CN103103257A

CN103103257A - TMC1 deafness gene mutation screening method

Info

Publication number: CN103103257A
Application number: CN2012105794802A
Authority: CN
Inventors: 高雪; 戴朴
Original assignee: Chinese PLA General Hospital
Current assignee: Chinese PLA General Hospital
Priority date: 2012-12-28
Filing date: 2012-12-28
Publication date: 2013-05-15

Abstract

The invention provides a TMC1 deafness gene mutation screening method which comprises the following steps of: (1) extracting peripheral blood leucocyte DNA; (2) performing PCR amplification by taking the peripheral blood leucocyte DNA as a template and adopting an upstream primer TCCTCTAGCCTTCATACACCGAAGTC and a downstream primer AACCTGGGAGGCTTTTCTGT; and (3) performing enzyme digestion of the PCR amplification product by using restriction enzyme Asl 1 to obtain three strips of 160bp, 130bp and 30bp, which are the TMC1 deafness gene positive mutation samples. The method provided by the invention has the beneficial effects of easiness in implementation, simplicity in operation, low cost and high accuracy, and solves the problem that large-scale screening of people is difficult to perform at the hotspots when TMC1c.1714G is larger than A.

Description

A kind of TMC1 deaf gene Mutation Screening method

Technical field

The present invention relates to a kind of gene mutation for screening method, be specifically related to a kind of TMC1 deaf gene Mutation Screening method.

Background technology

Studies show that, 60% deafness is caused by inherited genetic factors, and other 40% is relevant with environmental factors.In the past because people lack deaf inheritance etiologic etiological deeply understanding and diagnostic techniques, can't clear and definite deaf molecular disease because of, more can't prevent its generation.Over nearly 30 years, follow the fast development of deaf inheritance nosetiology and Protocols in Molecular Biology, existing 84 deaf genes are cloned so far, and some common genes have obtained deep understanding, and deaf Molecular Etiology diagnosis becomes possibility.Although the America and Europe has carried out the deaf gene diagnostic work from last century end, but for want of the Chinese non-syndromic hearing loss crowd is caused the systematic Study of deaf inherited genetic factors, and lacking deaf gene examination and the diagnostic tool that meets China's actual conditions and genetic background, the clinical deaf gene diagnostic work of China is severely limited and lags behind far away.

The TMC1 transgenation can cause autosomal dominant and recessive deaf.As " deaf-related gene TMC1 " (" international otorhinolaryngology neck surgical magazine ", the 05th phase in 2008) report in, the TMC1 transgenation has autosomal recessive inheritance and two kinds of modes of inheritance of dominant inheritance, two kinds of distinct hearing phenotypic characteristics of corresponding appearance are paid close attention to by audiologist, geneticist and otology clinical position person just gradually.Studies show that: TMC1c.1714G＞A (p.D572N) is the hot spot mutation that causes the autosomal dominant deafness, and recent research has also found to carry the deaf family of this sudden change in China.Because this Sudden change region lacks restriction enzyme site, can not carry out endonuclease reaction, therefore detecting in the world at present this sudden change is mainly to adopt the Sanger sequencing.This method cost is higher, has limited the large-scale crowd examination of this sudden change.

Goal of the invention

In view of this, in order to overcome the deficiencies in the prior art, the invention provides a kind of TMC1 deaf gene Mutation Screening method, the method is simple, quick, economical, has solved the difficult problem that TMC1c.1714G＞A (p.D572N) focus is difficult to carry out the extensive examination of crowd.

The deaf mutator gene screening method of a kind of TMC1 provided by the invention, described method comprise (1) extraction peripheral blood leucocyte DNA; (2) take peripheral blood leucocyte DNA as template, with

Upstream primer: TCCTCTAG CCTTCATACACCGAAGTC

Downstream primer: AACCTGGGAGGCTTTTCTGT

Carry out pcr amplification, (3) cut described pcr amplification product with restriction enzyme Sal 1 enzyme, obtain 160bp, and 130bp, 30bp three bands are the positive sudden change of TMC1 deaf gene sample.

Further, the reaction conditions that enzyme is cut described pcr amplification product is: 37 ℃, and 4 hours.

Further, identify with 2% agarose gel electrophoresis after described pcr amplification product enzyme is cut.

Further, identify with 8% polyacrylate hydrogel electrophoresis after described pcr amplification product enzyme is cut.

Beneficial effect of the present invention is:

(1) be easy to realize: the technology of the present invention method does not need special expensive equipment, and can comparatively fast order the required reagent of experiment, and the experiment early-stage preparations time is short;

(2) simple to operate: the programming operations according to the molecular biology test chamber can be completed.

(3) cost is low: the restriction enzyme Sal 1 that introduces is common enzyme commonly used, cheap (500U/80 unit), every routine sample detection needs 1U, add that gel, electrophoresis liquid, enzyme cut the preparation of system, the endonuclease reaction cost is about 3 yuan/example, and traditional Sanger sequencing cost is 25 yuan/example.

(4) accuracy rate is high: detected result and Sanger sequencing result fit like a glove, without false negative, false positive.

(4) solved a difficult problem: in view of above advantage, this technology can extensively be carried out in grass-roots unit, has solved the difficult problem that TMC1c.1714G＞A (p.D572N) focus is difficult to carry out the extensive examination of crowd.

The present invention is by modifying to upstream, mutational site the 3rd bit base in design of primers, introduce Sal 1 restriction enzyme site, modified upstream primer, adopted amended primer to carry out the PCR reaction, amplified production can adopt enzyme cutting method that sudden change is identified, greatly reduces testing cost.

Be two band 130bp after wild-type sample (being not mutated sample) enzyme is cut, 30bp, heterozygous mutant type sample (i.e. positive sudden change sample) is three band 160bp, 130bp, 30bp is easy to contrast and identifies.

Description of drawings:

Fig. 1: 2% agarose gel electrophoresis evaluation enzyme is cut amplified production.

The gel electrophoresis result, lane 1,21 is the PCR product; Lane 2,3, and 4,6,7,8,9,10,11,12,14,16,17,18,19,20,22,23,24 is wild-type; Lane 5,13, and 15 is mutant

Fig. 2: the sample agarose gel electrophoresis after wild-type and mutant enzyme are cut is the interpretation schematic diagram as a result.

Fig. 3: the sample Sanger sequence verification after wild-type and mutant enzyme are cut.

Embodiment:

Embodiment 1

1, template DNA: extract DNA in peripheral blood leucocyte,

2, PCR reaction system

3, PCR loop parameter

4, endonuclease reaction system:

The endonuclease reaction condition: 37 ℃, 4 hours.

5. enzyme is cut product through 2% agarose gel electrophoresis analysis,

Prepare 2% sepharose: claim the agarose of 0.26g, get the tbe buffer liquid of 13mL, melten gel is treated slightly coolingly, adds the goldview of 1uL left and right, and a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices, 20min pull out later on comb.

Deposition condition: 80V electrophoresis 60min.Electrophoresis result such as Fig. 1.

6, the interpretation as a result of wild-type and mutant is as Fig. 2.

Embodiment 2

Substantially the same manner as Example 1, institute's difference is that enzyme cuts product and adopt the method for 8% native polyacrylamide gel electrophoresis to detect.4 μ L amplified productions and 2.5 μ L sample-loading buffer (10mM EDTA pH8.0,98% deionized formamide, 0.05% tetrabromophenol sulfonphthalein and 0.05% dimethylbenzene cyanogen) mix through 8% non-denaturing polyacrylamide (acrylamide: methylene diacrylamide=39: 1) gel electrophoresis, electrophoretic buffer is 1 * TBE (90mM Tri s-borate pH 8.5,2mM EDTA), 110V electrophoresis 5h left and right.

8% non-denaturing polyacrylamide gel preparation:

40% polyacrylamide (Acr: Bis=12mL39: 1)

Adopt rapid silver staining that 8% non-denaturing polyacrylamide gel is detected, concrete steps are as follows:

1) preparation 0.1% silver nitrate solution 500mL is to the polyacrylamide gel 15-20min that dyes;

2) utilize the quick rinsing gel of deionized water 15s;

3) add developing solution (500mL deionized water+0.4g Na ₂CO ₃+ 10g NaOH+750 μ L formaldehyde solution) colour developing, constantly shake;

4) treating that the DNA band is high-visible utilizes the rinsed with deionized water gel 1 time;

5) gel after dyeing is taken pictures, and carries out the banding pattern statistics.

Embodiment 3

In order to detect the accuracy of the inventive method, we carry out this sudden change in 21 routine deafness patients (having adopted early stage the Sanger sequencing to detect the existence that has confirmed that TMC1c.1714G＞A suddenlys change) and 128 routine Subjects With Normal Hearings enzyme cutting method detects, detected result and Sanger sequencing result fit like a glove, without false negative, false positive.

Claims

1. TMC1 deaf gene Mutation Screening method is characterized in that: described method comprises that (1) extract peripheral blood leucocyte DNA; (2) take peripheral blood leucocyte DNA as template, with

Upstream primer: TCCTCTAGCCTTCATACACCGAAGTC

Downstream primer: AACCTGGGAGGCTTTTCTGT

2. according to TMC1 deaf gene Mutation Screening method claimed in claim 1, it is characterized in that: the reaction conditions that enzyme is cut described pcr amplification product is: 37 ℃, and 4 hours.

3. according to TMC1 deaf gene Mutation Screening method claimed in claim 1, it is characterized in that: identify with 2% agarose gel electrophoresis after described pcr amplification product enzyme is cut.

4. according to TMC1 deaf gene Mutation Screening method claimed in claim 1, it is characterized in that: identify with 8% polyacrylate hydrogel electrophoresis after described pcr amplification product enzyme is cut.