin VII a". Examples of mutations in substitution cdh23 include a valine to glutamine at amino acid number 2360; in myosin7a include an isoleucine to asparagine substitution at amino acid 487; and in TCMl, a tyrosine to histidine substitution at 499 or a tyrosine to cysteine substation at 182.

[0043] The order of the genes and genetic regions shown in Table 2 should not be taken as a ranking.

[0044] Accordingly, one aspect of the present invention contemplates a method for identifying a genetic profile associated with a sensory defect in a subject, the method comprising screening the subject for a mutation in a gene or region of the phosphoinositide pathway, including its 5' and 3' terminal regions, promoter, introns and Exons which has association to symptoms characterizing the sensory defect. Reference to a "sensory defect" includes a sensory neuropathy such as deafness.

[0045] Another aspect of the present invention provides a method for identifying a sensory neuropathy in an individual, said method comprising screening for a mutation in a gene or gene expression product associated with the phosphoinositide signaling pathway, which mutation is indicative of a sensory neuropathy or risk of developing same, wherein the presence of the mutation provides an indication of the sensory neuropathy.

[0046] Yet another aspect of the present invention provides a method for identifying a sensory neuropathy in an individual, said method comprising screening for a mutation in a gene or gene expression product associated with the Synaptojanin-2 (Synj2) pathway, which mutation is indicative of a sensory neuropathy or risk of developing same, wherein the presence of the mutation provides an indication of the sensory neuropathy.

[0047] The genetic locus comprising the genes or regions of the phosphoinositide pathway (including the genetic regions listed in Table 2) may be referred to as the "gene", "nucleic acid", "locus", "genetic locus" or "polynucleotide". Each refers to polynucleotides, all of which are in the gene region including its 5' or 3' terminal regions, promoter, introns or

Exons. According, the genes of the present invention are intended to include coding sequences, intervening sequences and regulatory elements controlling transcription and/or translation. A genetic locus is intended to include all allelic variations of the DNA sequence on either or both chromosomes. Consequently, homozygous and heterozygous variations of the instant genetic loci are contemplated herein.

[0048] The term "polymorphism" or "mutation" refers to a difference in a DNA or RNA sequence or sequences among individuals, groups or populations which give rise to a statistically significant phenotype or physiological condition. Examples of genetic polymorphisms include mutations that result by chance or are induced by external features.

These polymorphisms or mutations may be indicative of a disease or disorder and may arise following a genetic disease, a chromosomal abnormality, a genetic predisposition, a viral infection, a fungal infection, a bacterial infection or a protist infection or following chemotherapy, radiation therapy, substance abuse including alcohol or drug abuse or environmental factors such as noise. In one aspect, the mutation of the present invention is indicative of a sensory including peripheral neuropathy such as a hearing defect. Reference to a hearing defect includes complete loss of hearing or partial loss of hearing. In a particular embodiment, the defect is non-syndromic hearing loss or age related hearing loss such as presbyacusis. In another embodiment, the hearing loss is sensorineural recessive deafness.

[0049] Examples of nucleotide changes contemplated herein include single nucleotide polymorphisms (SNPs), multiple nucleotide polymorphisms (MNPs), frame shift mutations, including insertions and deletions (also called deletion insertion polymorphisms or DIPS), nucleotide substitutions, nonsense mutations, rearrangements and microsatellites. Two or more polymorphisms may also be used either at the same allele (i.e. haplotypes) or at different alleles. All these mutations are encompassed by the term "mutation".

[0050] The present invention provides, therefore, a genetic marker of a sensory defect such as hearing loss or impairment wherein the genetic marker is selected from a gene or region of the phosphoinositide signaling pathway or in cdh23, connexin (including connexin26 or other connexin genes), TCMI, pendrin, myosin7a or usherin. The present invention is also directed to any mutation in Synj2 [heterozygous or homozygous] (or its gene product) associated with a sensory neuropathy alone or in combination with any mutation in genes such as connexin, cdh23, pendrin, myosin7a, usherin, TMCl, Synjl, FIG4, MTMR2, SBF2, FGD4, SPASTI and ZIN (or their gene products) or a site of interaction between Synj2 and one or more of the genes associated with a sensory neuropathy such as connexin, cdh23, pendrin, myosin 7a, usherin, TMC 1 , Synjl , FIG4, MTMR2, SBF2, FGD4, SPASTI and ZIN

[0051] hi accordance with the present invention, an animal model involving mutagenesis protocols of animals and then screening for hearing impairment is employed. A particularly useful animal model comprises ENU-mutagenized mice. Through this model, the Synj2 gene was identified as being associated with hearing. A mutation in this gene results in hearing impairment. A mutation in cdh23 is also associated with hearing impairment or other sensory neuropathy.

[0052] Hence, another aspect of the present invention contemplates a diagnostic or prognostic assay for hearing impairment or other sensory neuropathy, the method comprising screening the Synj2 gene or gene product for a mutation associated with the hearing impairment or sensory neuropathy.

[0053] Yet another aspect of the present invention contemplates a diagnostic or prognostic assay for hearing impairment or other sensory neuropathy, the method comprising screening the cdh23 gene or gene product for a mutation associated with the hearing impairment or sensory neuropathy.

[0054] The Synj2 gene may comprise a homozygous mutation or a heterozygous mutation. Any mutation in the Synj2 gene or cdh23 gene may also be associated with another mutation such as in the connexin gene, TMCl gene, pendrin, myosin! a and/or usherin gene, or any gene in the phosphoinositide signaling pathway such as FIG4, MTMR2, SBF2, FGD4, SPASTI and/or ZIN

[0055] Hence, the present invention contemplates the use of a mutation in a gene selected from:

(i) Synj2;

(ii) cdh23\

(iii) a gene in the phosphoinositide signaling pathway;

(iv) connexin, connexin, pendrin, myosin7a, usherin and/or TCMl; and

(v) FIG4, MTMR2, SBF2, FGD4, SPASTI, Synjl and/or ZIN

in the manufacture of a diagnostic assay in the detection or monitoring of a sensory including peripheral neuropathy such as deafness.

[0056] Examples of gene mutations include mutations in:

(i) Synj2;

(ii) cdh23;

(iii) a gene in the phosphoinositide signaling pathway; (iv) connexin, connexin, pendrin, myosin7a, usherin and/or TCMl; and

(v) FIG4, MTMR2, SBF2, FGD4, SPASTI, Synjl and/or ZIN.

[0057] Still another aspect of the present invention provides a use of an animal model genetically modified to induce a mutation in a gene of the Synj2 pathway associated with a sensory neuropathy in manufacture of a medicament or diagnostic for the treatment or detection of sensory neuropathy.

[0058] Another aspect of the present invention involves screening a gene product such as RNA or protein.

[0059] Generally, the genetic test is part of an overall diagnostic protocol involving clinical assessment and diagnostic tools such as standard hearing tests. Consequently, this aspect of the present invention may be considered as a confirmatory test or part of a series of tests in the final diagnosis of a hearing impairment. The results may also be used to develop occupational health and safety protocols.

[0060] Accordingly, another aspect of the present invention provides a diagnostic assay for a genetic profile predetermined to be associated with a hearing impairment or other sensory neuropathy, the method comprising obtaining or extracting a DNA sample from cells or a proteomic sample from a subject and screening for or otherwise detecting the presence of a mutation in a gene or a gene product selected from:

(i) Synj2;

(ii) cdh23;

(iii) a gene in the phosphoinositide signaling (i.e. Synj2) pathway; (iv) connexin, pendrin, myosin! a, usherin and/or TCMl; and

(v) FIG4, MTMR2, SBF2, FGD4, SPASTI, Synjl and/or ZIN

alone or in combination with another mutation.

[0061] As indicated above, "connexin" includes any connexin gene such as connexin26.

[0062] The methods and assays of the present invention may also be used to detect "normal" hearing. In other words, an individual which may be at risk such as through his or her genetic lines or because of environmental factors or who has behavioral tendencies which suggest hearing impairment can be screened for the presence of a mutation such as in a gene or region in the phosphoinositide signaling pathway.

[0063] Reference herein to an "individual" includes a human which may also be considered a subject, patient, host, recipient or target. The "individual" may also be an animal model such as a murine or other rodent model or pig, sheep or non-human primate model.

[0064] The present invention enables, therefore, a stratification of individuals based on a genetic profile. The stratification or profiling enables early diagnosis, confirmation of a clinical diagnosis, treatment monitoring and treatment selection for a sensory neuropathy such as hearing impairment or a predisposition thereto.

[0065] Reference to the "Synj2 pathway" includes any gene encoding a product associated with the phosphoinositide signaling pathway.

[0066] There are many methods which may be used to detect a DNA sequence profile.

Direct DNA sequencing, either manual sequencing or automated fluorescent sequencing can detect sequence variation including a polymorphism or mutation. Another approach is the single-stranded conformation polymorphism assay (SSCP) [Orita, et al, Proc. Natl. Acad. Sci. USA. 86:2166-2170, 1989]. This method does not detect all sequence changes, especially if the DNA fragment size is greater than 200 bp, but can be optimized to detect most DNA sequence variation. The reduced detection sensitivity is a disadvantage, but the increased throughput possible with SSCP makes it an attractive, viable alternative to direct sequencing for mutation detection. The fragments which have shifted mobility on SSCP gels are then sequenced to determine the exact nature of the DNA sequence variation. Other approaches based on the detection of mismatches between the two complementary DNA strands include clamped denaturing gel electrophoresis (CDGE) [Sheffield et al, Proc. Natl. Acad. Sci. USA 5(5:232-236, 1989], heteroduplex analysis (HA) [White et al, Genomics 72:301-306, 1992] and chemical mismatch cleavage (CMC) [Grompe et al, Proc. Natl. Acad. Sci. USA 5(5:5855-5892, 1989]. None of the methods described above detects large deletions, duplications or insertions, nor will they detect a mutation in a regulatory region or a gene. Other methods which would detect these classes of mutations include a protein truncation assay or the asymmetric assay. A review of currently available methods of detecting DNA sequence variation can be found in Kwok, Curr Issues MoI. Biol 5(2j:43-60, 2003; Twyman and Primrose, Pharmacogenomics. 4(1):61-19, 2003; Edwards and Bartlett, Methods MoI. Biol. 22(5:287-294, 2003 and Brennan, Am. J. Pharmacogenomics. 1 (4):395-302, 2001. Once a mutation is known, an allele-specific detection approach such as allele-specific oligonucleotide (ASO) hybridization can be utilized to rapidly screen large numbers of other samples for that same mutation. Such a technique can utilize probes which are labeled with gold nanoparticles or any other reporter molecule to yield a visual color result (Elghanian et al, Science 277:1078-1081, 1997).

[0067] A rapid preliminary analysis to detect polymorphisms in DNA sequences can be performed by looking at a series of Southern blots of DNA cut with one or more restriction enzymes, preferably with a large number of restriction enzymes. Each blot contains a series of normal individuals and a series of individuals having a hearing defect. Southern blots displaying hybridizing fragments (differing in length from control DNA when probed with sequences near or to the genetic locus being tested) indicate a possible mutation or polymorphism. If restriction enzymes which produce very large restriction fragments are used, then pulsed field gel electrophoresis (PFGE) is employed. Alternatively, the desired region of the genetic locus being tested can be amplified, the resulting amplified products can be cut with a restriction enzyme and the size of fragments produced for the different polymorphisms can be determined.

[0068] Detection of point mutations may be accomplished by molecular cloning of the target genes and sequencing the alleles using techniques well known in the art. Also, the gene or portions of the gene may be amplified, e.g, by PCR or other amplification technique, and the amplified gene or amplified portions of the gene may be sequenced.

[0069] Methods for a more complete, yet still indirect, test for confirming the presence of a susceptibility allele include: 1) single-stranded conformation analysis (SSCP) [Orita et al, supra 1989]; 2) denaturing gradient gel electrophoresis (DGGE) [Wartell et al, Nucl. Acids Res. 75:2699-2705, 1990; Sheffield et al, supra 1989]; 3) RNase protection assays (Finkelstein et al, Genomics 7:167-172, 1990; Kinszler et al, Science 257:1366-1370, 1991); 4) allele-specific oligonucleotides [ASOs] [Conner et al, Proc. Natl. Acad. Sci. USA 50:278-282, 1983]; 5) the use of proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modrich Ann. Rev. Genet. 25:229-253, 1991); 6) allele-specific PCR (Ruano and Kidd, Nucl. Acids Res. 77:8392, 1989); and 7) PCR amplification of the site of the polymorphism followed by digestion using a restriction endonuclease that cuts or fails to cut when the variant allele is present.

[0070] Additionally, real-time PCR such as the allele specific kinetic real-time PCR assay can be used or allele specific real-time TaqMan probes.

[0071] For allele-specific PCR, primers are used which hybridize at their 3' ends to a particular target genetic locus or mutation. If the particular polymorphism or mutation is not present, an amplification product is not observed. Amplification Refractory Mutation System (ARMS) can also be used, as disclosed in European Patent Application Publication No. 0332435. Insertions and deletions of genes can also be detected by cloning, sequencing and amplification. In addition, restriction fragment length polymorphism (RFLP) probes for the gene or surrounding marker genes can be used to score alteration of an allele or an insertion in a polymorphic fragment. Such a method is particularly useful for screening relatives of an affected individual for the presence of the mutation found in that individual. Other techniques for detecting insertions and deletions as known in the art can be used.

[0072] In SSCP, DGGE and the RNase protection assay, an electrophoretic band appears which is absent if the polymorphism or mutation is not present. SSCP detects a band which migrates differentially because the sequence change causes a difference in single-strand, intramolecular base pairing. RNase protection involves cleavage of the mutant polynucleotide into two or more smaller fragments. DGGE detects differences in migration rates of mutant sequences compared to wild-type sequences, using a denaturing gradient gel. In an allele-specific oligonucleotide assay, an oligonucleotide is designed which detects a specific sequence, and the assay is performed by detecting the presence or absence of a hybridization signal, In the mutS assay, the protein binds only to sequences that contain a nucleotide mismatch in a heteroduplex between mutant and wild-type sequences.

[0073] Mismatches, according to the present invention, are hybridized nucleic acid duplexes in which the two strands are not 100% complementary. Lack of total homology may be due to deletions, insertions, inversions or substitutions. Mismatch detection can be used to detect point mutations in the gene or in its mRNA product. While these techniques are less sensitive than sequencing, they are simpler to perform on a large number of samples. An example of a mismatch cleavage technique is the RNase protection method. In the practice of the present invention, the method involves the use of a labeled riboprobe which is complementary to the human wild-type genes. The riboprobe and either mRNA or

DNA isolated from the person are annealed (hybridized) together and subsequently digested with the enzyme RNase A which is able to detect some mismatches in a duplex

RNA structure. If a mismatch is detected by RNase A, it cleaves at the site of the mismatch. Thus, when the annealed RNA preparation is separated on an electrophoretic gel matrix, if a mismatch has been detected and cleaved by RNase A, an RNA product will be seen which is smaller than the full length duplex RNA for the riboprobe and the mRNA or DNA. The riboprobe need not be the full length of the mRNA or gene but can be a segment of either. If the riboprobe comprises only a segment of the mRNA or gene, it will be desirable to use a number of these probes to screen the whole mRNA sequence for mismatches.

[0074] In similar fashion, DNA probes can be used to detect mismatches, through enzymatic or chemical cleavage (see, for example, Cotton et al, Proc. Natl. Acad. Sci. USA 57:4033-40371988; Shenk et al, Proc. Natl. Acad. ScL USA 72:989-993, 1975; Novack et al, Proc. Natl. Acad. Sci. USA <°3:586-590, 1986). Alternatively, mismatches can be detected by shifts in the electrophoretic mobility of mismatched duplexes relative to matched duplexes (see, for example, Cariello Am. J. Human Genetics 42:726-734, 1988). With either riboprobes or DNA probes, the cellular mRNA or DNA which might contain a mutation can be amplified using PCR (see below) before hybridization. Changes in DNA of the associated genetic polymorphisms or genetic loci can also be detected using Southern blot hybridization, especially if the changes are gross rearrangements, such as deletions and insertions.

[0075] DNA sequences of Synj2 or cdh23 or other genetic regions may be amplified using allele-specific probes. These probes are nucleic acid oligomers, each of which contains a region of the gene sequence harboring a known mutation. For example, one oligomer may be from about three to about 100 nucleotides in length such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,

13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,

37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,

85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100. An oligomer of about 20 nucleotides in length is particularly convenient. These oligomers correspond to a portion of the gene sequence. By use of a battery of such allele-specific probes, PCR amplification products can be screened to identify the presence of a previously identified mutation in the gene. Hybridization of allele-specific probes with amplified target gene sequences can be performed, for example, on a nylon filter. Hybridization to a particular probe under high stringency hybridization conditions indicates the presence of the same mutation in the tissue as in the allele-specific probe.

[0076] Once the site containing the polymorphisms has been amplified, the SNPs or MNPs can also be detected by primer extension. Here a primer is annealed immediately adjacent to the variant site, and the 5' end is extended a single base pair by incubation with di- deoxytrinucleotides. Whether the extended base was a A, T, G or C can then be determined by mass spectrometry (MALDI-TOF) or fluorescent flow cytometric analysis (Taylor et al, Biotechniques 30:661-669, 2001) or other techniques.

[0077] Nucleic acid analysis via microchip technology is also applicable to the present invention. In this technique, thousands of distinct oligonucleotide probes are built up in an array on a silicon chip. Nucleic acids to be analyzed are fluorescently labeled and hybridized to the probes on the chip. It is also possible to study nucleic acid-protein interactions using these nucleic acid microchips. Using this technique, one can determine the presence of mutations or even sequence the nucleic acid being analyzed or one can measure expression levels of a gene of interest. The method is one of parallel processing of many, including thousands, of probes at once and can tremendously increase the rate of analysis.

[0078] The most definitive test for mutations in the target loci is to directly compare genomic sequences from patients with those from a control population. Alternatively, one can sequence mRNA after amplification, e.g, by PCR, thereby eliminating the necessity of determining the Exon structure of the candidate gene.

[0079] Mutations falling outside the coding region of the target loci can be detected by examining the non-coding regions, such as introns and regulatory sequences near or within the genes. An early indication that mutations in non-coding regions are important may come from Northern blot experiments that reveal messenger RNA molecules of abnormal size or abundance in patients as compared to those of control individuals. [0080] Alteration of mRNA expression from the genetic loci can be detected by any techniques known in the art. These include Northern blot analysis, PCR amplification and RNase protection. Diminished mRNA expression indicates an alteration of the wild-type gene. Alteration of wild-type genes can also be detected by screening for alteration of wild-type protein. For example, monoclonal antibodies immunoreactive with a target protein (i.e. a protein encoded by a gene of the phosphoinositide signaling pathway) can be used to screen a tissue. Lack of cognate antigen or a reduction in the levels of antigen would indicate a mutation. Antibodies specific for products of mutant alleles could also be used to detect mutant gene product. Such immunological assays can be done in any convenient formats known in the art. These include Western blots, immunohistochemical assays and ELISA assays. Any means for detecting an altered protein can be used to detect alteration of the wild-type protein. Functional assays, such as protein binding determinations, can be used. In addition, assays can be used which detect the protein biochemical function. Finding a mutant gene product indicates alteration of a wild-type gene product.

[0081] Hence, the present invention further extends to a method for identifying a genetic basis behind a hearing impairment or other sensory neuropathy in an individual, the method comprising obtaining a biological sample from the individual and detecting a protein encoded by a nucleotide sequence having a mutation in one or more genes of the phosphoinositide signaling pathway including their 5¹ or 3' terminal region, promoter, intron or Exons wherein an altered amino acid sequence is indicative of the presence of a mutation and the likelihood of a sensory neuropathy.

[0082] Genes and gene products contemplated herein include:

(i) Synj2;

(ii) cdh23;

(iii) a gene in the phosphoinositide signaling (i.e. Synj2) pathway; (iv) connexin (including any connexin gene such as connexin26), pendrin, myosin7a, usherin and/or TCMl; and

(v) FIG4, MTMR2, SBF2, FGD4, SPASTI, Synjl and/or ZIN.

[0083] The altered amino acid sequence may be detected via specific antibodies which can discriminate between the presence or absence of an amino acid change, by amino acid sequencing, by a change in protein activity or cell phenotype and/or via the presence of particular metabolites if the protein is associated with a biochemical pathway.

[0084] A mutant gene or corresponding gene products can also be detected in other human body samples which contain DNA, such as serum, stool, urine and sputum. The same techniques discussed above for detection of mutant genes or gene products in tissues can be applied to other body samples. By screening such body samples, an early diagnosis can be achieved for subjects at risk of developing a particular hearing condition or other sensory neuropathy.

[0085] Primer pairs disclosed herein are useful for determination of the nucleotide sequence of a particular target gene using PCR. The pairs of single-stranded DNA primers can be annealed to sequences within or surrounding the gene in order to prime amplifying

DNA synthesis of the gene itself. A complete set of these primers allows synthesis of all of the nucleotides of the gene coding sequences, i.e., the Exons. The set of primers preferably allows synthesis of both intron and Exon sequences. Allele-specific primers can also be used. Such primers anneal only to particular polymorphic or mutant alleles, and thus will only amplify a product in the presence of the polymorphic or mutant allele as a template.

[0086] In order to facilitate subsequent cloning of amplified sequences, primers may have restriction enzyme site sequences appended to their 5' ends. Thus, all nucleotides of the primers are derived from the gene sequence or sequences adjacent the gene, except for the few nucleotides necessary to form a restriction enzyme site. Such enzymes and sites are well known in the art. The primers themselves can be synthesized using techniques which are well known in the art. Generally, the primers can be made using oligonucleotide synthesizing machines which are commercially available. Given the sequence of each gene and polymorphisms described herein, design of particular primers is well within the skill of the art. The present invention adds to this by presenting data on the intron/Exon boundaries thereby allowing one to design primers to amplify and sequence all of the Exonic regions completely.

[0087] The nucleic acid probes provided by the present invention are useful for a number of purposes. They can be used in Southern blot hybridization to genomic DNA and in the RNase protection method for detecting point mutations already discussed above. The probes can be used to detect PCR amplification products. They may also be used to detect mismatches in the target genes or mRNA using other techniques.

[0088] As used herein, the phrase "amplifying" refers to increasing the content of a specific genetic region of interest within a sample. The amplification of the genetic region of interest may be performed using any method of amplification known to those of skill in the relevant art. In once aspect, the present method for detecting a mutation utilizes PCR as the amplification step.

[0089] PCR amplification utilizes primers to amplify a genetic region of interest. Reference herein to a "primer" is not to be taken as any limitation to structure, size or function. Reference to primers herein, includes reference to a sequence of deoxyribonucleotides comprising at least three nucleotides. Generally, the primers comprises from about three to about 100 nucleotides, preferably from about five to about 50 nucleotides and even more preferably from about 10 to about 25 nucleotides such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides. The primers of the present invention may be synthetically produced by, for example, the stepwise addition of nucleotides or may be fragments, parts or portions or extension products of other nucleic acid molecules. The term "primer" is used in its most general sense to include any length of nucleotides which, when used for amplification purposes, can provide free 3' hydroxyl group for the initiation of DNA synthesis by a DNA polymerase. DNA synthesis results in the extension of the primer to produce a primer extension product complementary to the nucleic acid strand to which the primer has annealed or hybridized.

[0090] Accordingly, the present invention extends to an isolated oligonucleotide which comprises from about three to about 100 consecutive nucleotides from the Synj2 gene which encompass at least one mutation associated with or otherwise likely to be found in individuals with a hearing impairment.

[0091] In a preferred embodiment, one of the at least two primers is involved in an amplification reaction to amplify a target sequence. If this primer is also labeled with a reporter molecule, the amplification reaction will result in the incorporation of any of the label into the amplified product. The terms "amplification product" and "amplicon" may be used interchangeably.

[0092] The primers and the amplicons of the present invention may also be modified in a manner which provides either a detectable signal or aids in the purification of the amplified product.

[0093] A range of labels providing a detectable signal may be employed. The label may be associated with a primer or amplicon or it may be attached to an intermediate which subsequently binds to the primer or amplicon. The label may be selected from a group including a chromogen, a catalyst, an enzyme, a fluorophore, a luminescent molecule, a chemiluminescent molecule, a lanthanide ion such as Europium (Eu³⁴), a radioisotope and a direct visual label. In the case of a direct visual label, use may be made of a colloidal metallic or non-metallic particular, a dye particle, an enzyme or a substrate, an organic polymer, a latex particle, a liposome, or other vesicle containing a signal producing substance and the like. A large number of enzymes suitable for use as labels is disclosed in U.S. Patent Nos. 4,366,241, 4,843,000 and 4,849,338. Suitable enzyme labels useful in the present invention include alkaline phosphatase, horseradish peroxidase, luciferase, β- galactosidase, glucose oxidase, lysozyme, malate dehydrogenase and the like. The enzyme label may be used alone or in combination with a second enzyme which is in solution. Alternatively, a fluorophore which may be used as a suitable label in accordance with the present invention includes, but is not limited to, fluorescein-isothiocyanate (FITC), and the fluorochrome is selected from FITC, cyanine-2, Cyanine-3, Cyanine-3.5, Cyanine-5, Cyanine-7, fluorescein, Texas red, rhodamine, lissamine and phycoerythrin.

[0094] Examples of fluorophores are provided in Table 4.

Table 4 Fluorophores

Ex: Peak excitation wavelength (nm) Em: Peak emission wavelength (nm)

[0095] In order to aid in the purification of an amplicon, the primers or amplicons may additionally be incorporated on a bead. The beads used in the methods of the present invention may either be magnetic beads or beads coated with streptavidin.

[0096] The extension of the hybridized primer to produce an extension product is included herein by the term amplification. Amplification generally occurs in cycles of denaturation followed by primer hybridization and extension. The present invention encompasses form about one cycle to about 120 cycles, preferably from about two to about 70 cycles, more preferably from about five to about 40 cycles, including 10, 15, 20, 25 and 30 cycles, and even more preferably, 35 cycles such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,

41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64,

65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120 cycles.

[0097] In order for the primers used in the methods of the present invention to anneal to a nucleic acid molecule containing the gene of interest, a suitable annealing temperature must be determined. Determination of an annealing temperature is based primarily on the genetic make-up of the primer, i.e. the number of A, T, C and Gs, and the length of the primer. Annealing temperatures contemplated by the methods of the present invention are from about 40°C to about 80⁰C, preferably from about 50⁰C to about 70⁰C, and more preferably about 65°C such as 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,

56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or

80°C.

[0098] The PCR amplifications performed in the methods of the present invention include the use of MgCl₂ in the optimization of the PCR amplification conditions. The present invention encompasses MgCl₂ concentrations for about 0.1 to about 10 mM, preferably from 0.5 to about 5 mM, and even more preferably 2.5 mM such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 or 10 mM.

[0099] Polymorphisms of the present invention including SNPs, MNPs and multiple mutations may be detected due to the presence of a base mis-match in the heteroduplexes formed following PCR amplification. A base mis-match occurs when two nucleotide sequences are aligned with substantial complementarity but at least one base aligns to a base which would result in an "abnormal" binding pair. An abnormal binding pair occurs when thymine (T) were to bind to a base other than adenine (A), if A were to bind to a base other than T, if guanine (G) were to bind to a base other than cytosine (C) or if C was to bind to a base other than G.

[0100] In order to detect the presence of alleles from the genes of the phosphoinositide signaling pathway predisposing an individual to a hearing impairment or other sensory neuropathy, a biological sample such as blood is obtained and analyzed for the presence or absence of a selected mutation or panel of mutations in a single or multiple alleles. Microarray analysis is particularly convenient. Results of these tests and interpretive information are returned to the health care provider for communication to the tested individual. Such diagnoses may be performed by diagnostic laboratories, or, alternatively, diagnostic kits are manufactured and sold to health care providers or to private individuals for self-diagnosis. Suitable diagnostic techniques include those described herein as well as those described in U.S. Pat. Nos. 5,837,492, 5,800,998 and 5,891,628.

[0101] According to the present invention, a method is also provided for supplying wild- type genes of the phosphoinositide signaling pathway to a cell which carries a mutation. Supplying such a function should allow normal functioning of the recipient cells. The wild-type gene or a part of the gene may be introduced into the cell in a vector such that the gene remains extrachromosomal, in such a situation, the gene will be expressed by the cell from the extrachromosomal location. More preferred is the situation where the wild- type gene or a part thereof is introduced into the mutant cell in such a way that it recombines with the endogenous mutant gene present in the cell. Such recombination requires a double recombination event which results in the correction of the gene mutation. Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation, calcium phosphate co-precipitation and viral transduction are known in the art, and the choice of method is within the competence of the practitioner. Conventional methods are employed, including those described in U.S. Pat. Nos. 5,837,492, 5,800,998 and 5,891,628.

[0102] The identification of the association between a gene polymorphism/mutation and a hearing impairment or other sensory neuropathy permits the early presymptomatic screening of individuals to identify those at risk for developing the neuropathy or to identify the cause of such disorders or the risk that any individual will develop same. To identify such individuals, the alleles are screened as described herein or using conventional techniques, including but not limited to, one of the following methods: fluorescent in situ hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single stranded conformation analysis (SSCP), linkage analysis, RNase protection assay, allele-specific oligonucleotide (ASO), dot blot analysis and PCR-SSCP analysis. Also useful is DNA microchip technology. Such techniques are described in U.S. Pat. Nos. 5,837,492; 5,800,998 and 5,891,628, each incorporated herein by reference.

[0103] Genetic testing enables practitioners to identify or stratify individuals at risk for certain hearing disorders. For particular at risk couples, embryos or fetuses may be tested after conception to determine the genetic likelihood of the offspring being predisposed to a hearing disorder. Certain behavioral or therapeutic protocols may then be introduced from birth or early childhood to reduce the risk of the impairment adversely affecting development. Presymptomatic diagnosis will enable better treatment of these disorders, including the use of existing medical therapies. Genetic testing will also enable practitioners to identify individuals having diagnosed disorders (or in an at risk group) which have polymorphism identified in the genetic loci. Genotyping of such individuals will be useful for (a) identifying a hearing condition or other sensory neuropathy that will respond to drugs affecting gene product activity, (b) identifying a hearing condition or other sensory which respond well to specific medications or medication types with fewer adverse effects; and (c) guide new drug discovery and testing. The results may also guide occupational health and safety protocols.

[0104] Further, the present invention provides a method for screening drug candidates to identify molecules useful for treating a sensory neuropathy such as hearing loss involving the gene or its expression product. Drug screening is performed by comparing the activity of native genes and those described herein in the presence and absence of potential drugs. In particular, these drugs may have the affect of masking a polymorphism or mutation or may bind to a particular polymorphism or mutation enabling it to be used as a diagnostic agent. The terms "drug", "agent", "therapeutic molecule", "prophylactic molecule", "medicament", "candidate molecule" or "active ingredient" may be used interchangeable in describing this aspect of the present invention. [0105] The goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g, agonists, antagonists, inhibitors) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g, enhance or interfere with the function of a polypeptide in vivo or which are specific for a targetable (e.g. a polymorphism) and hence is a useful diagnostic. Several approaches for use in rational drug design include analysis of three-dimensional structure, alanine scans, molecular modeling and use of anti-id antibodies. These techniques are well known to those skilled in the art, including those described in U.S. Pat. Nos. 5,837,492; 5,800,998 and 5,891,628.

[0106] A substance identified as a modulator of polypeptide function may be peptide or non-peptide in nature. Non-peptide "small molecules" are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.

[0107] The designing of mimetics to a known pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This approach might be desirable where the active compound is difficult or expensive to synthesize or where it is unsuitable for a particular method of administration, e.g, pure peptides are unsuitable active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal, Mimetic design, synthesis and testing are generally used to avoid randomly screening large numbers of molecules for a target property.

[0108] Once the pharmacophore has been found, its structure is modeled according to its physical properties, e.g, stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g, spectroscopic techniques, x-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modeling process. A template molecule is then selected, onto which chemical groups that mimic the pharmacophore can be grafted. The template molecule and the chemical groups grafted thereon can be conveniently selected so that the mimetic is easy to synthesize, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound. Alternatively, where the mimetic is peptide-based, further stability can be achieved by cyclizing the peptide, increasing its rigidity. The mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent it is exhibited. Further optimization or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.

[0109] Briefly, a method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.

[0100] Following identification of a substance which modulates or affects gene or gene product activity, the substance may be further investigated. Furthermore, it may be manufactured and/or used in preparation, i.e., a manufacture or formulation, or a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals directly or via gene therapy.

[0101] The expression products of the genes of the phosphoinositide signaling pathway,, antibodies, peptides and nucleic acids of the present invention can be formulated in pharmaceutical compositions, which are prepared according to conventional pharmaceutical compounding techniques. See, for example, Remington's Pharmaceutical

Sciences, 18th Ed. 1990, Mack Publishing Co., Easton, Pa.. The composition may contain the active agent or pharmaceutically acceptable salts of the active agent. These compositions may comprise, in addition to one of the active substances, a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g, intravenous, oral, intrathecal, epineural or parenteral.

[0102] The present invention provides information necessary for medical practitioners to select drugs for use in the treatment of a hearing condition. With the identification that a mutation within genes such as Synj2 is associated with hearing loss, drugs can be selected for the treatment of sensory neuropathies.

[0103] The present invention further contemplates a method of treating an individual with a sensory neuropathy such as a hearing condition, the method comprising identifying a mutation in a gene associated with the sensory neuropathy and subjecting the individual to gene therapy to alter the gene or genetic sequence having a different mutation or to treat the defect caused by the mutation or to subject the individual to behavioral modification protocols to help ameliorate the symptoms.

[0104] Another aspect of the present invention provides a method a method for determining the likelihood of a subject responding favorably to a particular drug in the treatment of a sensory neuropathy such as hearing loss, the method comprising obtaining or extracting a DNA sample from cells of said individual and screening for or otherwise detecting the presence of a mutation in a gene associated with the neuropathy wherein the presence of the mutation is indicative of the likelihood of the drug being effective.

[0105] Using the compositions of the present invention, gene therapy may be recommended when a particular mutation conferring, for example, hearing loss is identified in an embryo. Genetically modified stem cells may then be used to alter the genotype of the developing cells. Where an embryo has developed into a fetus or for postnatal subjects, localized gene therapy may still be accomplished. Alternatively, a compound may be identified which effectively masks a particular undesired polymorphic variant or which influences the expression of a more desired phenotype. For example, one polymoφhic variant of a receptor may result in an instability of the mRNA transition product. Accordingly, the present invention also provides genetic test kits which allow the rapid screening of a mutation or mutations within a test sample or multiple test samples. The kits of the present invention comprise one or more sets of primers, as described herein, which are specific for the amplification of a genetic region of interest. In addition, the genetic testing kits of the present invention provide a PCR mix, comprising MgCl₂. In a preferred aspect, the MgCl₂ is provided at a concentration of 2.5 mM. Additionally, the genetic test kits of the present invention provide instructions for using the primers of the present invention to obtain the desired duplexes, as well as instructions as to the analysis of the duplexes using d-HPLC. The test kits may also contain instructions for use.

[0106] Therapeutic kits are also contemplated by the present invention. For example, the kit may comprise a diagnostic or mutation detection component and a selection of therapeutics, the choice of use of which is dependent on the outcome of the diagnostic assay.

[0107] The present invention is further described by the following non-limiting Examples. Materials and methods relevant to these Examples are provided below.

Generation of the custom-made synaptojanin-2 (Synj2) polyclonal antibody

[0108] A rabbit antibody to mouse Synj2 was made in collaboration with Mimotopes (Clayton, Victoria, Australia). The Synj2 protein sequence (1216 amino acids, NCBI Ref. NP 035653) was analyzed using the PREDITOP program by (Pellequer and Westhof, J MoI Graph U(3):204-2\0, 191-192, 1993). Based on turn predictions, this program suggests suitable peptide(s) to generate antibodies which are likely to cross-react with the native protein. It was then decided to make an antibody to the following peptide GIy⁴⁸²- Ala-Val-Asp-Ser-Gln-Asp-Asp-Gly-Ser-Pro-Ala-Asp-Val-Phe⁴⁹⁶. This peptide spans amino acids 482-496, which is part of the inositol polyphosphate phosphatase catalytic domain. An additional Cys residue was added to the C-terminal end of the peptide. This allowed the peptide to be coupled to the immunogenic carrier protein Diphtheria Toxoid using a maleimidocaproyl-N-hydroxysuccinimide linker. The conjugate was used to immunize rabbits. To reduce background staining in immunohistochemistry studies, the polyclonal rabbit antibody was affinity purified on Thiopropyl Sepharose 6B to which the peptide had been conjugated.

Primary Antibody Solutions

[0109] Anti-PI(4,5)P₂ and anti-PI(3,4,5)P₃ monoclonal antibodies (mouse anti-bovine unconjugated) [Invitrogen Molecular Probes] were diluted 1 in 50 with blocking reagent (5% v/v goat serum [Sigma] and 2% w/v BSA [Sigma] in PBS [Oxoid]).

[0110] Anti-Clathrin monoclonal antibody (mouse anti-bovine unconjugated) [Sigma] was diluted 1 in 750 with blocking reagent.

[0111] Anti-Synj2 polyclonal antibody (rabbit anti-mouse unconjugated) [Custom Made] was diluted 1 in 250 with blocking reagent.

Secondary Antibody Solutions

[0112] Texas Red 594-conjugated monoclonal (goat anti-mouse) secondary antibody

(Invitrogen Molecular Probes) was diluted 1 in 400 with blocking reagent.

[0113] Alexa Fluoro (AF) 594-conjugated monoclonal (goat anti-mouse) and polyclonal (goat anti-rabbit) [Invitrogen Molecular Probes] was diluted 1 in 1000 with blocking reagent.

Mouse procedures [0114] Hearing and deaf mice from required time periods (4, 8 and 12 weeks of age respectively) were anesthetized with isoflurane and culled by cervical dislocation. The cochleas from these mice were then surgically removed for decalcification and preparation for immunohistochemistry by (Whitlon and Szakaly, Brain Res Brain Res Protoc 6(3):\59- 166, 2001). Cryoembedding and sectioning of Mouse Cochlea's for Immunofluorescence [0115] Cochleae were fixed in 4% v/v paraformaldehyde (BDH, UK) in 0.1M sodium phosphate buffer, pH 7.2 - 7.4 (Sigma) and decalcified in 10% w/v EDTA/10% w/v sucrose (Gibco-BRL)/4% v/v Paraformaldehyde in PBS, pH 7.2 - 7.4 for 16 hours at 4 ⁰C with rotation; tissues were infiltrated with 10% w/v and 30% w/v sucrose in PBS in ratios varying from 1:2 to 2:1 then rotated for 16 hours at 4 °C in 30% sucrose/ 4% v/v paraformaldehyde in borate buffer, pH 9.5 at 4 ⁰C overnight. The tissues were then washed with 30% w/v sucrose in PBS and embedded in OCT (optimum cooling temperature embedding compound) (Tissue-Tek [Registered]) and stored at -70 ⁰C until use.

[0116] The OCT embedded cochleas were sectioned using a cryostat (Leica, Germany) to a thickness between 10 to 12 μm. The sections were mounted on Superfrost ® Plus Slides and stored at -20 °C until use.

Immunofluorescence of Frozen Cochlea Sections

[0117] Sections stored at -20 ⁰C were collected and allowed to thaw for 20-30 minutes at room temperature. Thawed sections were washed with IX PBS in a coplin jar, with 3 changes of PBS each 10 minutes (3 X 10 minute washes). Following the PBS wash, the tissue sections were permeabilized with 0.3% v/v Triton X-100 in PBS for 20 minutes at room temperature. Sections were then washed for an additional 10 minutes in PBS. Next, the tissue sections were incubated with blocking reagent (5% v/v goat serum, 2% v/v BSA in PBS) for a period of 2 hours in a humidified chamber at room temperature, followed by application of the primary antibody at 4 ⁰C overnight. Concentrations of mouse anti -bovine PI(4,5)P₂ and PI(3,4,5)P₃ polyclonal primary antibodies (Invitrogen Molecular Probes) were 1 :50. The mouse anti-bovine Clathrin monoclonal primary antibody (Sigma) was diluted 1:500 and the goat anti-rabbit Synj2 polyclonal primary antibody (Custom Made) was used at a concentration of 1 :250. Parafilm was used to aid the homogenous spread of primary antibody across all sections.

[0118] Following the overnight primary incubation, the tissue sections were washed three times with PBS and the secondary antibody was applied at room temperature in darkness for 2 hours. For anti- PI(4,5)P₂ and anti-PI(3,4,5)P₃ a Texas Red 594 conjugated secondary antibody was used at a concentration of 1 :400; for anti-Clathrin and anti-Synj2 primary antibodies an Alexa 594 conjugated secondary antibody (Invitrogen Molecular Probes) was used at a concentration of 1 : 1000.

[0119] Following secondary antibody incubation, the sections were washed with PBS (3 X 10 minutes) in a coplin jar. The area around the sections was dried and the slides were then mounted onto a coverslip with Gold Prolong Antifade Reagent (Invitrogen Molecular Probes). This reagent contains DAPI(4', 6-diamidino-2-phenylindole) for fluorescent visualization of the nucleus. Analysis of the slides was conducted using Olympus and Zeiss Fluorescent Microscopes, and Leica SP2 confocal microscope.

TUNEL assay

[0120] Methods 1 and 2 were adapted from the protocol supplied with the Roche Applied Sciences In Situ Cell Death Detection Kit (FITC [fluorescein]).

Method 1

[0121] Sections stored at -20 °C were allowed to thaw for 20 - 30 minutes at room temperature. When the sections were appropriately thawed, they were washed by immersion in IX PBS for 30 minutes. Sections then were permeabilized with 0.1% v/v Triton X-100, 0.1% w/v sodium citrate for 2 minutes at 4 "C, followed by a wash with IX PBS for (3 X 10 minutes).

[0122] The positive control slide was incubated with DNase I (Roche Applied Sciences) (3 U/ml in 5OmM Tris HCL, pH 7.5, lng/ml BSA) for 15 minutes at 37 °C, to induce DNA breaks prior to labeling procedures. Whilst incubating, the TUNEL reaction mixture was prepared and kept on ice prior to use. First, required amount of the Label Solution

(containing FITC [Fluorescein] conjugated dUTPs) was removed and set aside in a separate tube for a negative control. The TUNEL reaction mixture was made up with the Enzyme Solution (containing terminal transferase) and remaining volume of the Label

Solution. Components were mixed and kept on ice prior to use. [0123] The labeling protocol proceeded as follows; added TUNEL reaction mixture (~

50μl per slide) to each of the positive control and 'TUNEL' slides. For the negative control, label solution (lacking terminal transferase) [~ 50μl per slide] was applied. Tissue sections were then incubated in a humidified atmosphere for 60 minutes at 37 ⁰C in the dark. The TUNEL reaction was stopped when the sections were washed in PBS (3 X 10 minutes). The area around the sections was dried and the slides were then mounted onto a coverslip with Gold Prolong Antifade Reagent (includes DAPI stain for fluorescent visualization of the nucleus). Analysis of the slides was conducted using Olympus and Zeiss Fluorescent Microscopes, and Leica SP2 confocal microscope.

Method 2

[0124] Sections stored at -20 ⁰C were collected and allowed to thaw for 20 - 30 min at room temperature. Slides were then placed in a plastic jar containing 200ml Citrate Buffer (0.1 M, pH 6.0), applied 750W (high) microwave irradiation for 1 minute and cooled rapidly by adding 80ml dH₂O (at room temperature). Following ample cooling time, the slides were transferred to a staining dish containing IX PBS for 5 - 10 minutes.

[0125] The sections were then immersed for 30 minutes at room temperature in Tris-HCL, 0.1M pH 7.5; containing 3% w/v BSA and 20% v/v rabbit serum (Sigma). Then rinsed slides three times with PBS, for a period of 5 minutes at room temperature. Positive control slides were only washed for 5 minutes, then removed an incubated with DNaseI for 10 minutes at 37 °C.

[0126] TUNEL reaction mixture was added to each of the positive control and 'TUNEL' slides (~ 50μl per slide). For the negative control, label solution (lacking terminal transferase) was applied (~ 50μl per slide). Slides were then incubated in a humidified atmosphere for 60 minutes at 37 °C in the dark. The TUNEL reaction was stopped when the sections were washed in PBS (3 X 5 minutes). The area around the sections was dried and the slides were then mounted onto a coverslip with Gold Prolong Antifade Reagent (includes DAPI stain for fluorescent visualization of the nucleus). Analysis of the slides was conducted using Olympus and Zeiss Fluorescent Microscopes, and Leica SP2 confocal microscope.

Synaptojanin-2 Peptide Competition Assay [0127] Prior to using the Synj2 polyclonal primary antibody for immunofluorescence, its relative specificity and binding affinity for the antigen sites of the Synj2 5 'phosphatase domain was tested using a simple Synj2 peptide competition assay. This involved preincubating the primary antibody with the peptide to which the antibody was made, before applying the primary antibody to the cochlea sections. If the antibody preparation reacts specifically with the GIy- Ala- VaI- Asp-Ser-Gln-Asp-Asp-Gly-Ser-Pro-Ala- Asp- VaI- Phe peptide, the preincubated antibody should give no or a much reduced signal when compared to the "normal" antibody in immunofluorescence studies.

[0128] An equivocal amount of peptide (weight per volume) was added to the appropriate dilution of primary antibody (1 :250 in blocking reagent). The reaction tubes were incubated for lhr on a rocking platform at room temperature. The reactions were then centrifuged at 14,000rpm for 20 mins. The supernatant from the Sy«/2-peptide was carefully removed and transferred to a new eppendorf tube. Slides were then incubated with the appropriate mixture at 4 °C, continuing with the standard immunofluorescence protocol.

Primers and Exons

[0129] Tables 5 to 8 provides a list of primers and Exons used in the Examples in relation to Synj2, TMCl, cdh23 and myosin7a. Table 5 Primer sets and conditions used for amplication of TMCl gene for sequence analysis

ENU mouse libraries

[0130] ENU mutant mouse libraries (predominantly based on C57BL6 background strain) were screened to identify and characterize novel mouse models with recessive hearing loss. The clickbox hearing test that elicits a Preyer reflex or startle response, provided a high- throughput phenotypic screen (Institute of Hearing Research, Nottingham, UK). Mice that failed the clickbox hearing test were subjected to a more detailed assessment of hearing loss deficit using the evoked Auditory Brainstem Response (ABR) test (AEP, Bio-logic Systems Crop.). A subdermal active, reference and ground electrodes are placed at the vertex, ventrolateral to the left ear and the abdomen of the anaesthetized mouse. Specific auditory stimulus in the form of click was delivered in a range of decibel sound pressure levels (dB SPL). Mice with vestibule dysfunction were identified by the display of hyperactivity, that manifests either as circling, head tossing/tilting and star gazing behavior.

Inheritability-Mapping

[0131] Potential hearing loss mouse mutants that failed the clickbox hearing test were intercrossed to a congenic strain C57BL10 for inheritability testing, whereby F2 progeny were assessed for the expected 25% hearing loss phenotype. Genetic mapping of the mutation were performed using haplotype analysis of F2 progeny by outcrossing to CBA/H or BALB/c strain. Briefly, genomic DNA from affected were analyzed using genome wide scans that included 120 microsatellites (AGRF, Australia). For statistical analysis the normal approximation to bionomial test was used for proportions using affecteds (hearing loss mutants) only, to localize the deafness locus. Tissue collection

[0132] Mice were anaesthetized with CO₂ and culled by cervical dislocation according to the National Health and Medical Research Council Australian code of practice for the care and use of animals for scientific purposes (RCH AEEC approval A488). Intact cochleae were surgically removed using a posterolateral approach and the brain was dissected from mice of the same strain, age and gender. Adult mouse cochleae were processed. The postnatal day 2 (P2) mouse head were fixed in 4% v/v paraformaldehyde at 4⁰C for 14 hr followed by incubation in 20% w/v sucrose in phosphate buffered saline (PBS) at 4⁰C for

1-2 days. The brain tissues were stored in RNAlater buffer (Qiagen, Germany) at -7O⁰C for total RNA isolation.

Reverse transcriptase (RT) PCR amplification

[0133] To scan for mutations in the Cdh23 gene, 1 μg total RNA from mouse brain was reverse transcribed using random hexamers (Roche, Germany). cDNA products were PCR amplified using HotStar Taq polymerase (Qiagen). 16 primer sets were devised encompassing Exons, this strategy amplified overlapping cDNA products constituting the 10 kb full length Cdh23 RNA transcript. The PCR conditions and the oligonucleotide primers are outlined in Table 5. The Cdh23 cDNA primer sequences were based on the NCBI sequence, accession number NM23370 (AF 308939). The PCR products were sequenced with both the Forward and Reverse primers using the Big Dye Sequencing kit (version 3.1, ABI) and analyzed on an Applied Biosystems DNA Analyzer (Model 3730x1).

[0134] To scan for mutations in the Myo7A gene, genomic DNA was isolated from mouse tail of deaf and hearing sibling littermates. cDNA products were PCR amplified using

HotStar Taq polymerase (Qiagen). The Myo7A cDNA primer sequences were based on the

NCBI sequence, accession number NM 008663. Each PCR product was amplified at 58⁰C for 35 cycles and sequenced with the corresponding- forward and reverse primers flanking each Exon using the Big Dye Sequencing kit (version 3.1, ABI) and analyzed on an Applied Biosystems DNA Analyzer (Model 3730x1) (Table 6). [0135] To scan for mutations in the Tmcl gene, genomic DNA was isolated from mouse tail of deaf and hearing sibling littermates. cDNA products were PCR amplified using HotStar Taq polymerase (Qiagen) at 58⁰C for 35 cycles. The Tmcl cDNA primer sequences were based on the NCBI sequence, accession number NM 28953. The PCR products were sequenced with the corresponding-forward and reverse primers flanking each Exon using the Big Dye Sequencing kit (version 3.1, ABI) and analyzed on an Applied Biosystems DNA Analyzer (Model 3730x1) [Tables 5, 6, 7 and 8].

Processing tissues for In situ hybridization and H&E analysis [0136] The processed cochleae and embryonic heads were embedded in OCT (Sakura, USA), sectioned (10 and 20μm for cochlea and mouse head sections, respectively) using a cryostat (Leica, Germany) onto Superfrost*Plus microscope slides (Biolab Scientific, USA) and stored at -2O⁰C until use. Tissue sections were also processed for downstream application including, H&E staining, in-situ hybridization and immunohistochemical studies. For spatial localization of cdh23 RNA transcripts in the embryonic head cryosections were examined by in situ hybridization using digoxigenin-labelled sense and antisense riboprobes generating 950bp fragment encompassing nucleotide 6011-6851 (Exon 45-49) of cdh23 gene. Probe binding was detected with an anti-digoxigenin antibody coupled to alkaline phosphatase (Roche, Germany). Slides were analyzed using the Olympus 1X70 inverted fluorescence microscope and images were captured with TciPRo (Coreco, USA) software.

Immunohistochemical staining for cdh23 protein

[0137] Ten μm mouse cochlea cryosections were also processed for immunohistochemical staining with an anti-cadherin 23 antibody (gift from Prof. Thomas Friedman, NIDCD).

Briefly, the sections were rinsed 3 times in PBS for 15 min for each wash, then permeabilized for 30 min with 0.3% v/v Triton X-100 in PBS. Sections were washed 3 times in PBS with 10 min intervals between washes and then blocked in 5% goat serum in

PBS for 2 hr. Sections were incubated with the anti-cadherin 23 antibody (1:1500) in 1% v/v goat serum in PBS for 16 hr at 4⁰C in a humidified chamber. The sections were rinsed

3 times in PBS with 10 min intervals, followed by incubation with an Alexa Fluor 488 conjugated goat anti-rabbit IgG (Molecular Probes, USA) in 1% goat serum in PBS (1:3000) at room temperature for 2 hr and washed 3 times with PBS. Slides were mounted with Prolong Gold Antifade reagent with DAPI (Molecular Probes, USA) and viewed using an Olympus 1X70 inverted fluorescence microscope and images were generated using Spot version 3.5 software (Diagnostic Instruments Inc).

Table 6

Primers sets and conditions used for the amplification ofcdh23 gene

Primers Forward/Reverse Primers EXONic PCR product size Tm "C/Cj region (bp) No.

1 ATGAGGTACTCCCTGGTCAC 1-6 617 58, 36 GCGTACCAGCTCACAGTCAA

2 CACCCATCTTCATCGTCAAC 6-10 503 58, 40 GACCGGGAGAACCCCCTGTA

3 CACTCTCCTCCAGGCACAAC 7-15 968 62, 35 GATGCCTATGTGGGTGCTCT

4 ACAAGGACACGGGTCTCATC 15-20 693 62, 35

CTGGACCGAGAGACCAAGT

5 CTTCGTGTCTGTGCTGGAGA 18-24 823 62, 35

GGTGTGGTCACGACGACA

6 CCTGAATGGACTGGTGTCCT 24-29 772 62, 40 AACTCGTCCCACGTACTGAG

7 AGCAGCTATGAGGCCAGTGT 27-32 827 62, 40 AAAGGCTTGGTCGACAGAGA

8 TACGAGGCAGTCATCATGGA 31-37 817 62, 35

GAGATTGCTACACGGCCTG

9 TGAATGAGAATGTGGGTGGA 37-41 831 62, 35 CGAACTGGATAGGGAGACCA

10 AATGGGCAGGTGGAGTACAG 40-46 816 62, 35 TGTTGGCTGAAGACATTGGA

11 GCACCCACAGTGACCTCTTT 45-49 841 62, 35 AAGCTCACGGTCAACATCCT

12 GATGGTGAAGTCCCCTCTGA 48-53 787 62, 35 TGATCCGAGTGCTTGATGTC

13 AGAGGGCAAGTTCGCTATCA 51-55 751 62, 35 GTCTCATCTTGGTGGCCAGT

14 GGGCAGTACGCTACAGCTTC 55-60 918 62, 35 CATCGGCATCTACATCCTGA

15 GCCCTGGCTATTTTGTGGTA 60-67 827 62, 35 AGGAATACGACAACATCGCC

16 GATGGGTCCAACCCTGTGTG 66-69 752 62, 35 CCAGTACAGCCTTTGTGGGT Table 7 Primers sets and conditions used for the amplification ofMysoin Vila gene

Primers Forward/Reverse Primers PCR product size (bp)

1 CTGTCTTCTGGCTCGGAT TC 246 AGACACCTGCCATTGTAGCC

2 CCTTGCTCCCCTTATGTGTC 482 CTTCAGTTCCCAAGCCTCTG

3 TCTCCTCCTCCTTTCACCAA 498 AATGTGGGGGTGACTCCATA

4 TGT GGC AGA GCC CTT TGT 300 GTG GCA GGG ATC ACA GGT

5 GCCAGGTTCTGAAGGTGAGA 296 TGCTAACAGATGGCCCAGAC

6 GGGCCATCTGTTAGCACACT 298 AGTGCCACTCTGCCAAGTTT

7 CTGGGTAAGGTGTTGGTGCT 490 CCACTGTGTACCACCCTTGA

8 CAGCCTGCTCTTCTCAGGTG 210 CCAACTGAGCCAGGTGTCC

9 TGGGCCTCTGTGATATCTGG 293 TGGGAAACATCTTGCACCTG

10 GGGGCATTAATGTCACCTGT 334 CAAGTTTCCCAAGCCTGAAG

11 CACGTGATGGGAGTCTTGTG 396 AGTGCAGAGCACCAGAACAG

12 AGAAAGTCAGGGGAGGTTGG 294 CCTTGTGGGCTCACTCCTAA

13 CTCAGATGTTGTGGGTTTGG 266 CAAGACTCAGGGTGGGGTAG

14 TCCAGGACAGCTGTTGGAG 295 CACTGCCCACCTACCTCATC

15 GCTCTTAGGAGGCCTCGACT 345 TGTCAAGCTCCACCAGTCAC

16 GGGGGCCTTTCCATTAGTTA 221 GAGCCCCCTCAGAAACATC

17 AGAGCCATGACGGGAGACTA 290 GACCTTGTGACCATGTGTGC

18 TGCTATCTGGGCACACCTG 246 CTGCTGCCAAGGTAACACAG

19 CTTGGTGGGTCCAGTCTGAT 400 CAAGGGTTGGGAGACACCT

20 ACTGCAACCAGGAGACCAAC 288 GCCAGCAATGGAGAAAAGTC mers Forward/Reverse Primers PCR product size (bp)

21 AGACAGCTGTTCTCGGAAGC 384 TCAGTCACCACTGCCTTCTG

22 CAGCGCTGCTTCTGTTCTG 398 GTGGTCTGACCCTAGGTTGG

23 CTCCAAGGCTCTCTCTGTGG 367 CAGGGATGAGGCAGAGACA

24 CTTGTGAGCCTCTGTGTGGA 286 GAGGCATCATCCAGTTCTCC

25 AGGGACAGCACCCCATCTAT 300 CTGGAGACCACCAGCCTCT

26 CTTAGGCTGGCTGGTCAGAA 287 CCAGAAAGCACATGCCACAT

27 GGGTGTGCCTGGAGAGACT 274 TGAGATTCCAGAACCCAAGG

28 GACAGATCCAGGTGGTGTCC 363 TGACTCACATGCATGCAAAC

29 CCTCAGGGCTATCTGTGCTC 396 CCAGCCAACTGACAACAGC

30 TCAGGGTCCCCAAACTACAG 351 CAGCAACTGTCAGGCAGAAG

31 CAGAGGCACCTAAGCTCACC 299 CACAGCCCTTCAGCAGTAGA

32 CCACCTTGCAGTTATGAGGAG 300 CCCCCTTGATAACACTGATTG

33 CGTCTGCCTTAGAGGGTGAT 467 ACCAGCCACCTGCTATGAGT

34 TACAGGTCACCAGCCCAAAT 339 TGACCGGATGTGAGAAGAAG

35 TGGAAGGCTCCAGCTTTATC 291 CTTATGCTGCCCCTGAGC

36 GAGAAGGTGGCATGTGTGTG 345 AGTCAGGGTCTTCCATCTGC

37 ACACACACACACAGGAGACAG 541 TTCTGGGCTCTTGACAGGTT

39 CGTΠTGGTCCTTGGACAG 297 TGTCCTAGAGCTGGGTGTGG

40 CTCCTGTCTCCTCTGCTTCC 296 TACCCAAGGGCAAGAGACTG

41 GGTGGGTAGGAGAGACAGCA 284 GAGAGATGCTCCATGCAGGT

42 ACAGCAATGTTGGTGGGAAA 249 GTTCCAGCTGCTTGGCTAAC

43 GTTAGCCAAGCAGCTGGAAC 547

CAGCACTTGCTGTCTCAACC Primers Forward/Reverse Primers PCR product size (bp)

45 GTACCATGCCTGGCTCTGAT 282 GCTGTCACCTCCATTCCAGT

46 CTGGCTTCATGCCTGTCTG 247 CTCCGAAGTGGGGACAGTAG

47 TTCTTTGAGGGGGTATCTGC 300 CATTTTTCCCCGGACCTAAA

48 GAGCCGTGTCTGTGTGTGAG 493 TTCAGAGCATCCGTTCAATG

Table 8 Primers sets and conditions used for the amplification ofTmcl gene

Primers Forward/Reverse Primers PCR product size (bp)

1 GAG ACT CTG TGG CAG GCA GT 243 AAC AGA AGA AAC GCC CAA GA

2 GTT GCT TGT AGG GAG GTG GA 246 TTT CAG ATT TCA GAA TGT CAC CA

3 CCT GCA CAA AAA TGT TAT GAT GA 222 ACA AGA TGG CAG GGA CAT TC

4 GAA GGT TGC CAT CAC CAG TT 329 CTT CTG CCT CGT GCC TTT AC

5 CGT ATC TGA CAG GCG TCC TT 390 CAA ATG ATT CAA GGC AAC CA

6 GTG TGT CCA CAC CTG TCT GC 221 GCT CTG TCC CCT CAA AAC AG

7 CTT GTC ACT TGG GGA AAT GG 242 GGG AAA GGT CTG GGT AAA GC

8 AGG CTG GTT TTT CAT TGG TG 240 TGG GGG TCA ACA GAA ATC AC

9 AAA ACC ATT TGT GGT CAC CTG 227 GGC ATA GAG TTT CCG GAT CA

10 AGT CAG CTG CTG GGT AGA GC 324 CTC TAA ACC TGA AAT GGT ATC

11 CCG TGA CTG CTG TTT TCT CA 320 GCA TCT GTC TCA TAA CTG TCA

12 ACC CTC TTG CCC TAC CAG TT 480 TCC TTG TCT CAC ACT CAG CT

13 TGG ACA CAC ACA CAC ACG AAT 449 TGG AAA GGA AAA TAA CAG AGC

AC

14 AGT GTG CCA GTT TCC CAG TC 400 GGC AGC AAA TGC TAA ATC TTC

15 TTC AAG GAT GGA GAC AGT TTG A 488 Primers Forward/Reverse Primers PCR product size (bp)

TGA TGC TTA AGT CTG GGC TCT

16 TCT AGG CAT GTT GAC AAA CCA 250 GGA CTC ACA GAA TGG GGA TA

17 GTT TCG AAG GCG GGA GTA GT 597 CCC AAT TGA CAT AAC ACA TGG A

18 TCT GAG TAT TAG ATG TGT TGC 400 TGA A

CAG CAG GAG CAG AAG ATG GT

19 GGG TTC TAC GTT TGC CTC TTT 596 GAA GGA AGC GTG GGA TGA G

21 TGA GCA CTT TGT AAA ATG GCA TA 548

GAC CAG TGT GTA AGA AAA AGT CCA

(a) PCR conditions

[0138] As DNA sample available in the project was of variable quality and quantities a nested PCR approach was employed in order to obtain single and clean amplicons in equivalent amounts to be used as templates for the subsequently pre-HRM amplification.

Primers for the primary outer PCR reaction were designed to amplify the target Exon including 50-100bp intronic sequence both upstream and downstream of the Exon. Nested primers were designed to flank the target Exon including Exon/intron boundaries, amplifying end products for HRM analysis between 125bp to 250bp in length. Primers for amplification of all Exon and both rounds of PCR were designed to anneal at 6O⁰C. All primers and expected fragment length are listed in Table 5, 6, 7 and 8.

(b) Primary PCR

[0139] Primary PCR for all Exons contained 0.5 μM of each primer, 2μl DNA solution (DNA diluted 1 :10), 0.2mM of each dNTP and 0.5 U HotStarTaq DNA Polymerase (Qiagen, Valencia, CA) as recommended by the manufacturer in 15μM reactions. Cycling conditions for amplification of all seven Exons were initiated with a preincubation at 95°C for 15 minutes followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 58⁰C for 30 seconds and extension 72°C for 40 seconds and terminated with a final extension step at 72°C for 2 minutes. PCR cycling was performed on the Gradient Palm- Cycler (trademark) [Corbett Life Science, Mortlake, New South Wales, Australia]. (c) Nested PCR

[0140] Primary PCR amplification products were diluted 1/10.000 at the CAS-1200 (trademark) robotic workstation (Corbett Life Science, Mortlake, New South Wales, Australia) and used as templates for the pre-HRM PCR together with new nested primers and a HRM-compatible DNA double stranded intercalating dye included. The reaction mixture consisted of Ix SensiMix (trademark) HRM and Ix EvaGreen (trademarke) dye (Quantace Ltd, London, United Kingdom), 0.5μM of each primer, 2 μL of diluted first round PCR product instead of genomic DNA in 12μL reaction volumes. PCR cycling and subsequently HRM analysis were performed on the Rotor-GeneTM 6000 (Corbett Life Science, Mortlake, New South Wales, Australia) for all seven Exons. The amplification were initiated with a lOmin incubation at 95°C for enzyme activation followed by 45-50 cycles of denaturation 95°C for 15 seconds, annealing at 58°C for 15 seconds and extension at 72°C for 20 seconds and terminated with one cycle of 72⁰C for 1 minute, 95⁰C for 1 minute and 58 for lmin.

(d) HRM conditions for mutation screening

[0141] HRM was performed from 65°C to 92°C depending on amplicons melt behavior, increasing by 0.1⁰C pr second. Amplification progress during PCR cycling and the following amplicons melt transition were monitored in real time by optical measurements at the Green channel (470/510 nm) after each PCR extension step and after each temperature rice during the HRM scan.

[0142] All HRM results were analysis using the Rotor-Gene 6000 Series Software 1.7, build 34 (Corbett Life Science, Mortlake, New South Wales, Australia) and the included HRM algorithm. Normalization regions for the normalized dissociation plots were adjusted to the melt behavior of each Exon analyzed using the linear regions pre/post the melting transition stages with a confidence threshold of 90% applied. Samples showing variation were identified utilizing the normalized melt plot, the derivative melting curve plot (- dF/dT) as well as the HRM difference plot and the automated genotype calling algorithm included in the software package. The fluorescent difference curves were created from the normalized melt plot by including a known WT control sample in the analysis. (e) DNA sequencing DNA Sequencing

[0143] Following HRM analysis samples of interest were selected for DNA sequencing. Samples were selected based altered HRM behavior or selected randomly among the expected WT population in search for SNP 's missed by the HRM. None-diluted PCR product from the primary PCR were treated with ExoSapIT (GE Healthcare, Buckinghamshire, United Kingdom) as instructed by manufacturer and used as template for DNA sequencing. Cycle sequencing was carried-out using the BigDye (Registered) Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, USA) together with primers used in the primary PCR and 5μL purified PCR product. The sequencing reactions were run on an Applied Biosystems AB 13130x1 genetic analyzer (Applied Genetic Diagnostics, The Department of Pathology, University of Melbourne) and examined using the Mutation Surveyor (Registered) Software (SoftGenetics, LLC, Pennsylvania, USA)

EXAMPLE 1 ENU Mouse Models

[0144] Deaf ENU-treated mice strains with recessive deafness are analyzed: the mutated genes are mapped and the causative genes are identified. Details of the mapped strains include:

♦ Strain69 mice exhibits sensorineural age-related hearing loss. By 12 weeks the mice are severely deaf. The gene mapped to chrl7, region 3-5.2 Mb. This is identified as a mutation in a "deafness" gene, Synaptojanin 2 (Synj2), that changes a highly conserved Asn to a Lys. Synaptojanin 2 is a key enzyme in phosphoinositol metabolism.

Phosphoinositides are crucial regulators of a variety of cellular functions.

♦ Strain 165 mice exhibits congenital severe sensorineural deafness. The deafness locus mapped to chrlO (58.1-60.2 Mb). A novel mutation, p.Val2360Glu, was found in the cadherin23 gene. The mice do not have vestibular or visual problems, as is the case with other cadherin23 gene mutants. Gene expression studies (in situ and immunohistochemistry) have shown that mutant cadherin 23 mRNA and protein is expressed in the cochlear hair cells, but that the spatial organization of the stereocilia is disrupted.

♦ Strain 19 mice are born with a moderate sensorineural hearing loss and are totally deaf by 8 weeks of age. The causative gene mapped to chr 19 near D19Mit 41. A novel mutation was found in the TMCl gene.

♦ Strain 14 mice exhibits congenital sensorineural deafness and vestibular dysfunction. The deafness locus maps to chr7, region 82-91 Mb, a region with no previously identified mouse or human "deafness" locus or gene. ♦ Strain2 mice exhibits sensorineural age-related hearing loss. By 16 weeks the mice are severely deaf. DNAs are currently being collected for mapping and gene identification studies.

♦ Strain 36 mice exhibits age-related hearing loss. By 16 weeks the mice are severely deaf. DNAs are currently being collected for mapping and gene identification studies. EXAMPLE 2 Determining the chromosome location and identity of the mutated "deafness" gene

[0145] Potential deafness genes are mapped to a chromosome region. A mapping cross of each deafness strain is initiated by mating a deaf mouse with the divergent inbred mapping partner strain CBA. Fl carrier mice are then intercrossed and the F2 offspring tested for hearing loss (approximately 245% will have a hearing loss if the trait is fully penetrant and recessive). The aim is to obtain approximately 35 affected animals which is enough for locating the causative gene to an approximately 5-10 cM chromosome region by homozygosity mapping. DNA from affected mice is typed using a genome-wide panel of Simple Sequence Length Polymorphisms (SSLP) markers. The chromosome region of interest is homozygous for the C57BL/6 alleles. An appropriate test statistic tailored to the detection of the ENU mutant was used to assess linkage. The test statistic is a binomial proportion test, carried out with a one-sided hypothesis to reflect prior knowledge about the effect of the ENU mutant. The analyses are implemented and performed in R7qtl by AI Bah Io (Broman et al, Bioinformatics /9:889-890, 2003).

[0146] Following mapping of a locus, the next step is to select candidate genes and search for mutations in these genes in the mice. The information that is being accumulated in the human and mouse genome projects have significantly aided gene identification. As mentioned above, homozygosity mapping localizes the causative "deafness" gene to an approximately 5-10 cM region, a region that on average is likely to contain approximately 100-200 genes. Using public databases (eg Ensembl, NCBI, UCSC Genome Database) a detailed gene map is constructed of the region of interest. Candidate genes are selected on the basis of their known or potential functions and more importantly, on the basis of their expression patterns.

[0147] For a subset of high priority mutant strains, it is likely that the gene will be mapped to regions that contain too many or no obvious candidate. It is also possible that no mutations are found in candidate genes. In these cases, a fine-mapping cross is performed to localize the mutation to an interval of less than 1 cM containing approximately 10 genes. The fine mapping cross will entail a larger F2 intercross as described above, producing up to 500 offspring that will be genotyped for two flanking markers at weaning. Only recombinant animals within the interval are kept, tested for deafness, and analyzed for SSLP markers within the interval. The annotation of the current Ensembl database provides a dense set of annotated simple sequence repeats with which to obtain additional markers to narrow the mutation interval.

[0148] Identification of mutations in candidate genes follows established procedures, using inner ear cDNA and genomic DNA. Because ENU mutations usually are located in coding regions Exons and Exon-intron boundaries of candidate genes are normally sequenced from genomic DNA. Sequences are analyzed using the Mutation Surveyor program.

[0149] Studies into the effect of the change assist in determining if it is the causative mutation: does it create a stop codon, does it affect RNA splicing, does it alter a conserved amino acid, is it likely to affect the function or structure of the protein?

EXAMPLE 3 Gene identification and gene expression analysis of the deaf ENU mouse strains

[0150] A major aim is to gain further knowledge about the genes that cause deafness. The function of the mutated gene becomes clear once it has been identified. Methods employed include:

^■ Determine the gene structure, using the information on public databases combined with standard molecular techniques (DNA sequence analysis of PCR amplified cDNA and genomic DNA).

^■ Investigate transcript levels in different tissues using real-time PCR. 18S RNA is used as the molecule to which gene expression pattern in different tissues is correlated.

^■ Determine, by in situ hybridization, the RNA developmental profile, identify the sites of gene transcription and further analyse the tissue distribution of expression. ■ Determine protein expression (localization and developmental profile) using immunohistochemistry. ^■ Investigate the ultrastructural defects in the deaf mice by confocal or electron microscopy.

■ Measure the endocochlear potential in wild-type, carrier and deaf mice. The endocochlear potential (approx. 80-100 millivolt) is created by potassium and sodium ion distributions in the cochlea and is essential for cochlear function. The endocochlear potential is an excellent measure of cochlear function and therefore useful in assessing the effects of gene mutations on the cochlea and hearing.

EXAMPLE 4 Determine human homolog genes

[0151] It is of practical and scientific interest to identify genes that cause deafness in humans. This information is essential when assessing the cost effectiveness and feasibility of screening for genetic causes of hearing impairment and when developing novel tests for the detection of early hearing loss. Once a mouse "deafness" gene is mapped a human equivalent gene is sought.

EXAMPLE 5 Investigate if mutations in a novel "deafness" gene cause hearing loss in humans

[0152] DNA samples are analyzed from cohorts. The first cohort consists of over 600 people with severe or profound deafness referred to GHSV for possible identification of mutations in "deafness" genes. A second cohort consists of 120 people with early onset of presbyacusis. These are people in whom the age-related hearing loss became a significant problem when they were in their 40s and 50s. EXAMPLE 6

Determine if homozygous or heterozygous mutant mice are more susceptible to hearing loss due to noise or ototoxic drugs than their wild-type littermates

[0153] Approximately 2% of Australians are carriers of a mutation in the connexin 26 gene [l l/HD-141]. Based on the incidence of recessive deafness and on the number of predicted "deafness" genes. It is estimated that 3-10% of the population carries mutations in genes associated with hearing loss. It is hypothesized that these "normal hearing" carriers are predisposed to hearing impairment due to increased susceptibility to trauma or age-related hearing loss. In a pilot study of 22 normal hearing people (aged 25-45 years) carrying a connexin26 mutation a statistically significantly lower otoacoustic emission was observed at higher frequencies when compared to an age and sex-matched control group. These results can be interpreted as the initial stages of a deteriorating hearing loss in this young carrier group. Furthermore, the connexin26 gene was analyzed in 106 people with onset of hearing loss in their 40s and 50s and found that six carried a connexin 26 mutation (5.7%; 95% CI: ± 4.4%). In the control group, eight of 262 people were carriers of a connexin 26 mutation (3.1%; 95% CI: + 2.1%). These preliminary data are highly suggestive that carriers of connexin26 mutations are at increased risk of developing a hearing impairment.

EXAMPLE 7 SiVPs detected in HRM analysis

[0154] Tables 9 and 10 provide a summary of the SNPs detected by HRM analysis in Synj2. Results are also presented in Figures 1 to 5.

Table 9

Summary of SNPs in Synj2 detected by HRM analysis

SYNJ2 HRM SCAN Exon 11 Exon 12 Exon 13 Exon 14 Exon 15 Exon 16 Exon 17

Exon length (bp) 166 192 83 141 194 247 238

No. sample analyzed 528 528 528 528 528 528 528

No. different SNP identified 1 8 0 0 1 1 0^*

No of samples containing SNP's 1 33 0 0 2 1 0

No. of samples sequenced 120 132 46 42 156 38 73

SNP's not detected by HRM 0 0 0 0 0 0 0

*In Exon 17, the common polymorphism is not included in the summary.

Table 10

Summary of nucleotide and deduced amino acid changes in Synj2 detected by sequence analysis

SYNJ2 Nucleotide Genotype Amino acid NO. samples identified change

Exon 11 G1586C Heterozygous S504T 1

Exon 12 G1634A Heterozygous R520H 3

Exon 12 T1676C Heterozygous M534T 7

Exon 12 G 1690A Heterozygous V539M 1

Exon 12 C1695T Heterozygous N340N 18

Exon 12 Cl 730T Heterozygous T552M 1

Exon 12 G1773A Heterozygous S562S 1

Exon 12 G1785A Heterozygous S566S 1

Exon 12 C 1800T Heterozygous S571S 1

Exon 15 C2042G Heterozygous T656M 2

Exon 16 G2252A Heterozygous D726N 1 [0155] All nucleotide numbering, exons and deduced nucleotide and amino acid changes are relative to NCBI human Syηj2 mRNA NM 003898 (gi:52851404)

[0156] In Exon 11, one sample was identified as a variant by comparing the melt curve behavior of this sample with the additional 48 samples included in the HRM scan. Subsequently DNA sequencing revealed a heterozygous G1586C SNP changing a serine to threonine at position 504.

[0157] In Exon 12, a total of 33 samples were found to have altered HRM profiles compared to WT sample, with a total of eight different HRM melt curve being observed in addition to the WT melt curve. DNA sequencing of Exon 12 in the identified variant samples revealed a total of eight different Exon 12 SNP's in the 33 samples, all changes being heterozygous. Four of the identified changes were polymorphism and are listed in table 10 whereas the remaining 4 all changes a residue in the expressed protein. The changes identified were G1634A (R520H) found in three samples, T1676C (M534T) found in seven samples and G1690A (V539M) and C1730T (T552M) both identified in one sample each.

[0158] No changes in the DNA sequence were discovered in Exon 13 and Exon 14, whereas in Exon 15 two non-related sample were identified as variant by HRM sharing the same differentiated HRM profiles. Sequencing revealed both sample were carrying a heterozygous C2042G (T656M) SNP (Table 10). In one of the samples the heterozygous Cl 730T (T552M) Exon 12 variation was also identified.

[0159] Screening of Exon 16 by HRM analysis revealed one sample being identified as a variant by HRM . The sample was found to carry a novel heterozygous G2252A (D726N) change (Table 10).

[0160] No additional DNA changes were discovered in Exon 17 except for the known T2427C (V784V) polymorphism. Exon 17 samples can be grouped into three distinguishable genotypes representing the three possible variations of the T2427C (V784V) SNP. [0161] None of the melt curves from the 528 samples analyzed differentiated noticeably from the three expected HRM profiles indicative of no additional changes in the amplicons. For Exon 17 the variation in normalized melt curves were more variable between identical WT samples than observed in previously Exons analyzed. To verify that this variation in melt curve behaviour were due to technical variation and not caused by changes in the amplicons, a total of 73 samples was selected for DNA sequencing representing the boundaries of the melt curve clusters, hi each sample DNA sequencing confirmed the initial determined genotype and no additional changes were found.

[0162] One patient had two SNPS at C1730T (T552M) in Exon 12 and T656M in Exon 15. This patient not only had a hearing defect but also had peripheral neuropathies. Further analysis of this patient's genetic and clinical history revealed that this patient had a common mutation in connexion 26 mutation. This common mutation in connexion 26 has not been previously associated with peripheral neuropathies. This suggests a relationship with Synj2 mutations and peripheral neuropathies as well as hearing defects.

EXAMPLE 8 Synj2 localization in the inner ear

Synj2 polyclonal antibody peptide competition assay (immunofluorescence) [0163] A custom made peptide was designed around the central 5' phosphatase domain of the mouse Synj2 polypeptide sequence. The peptide was used to generate a polyclonal antibody to the mouse Synj2 protein in a rabbit. The antibody was subsequently affinity purified on a column to which the custom made peptide had been conjugated. Considering that this antibody had yet to be used for immunofluorescence analysis, it was important to test its relative specificity and binding affinity for the antigen sites of the mouse Synj2 protein. This was achieved by performing a peptide competition assay, in which the Synj2 antibody was pre-incubated with the peptide that was used to raise the resulting polyclonal antibody, in order to block specific Synj2 binding sites in the antibody preparation. There was specific binding of the custom made Synj2 antibody in the inner ear to inner and outer hair cells, as well as supporting Deiter, Claudius and Hensen cells. Strong staining was also observed in the spiral ganglion cells. The specific pattern of staining was not observable when antibody binding was competed out with the Synj2 peptide. The staining that was observed with the Synj2 antibody was distinct and specific enough to enable the use of this polyclonal antibody for the comparative immunofluorescence of the Synj2 mice.

Comparative Synj2 protein expression and localization in the inner ear of the Synj2 wild-type and mutant mice

[0164] Synj2 is reported to be expressed in most, if not all, tissues and thought to play a central role in the regulation of the important phoshoinositol signaling pathways (Nemoto and Arribas, J Biol chem. 272^:30817-30821, 1997; Astle and Seaton, IUBMB Life 58(8):A5\-A5β, 2006). The ENU generated Asn⁴⁵³ to Lys amino acid mutation in the central 5' phosphatase domain of the mouse Synj2 protein results in a complete loss of phosphatase activity. As a step towards understanding the role of Synj2 in the hearing process, a series of Synj2 immunofluorescence expression profiles between the normal and mutant Synj2 mice was completed.

[0165] The specific Synj2 protein localization and relative expression levels were determined using laser-scanning confocal microscopy. In the wild-type mouse, Synj2 was found in the inner and outer hair cells, the supporting cells of the organ of Corti (Cells of Claudius, Dieters and Henson), outer and inner sulcus cells, the fibrocyte cells in the spiral ligament, the nerve fibres in the Rosenthal's canal and the neural cells of the spiral ganglion. The distribution of Sy nj ^'2 amongst the cells of the organ of Corti (which includes the hair cells and supporting cells) remained relatively constant over the time periods examined, with a developmental increase in the level of expression between 4 and 12 weeks, in particular the more prominent appearance of Synj2 in the hair cells and the fibroblast cells in the stria vascularis of the 12 week wild-type mouse. Synj2 appears to be specific to the cytoplasm and the apical and basal lateral regions of the inner and outer hair cells. There is a distinct dispersed pattern throughout the cytoplasm of both the inner and outer hair cells and by 12 weeks there is a clearly a higher expression level of Synj ^'2 in the inner hair cell, when compared with that apparent in the outer hair cell. The localization to the basolateral region of the inner hair cell is well depicted in the image of the organ of Corti of the 8 week normal mouse. This is consistent with Synj2 being enriched at nerve terminals (Nemoto and Arribas supra 1997; Neomoto and Wenk, J Biol Chem 276(44):A\ \2>2>-A\ 142, 2001), that are far more prominent at the base of the inner hair cells. Furthermore, the specific pattern of Synj2 staining in spiral ganglion cells is consistent for all three developmental time periods. Synj2 appears to be expressed at a high level and distributed throughout the whole cytoplasm as indicated by the DAPI counterstain. There may also be a basal level of Synj 2 expression in the nucleus of these cells.

[0166] The expression pattern of Synj2 in the mutant mouse, although similar in the cells of the organ of Corti, progressively changes in the neural cells of the spiral ganglion. At 4 weeks, the expression pattern is similar to that observed for the 4 week normal mouse, by 8 weeks a transition occurred where localization of Synj2 appears to change from the cytoplasm to the nucleus of the spiral ganglion cells and by 12 weeks there is a striking contrast between the appearance and specific distribution of Synj2 in this cell body compared with the normal mouse. In some spiral ganglion cells in the mutant mouse Synj2 is expressed in both the cytoplasm and nucleus, but in other cells appears to be exclusively localized to the nucleus, which is representative of the appearance of Synj2 in the spiral ganglion cells by 12 weeks. Furthermore, there seems to be evidence of apoptotic cells, which could explain the reduction of cell number. This suggests that the loss of Synj2 directed inositol 5' phosphatase activity may be detrimental to the survival of the spiral ganglion cells and/or the loss of PI(4, 5) P₂ dephosphorylation could be a pro-apoptotic stimulus, therefore resulting in the degeneration of these cells. As originally postulated though, the expression level of Synj ^'2 protein does not appear to be affected by the 'loss of function' Synj 2 mutation. EXAMPLE 9 Pl (4,5) P₂ localization in the Innter Ear ofSynj2 wild-type and mutant mice

[0167] The mutation of Synj2 in the S69 mice was expected to abolish the inositol 5' phosphatase activity, and hence cellular levels of PI(4,5)P₂ were expected to rise. To investigate whether this had occurred, and whether any localization changes resulted, sections from normal and mutant mice were examined.

[0168] Immunofluorescence analysis of PI(4,5)P₂ in the inner ear of the Synj2 wild-type and mutant mice, was studied in 4, 8 and 12 week old mice using frozen cochlea sections.

PI(4,5)P₂ was localized using a commercially available primary antibody specifically designed to the plextin homology (PH) domain of this phosphatidylinositol, with an Alexa

Fluor 594 conjugated secondary antibody. Previous studies have successfully localized

PI(4,5)P₂ to specific cell types in the inner ear using this antibody (Hirono and Denis, Neuron 44(2):309-320, 2004) therefore validating its use for a comparative study in the

Synj2 mice.

[0169] Analysis of the cochlea sections from normal mice showed that PI(4,5)P₂ expression in the inner ear was quite high, but that the level varied significantly between cell types. For the wild-type Synj2 mouse, there is a distinct and high level of fluorescence in the inner and outer hair cells, supporting cells of the organ of Corti (which includes the inner and outer sulcus cells, and the cells of Henson and Claudius), the nerve fibres in the Rosenthal's canal and the spiral ganglion neural cells. The localization of PI(4,5)P₂ amongst the cells of the organ of Corti does not change significantly when comparing the 4, 8 and 12 week time points. However, there appears to be an increase in the level of PI(4,5)P₂ expression between 4 and 12 weeks, in particular a more prominent appearance of PI(4,5)P₂ in the hair cells was observed and Rosenthal's canal of the 8 and 12 week wild-type mouse. When investigating the cochlear hair cells it is notable that PI(4,5)P₂ expression is especially prominent in the apical tip of the outer hair cells, as well as the apical and basal lateral regions of the inner hair cell. [0170] The localization of PI(4,5)P₂ in the neural cells of the spiral ganglion did not change when comparing the 4, 8 and 12 week time points in the wild-type mouse. Within these neural cells, PI(4,5)P₂ expression was evident in the cytoplasm, nucleus and plasma membrane. Although, similar to the cells of the organ of Corti, the level of PI(4,5)P₂ expression appeared to increase between 4 and 12 weeks, in particular the more prominent appearance of PI(4,5)P₂ along the plasma membrane of the spiral ganglion cells of the 8 and 12 week Synj2 wild-type mouse. There was a spotted array pattern of PI(4,5)P₂ outlining the plasma membrane. PI(4,5)P₂ is a marker for the plasma membrane which is clear in the 12 week hearing mouse, with a translucent line outlining the parameter of the cell.

[0171] The localization of PI(4,5)P₂ in the mutant Synj2 mouse showed both similarities and differences when compared to the normal hearing Synj2 mouse. PI(4,5)P₂ expression was evident in the specific cell types in the inner ear aforementioned for the wild-type Synj2 mouse. The expression pattern of PI(4,5)P₂ is comparable in the cells of organ of Corti at all three time points.

[0172] In the neural cells of the spiral ganglion, the expression pattern of PI(4,5)P₂, was similar at 4 weeks; at 8 and 12 weeks however, the distribution of PI(4,5)P₂ was strikingly different. PI(4,5)P₂ was more concentrated in the nucleus of the spiral ganglion cells of the 8 and 12 week Synj2 mutant and at 12 weeks there was a distinct reduction in the number of cells expressing PI(4,5)P₂, most likely the result of the apoptotic cell death of these cells. The contrasting distribution of PI(4,5)P₂ amongst the spiral ganglion cells. In the 8 week Synj2 mutant, it is clear that PI(4,5)P₂ is saturated in the nucleus and it looks like there is a progressive disintegration of the plasma membrane. In the 12 week Synj2 mutant, PI(4,5)P₂ was exclusively in the nucleus of these cells, with the expression level of PI(4,5)P₂ seemingly reduced from that observable in the spiral ganglion cells of the 8 week Synj2 mutant. There was also a scattered pattern of PI(4,5)P₂ surrounding the nuclei, which may be residual PI(4,5)P₂ from the degraded plasma membranes. It is difficult to ascertain whether there is a rise in cellular PI(4,5)P₂ levels in the specific cell types in the inner ear of the Synj2 mutant, considering the high endogenous expression of PI(4,5)P₂. The contrasting distribution throughout the cells of the spiral ganglion is perhaps more representative of the affect of the defect in Synj2 hydrolysis of PI(4,5)P₂.

EXAMPLE 10 PI(3,4,5)P₃ localization in the inner Ear ofSynj2 wild-type and mutant mice

[0173] PI(3,4,5)P₃ is the phosphorylated derivative of PI(4,5)P₂. Although not thought to be the primary substrate of Synj2 hydrolysis, it is possible that Synj2 dephosphorylates PI(3,4,5)P₃ (Mitchell and Gurung, IUBMB Life 53(l):25-36, 2002), so that changes to Synj2 catalytic activity could affect PI(3,4,5)P₃ levels. As PI(3,4,5)P₃ is the effector of multiple downstream targets of the phosphoinositide 3 kinase (PI3K) pathway, changed levels of PI(3,4,5)P₃ might interfere with normal cellular functions. It was therefore of important to determine if cellular levels and sub-cellular localization of PI(3,4,5)P₃ were altered by the loss of Synj2 5 '-phosphatase activity.

[0174] Similar to PI(4,5)P₂, a commercially available mouse monoclonal antibody specially designed around the PH domain of this phosphatidylinositol was used to immunolocalize PI(3,4,5)P₃. An Alexa Fluor 594-conjugated secondary antibody was used to detect the primary antibody. The results obtained by confocal microscopy analysis in the wild-type Synj2 mouse revealed that PI(3,4,5)P₃ is expressed in most, if not all cells, at the three different ages. However strong immunofluorescence was seen in the inner and outer hair cells, supporting cells of the organ of Corti (inner and outer sulcus cells, cells of Deiters, Henson and Claudius), fibrocyte cells of the spiral ligament, cells of the spiral limbus and the neural cells localized in the spiral ganglion. The strong PI(3,4,5)P₃ signal in the cells of the organ of Corti and in the fibrocyte cells in the apical region of the spiral ligament is comparable for all three ages (4, 8 and 12 weeks, respectively). The intensity of the PI(3,4,5)P₃ signal appears to increase in the spiral limbus and in the spiral ganglion between 4 and 12 weeks.

[0175] A DAPI counter-stain, which specifically targets nuclei, was incorporated to ascertain the cellular localization of PI(3,4,5)P₃. This phosphatidylinositol was detected as a punctate staining throughout the cytoplasm of the spiral ganglion cell bodies and the cells of the organ of Corti.

[0176] The localization of PI(3,4,5)P₃ in the mutant Synj2 mouse is indistinguishable from the wild-type mouse. The intensity of the signal within all specific cell types however, appears considerably higher in the mutant mouse. This is particularly evident in the cells of the organ of Corti and the spiral ligament at 8 and 12 weeks time points, as well as in the spiral ganglion cells, where there are still many intact cells present. The apparent increase in PI(3,4,5)P₃ expression, which is exclusively focused on the spiral ligament. There appears to be an accumulation of PI(3,4,5)P₃ in the fibrocytes of the Synj2 mutant, when compared to the 12 week normal mice.

EXAMPLE 11 Clathrin localization in the Inner Ear ofSynj2 wild-type and mutant mice

[0177] As Synj2 plays a key role in clathrin mediated endocytosis, it was important to examine whether this important process was affected by the Synj2 mutation in the deaf mouse.

[0178] A commercial mouse monoclonal antibody specific to the light chain of the clathrin protein was used to track the sub-cellular localization of clathrin in the inner ear of the Synj2 wild-type and mutant mice at 4, 8 and 12 weeks of age, with subsequently fluorescence detection with an Alexa Fluor 594-conjugated secondary antibody. Clathrin is expressed in all cell types, but the level is expected to be particularly high in those cell types that have sensory-neural and ion trafficking properties.

[0179] The results taken from confocal microscopy analysis revealed that there is distinct and specific fluorescence in the wild-type Synj2 mouse in the inner and outer hair cells, supporting cells of the organ of Corti (inner and outer sulcus cells, cells of Deiters, Henson and Claudius), fibrocyte cells in the spiral ligament, cells of the spiral limbus and the neural cells of the spiral ganglion. The intensity of the fluorescence signal in all cell types where clathrin is expressed appears to increase with the age of the mouse. The incorporation of a DAPI counter stain allowed for enhanced determination of the cellular localization of the clathrin protein, hi the inner and outer hair cells, clathrin is specific to the apical tip and basal lateral cytoplasmic region of these sensory epithelial. The higher expression of clathrin in the inner hair cell is consistent with the inner hair cell having a more prominent role in synaptic transmission of the auditory signal in the inner ear. Clathrin localization amongst the spiral ganglion cells is entirely cytoplasmic, with clathrin dispersed in a punctate pattern. Similar to the other clathrin expressing cell types in the inner ear, a graduated developmental increase in clathrin level is evident in spiral ganglion.

[0180] The distribution of clathrin between the different cell types in the inner ear of the Synj2 mutant mouse is similar to that seen in the wild-type mouse. However, upon analysis of intracellular clathrin localization, it is noticeable that there are significant changes, especially within the cells of the spiral ganglion, as the Synj2 mutant mouse loses its hearing. At 4 weeks, when the Synj2 mutant mouse has near normal hearing, intracellular clathrin localization is indistinguishable to the 4 week wild-type mouse. However, a slight change is seen at 8 weeks and by 12 weeks there is a noticeable change in appearance of clathrin within the cells of the spiral ganglion. The expression pattern appears distorted (particularly at 12 weeks) and not nicely ordered like the Synj2 wild-type mouse. A similar clathrin expression pattern also appears in the fibrocyte cells of the spiral ligament. Instead of there being a dispersed punctuate pattern of clathrin (clathrin-coated vesicles) throughout the cytoplasm of the spiral ganglion cells, these cells contain larger accumulated "clumps" of clathrin, which suggests that the normal cycling of clathrin- coated pits is disrupted. Furthermore, there are a reduced number of spiral ganglion cells expressing clathrin in the deaf mouse, which is consistent with increased cell death in this tissue. EXAMPLE 12

TUNEL Assay - comparative analysis of the level of in situ cell death in the inner ear of

Synj2 wild-type and mutant mice

[0181] As hearing loss is normally associated with reduction in hair cells, supporting cells or neural cells, the possibility of apoptosis occurring in these cells in the deaf mouse was investigated.

[0182] The TUNEL assay was used. Two separate, but related methods were used in order to optimise the detection of DNA breaks within the cells of the frozen cochlea sections.

The main difference was the inclusion of a microwave antigen retrieval step, in an attempt to increase the permeability and subsequent access to the free 3' hydroxyl ends; thereby boosting the TUNEL signal obtained. Treating a tissue section with DNase I leads to the fragmentation of the genomic DNA. Such sections were used as positive controls for the assay and used as a reference point for determining the nuclear signal typical of an apoptotic cell.

[0183] Initially it was difficult to differentiate between a positive TUNEL signal and background fluorescence of the FITC (fluorescein) conjugated dUTP's. A fluorescent signal was observed in the negative control (no terminal transferase added). However closer analysis revealed that this signal differs from the positive control, the latter having a stronger and more dispersed signal. The main focus was on the spiral ganglion, as this is a region that appears to degenerate significantly in the Synj2 mutant. This is evidenced by the marked difference in the localization of the previously described phosphatidylinositols [PI(4,5)P₂ and PI(3,4,5)P₃] and clathrin, which are associated with Synj2 inositol 5' phosphatase activity; within the cells of the spiral ganglion.

[0184] Results acquired from confocal microscopy analysis did not reveal apoptosis in spiral ganglion cells in 4 and 8 week wild-type Synj2 mice. A few apoptotic cells were detected in the spiral ganglion in 12 week wild-type Synj2 mice. There is no significant signal difference in the spiral ganglion cells between the 4 week old Synj2 mutant and wild-type mice. Although there is a basal level of apoptotic cell death in the neural cells of the 12 week Synj2 wild-type mouse, the number of apoptotic cells is increased and the progression of the cell death is much more pronounced in 8 week and 12 week Synj2 mutant mice. Evidence of degrading DNA and malformation of the chromatin is quite striking, indicative of the apparent 'shutting-down' and imminent death of these cells.

EXAMPLE 13 Identification of mutations in Synj2 in human patients with impaired hearing

[0185] To investigate Synj2 mutations and SNP's in human patients the following methodology was used. DNA was isolated from 548 patient samples using standard molecular techniques and amplified by PCR and the amplified products were screened using HRM. Samples that had differences in HRM profiles compared to wild type control samples were subject to further sequence analysis.

EXAMPLE 14 DNA amplification

[0186] Figure 1 shows amplification products of SYNJ2 Exon 13 from 24 randomly selected samples using nested PCR approach. In the figure, amplification products from both rounds of PCR are shown with primary PCR products in the upper row and Nested

PCR products in the lower row. For all Exon product quantities are variable after the primary PCR and a smear of unspecific product formation were also observed in several lanes. The variation in product quantities is reduced considerably after the second round of amplification and there are no traces of additional products as seen after the primary PCR.

Similar results were obtained using nested PCR for amplification of SYNJ2 Exon 11-17.

[0187] Amplification of all seven SYNJ2 Exons screened to cover the Inositol 5- phosphatase domain, two set of PCR amplification protocols were optimized. One protocol were designed for the primary PCR amplification step and one for the following nested pre-HRM PRC amplification, and both protocols were successfully employed for amplification of all seven target Exons and provided single and clean amplicons.

EXAMPLE 15 SYNJ2 Inositol 5-phosphatase

[0188] A summary of all findings obtained from screening of the SYNJ2 Inositol 5- phosphatase domain (Exon 11-17) by HRM analysis are listed in Table 5 and Table 6. For each Exon a total of 528 samples were analyzed. Figure 2 shows an example of a standard pre-HRM Real-Time PCR amplification of 48 nested PCR samples in duplicates, and the following HRM melt curve. All 96 samples have similar amplification profiles and plateau after 45-46 cycles. In the succeeding temperature gradient scan, all samples in the run showed similar melt curve behavior melting between 79-80°C and no variants were detected in the HRM analysis. Similar quality RT-PCR and melt curve results were achieved for all seven Exons analyzed. Figures 3,4 and 5 show examples of SNPs detected using HRM.

EXAMPLE 16

Identification of genes associated with deafness (ENU SM-165 [5] mutant)

[0189] The strategy adapted to identify and characterising hearing loss mutants, included phenotypic high throughput screen of recessive ENU mutant libraries using the click box hearing test. Potential hearing loss mutants were identified, which were set up for heritability testing and to determine their hearing profile. On the other hand, the hearing loss mutants were also set up with a mapping cross. Cassical mapping studies were used to define the deafness locus, including microsatellites and Amplifluor SNP analysis. Candidate genes in the region were sequence analyzed to detect mutation in the causative gene, and subjected to molecular analysis. 21 potential mutant lines were identified with hearing loss and sometimes in association with vestibular problem manifested as behavioral problem. Of the 21 mutant lines, the causative gene was mapped in 5 mutants, 3 lines are currently mapping and further 2 are under validation phase to determine the inheritability of hearing loss of the founders. In 5 of 21 mutants, the founders were deaf due to other reasons non-genetical.

Identification of the causative gene [0190] Homozygosity mapping was used by genome wide scans to define the deafness locus in ENU SM-165[5] to mouse chromosome 10, DlOMit 198-D10Mit68. Fine mapping analysis using Amplifluor SNP based assay narrowed the deafness locus between D10-58.1 to 66.4 Mb. The deafness locus contained the cdh23 gene, which was sequenced for mutation detection. A novel mutation was detected which was a T to A transversion at nucleotide position 7486 (NM 23370) in Exon 52, resulting in amino acid 2360 (NP 075859) changing from a valine to a glutamic acid (cdh23p.V2360E) in the extracellular E-cadherin domain (EC) 22. Therefore, identifying otocadherin23 (cdh23) as the causative gene causing hearing loss in ENU SM-165[5] (C57BL6-cdh23^v"V2360E/HHMD) with no vestibular defect and therefore allelic variant to waltzer hearing loss mouse mutant.

Auditory profile

[0191] To examine the effect of the cdh23p.V2360E mutation on auditory function, ABR was used to assess the hearing profile in ENU SM-165[5]. The homozygous mutant displays profound hearing loss at 4 weeks of age, whereas normal ABR thresholds were observed to broadband clicks in cdh23p.V2360E+/+ and +/- mice. The cdh23p.V2360E^+/" heterozygous exhibits statistically significant (p<0.0001) increase in hearing threshold at 24 wks of age compared to cdh23p.V2360E^{+ +} wild-type littermates. Behavioral test including movement and righting response were normal in all 3 genotypes, indicating no vestibular defect.

Structural and molecular analysis

[0192] To establish whether the cdh23p.V2360E mutation caused partial or complete loss of function in-situ hybridization was performed and immunohistochemical analysis to determine level of cdh23 expression of in the mouse inner ear. Cdh23 RNA expression was localized to the outer (OHC) and inner hair (IHC) cells of normal hearing mouse, however diffused and reduced expression was observed in the hearing loss mutant cdh23p.V2360E. [0193] Immunofluorescence analysis was performed using cdh23 antibody on inner ear sections from P2 cdh23p.V2360E mutant and wildtype mice. Confocal microscopy demonstrated that expression of cdh23 was localized at the apical surface (stereocilia) of both OHC and IHC of hearing mice, whereas reduced expression was observed in the cdh23p.V2360E mutant. These results correlate with the level of cdh23 mRNA expression in the hair cells.

Molecular Modeling [0194] To investigate the structural effect of the Ieu66 to glutamic mutation of the cdh23 subdomain, molecular models were constructed of the extracellular calcium binding domains based on the mouse E-cadherin IEDH crystal structure. Both wild type and the L66E (the corresponding mutated amino acid is leucine in E-cadherin) mutations were constructed and simulated for 4 nano seconds (ns) of fully solvated molecular dynamics at 310 K using the NAMD software package. Simulations were run with both calcium ions in the crystallographically identified binding sites and with the calcium ions moved away from the binding sites. Images were generated using the VMD software package. Crystallographic studies have revealed the extracellular domains of calcium bound, E- cadherins to be parallel two fold symmetric dimers, held together primarily by a network of hydrogen bonding at an interface region coordinated by calcium ions. Additional inter- molecular salt bridges at positions kl4/d38 and rlO5/el99 also appear important to help stabilize dimer formation. Simulation of the wildtype models showed the parallel dimer structure to be quite stable, with no significant conformational change while the calcium ions are held in the calcium binding regions consisting of conserved residues el l, d67, e69, dlOO, dl03, dl34, dl36, and dl95. Removing the calcium ions from these positions allows greater flexibility in the calcium binding regions and consequently appears to destabilize the dimer complex. Residue leucine 66 helps stabilize the extracellular domains by participating in hydrophobic interactions with adjacent residues c9, f51, v62 and y74 with the sidechain portion directed internally. Simulations with leucine residue 66 mutated to glutamic acid consistently show the tendency for the glutamic residue to repel from the hydrophobic pocket and direct itself externally to the solvent causing a local conformational change. From the simulations evidence of the mutated residue was found to be able to form a new calcium binding arrangement with residue d67, such that to severely interrupt the WT calcium binding. The mutant form also appears to lead to other structural changes in adjacent beta sheets, altering the positioning of lysine 14, which is likely to affect its ability to form intermolecular salt bridging with glutamic acid 138. Therefore, the mutation alters the structural conformation, interfering with Ca2+ interaction, resulting in destabilization of the region.

EXAMPLE 17 Identification of genes associated with deafness (ENU SM-14[16] Mutant)

[0195] Homozygosity mapping by genome wide scans was used to define the deafness locus in ENU SM-14[6] mutant to mouse chromosome 7, D7Mitl26. Fine mapping analysis using Amplifluor SNP based assay narrowed the deafness locus between D7-87 to 94 Mb. Mutation detection by sequence analysis was performed that identified Myosin Vila as the causative gene in ENU SM-14[6] and therefore an allelic variant of Shaker 1 hearing loss mouse mutant. A novel mutation was detected which was a T to A transversion at nucleotide position 1720 in Exon 13, NM 008663 (AY821853, Nuc 1556), resulting in amino acid 487 (NP 032689) changing from an isoleucine (I) to an asparagine (N) (C57BL6-Myosin VIIa^{Shl "I487N}/HHMD).

Auditory profile

[0196] To examine the effect of the Myosin VIIap.I487N mutation on auditory function,

ABR was used to assess the hearing profile in ENU SM-14[6]. The homozygous mutant displays predominantly exhibited profound hearing loss at 4wk, however by 8 wk they were completely deaf. Normal ABR thresholds were observed to broadband clicks in Myosin VIIap.I487N+/+ and +/- mice. Furthermore, the Myosin VIIa-I487N+/- heterozygous has statistically significant (pO.OOOl) increase in hearing threshold at 24 wks of age compared to Myosin VIIa-I487N^+/+ wild-type littermates. Behavioral test (movement and righting response) indicated that the mutant had a vestibular defect as that manifested in circling behavior and abnormal righting response. Structural and molecular analysis

[0197] In order to determine the structural integrity of the inner ear, cochlea sections from 8 week old WT hearing and Myosin VIIap.I487N mutant were stained with Haematoxylin/Eosin. The cellular architecture in the mutant is clearly abnormal, the hair cells clearly evident residing on the basilar membrane in the WT sections are missing in the mutant.

Molecular modeling

[0198] To investigate the effects of mutation Myosin VIIap.I487N on its function, a wild- type and mutant myosin Vila model of the head domain was made using the 2DFS pdb structure as a template from residues 1 to 780. Models were solvated in a 72 x 96 x 160A box of water containing ~ 0.15 M NaCl and simulated for approximately 4 nanoseconds at 310K using NAMD molecular dynamics. Comparison of the ATP-bound Myosin II structure (pdb entry: 1W9J) with the inactive Myosin V structure (pdb entry:2DFS) shows significant conformational change exists between these states, especially the relative conformational change between a small beta sheet region of residues 718-730 and 672- 678 and the alpha helix of residues 449-481. A comparative dynamics study between the wild type and mutant forms of the protein indicated that a bulge region between residues 668 and 773 is destabilized by the presence of the I487N mutation. The mutant 487Asn residue is in a good position to hydrogen bond to the protein backbone around residue 772 and also to hydrogen bond to TYR477. Interaction of the mutant Asn to Tyr477 also appears to interfere with salt bridging interactions between Glu473, Arg675 and Arg668. Overlap of myosin hinge region after 4 ns of molecular dynamics simulation showing a conformational change in the region 670-673 close to the 487 mutation site. EXAMPLE 18

SM-19 ENU Mutant

Identification of the causative gene [0199] Homozygosity mapping by genome wide scans defined the deafness locus in ENTJ SM- 19 [6] mutant to mouse chromosome 19, D19Mit41. Fine mapping analysis using Amplifluor SNP based assay narrowed the deafness locus between D19-18.37 to 22 Mb. Mutation detection by sequence analysis was performed that identified Transmembrane channel-like gene 1 {Tmcl) as the causative gene in ENU SM-19[6] and therefore an allelic variant of Beethoven hearing loss mouse mutant. A novel mutation was detected which was an A to G transition at nucleotide position 708 in Exon 8 (NM 28953), resulting in amino acid 182 (NP 083229) changing from a Tyrosine (Y) to a Cysteine (C) (C57BL6- Tmcl^Btl>Y182C/HHMD). Another Bth allelic variant was identified, ENU SM-89[8], which had a novel mutation which was T to C transversion at nucleotide position 1508 in Exon 13 (NM 28953), resulting in amino acid 449 (NP 083229) changing from a Tyrosine (Y) to a Histidine (H) (C57BL6-Tmcl^Bth"Y449H/HHMD).

Auditory proΩIe

[0200] To determine the effect of Tmclp.Y182C and Tmclp.Y449H mutation in ENU SM-19[6] and ENU SM-89[8], respectively on auditory function broad-band click ABR hearing tests were performed. The homozygous mutant displayed severe to profound hearing loss at 4 weeks of age. There was no difference in hearing threshold observed between heterozygotes (NM) at 24 wks of age compared to either wild-type (NN) littermates Behavioral tests showed normal response in the Tmcl mutants indicating normal vestibular function.

Structural and molecular analysis

[0201] In order to determine the effect of the Y182C mutation on the structural integrity of the inner ear, (cochlea) sections from 8 week old WT and Tmclp.Y182C mutant mice were stained with Haematoxylin/Eosin (Figure 8). Both the IHC and OHC hair cells in the WT inner ear sections are clearly evident residing on the basilar membrane, whereas in the Tmclp.Y182C mutant these appear to be absent. The morphology of the stria vascularis appears abnormal and vacuolated. A similar pathology was observed with Tmclp.Y449H mutant as demonstrated for Tmclp.Y182C.

Molecular modeling

[0202] To predict the effects of the mutations Tmclp.Y182C and Y449H several proteomic algorithms were used. The Tyrosine residues were predicted to be highly evolutionarily conserved. MemBrain (Hongbin, S et al, PLoS One, 2008) predicted 9 transmembrane domains (TM) in Tmcl protein, which localises the Tyrosine residues 182 and 449 residing in TM 1 and 5, respectively. DIPro (http://scratch.proteomics.ics.edu) and DiANNA (http://bioinformatics.bc. edu/clotelab/DiANNA) disulphide bond prediction programs indicated that both the Tmcl mutations altered disulphide bond pairing. Polymorphism phenotyping (Polyphen) analysis which predicts the impact on structure/function due to amino acid substitution (http://genetics.bwh.harvard.edu/php) indicated the mutations would have probably (PSCI score: 2.884) and possibly (PSCI score: 1.984) damaging affect (leading to conformational changes) for Y182C and Y449H, respectively.

[0203] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. BIBLIOGRAPHY

Astle and Seaton, IUBMB Life 55(5; :451-456, 2006

Brennan, Am. J. Pharmacogenomics. l(4):395-302, 2001

Broman et al, Bioinformatics 79:889-890, 2003

Cariello Λm. J. Human Genetics 42:726-734, 1988

Conner et al, Proc. Natl. Acad. Sci. USA 50:278-282, 1983

Cotton et al, Proc. Natl. Acad. Sci. USA 57:4033-40371988

Edwards and Bartlett, Methods MoI. Biol. 226:287-294, 2003

Elghanian et al, Science 277:1078-1081, 1997

Finkelstein et al, Genomics 7:167-172, 1990

Grompe et al, Proc. Natl. Acad. Sci. USA 55:5855-5892, 1989

Hirono and Denis, Neuron 44(2):309-320, 2004

Kinszler et al, Science 251:1366-1370, 1991

Kwok, Curr Issues MoI. Biol. 5(2):43-60, 2003

McHugh and Friedman, Anat. Rec. A Discov. MoI. Cell Evol. Biol. 255(^:370-381, 2006

Mitchell and Gurung, IUBMB Life 53(l):25-36, 2002 Modrich Ann. Rev. Genet. 25:229-253, 1991

Mohr and Feldman, Int J Technol Assess health Care 7<ftø):l 120-1135, 2000

Morton, Ann N Y Acad Sci (550:16-31, 1991

Nance, Ment Retard Dev Disabil Res Rev 9(2) : 109- 119, 2003

Nemoto and Airibas, 75/0/ cΛe/n. 272(¥P):30817-30821, 1997

Neomoto and Wenk, J Biol Chem 276(44):4U33-4l 142, 2001

Novack et al, Proc. Natl. Acad. Sci. USA 53:586-590, 1986

Orita, et al, Proc. Natl. Acad. Sci. USA. 56:2766-2770, 1989

Pellequer and Westhof, JMoI Graph 11 (3):204-2l0, 191-192, 1993

Petersen and Willems, Clin. Genet 69(5):371-392, 2006

Petit, Trends MoI. Med. 720:57-64, 2006

Ruano and Kidd, Nucl. Acids Res. 17:8392, 1989

Sheffield et al, Proc. Natl. Acad. Sci. USA 86:232-236, 1989

Shenk et al, Proc. Natl. Acad. Sci. USA 72:989-993, 1975

Taylor et al, Biotechniques 50:661-669, 2001 Twyman and Primrose {Pharmacogenomics. 4(1):61-19, 2003 Wartell et al, Nucl. Acids Res. 18:2699-2105, 1990 White et al, Genomics 72:301-306, 1992

Whitlon and Szakaly, Brain Res Brain Res Protoc 6(3):\59-\66, 2001 Yoshinaga-Itano, Otolaryngol Clin. North Am. 32^:1089-1102, 1999

Claims

CLAIMS:

1. A method for identifying a sensory neuropathy in an individual, said method comprising screening for a mutation in a gene or gene expression product associated with the Synaptojanin-2 (Synj2) pathway, which mutation is indicative of a sensory neuropathy or risk of developing same, wherein the presence of the mutation provides an indication of the sensory neuropathy.

2. The method of Claim 1 wherein the sensory neuropathy is a hearing impairment.

3. The method of Claim 1 or 2 wherein the mutation is detected in Synj2 or its expression product.

4. The method of Claim 3 wherein the mutation is an amino acid substitution from asparagine to lysine at amino acid position number 43 in a mouse model or its human equivalent.

5. The method of Claim 3 wherein the mutation in the human Synj2 gene is selected from the list consisting of G1586C [S504T] in Exon 11; G1634A [R520H] in Exon 12; T1676C [M534T] in Exon 12; G1690 [V539M] in Exon 12; C1695T [N340N] in Exon 12; C1730T [T552M] in Exon 12; G1773A [S562S] in Exon 12; G1785A [S566S] in Exon 12; C1800T [S571S] in Exon 12; C2042G [T656M] in Exon 15 and/or G2253A [D726N] in Exon 16.

6. The method of Claim 1 or 2 or 3 or 4 or 5 wherein the mutation is detected in one or more oϊcdh23, connexin, TMCl,pendrin, myosin and/or usherin.

7. The method of Claim 6 wherein the mutation in cdh23 is an amino acid substitution from valine to glutamic acid at amino acid number 2360.

8. The method of Claim 6 wherein the mutation in mysoin7a is an amino acid substitution from isoleucine to asparagine of amino acid number 487.

9. The method of Claim 6 wherein the mutation in TMCl is an amino acid substitution from tyrosine to histidine at amino acid number 499 or a tyrosine to cysteine at amino acid number 182.

10. The method of any one of Claims 1 to 9 wherein the mutation is in one or more of FIG4, MTMR2, SBF2, FGD4, SPASTI, ZIN and/or Synjl.

11. The method assay of any one of Claims 1 to 10 wherein the mutation is a homozygous mutation.

12. The method of any one of Claims 1 to 10 wherein the mutation is a heterozygous mutation.

13. The method of Claim 11 or 12 wherein the mutation is a single or multiple nucleotide polymorphism.

14. A method of Claim 1 wherein the individual is a human.

15. Use of a gene or gene product selected from:

(i) Synj2;

(ii) cdh23\

(iii) a gene in the Synj2 pathway;

(iv) connexin, pendrin, myosin7a, usherin and/or TCMl; and

(v) FIG4, MTMR2, SBF2, FGD4, SPASTI, Synjl and/or ZIN in the manufacture of a diagnostic assay in the detection or monitoring of a sensory including peripheral neuropathy such as deafness.

16. Use of Synj2 or its protein in the manufacture of a diagnostic assay to detect a sensory neuropathy in a subject.

17. Use of Claim 16 wherein the Synj2 comprises an asparagine to lysine substitution at amino acid 453 in a mouse model or its human equivalent.

18. Use of Claim 16 wherein the mutation in the human Synj2 gene is selected from the list consisting of G1586C [S504T] in Exon 11; G1634A [R520H] in Exon 12; T1676C [M534T] in Exon 12; G1690 [V539M] in Exon 12; C1695T [N340N] in Exon 12; C1730T [T552M] in Exon 12; G1773A [S562S] in Exon 12; G1785A [S566S] in Exon 12; C1800T [S571S] in Exon 12; C2042G [T656M] in Exon 15 and/or G2253A [D726N] in Exon 16.

19. Use of Claim 17 or 18 wherein the mutation is a single or multiple nucleotide polymorphism.

20. Use of Claim 16 or 17 or 18 or 19 in combination with a mutation in one or more of connexin, TMCl, cdh23,pendrin, myosin7a and usherin.

21. Use of Claim 19 wherein the mutation in cdh23 is an amino acid substitution from valine to glutamic acid at amino acid number 2360.

22. Use of Claim 19 wherein the mutation in mysoin7a is an amino acid substitution from isoleucine to asparagine of amino acid number 487.

23. Use of Claim 19 wherein the mutation in TMCl is an amino acid substitution from tyrosine to histidine at amino acid number 499 or a tyrosine to cysteine at amino acid number 182.

24. Use of any one of Claims 15 to 23 wherein the sensory neuropathy is a hearing impairment.

25. Use of an animal model genetically modified to induce a mutation in a gene of the Synj2 pathway associated with a sensory neuropathy in manufacture of a medicament or diagnostic for the treatment or detection of sensory neuropathy.

26. Use of Claim 25 wherein the genetically modified animal or its parent is treated with N-ethyl-N-nitrosourea (ENU).

27. Use of Claim 26 wherein the mutation is a gene selected from:

(i) Synj2;

(ii) cdh23;

(iii) connexin, pendrin, myosin7a, usherin and/or TCMl; and

(iv) FIG4, MTMR2, SBF2, FGD4, SPASTI, Synjl and/or ZIN.

28. Use of Claim 27 wherein the Synj2 mutation comprises an asparagine to lysine substitution at amino acid 453 in a mouse model.

29. Use of Claim 27 wherein the mutation in the animal Synj2 gene is equivalent to a mutation in human Synj2 selected from selected from the list consisting of G1586C [S504T] in Exon 11; G1634A [R520H] in Exon 12; T1676C [M534T] in Exon 12; G1690 [V539M] in Exon 12; C1695T [N340N] in Exon 12; C1730T [T552M] in Exon 12; G1773A [S562S] in Exon 12; G1785A [S566S] in Exon 12; C1800T [S571S] in Exon 12; C2042G [T656M] in Exon 15 and/or G2253A [D726N] in Exon 16.

30. Use of Claim 27 wherein the mutation in cdh23 is an amino acid substitution from valine to glutamic acid at amino acid number 2360.

31. Use of Claim 27 wherein the mutation in mysoin7a is an amino acid substitution from isoleucine to asparagine of amino acid number 487.

32. Use of Claim 27 wherein the mutation in TMCl is an amino acid substitution from tyrosine to histidine at amino acid number 499 or a tyrosine to cysteine at amino acid number 182.

33. Use of any one of Claims 27 to 32 wherein the mutation is a single or multiple mutation in a single or multiple gene.

34. An animal model genetically modified to induce a mutation in a gene of the Synj2 pathway associated with a sensory neuropathy.