WO2019078634A2 - Pharmaceutical composition for prevention or treatment of insulin resistance or fatty liver, comprising ptp4a1 protein - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for prevention or treatment of insulin resistance or fatty liver, comprising a PTP4A1 protein or a polynucleotide coding for the PTP4A1 protein. Overexpression of PTP4A1 protein results in the effect of alleviating insulin resistance and suppressing fatty liver production so that the PTP4A1 protein of the present invention can be effectively used as a therapeutic agent in the metabolic syndrome field.

Description

Pharmaceutical composition for prevention or treatment of insulin resistance or fatty liver comprising PTP4A1 protein

The present invention relates to a pharmaceutical composition for the prevention or treatment of insulin resistance or fatty liver comprising PTP4A1 (protein tyrosine phosphatase type IV A1) protein or a polynucleotide encoding said PTP4A1 protein.

Diabetes mellitus (DM) is a metabolic disorder in which the body does not produce sufficient insulin, or the cells are not responsive to the resulting insulin and high blood glucose is maintained. Hyperglycemia in diabetes causes classic symptoms of polyuria (frequent urination), increased thirst, and bulimia.

Type 1 diabetes results from the failure of insulin production in the body and can be improved by immediate injectable treatment with insulin. Type 1 diabetes is caused by the loss of insulin-producing beta cells in the islets of Langerhans in the pancreas, leading to insulin deficiency. Type 2 diabetes is sometimes caused by insulin resistance, which is a condition in which cells fail to properly use insulin, in combination with absolute insulin depletion, and hyperglycemia is a disease that improves insulin sensitivity or reduces glucose production by the liver Can be improved by treating the drug.

Insulin resistance refers to a pathological condition in which cells lose adequate responsiveness by insulin. In general, when digesting carbohydrates, insulin is secreted by glucose into the blood, and blood glucose is absorbed into cells by insulin and used as an energy source. That is, the level of blood sugar rises after the meal, thus stimulating cells of peripheral tissues (skeletal muscles and fat) to secrete insulin and actively take glucose from the blood as an energy source. Since blood glucose is used as an energy source, lipids stored in the body are not used as an energy source. However, the normal carbohydrate digestion process does not appear normally in the insulin resistant state.

In the insulin resistant state, beta cells in the pancreas secrete more insulin to maintain blood glucose homeostasis in order to lower blood glucose concentration. However, when insulin resistance does not allow an adequate amount of glucose to enter the liver, the liver is recognized to have low levels of glucose in the liver, thereby increasing glucose biosynthesis, which causes blood glucose to increase again. Therefore, in the state of persistent insulin resistance, even though the amount of insulin in the blood is increased, the blood glucose level is greatly increased and becomes a cause of metabolic disease.

Currently, the insulin resistance treatment method induces weight loss through dietary habits and lifestyle changes through exercise and exercise, thereby lowering the blood sugar level. The main problem is that patients do not maintain such treatment continuously. In this case, a hypoglycemic agent that lowers blood glucose (metformin, a kind of BIGOANID, thyazolidinediones such as pioglitazone and rosiglitazone, which activate PPARgamma, glucosidase inhibitors that delay the absorption of carbohydrates in the small intestine, , Sulfonylurea and non-sulfonylurea, alone or in combination with insulin, have been associated with problems such as weight gain, digestive disorders, cardiovascular disease, liver disease and hypoglycemia.

Therefore, it is required to develop a therapeutic technique that can overcome insulin resistance by increasing insulin sensitivity of cells through development of new therapeutic target detection and control technology that causes insulin resistance due to increasing insulin resistance-related diseases and problems of existing therapeutic agents.

Fatty liver disease is defined as fatty liver when fat accounts for more than 10% of liver weight and is closely related to metabolic diseases such as obesity and diabetes. Fatty liver formation can be the cause of insulin resistance, and conversely, insulin resistance can cause fatty liver production. The action of insulin in liver tissues can be broadly divided into the inhibition of glucose biosynthesis and the promotion of lipid biosynthesis. However, in the insulin-resistant state, only the inhibition of glucose biosynthesis is impaired and the lipid biosynthesis reaction is continuously activated, resulting in fatty liver formation. Fatty liver disease can be classified according to the presence or absence of inflammation and fibrosis, and fatty liver accompanied by inflammation and fibrosis is called lipid hepatitis. Continuous fatty liver disease may ultimately lead to liver cirrhosis, which can lead to hepatic function impairment, and there is no urgent need for the development and research of therapeutic agents in the absence of appropriate therapeutic agents except for liver transplantation.

Many studies have been conducted to prevent or treat insulin resistance and fatty liver. For example, Patent Document 1 discloses a technique for treating insulin resistance or fatty liver using a black bean leaf extract.

On the other hand, PTP4A1 (phosphatase of regenerating liver 1 (Pr1-1)) is a dual protein tyrosine dephosphorylation capable of eliminating phosphorylation of tyrosine residue and serine / threonine residue in 109 mammalian protein tyrosine dephosphorylating enzymes Belong to the enzyme group. PTP4A1 is known to play an important role in cell growth and liver regeneration as an immediate early gene, but there is no report of PTP4A1 related to insulin resistance and fatty liver induction.

[Prior Art Literature]

[Patent Literature]

Korean Patent Publication No. 2017-0023391

The present invention relates to a method for treating insulin resistance and fatty liver in which insulin resistance and insulin resistance which can substitute for these methods in order to solve the problems such as difficulties in continuous administration in the case of diet and side effects in chemotherapy, PTP4A1, a protein tyrosine dephosphorylase, is presented as a target molecule for the development of a preventive and therapeutic agent for fatty liver. Specifically, it is intended to provide a pharmaceutical composition for preventing or treating insulin resistance or fatty liver comprising a PTP4A1 protein or a polynucleotide encoding the PTP4A1 protein.

In order to achieve the above object, one aspect of the present invention provides a pharmaceutical composition for preventing or treating insulin resistance or fatty liver comprising a protein tyrosine phosphatase type IV A1 (PTP4A1) protein or a polynucleotide encoding the PTP4A1 protein .

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating insulin resistance or fatty liver comprising a cell transfected with a polynucleotide encoding a PTP4A1 protein.

Another aspect of the present invention relates to a method for detecting PTP4A1 comprising: 1) measuring the expression level of PTP4A1 in a sample derived from a subject as an experimental group; 2) comparing the expression level of PTP4A1 in step 1) with the expression level of PTP4A1 in the control-derived sample; And 3) determining that the expression level of PTP4A1 in step 2) is lower than that of the control, determining that the risk of insulin resistance or fatty liver is high, and providing a protein detection method for providing information on insulin resistance or fatty liver diagnosis do.

Another aspect of the present invention is a method for treating a PTP4A1-expressing cell line, comprising: 1) treating a test substance with a PTP4A1 expressing cell line; 2) measuring the level of expression or activity of the PTP4A1 protein in the cell line treated with the test substance of step 1); And 3) screening the test substance for which the expression or activity level of the PTP4A1 protein of step 2) is increased compared to the control not treated with the test substance, comprising the step of screening the test substance for insulin resistance or fatty liver therapeutic candidate .

When a polynucleotide-inserted vector encoding the PTP4A1 protein of the present invention was administered to a wild type mouse subjected to a high-fat diet, blood glucose level was lower than that of a control group not overexpressing PTP4A1, insulin resistance Is improved and the insulin sensitivity is restored. In addition, when PTP4A1 is overexpressed, the fat production is remarkably inhibited as compared with the control group in which PTP4A1 is not overexpressed. Therefore, the PTP4A1 protein of the present invention or a polynucleotide encoding the PTP4A1 protein can be used to improve insulin resistance or fatty liver.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned can be clearly understood by those skilled in the art from the following description.

Figure 1A is a graph showing the glucose tolerance test results of PTP4A1 deficient mice: WT; Wild-type mice, PTP4A1 ^-1-; PTP4A1 deficient mice, the same in the following figures.

Figure 1B is a graph showing the results of insulin resistance test of PTP4A1 deficient mice.

FIG. 2A is a graph showing blood glucose level of PTP4A1 deficient mice fed a high-fat diet. FIG.

FIG. 2B is a graph showing blood insulin levels in PTP4A1-deficient mice fed a high-fat diet.

FIG. 2c is a graph showing blood glucose levels when fasting diabetic PTP4A1 deficient mice were fasted: HFD (fast); Fasting is followed by fasting. In the following figures, fast is fasting.

FIG. 2d is a graph showing insulin levels in blood when fasting-fed PTP4A1-deficient mice were fasted.

Figure 2E shows the HOMA-IR results of PTP4A1 deficient mice with high fat diet.

FIG. 2f is a graph showing the results of glucose tolerance test of PTP4A1 deficient mice in high-fat diets.

FIG. 2g is a graph showing the results of insulin resistance test of PTP4A1-deficient mice that were fed a high-fat diet.

FIG. 3A shows the results of staining fat formed in liver tissue of PTP4A1-deficient mice that received high-fat diets.

Figure 3b shows the amount of triglyceride in liver tissue of PTP4A1 deficient mice fed high fat diet.

FIG. 4A shows the change in body weight after high-fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into PTP4A1 deficient mice, respectively.

Figure 4b shows the fasting blood glucose levels after high fat diet with AAV-aat-PTP4A1 and AAV-aat-Control injected into PTP4A1 deficient mice, respectively.

FIG. 4C shows the levels of insulin levels in the blood after high-fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into PTP4A1 deficient mice, respectively.

Figure 4d shows the glucose tolerance test results after high fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into PTP4A1 deficient mice, respectively.

Figure 4e shows the amount of triglyceride in liver tissue after high fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into PTP4A1 deficient mice, respectively.

FIG. 5A shows changes in body weight after high-fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into wild-type mice, respectively.

Figure 5b shows the fasting blood glucose levels after high fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into wild-type mice, respectively.

FIG. 5c shows the levels of insulin in the blood after high-fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into wild-type mice, respectively.

FIG. 5D shows results of glucose tolerance test after high-fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into wild-type mice, respectively.

FIG. 5E shows the amount of triglyceride in liver tissues after high-fat diet by injecting AAV-aat-PTP4A1 and AAV-aat-Control into wild-type mice, respectively.

FIG. 6 is an image showing the degree of suppression of lipogenesis in human hepatocyte from overexpressing PTP4A1.

In this specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless otherwise defined. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

Hereinafter, the present invention will be described in detail.

1. PTP4A1 (protein tyrosine phosphatase type IV A1) protein for the prevention or treatment of insulin resistance or fatty liver

An aspect of the present invention provides a pharmaceutical composition for preventing or treating insulin resistance or fatty liver comprising a PTP4A1 protein or a polynucleotide encoding the PTP4A1 protein.

In the present invention, 'insulin resistance' refers to a state resulting in an increase in blood glucose over a normal range not due to insulin deficiency.

In the present invention, 'fatty liver' is a disease that fat accumulates in hepatocytes and accounts for more than 10% of liver weight, and there are alcoholic fatty liver related to alcohol and nonalcoholic fatty liver which is not related to alcohol. In the present invention, the fatty liver preferably means a non-alcoholic fatty liver.

The term " prophylactic " refers to a reduction in the risk of developing a disease or disorder, i.e., one or more clinical symptoms of the disease progress in a subject that is susceptible to or susceptible to disease, . The term " treatment " refers to alleviating the disease or disorder, i.e., inhibiting or reducing the progression of the disease or one or more clinical symptoms thereof.

The PTP4A1 protein of the present invention comprises the amino acid sequence of SEQ ID NO: 1 (NP_035330.1) or the amino acid sequence of SEQ ID NO: 2 (NP_003454.1), and the PTP4A1 protein includes, Deletions, insertions, substitutions, or combinations of amino acid residues, or fragments thereof. Amino acid exchange at the level of proteins and peptides that do not globally alter the activity of the PTP4A1 protein is known in the art. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like. Accordingly, the present invention includes a protein having substantially the same amino acid sequence as the protein comprising the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, a mutant thereof, or an active fragment thereof. The substantially same protein means those having an amino acid sequence homology of not less than 80%, preferably not less than 90%, and most preferably not less than 95%, but is not limited thereto, and has homology of not less than 80% Activity is included in the scope of the present invention.

The polynucleotide encoding the PTP4A1 protein comprises the nucleotide sequence of SEQ ID NO: 3 (NM_011200.2) or the nucleotide sequence of SEQ ID NO: 4 (NM_003463.4, 1154-1675). The present invention also encompasses a gene consisting of a nucleotide sequence substantially identical to a nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence of SEQ ID NO: 4, and a fragment thereof. The term "gene comprising substantially the same base sequence" as used herein refers to those having 80% or more, preferably 90% or more, and most preferably 95% or more of sequence homology, but is not limited thereto, and 80% or more of the sequence homology And is not limited as long as it is expressed as PTP4A1 protein and maintains the function of preventing or treating insulin resistance or fatty liver. Such base sequences may be short or double-stranded, and may be DNA molecules or RNA (mRNA) molecules.

The polynucleotide encoding the PTP4A1 protein may be inserted into a vector. The recombinant vector of the present invention may further comprise a polynucleotide encoding PTP4A1 and a control sequence for transcription or translation thereof. Especially important regulatory sequences among the regulatory sequences are those that regulate transcription initiation, such as promoters and enhancers. It may also contain regulatory sequences consisting of initiation codon, termination codon, polyadenylation signal, Kozak, signal sequence for enhancer, membrane targeting and secretion, IRES (Internal Ribosome Entry Site), and the like. Such regulatory sequences and polynucleotides encoding PTP4A1 can be operably linked.

Promoters to be introduced for the specific purpose of the recombinant virus include CMV promoter, RSV promoter and SV promoter derived from viruses that induce continuous gene expression. Promoters capable of inducing expression of genes only in a specific environment and operated by hormones A promoter containing the ERE induced, an insect hormone-promoted promoter, an antibiotic tetracycline-induced promoter, and the like. These promoters can be inserted into the viral genome in a manner suitable for the purpose of the objective genetic material.

The vector may further include a promoter that specifically expresses a polynucleotide encoding PTP4A1 in liver tissue, and is a liver-specific promoter capable of regulating the transcription of the PTP4A1 polynucleotide. For example, a human alpha1-antitrypsin (hAAT or SERPINA1) promoter (hereinafter referred to as hAAT promoter) (SEQ ID NO: 5), a human albumin (ALB) promoter (SEQ ID NO: 6), human thyroxine-binding globulin or SERPINA7 promoter (hereinafter referred to as hTBG promoter) (SEQ ID NO: 7), human apolipoprotein 8) (nt + 233 to -548) and human cytochrome P450 3A4 (human cytochrome P450 3A4 or CYP3A4) promoter (hereinafter referred to as hAPOA2 promoter) (SEQ ID NO: ) (SEQ ID NO: 9) (nt +55 to -365) can be used. Preferably, hAAT promoter can be used, but is not limited thereto. The liver-specific promoter and the PTP4A1 polynucleotide are operatively linked and the PTP4A1 polynucleotide is expressed specifically in the liver rather than other tissues by introducing a vector into which the liver-specific promoter and the PTP4A1 polynucleotide are operatively linked And the efficiency of gene therapy can be enhanced. The liver-specific promoter may be derived from another gene or any other animal species. By "operably linked" is meant that when a gene is ligated downstream of the promoter sequence, the expression of the gene is ligated into a possible form.

The vector may be a linear DNA, a plasmid vector, a recombinant viral vector, which can be expressed in a human or animal cell, and the recombinant virus may be a baculovirus, a vanishia virus, a retrovirus, an adenovirus, an adeno-associated virus, a herpes simplex virus And lentivirus, and preferably it may be an adeno-associated virus, but is not limited thereto.

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating insulin resistance or fatty liver comprising a cell transfected with a polynucleotide encoding a PTP4A1 protein.

The vector may be introduced into the host cell in a manner well known to those of ordinary skill in the art. Methods of introduction include, but are not limited to, electroporation and lipofection, and methods known in the art can be selected.

The transduction may be stable or transient. One example of transient transduction involves vector expression in a particular cell in which the vector is not integrated into the host cell genome. On the other hand, stable transduction may involve vector expression in a particular cell, wherein the vector is integrated into the host cell genome.

The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, humans, and the like in various routes. &Quot; Administration " in the present invention includes a method of delivering a pharmaceutical composition or medicament into a system of a subject or to a specific area within or above the subject. Administration can be, for example, by intramuscular, parenteral, intravenous, intramuscular, subcutaneous, intradermal, intranasal, oral, percutaneous, intrauterine, intracerebroventricular or mucosal administration have. It may also be administered topically or systemically.

The pharmaceutical composition of the present invention may be administered together with one or more active ingredients exhibiting the same or similar functions. For administration, one or more additional pharmaceutically acceptable carriers may be included. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components. If necessary, an antioxidant, Other conventional additives such as a bacteriostatic agent may be added.

The amount of a component selected from the group consisting of a PTP4A1 protein, a polynucleotide encoding a PTP4A1 protein, and a polynucleotide encoding a PTP4A1 protein, which is an effective ingredient in the administration, is determined by the weight, age, sex, , Diet, administration time, administration method, excretion rate, target site and severity of disease. The daily dose of the pharmaceutical composition of the present invention may be administered in an amount of 0.0001 to 100 mg / kg, preferably 0.001 to 30 mg / kg, once or several times per day. In addition, the administration period may be from 1 day to 2 months, but may be administered unlimited until the prevention or therapeutic effect of the disease is manifested.

When the PTP4A1 protein is contained as an effective ingredient in the pharmaceutical composition of the present invention, the protein may be contained in an amount of 0.0001 to 10% by weight, preferably 0.001 to 1% by weight, based on the pharmaceutical composition.

When a vector comprising a polynucleotide encoding the PTP4A1 protein is contained as an effective ingredient in the pharmaceutical composition of the present invention, it is preferable that 0.05 to 500 mg is contained, more preferably 0.1 to 300 mg, and PTP4A1 In the case of a recombinant virus containing a polynucleotide, the protein preferably contains 10 ³ to 10 ¹² IU (10 to 10 ¹⁰ PFU), more preferably 10 ⁵ to 10 ¹⁰ IU.

The effective dose of the composition containing the polynucleotide encoding the PTP4A1 protein of the present invention as an active ingredient is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 ⁷ to 10 ^{6 in} the case of the recombinant virus, 10 ¹¹ viral particles (10 ⁵ to 10 ⁹ IU) / ㎏, preferably when the vector is 0.1 to 10 ㎎ / ㎏, when the recombinant virus is 10 ⁸ to 10 ¹⁰ particles (10 ⁶ to 10 ⁸ IU) / Kg, and can be administered 2 to 3 times a day. Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.

2. Methods for diagnosing insulin resistance or fatty liver by measuring the expression level of PTP4A1 protein, screening candidate therapeutic substances

Another aspect of the present invention relates to a method for detecting PTP4A1 comprising: 1) measuring the expression level of PTP4A1 in a sample derived from a subject as an experimental group; 2) comparing the expression level of PTP4A1 in step 1) with the expression level of PTP4A1 in the control-derived sample; And 3) determining that the expression level of PTP4A1 in step 2) is lower than that of the control, determining that the risk of insulin resistance or fatty liver is high, and providing a protein detection method for providing information on insulin resistance or fatty liver diagnosis do.

Diagnosis " in the context of the present invention refers to a subject based on observation, test or circumstances to identify a subject having a disease, disorder, or condition based on the presence of one or more indicators, such as a disease, disorder, Clinical or other evaluation of the condition of the subject.

A "sample" in the present invention represents a collection of similar fluids, cells, or tissues separated from a subject. The term " sample " refers to a body fluid (e.g., urine, serum, blood fluids, lymph, bile fluid, ascetic fluid, ocular fluids and fluids collected by bronchial washing and / , Ascites, tissue samples, or cells from a subject. It also includes tear drops, serum, cerebrospinal fluid, feces, sputum, and cell extracts.

The level of expression of PTP4A1 is determined by Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining (IHC), immunoprecipitation and immunofluorescence And the method of measuring the protein expression level can be applied to the present invention without limitation.

Another aspect of the present invention is a method for treating a PTP4A1-expressing cell line, comprising: 1) treating a test substance with a PTP4A1 expressing cell line; 2) measuring the level of expression or activity of the PTP4A1 protein in the cell line treated with the test substance of step 1); And 3) screening the test substance for which the expression or activity level of the PTP4A1 protein of step 2) is increased compared to the control not treated with the test substance, comprising the step of screening the test substance for insulin resistance or fatty liver therapeutic candidate .

The 'test substance' refers to all substances that are expected to indirectly or directly induce a change in the amount of gene expression that occurs in cells.

The test substance of step 1) may be selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacteria or fungi metabolites and bioactive molecules, Not limited.

The expression level of the PTP4A1 protein in step 2) can be determined by Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining (IHC), immunoprecipitation, Immunofluorescence and flow cytometry (FACS). Any method capable of measuring the protein expression level can be used without limitation in the present invention.

The activity level of the PTP4A1 protein in the step 2) can be measured by any one method selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip, The present invention is not limited thereto.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following examples and experimental examples are provided only for illustrating the present invention, and the content of the present invention is not limited by the following examples and experimental examples.

[Example 1]

Identification of Insulin Resistance in PTP4A1 Deficiency

Wei Ni and others PLoS One. 2014; 9 (9): e106718. Using the CRISPR / CAS9 gene correction method PTP4A1 deficient mice were prepared. The CRISPR system is a bacterial immune system that recognizes these fragments as DNA when invaded by viruses and plasmids, and then uses Cas 9 (CRISPR associated protein 9: RNA-guided DNA endonuclease enzyme), a nuclease Cut it out. This can be applied to the genome, and if it is recognizable by the guide RNA, which is a specific nucleotide sequence, the desired site can be cut and corrected. When preparing pX330 (bicistronic expression vector) expressing Cas9 and gRNA (single guide RNA), gRNA was prepared by targeting PTP4A1. The nucleotide sequences of gRNA, wild-type PTP4A1, and PTP4A1 KO are shown in Table 1 below. The prepared pX330 vector was introduced into a embryonic stem cell through a microinjection technique to produce a KO (knock-out) mouse.

SEQ ID NO:	Gene name	The sequence (5 '- > 3')
10	gRNA	AAAGGACGAAACACC
11	PTP4A1 WT	AAGTCTTGTGAAGA TTAAGTTTCGTGAAGAACC T GG TTGCTGTATTGCTGTCCA
12	PTP4A1 KO	AAGTCTTGTGAAGATTAAGTTTCG * * * * * * * * * * * * * TGCTGTATTGCTGTCCA
* Indicates the deletion of the nucleotide at the position.

As a control group, wild type mice were used. Glucose tolerance test (GTT) was performed on each mouse. Glucose tolerance is measured by measuring the glucose level with time after glucose injection. The glucose tolerance is measured by measuring the glucose level in the blood, that is, the degree of glucose absorption. The higher the concentration of glucose in the blood, High. After fasting for 16 hours, the animals were fasted and fed with 2 g D-glucose / Kg of body weight. The blood glucose level was measured with Bayer breeze for 2 hours. In addition, insulin tolerance test (ITT) was also performed on each mouse. The mice were fasted for 6 hours and fasted. The blood glucose level was measured with a glucose meter for 2 hours after intraperitoneal injection of 1 U insulin / kg of body weight (Bovine Insulin-Sigma # 10516) , PTP4A1 - deficient mice had higher fasting blood glucose and hyperglycemia than the control group, and the area under the Curve of Glucose (AUC) was higher than that of wild - type mice at the time of glucose loading. From this, it was found that glucose resistance was deteriorated when PTP4A1 deficiency (Fig. 1A). Regarding insulin resistance, PTP4A1-deficient mice were also found to be insulin sensitive because their blood glucose levels remained higher than those of the control group even when insulin was administered, and the area of blood glucose was higher than that of the control group (FIG. 1B ).

[Example 2]

Insulin resistance through high-fat diets and insulin sensitivity deterioration due to PTP4A1 deficiency in the fat-fed mouse model and promotion of fatty liver formation

2-1. Evaluation of insulin resistance after high fat diet

Insulin resistant mice lacking PTP4A1 (PTP4A1 ^{- / -} ) prepared in Example 1 were used as an experimental group and wild type mice (WT) were used as a control group. Each mouse was given a high fat diet (60% fat, HFD) for 12 weeks to produce a nonalcoholic fatty liver disease model. After 5 and 12 weeks, blood glucose and insulin concentrations were measured , And the glucose tolerance and insulin resistance of the experimental group and the control group were evaluated in the same manner as the glucose tolerance test and the insulin resistance test of Example 1, respectively. In addition, when each mouse was fasted for 16 hours to inhibit insulin secretion, blood glucose and insulin levels were examined and HOMA-IR levels were evaluated to evaluate insulin resistance. HOMA-IR was calculated using the following equation.

HOMA-IR = fasting insulin (uU / mL) fasting blood glucose (mg / dL) / 405

As a result, when PTP4A1 was deficient, blood glucose was higher than that of wild type control (Fig. 2a). Analysis of insulin in the blood revealed that when PTP4A1 was deficient, the insulin concentration at the time of high-fat diet was significantly increased (FIG. 2B). PTP4A1 deficient mice significantly increased blood glucose level in the control group (Fig. 2c) when insulin secretion was inhibited for 16 hours, and blood insulin levels were significantly elevated compared to the control group (Fig. 2d). In addition, HOMA-IR for evaluating insulin resistance was found to be 2.5 or more, which is close to insulin resistance (Fig. 2E). As for glucose tolerance, PTP4A1 - deficient mice had higher fasting blood glucose and hyperglycemia than the control group, and the area under the Curve of Glucose (AUC) was higher than that of the wild type mice. From this, it was found that glucose resistance was deteriorated when PTP4A1 deficiency (Fig. 2f). Regarding insulin resistance, it was also found that PTP4A1-deficient mice are insulin sensitive because their blood glucose levels are maintained higher than those of the control group even when insulin is administered, and the area of blood glucose is higher than that of the control group, indicating insulin resistance ).

These results indicate that insulin resistance is significantly higher in the insulin resistance-deficient mice than in the control group even when a fatty liver disease model is established by high-fat diet in mice deficient in PTP4A1.

2-2. Evaluation of fatty liver formation after high fat diet

As in Example 1-1, the hepatic disease model established by insemination of PTP4A1 deficient insulin resistant mice was sacrificed at week 12 and liver was extracted. Liver tissue was subjected to oil-red O lipid staining and H & E (hematoxylin and eosin) staining, and the level of lipid formation was assessed by quantifying the amount of lipid.

As a result, mice with high insulin resistance (PTP4A1 ^{- / -} ) fed with high fat diet had more fat staining and significantly higher hepatic triglyceride (hepatic TG) levels than the control group, (Figs. 3A and 3B).

These results suggest that PTP4A1 deficiency causes insulin resistance and PTP4A1-deficient mice with insulin resistance cause fatty liver formation. Therefore, PTP4A1 plays an important role in metabolic diseases such as insulin resistance and fatty liver Could know.

[Example 3]

Identification of effect of PTP4A1 on liver tissue specific expression on insulin signaling and resistance or fatty liver formation: Analysis in PTP4A1 deficient mice treated with high fat diet

(Aat) (SEQ ID NO: 5), which is a liver-specific gene for adeno-associated virus (AAV) in order to analyze the effect of PTP4A1 on liver tissue-specific expression on insulin signaling and resistance, Were used to prepare the AAV-aat-PTP4A1 vector. PTP4A1 uses mouse-derived mPTP4A1 CDS nucleotide sequence (NM_011200.2) (SEQ ID NO: 1), which encodes the mPTP4A1 amino acid sequence of SEQ ID NO: 3. AAV8.2-hAAT-Flag-mPTP4A1 (AAV-aat-PTP4A1 vector) was constructed by double infecting insect Sf9 cells with rBV-inCap8.2-inRepOpt (V105) and rBV-hAAT-Flag-mPTP4A1 (KB22). The AAV8.2-hAAT-intron vector (AAV-aat-control vector) was also constructed by double infecting insect Sf9 cells with rBV-inCap8.2-inRepOpt (V105) and rBV-hAAT-intron (KB23). The vector was purified by using a CsCl supernatant centrifuge twice. CsCl was removed via buffer exchange with a desalting column. The prepared AAV-aat-PTP4A1 vector was injected into a PTP4A1-deficient mouse in a high-fat diet as in Example 2. As a control group, AAV-aat-Control was injected into PTP4A1 deficient mice with high-fat diets. The prepared vector was injected with 2 × 10 ¹¹ AAV through mouse tail vein injection. After induction of PTP4A1 expression, body weight, glucose, glucose tolerance and insulin resistance were evaluated. In addition, the amount of neutral lipids was quantified to evaluate the degree of fatty liver formation.

As a result, there was no difference in body weight between the AAV-aat-PTP4A1 injected group and the AAV-aat-Control injected group in the PTP4A1-deficient mice subjected to the high-fat diets (Fig. 4a) and the PTP4A1 ATP-aat-PTP4A1 injected mice showed significantly lower fasting blood glucose levels (Fig. 4b) and significantly lower blood insulin levels than the AAV-aat-Control injected control group (Fig. 4c) . Also, glucose resistance was significantly improved by the glucose tolerance test (FIG. 4d).

These results suggest that the insulin resistance of PTP4A1 deficient mice can be improved by the exogenous PTP4A1 expression.

ATP-aat-Control-treated mice were fed a high-fat diets containing AAV-aat-PTP4A1 and AAV-aat-Control. -PTP4A1 injected group showed significantly lower neutral lipid levels than the control group AAV-aat-Control injected group (Fig. 4e))

These results suggest that PTP4A1-deficient mice can be improved through the expression of exogenously injected PTP4A1.

[Example 4]

Identification of effect of PTP4A1 on liver tissue specific expression on insulin signal transduction, resistance or fatty liver formation: Analysis in wild type mice subjected to high fat diet

We confirmed that expression of PTP4A1 can improve insulin resistance even when insulin resistance is induced by high-fat diet without deficiency of PTP4A1. AAV-aat-PTP4A1 and AAV-aat-Control were respectively injected into wild type mice to prepare test mice and control mice, and the insulin resistance was evaluated after high-fat diet. After the experiment was conducted in the same manner as in Example 3, except that the mice used were different, the degree of insulin resistance improvement was evaluated.

AAV-aat-PTP4A1 injection group and control AAV-aat-Control injection group were administered to the wild-type mice, respectively. There was no difference in body weight when the mice were fed a high-fat diet (Fig. 5A) One group showed significantly lower fasting blood glucose levels (Figure 5b) and significantly lower blood insulin levels than the control group AAV-aat-Control (Figure 5c). Also, glucose resistance was significantly improved by the glucose resistance test (Fig. 5d).

These results show that insulin resistance in the absence of PTP4A1 deficiency can be improved by introducing PTP4A1 in addition to insulin resistance by deficiency of PTP4A1.

ATP-aat-PTP4A1 was injected into the wild-type mouse and the AAV-aat-Control injected group. The results of biochemical analysis of neutral lipid in the liver were compared with those of AAV-aat-PTP4A1 (Fig. 5e), the neutral lipid level was lower than that of the control group, AAV-aat-Control.

These results suggest that the addition of PTP4A1 can improve fatty liver formation in the absence of PTP4A1 deficiency in addition to fatty liver formation caused by deficiency of PTP4A1.

[Example 5]

Confirmation of inhibition of fat production during overexpression of PTP4A1

 ATP-aat-PTP4A1 and AAV-aat-control vector prepared in Example 3 were transfected into HepG2 hepatocyte (ATCC; HB-8065), and then PTP4A1 was overexpressed to induce lipogenesis by treatment with oleate. And the degree of suppression of fat production was confirmed. BSA-OA (bovine serum albumin conjugated oleic acids, 400 μM) was added to the cell culture medium (DMEM containing 10% FBS) after preparing a stable cell line overexpressing PTP4A1 or mock through lenti virus in HepG2 hepatocyte After incubation for 24 hours, cells were fixed with 4% paraformaldehyde and lipid stained by oil red o staining method.

As a result, the cell line overexpressing PTP4A1 was significantly inhibited from lipogenesis compared to the control cells (Fig. 6). From the above results, it was also found that the introduction of PTP4A1 in the cell line lacking PTP4A1 significantly inhibited the fat production.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the scope of the invention is not limited to the disclosed exemplary embodiments. It will be possible to change it appropriately.

Claims (15)

1. A pharmaceutical composition for preventing or treating insulin resistance or fatty liver comprising PTP4A1 (protein tyrosine phosphatase type IV A1) protein or a polynucleotide encoding said PTP4A1 protein.
2. The method according to claim 1,

   Wherein the PTP4A1 protein comprises the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2. 2. A pharmaceutical composition for preventing or treating insulin resistance or fatty liver,
3. The method according to claim 1,

   Wherein the polynucleotide encoding the PTP4A1 protein comprises the nucleotide sequence of SEQ ID NO: 3 or the nucleotide sequence of SEQ ID NO: 4, or a pharmaceutical composition for preventing or treating insulin resistance or fatty liver.
4. The method according to claim 1 or 3,

   A pharmaceutical composition for preventing or treating insulin resistance or fatty liver, wherein the polynucleotide encoding the PTP4A1 protein is inserted in a vector.
5. The method of claim 4,

   Wherein the vector further comprises a promoter that specifically expresses a polynucleotide encoding the PTP4A1 protein in liver tissue.
6. The method of claim 5,

   The promoter may be a human alpha1-antitrypsin promoter (hAAT promoter) (SEQ ID NO: 5), a human albumin promoter (ALB promoter) (SEQ ID NO: 6), a human thyroxine-binding globulin promoter human thyroxine-binding globulin promoter, hTBG promoter (SEQ ID NO: 7), human apolipoprotein promoter (hAPOA2 promoter) (SEQ ID NO: 8) and human cytochrome P450 3A4 promoter , CYP3A4 promoter) (SEQ ID NO: 9). The pharmaceutical composition for preventing or treating insulin resistance or fatty liver according to claim 1, wherein the promoter is a promoter selected from the group consisting of:
7. The method of claim 4,

   Wherein said vector is a recombinant viral vector, for the prophylaxis or treatment of insulin resistance or fatty liver.
8. The method of claim 7,

   Wherein the recombinant virus is any one selected from the group consisting of baculovirus, vannisia virus, retrovirus, adenovirus, adeno-associated virus, herpes simplex virus and lentivirus, and a pharmaceutical composition for preventing or treating insulin resistance or fatty liver Composition.
9. A pharmaceutical composition for preventing or treating insulin resistance or fatty liver comprising a cell transduced with a polynucleotide encoding a PTP4A1 protein.
10. 1) measuring the expression level of PTP4A1 in a sample derived from a subject as an experimental group;

    2) comparing the expression level of PTP4A1 in step 1) with the expression level of PTP4A1 in the control-derived sample; And

    3) determining that the level of expression of PTP4A1 in step 2) is lower than that of the control, the risk of developing insulin resistance or fatty liver is high;

    Wherein the method comprises the steps of:
11. The method of claim 10,

    The level of expression of PTP4A1 is determined by Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining (IHC), immunoprecipitation and immunofluorescence Wherein the protein is detected by any one of the methods selected from the group consisting of:
12. 1) treating the test substance with the PTP4A1-expressing cell line;

    2) measuring the level of expression or activity of the PTP4A1 protein in the cell line treated with the test substance of step 1); And

    3) selecting the test substance whose expression or activity level of the PTP4A1 protein of step 2) is increased compared to the control not treated with the test substance;

    / RTI > a method of screening a candidate substance for an insulin resistance or fatty liver therapeutic agent.
13. The method of claim 12,

    Wherein the test substance in step 1) is selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens of bacterial or fungal metabolites and bioactive molecules. Screening method for candidate substances for treating liver disease.
14. The method of claim 12,

    Expression levels of the PTP4A1 protein in step 2) can be determined by Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining (IHC), immunoprecipitation and immunization A method for screening a candidate for an insulin resistance or fatty liver therapeutic agent, wherein the method is selected from the group consisting of immunofluorescence and flow cytometry (FACS).
15. The method of claim 12,

    The activity level of the PTP4A1 protein of step 2) is determined by any one of the methods selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chips. ≪ / RTI >

Images