TWI742617B - Antidiabetic and antihyperlipidemic effects of sulphurenic acid from antrodia camphorata - Google Patents

Abstract

The present patent was demonstrated that the protective effect of sulphurenic acid (SA), a pure compound from Antrodia camphorata, on diabetes and hyperlipidemia by lowering blood glucose but increasing blood insulin levels with restoration of the size of the islets of Langerhans cells and beta cell numbers, and increasing the skeletal muscular expressions of membrane glucose transporter 4 (GLUT4) and phospho-Akt and phospho-AMPK, thus leads to its hypoglycemic and hypolipidemic effects.

Description

Purified sulphoporosic acid extracted from Antrodia cinnamomea and its use for anti-diabetic and anti-hyperlipidemia

The present invention relates to a purified product of Antrodia cinnamomea, in particular to a purified product extracted from Antrodia cinnamomea mycelium, Sulphurenic Acid (SA) for the preparation of anti-diabetic and/or anti-hyperlipidemia pharmaceutical compounds use.

Type 1 diabetes (T1D), also known as juvenile diabetes or insulin-dependent diabetes, is a type of diabetes caused by the pancreas secreting little or no insulin. It is currently known that a combination of genetic and environmental factors can lead to type 1 diabetes. Its mechanism includes the destruction of the beta cells in the pancreas that produce insulin. Diabetes is diagnosed by measuring the concentration of glucose or glycosylated hemoglobin (HbA1C) in the blood. Type 1 diabetes accounts for about 5% to 10% of all diabetes cases. Type 1 diabetes is associated with many complications, which are considered to be the cause of morbidity and death in diabetic patients. There is currently no known method to prevent type 1 diabetes, and controlling insulin is a necessary means to avoid diabetes or to extend the survival of diabetic patients.

For the treatment of diabetes and drug development, streptozotocin (STZ) is one of the most commonly used diabetic agents for inducing diabetes in animal model experiments. It induces the toxicity of pancreatic β cells to cause diabetes. Medicaments have been widely used to induce insulin-dependent diabetes or type 1 diabetes. Streptozotocin is a donor of nitric oxide, which can cause the destruction of islet cells; and streptozotocin has been shown to produce reactive oxygen species (ROS), which can cause DNA fragmentation and Cause other harmful changes in pancreatic tissue, therefore, multiple low dose (Multiple low dose, MLD)-STZ injections (ie 35-55 mg/kg body weight for 4-5 consecutive days) are generally used to model the destruction of pancreatic β-cells And hyperglycemia, and can be used to establish insulin-dependent diabetes (insulin-dependent diabetes, IDDM) model, while reducing the area of each islet by 70%.

The main cellular mechanism produced by ingesting carbohydrates when blood sugar is low is that glucose is stimulated by insulin to be transported into skeletal muscle. Among them, glucose transporter 4 (GLUT4) is an insulin-regulated glucose transporter mainly expressed in skeletal muscle and adipose tissue. Skeletal muscle is considered to be the main part of the body where insulin regulates glucose uptake. Insulin stimulates glucose uptake in these cells mainly by inducing the net translocation of GLUT4 from the intracellular storage location to the cell membrane.

At present, there are two main cellular mechanisms known to explain the effect of promoting the displacement of GLUT4 to the plasma membrane: one is the transmission of insulin signals through the phosphoinositide 3-kinase (PI3-kinase)/Akt pathway, and the other is through the gland Glycoside monophosphate activated protein kinase (AMP-activated protein kinase, AMPK) pathway conducts insulin signals.

For the treatment of diabetes, Glibenclamide (Glib) is the second-generation analogue of sulfonylureas. Glibenclamide is an oral hypoglycemic agent that stimulates pancreatic beta cells to secrete insulin. The hypoglycemic mechanism of glibenclamide is to stimulate the pancreatic β cells to secrete insulin under the condition that the pancreatic β cells must still have the function of partially storing insulin, and the pancreas has no or almost no insulin secretion effect. Glyburide can enhance the effect of insulin in cultured cells and stimulate the synthesis of glucose transporters. Sulfonylurea drugs have also been shown to inhibit liver gluconeogenesis.

It is worth noting that Antrodia camphorata (Antrodia camphorata) belongs to the Polyporaceae (Aphyllophorales) of the Polyporaceae (Polyporaceae, Aphyllophorales), which is a known edible fungus and is used in folk remedies in Taiwan. Since Antrodia cinnamomea grows only in the heartwood of the evergreen Cinnamomum kanehirai tree, it is very rare and expensive. Antrodia cinnamomea is known to be composed of many biologically active compounds, which have been proven to improve health and various diseases. The mycelium of Antrodia cinnamomea has anti-cancer activity, liver protection, immune regulation, antioxidant, scavenging free radicals and anti-inflammatory activity. The fermentation broth showed anti-cancer effects, and the fruit body of Antrodia cinnamomea showed anti-cancer, liver protection and immunomodulatory activities. There is evidence that the filtrate from solid cultures and submerged cultures of fruiting bodies has hepatoprotective and antioxidant effects. Studies have shown that ergostatrien-3𝛽-ol (EK100), dehydroeburicoic acid (TR2), eburicoic acid (TR1) and Antcin K (AnK, which is a kind of wheat) extracted from Antrodia cinnamomea The new triterpenoid compound of kerasterol (ergostane-type) skeleton shows excellent anti-hyperglycemia and anti-hyperlipidemic activities. However, as shown in the structural formula of Figure 1, the purified product "Sulphurenic Acid (SA, 24-methylenelanosta-8-ene-3β,15α-diol-21-oic acid, 10) from Antrodia cinnamomea; TR3)”, its anti-diabetic and anti-hyperlipidemic potential in STZ-induced diabetic mice is still unknown.

The present invention provides a purified sulphoporosic acid extracted from Antrodia cinnamomea and its use in anti-diabetic and anti-hyperlipemia. ^{Since Thr 172} phosphorylation on α subunits is essential for AMPK activity, the present invention uses animal model experiments to evaluate the blood glucose and lipids of STZ-induced diabetic mice treated with sulfoporosic acid (SA). Whether it is adjusted, and compare these changes with two clinical drugs including glibenclamide (Glib) and fenofibrate (Feno) to confirm the potential of sulfoporosic acid (SA) in regulating blood sugar and lipid metabolism active. The aforementioned glibenclamide (Glib) is a sulfonylurea drug that can cause hypoglycemia by stimulating the release of insulin from pancreatic β cells. The aforementioned fenofibrate (Feno) is an agonist of peroxisome proliferator activated receptorα (PPARα). It is currently used to treat hypertriglyceridemia, which can cause hypolipidemia ( hypolipidemia).

In addition, because phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (glucose-6-phosphatase, G6Pase) are the key rate-limiting enzymes of glucose generation (gluconeogenesis). Therefore, based on a possible mechanism, the present invention also used animal model experiments to evaluate whether sulfoporosic acid (SA) can regulate the gene expression of anti-diabetic, adipogenesis, fatty acid oxidation and other related genes in STZ-induced diabetic mice. The aforementioned related genes include PEPCK, G6Pase, PPARα and lipogenic fatty acid synthase (FAS).

The first purpose of the present invention is to develop a new use of the purified substance sulphoporosic acid of Antrodia cinnamomea purified product, which is used to prepare medicinal compounds for the treatment of type 1 diabetes. The purified product is a purified substance extracted from the mycelium of Antrodia cinnamomea , The purified material is sulphur-color polyporic acid.

The second purpose of the present invention is to develop a new use of the purified substance of Antrodia cinnamomea sulphoporosic acid, which is used to prepare medical compounds for the treatment of hyperlipidemia associated with type 1 diabetes. The purified substance is derived from Antrodia cinnamomea The purified substance extracted from the silk body, the purified substance is sulphoporosic acid.

The third object of the present invention is to develop a new use of the purified material was purified Antrodia Polyporus sulphureus acid, which is based preparation for lowering blood glucose and glycosylated hemoglobin (HbA1 _C), and increasing the insulin concentrations of the drug compound, which was purified system The purified substance extracted from the mycelium of Antrodia cinnamomea. The purified substance is sulphur-colored polyporic acid.

Among them, the new use of the purified Antrodia camphorata is to improve insulin secretion by increasing the size of pancreatic islets and increasing the number of β-cells for insulin secretion.

Among them, the new use of the purified Antrodia camphorata is by increasing the phosphorylated Akt of C2C12 muscle fibers and the expression of GLUT4 on the cell membrane and the activation of AMPK, as well as increasing the GLUT4 protein on the cell membrane in skeletal muscle and increasing the expression of skeletal muscle p-AMPK protein. It also enhances the expression of p-Akt and p-FoxO1 in living livers, but reduces the mRNA of PEPCK and G6Pase to reduce the blood glucose concentration.

The fourth object of the present invention is to develop a new use of the purified substance of Antrodia cinnamomea sulphuric acid, which is used to prepare medicinal compounds for reducing blood triglycerides and total cholesterol in type 1 diabetes. The purified substance It is a purified substance extracted from the mycelium of Antrodia cinnamomea. The purified substance is sulphur-colored polyporic acid.

Among them, the new use of the purified Antrodia camphorata is to reduce the expression of FAS and PPARγ in the liver with sulphopolyporic acid and reduce the mRNA of SREBP1C, and increase the expression of PPARα to induce an increase in liver fatty acid oxidation, thereby increasing liver β -Oxidation activity and reduction of hepatic triglyceride synthesis, to reduce the blood triglyceride concentration.

Among them, the new use of the purified Antrodia cinnamomea is to reduce the mRNA of SREBP2 with sulphoporosic acid to reduce the value of total cholesterol in the blood.

The fifth object of the present invention is to develop a new use of the purified substance of Antrodia cinnamomea sulphoporosic acid, which is used to prepare medicinal compounds for treating fatty liver associated with type 1 diabetes and reducing vacuolation of the liver. The purified substance is a purified substance extracted from the mycelium of Antrodia cinnamomea, and the purified substance is sulphoporosic acid.

Among them, the new use of the purified Antrodia cinnamomea is to down-regulate the expression of PPARγ and FAS lipid production genes through sulphur-colored polyporic acid, reduce the differentiation of adipocytes, reduce the accumulation of fat in adipocytes, and reduce fatty liver, and through sulphur-colored porous Bacteric acid up-regulates the expression of liver fatty acid metabolism PPARα to reduce the expression of PPARγ gene, thereby reducing liver lipids and lowering the content of triglycerides in the blood.

Wherein, the new use of the purified Antrodia cinnamomea is to prepare a medicinal compound that increases leptin in the blood of type 1 diabetes. The purified product is a purified substance extracted from the mycelium of Antrodia cinnamomea. Bacteric acid.

In this way, through the purified substance sulphocorporic acid in the purified material of Antrodia cinnamomea, the diabetes and other related symptoms induced by STZ can achieve the following effects after administering the purified sulphocoric acid:

(1) The blood glucose value of the mice treated with 10, 20, and 40 mg/kg/day of sulphur-colored polyporic acid decreased significantly.

(2) By administering a dose of 40 mg/kg/day sulphochromoporic acid treatment, the glycosylated hemoglobin (HbA1 _C ) of STZ-induced diabetic mice was reduced.

(3) The insulin concentration of STZ-induced diabetic mice is increased by administering thiochromoporic acid treatment, which can improve insulin by increasing the average area of pancreatic islets and increasing the number of insulin-secreting β-cells. secretion.

(4) Through the treatment of sulfoporosic acid, the blood triglyceride (TG) and total cholesterol (TC) concentrations of STZ-induced diabetic mice are reduced, showing that sulfoporosic acid can improve The effect of diabetes and dyslipidemia.

(5) Through the treatment of sulphoporosic acid, the expression levels of GLUT4, p-AMPK and p-Akt in the skeletal muscle of STZ-induced diabetic mice were increased, showing that sulphoporosic acid has the effect of improving hyperglycemia. (P-AMPK, phospho-AMPK, phosphorylated adenosine monophosphate activated protein kinase; p-Akt, phospho-Akt, phosphorylated protein kinase B)

(6) In the process of improving hyperglycemia through the treatment of thiochromoporosic acid, the mRNA expression level of PEPCK and G6 Pase will be reduced accordingly, achieving the effect of inhibiting the production of liver glucose and accompanied by the effect of lowering blood sugar. (PEPCK, Phosphoenolpyruvate carboxykinase, phosphoenolpyruvate carboxykinase; G6-Pase, glucose-6-phosphatase, 6-phosphate glucose)

(7) By increasing the liver expression of PPARα and the mRNA expression of CPT-1a, it shows that the treatment of thioporic acid has the effect of lowering blood lipids.

(8) By reducing the expression of FAS, the treatment of thiochromoporosic acid has the effect of promoting the reduction of blood triglycerides.

(9) Through the treatment of sulphocorporic acid, STZ induced a decrease in the mRNA expression of SREBP-2 in diabetic mice and a decrease in blood cholesterol index, showing that sulphocorlic acid can regulate PPAR by increasing the GLUT4 protein of the skeletal muscle cell membrane α, FAS and increase the expression of p-AMPK/t-AMPK in skeletal muscle and liver tissue to prevent or improve diabetes and dyslipidemia in STZ-induced diabetic mice.

Some typical embodiments of the features and advantages of the present invention will be described in detail in the following description. It should be understood that the present invention can have various changes in different aspects, but they do not depart from the scope of the present invention, and the descriptions and drawings therein are essentially for illustrative purposes, not for limitation. this invention.

The present invention provides a new application of the purified substance sulphoporosic acid (SA) and its derivatives of the purified product of Antrodia camphorata for the preparation of medicinal compounds for lowering blood sugar, liver lipids, triglycerides, total cholesterol, and the treatment of diabetes. The following will further explain the extraction method of the purified Antrodia camphorata and its efficacy test.

The purified product of Antrodia cinnamomea in the present invention refers to a single component extracted from the freeze-dried powder of the entire extract of Antrodia cinnamomea mycelium: the purified substance Sulphurenic Acid (SA). The immersion culture solution containing the freeze-dried Antrodia cinnamomea powder of the present invention is obtained from the Biotechnology Center of Grape King Company (Zhongli City, Taiwan); the specific extraction method of the purified substance sulphur-colored porous bacteric acid (SA) is to combine Antrodia cinnamomea powder (1.6 kg). ) After extracting 3 times with methanol (16 L) at room temperature, the methanol extract was evaporated in vacuo to obtain a brown residue, which was suspended in H ₂ O (1 L), and then with 1 L of ethyl acetate (EtOAc) Assign 3 times. The EtOAc fraction (95 g) was chromatographed on silica gel and eluted with a mixture of hexane and EtOAc to increase polarity, and then further purified by high performance liquid chromatography (HPLC). Sulfur-colored polyporic acid (24-methylene lanostane-8-ene-3β, 15α-diol-21-acid, 10; TR3; SA) (1.1g) was eluted with a hexane solution containing 50% EtOAc ) It was eluted with 50% EtOAc and recrystallized with EtOH.

As shown in Figure 1, the chemical structural formula of the purified sulphoporosic acid (SA) of Antrodia cinnamomea according to the present invention is shown. The spectral measurement data are as follows: white powder; mp 246–248°C (MeOH); (α) _D + 36.4°C (c 0.22, MeOH); 1 H NMR (300 MHz, pyridine-d5): δ 3.41 (1H, dd , J = 7.0, 8.3 Hz, H-3), 4.61 (1H, dd, J = 6.2, 8.9 Hz, H-15), 1.05 (3H, s, H-18), 1.05 (3H, s, H- 19), 1.00 (3H, d, J = 6.9 Hz, H-26), 0.99 (3H, d, J = 6.8 Hz, H-27), 4.84 (1H, br s, H-28a), 4.87 (1H , Br s, H-28b), 1.34 (3H, s, H-29), 1.20 (3H, s, H-30), 1.17 (3H, s, H-31); 13C NMR (75 MHz, pyridine- d5): δ 36.2 (t, C-1), 28.7 (t, C-2), 78.1 (d, C-3), 39.3 (s, C-4), 50.9 (d, C-5), 18.9 (T, C-6), 27.7 (t, C-7), 134.9 (s, C-8), 135.2 (s, C-9), 37.3 (s, C-10)), 21.2 (t, C -11), 30.2 (t, C-12), 45.2 (s, C-13), 52.2 (s, C-14), 72.5 (d, C-15), 39.5 (t, C-16), 46.7 (D, C-17), 16.9 (q, C-18), 19.4 (q, C-19), 49.0 (d, C-20), 178.7 (s, C-21), 31.9 (t, C- 22), 32.7 (t, C-23), 155.9 (s, C-24), 34.2 (d, C-25), 21.9 (q, C-26), 22.0 (q, C-27), 107.1 ( t, C-28), 18.1 (q, C-29), 28.6 (q, C-30), 16.3 (q, C-31); APCI-MS (position): m / z 467 (M +1) .

The chemical products used in the animal model experiment of the present invention include: GLUT4 antibody (no. sc-7938) purchased from Santa Cruz Biotech (Santa Cruz, Paso Robles, CA, USA); phosphorylated AMPK (Thr ¹⁷² ), PPARα (no. ab8934) and PPARγ (no. ab45036) were purchased from Abcam Inc. (Cambridge, MA, USA); FAS (no. 3180), phosphorylated Akt (Ser ⁴⁷³ ) (no. 4060), total AMPK (Thr ¹⁷² ), phosphoric acid PhosphoFoxO1 (Ser ²⁵⁶ ) (no. 11115), total FoxO1 (Ser ²⁵⁶ ) (no. 2880) and β-actin (no. 4970) were purchased from Cell Signaling Technology (Danvers, MA, USA). Secondary anti-rabbit antibodies were obtained from Jackson ImmunoRes. Lab. (West Grove, PA, West Baltimore Pike, USA). Anti-insulin (1:100, no. sc-9168) or anti-glucagon (1:200, no. sc-13091) primary antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz Inc., Paso Robles, CA, USA).

In vitro experiments

[Cell Culture]

In the present invention, C2Cl2 skeletal myoblasts (ATCC, CRL-1772) are placed in a growth medium for cell culture, and the growth medium is Dulbecco's modified Eagle medium (DMEM, Dulbecco's modified Eagle medium; From Gibco BRL company); this medium is supplemented with 10% fetal bovine serum (FBS; from Hyclone company), 100U/mL penicillin and 100μg/mL streptomycin (Gibco BRL company), at 37°C and containing 5 Cultivate in a humid environment with% CO _2. The cells used to differentiate into muscle fibers were then seeded in a 9cm diameter petri dish at a density of 1×105; after 48 hours, when the cell confluent reached 80%, the medium was replaced with 1% (v/v) The DMEM of FBS was replaced at 2, 4, and 6 days of culture. On the 6th day after the completion of myofibroblast differentiation, the cells were treated with 1, 5, 10, and 25 μg/mL sulphocorporic acid (SA) or 10 nM insulin; this has been described in our previous report.

[Detection of the expression level of phosphorylated Akt (Ser ^{473) in cell lines]}

In the animal model experiment of the present invention, the protein concentration of the supernatant for detection is measured by the BCA protein quantification kit (BCA assay, Pierce). The specific detection steps include: take the same amount of protein, in SDS sample buffer (62.5 mM tris (hydroxymethyl) aminomethane (Tris-HCl), 20% glycerol, 2% sodium dodecyl sulfate (SDS), 75 M dithiothreitol (DTT), and 0.05% bromophenol blue) diluted four times, using SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) supplemented by Western blotting (Western blotting) The specific antibodies against total membrane-Akt (t-Akt) and phosphorylated Akt (Ser ⁴⁷³ ) (p-Akt (Ser ⁴⁷³ )) were determined. Alpha Easy FC software (purchased from Alpha Innotech Corp., Randburg, South Africa) was used to perform Western blot density analysis.

[Animal Experiment and Treatment]

The animal experiment of the present invention has been approved in accordance with the guidelines of Taiwan Zhongtai University of Science and Technology and the regulations of the Laboratory Animal Care and Use Committee (IACUC, No. 106-CTUST-08). Use 4-week-old male C57BL/6J mice obtained from the National Laboratory Animal Breeding Center. The animal treatment research program adopted by the present invention is to maintain the mice in a cycle of alternating light and dark every 12 hours, and provide free drinking water and standard rodent food. Among them, mice were given a specific dose of excipient (water); streptozotocin (streptozotocin, purchased from Sigma Chemical, St. Louis, MO, USA) was dissolved in 0.05 M cold sodium citrate buffer (pH 4.5) In. After seven days of environmental adaptation, the mice were intraperitoneally injected with 55 mg/kg streptozotocin solution to induce diabetes every day for five consecutive days, and then waited for a week. It was found that STZ induced hyperglycemia in diabetic mice, that is, fasting blood glucose higher than 250 mg/dL. The STZ-induced diabetic mice were randomly divided into six groups, each of which included seven mice; of which three groups were the experimental groups in which sulfosporic acid (SA) was orally administered, and the doses of oral administration (tube feeding) were as follows 10, 20 or 40 mg/kg (group names are STZ+SA1 group, STZ+SA2 group and STZ+SA3 group), the other three groups are the control group, and the treatment method is to administer similar volumes of distilled water (ie The aforementioned excipients, this group is called STZ group), glibenclamide (the group is called STZ+Gilb group, the oral dose is 10 mg/kg), fenofibrate (the group is called STZ+Feno) Group, the oral dose is 250 mg/kg). The aforementioned excipients, sulphoporosic acid (SA), glibenclamide (Glib) and fenofibrate (Feno) were administered orally once a day for a period of three weeks.

To determine the blood biochemical index, all mice were fasted overnight for 10 hours, and blood samples (approximately 150-200 μL) were collected from the retroorbital sinus under anesthesia. At the end of the experiment, the mice were euthanized with carbon dioxide, and then the liver, skeletal muscle and white adipose tissue (WAT) (including epididymis, mesenteric, and retroperitoneal WAT) were dissected and weighed, and the aforementioned was quickly frozen at -80°C Organize for target gene analysis. In addition to the measurement of blood glucose concentration, heparin (30 units/mL) (Sigma) is added to the test tube for collecting the blood sample first, and then the test tube is dried; the test tube treated with heparin is immediately used to collect the blood sample. The whole blood was centrifuged at 1600g and 4°C for 15 minutes to collect plasma samples, and the separation was completed within 30 minutes. Collect the supernatant for biochemical analysis (including total cholesterol (TC) and triglycerides (TG), 20-30μL). Collect aliquots of plasma samples (> 25μL) for the determination of insulin, adiponectin and leptin. During the experiment, the mouse body weight was measured at the same time every day (10:00 AM). Weigh the weight of the food particles given, and weigh the weight of the remaining food 24 hours after the food is given. The difference between the two is regarded as the food intake of the mice. In addition, mice were monitored, including weight changes, skin diseases, food consumption, and the appearance of all mice.

[Analysis of blood glucose, biochemical, adipocytokines and glycosylated hemoglobin (HbA1C) values]

In the animal model experiment of the present invention, the fasting blood glucose concentration is determined by taking a blood sample (>20μL) collected from the sinuses behind the orbit. Approximately 20 μ L of fresh blood sample quickly placed on foil and using a machine (Model 1500; Sidekick glucose analyzer; YSI Incorporated company, Yellow Springs, OH, USA) using the read blood glucose concentration by glucose oxidase. The concentration of total cholesterol and triglyceride in the blood was measured with commercial test kits (Triglycerides-E test and Cholesterol-E test, Wako Pure Chemical, Osaka, Japan) according to the manufacturer's instructions. Collect aliquots of plasma samples for the determination of insulin, adiponectin and leptin, and use the enzyme-linked immunosorbent assay (Enzyme-Linked Immunosorbent Assay, ELISA) kit (mouse insulin ELISA kit, Mercodia, Uppsala, Sweden); adiponectin ELISA kit, Crystal chem; mouse leptin ELISA kit, Morinaga, Yokohama, Japan). The percentage of glycosylated hemoglobin was determined using the Hemoglobin A1C kit (BioSystems SA, Barcelona, Spain).

[Histological examination]

Soak a small piece of liver tissue and pancreas in formalin (200 g/kg) neutral buffer solution, and then coat them with paraffin; cut off part (8μm) to form sections and stain them with hematoxylin and eosin, and then A microscope (Leica, DM2500) was used for inspection, and images were taken with a Leica digital camera (DFC-425-C) at a magnification of 10 (eyepiece) × 10 (objective lens). Each image is typical and represents seven mice.

The present invention evaluates the immunohistochemistry (IHC) staining status of insulin (brown) and glucagon (green) in mouse pancreatic islets, and briefly uses anti-insulin (1:100, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA, no. sc-9168) or an anti-glucagon (1:200, Santa Cruz Biotechnology, no. sc-13091) primary antibody. The staining technique was developed using the Histostain-Plus broad spectrum (AEC) kit (Invitrogen, Frederick, MD, USA, no. 859943). The IHC procedure was performed according to the manufacturer's instructions, and images were taken at 400 magnification.

[Relative quantification of mRNA and western blot]

Relative quantification of mRNA (primers shown in Table 1 below) and immunoblots. The present invention is used to evaluate the expression of GLUT4 on the cell membrane of skeletal muscle ^{and the expression of phosphorylated AMPK (Thr 172} ) and phosphorylated Akt in the liver. To evaluate the expression of phosphorylated Akt, phosphorylated FoxO1, PPARα, FAS and PPARγ in liver tissue. The skeletal muscles of mice were measured for GLUT4 expression, and the total membrane fraction as described above was collected and evaluated. The skeletal muscle is powdered under liquid nitrogen and homogenized for 20 seconds in a buffer (pH 7.4) containing 250 mmol/L sucrose, 50 mmol/L Tris and 0.2 mmol/L oxalic acid. Centrifuge the homogenate at 9000 × g for 10 minutes (4°C), and remove the supernatant. Wash the pellet with buffer and centrifuge 3 times. The supernatants obtained by the three centrifugation were mixed, and centrifuged at 190,000×g for 60 minutes (4° C.). The resulting pellet was resuspended in a small amount of buffer (approximately 0.5 mL) as the total membrane fraction. As mentioned in previous studies, Western blotting was used to analyze the protein expression of GLUT4, phosphorylated AMPK and total AMPK on the cell membrane.

Table I Gene license number Forward primer and reverse primer PCR product (bp) Annealing temperature ( ℃ ) Liver PEPCK NM_011044.2 F: CTACAACTTCGGCAAATACC R: TCCAGATACCTGTCGATCTC 330 52 G6Pase NM_008061.3 F: GAACAACTAAAGCCTCTGAAAC R: TTGCTCGATACATAAAACACTC 350 50 SREBP1c NM_011480 F: GGCTGTTGTCTACCATAAGC R: AGGAAGAAACGTGTCAAGAA 219 50 SREBP2 AF289715.2 F: ATATCATTGAAAAGCGCTAC R: ATTTTCAAGTCCACATCACT 256 47 β-actin NM_007392 F: TCTCCACCTTCCAGCAGATGT R: GCTCAGTAACAGTCCGCCTAGA 99 55

[Statistical Analysis]

All results are expressed as mean and standard error. Whenever, the experiments of the present invention use SPSS software (25.0.0.0, SPSS Inc., Chicago, IL, USA) to perform analysis of variance on the data, and then perform Dunnett's multiple range tests. When the statistical analysis result is p>0.05, it is considered to be statistically significant.

The above describes the experiment and detection method of the purified sulphoporosic acid extracted from Antrodia cinnamomea and its use for anti-diabetic and anti-hyperlipemia. Please refer to Figures 2A to 7D below to illustrate the animal model of the present invention. The result of the experiment.

[Expression of Akt phosphorylated protein in cell line]

Experiments are performed in cell lines. As shown in Figure 2A and Figure 2B, sulphur-colored polyporic acid (SA) activates Akt in a time-dependent manner. The expression level of phosphorylated Akt reached the highest concentration after 60 minutes of sulfoporosic acid treatment, which was equivalent to insulin.

[Body weight, food intake and relative tissue weight of diabetic mice induced by STZ]

The average weight of all mice entering the animal room was 15.81±0.42g, and all mice were allowed to acclimate in the animal room for one week. After STZ induction, the body weight of the normal control group (CON group for short) was 20.97±0.74 g, while the weight of STZ-induced mice was 19.19±0.17 g (p>0.05). Then, the STZ induced mice were divided into 6 groups, followed by drug vehicle (STZ control group, referred to as STZ group), SA1 (abbreviated to STZ+SA1 group), SA2 (abbreviated to STZ+SA2 group), SA3 (Referred to as STZ+SA3 group), Glib (referred to as STZ+Gilb group) or Feno (referred to as STZ+Feno group) for 3 weeks. At the end of the experiment, it was found that the final body weight of the STZ-induced mice was lower than the CON group (p>0.05), and there was no significant difference in the final body weight between the STZ+SA group (SA1, SA2, SA3) and the STZ+Gilb group, or , There was no significant difference in the final weight between the STZ+Feno group and the STZ group (Figure 3A). The STZ induction group consumed more food than the CON group mice (p>0.05); compared with the STZ group, there was no difference in the food intake of the STZ+SA group, STZ+Gilb group, and STZ+Feno group ( Figure 3B).

STZ induction significantly reduced the relative weight of epididymal white adipose tissue (EWAT), retroperitoneal WAT (RWAT), visceral fat and skeletal muscle (p>0.001, respectively) , P> 0.001, p> 0.001 and p> 0.001), but compared with the CON group, the relative weight of liver tissues in the STZ induction group increased (p> 0.001) (Figure 3C and Figure 3D). Compared with STZ group, STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, or STZ+Gilb group, compared with STZ group, in epididymal WAT (EWAT), mesenteric WAT (mesenteric WAT, MWAT), retroperitoneal WAT (RWAT), visceral fat, There were no significant differences between the relative weights of skeletal muscle, liver tissue, and brown adipose tissue (BAT). Compared with the STZ group, the STZ+Feno group significantly reduced the relative weight of epididymal WAT (EWAT) (p>0.05), but increased the relative weight of skeletal muscle and liver tissue (p>0.01 and p>0.001, respectively) ( As shown in Figure 3D).

[Blood metabolism parameters in diabetic mice induced by STZ]

Compared with the CON group, the blood glucose and HbA1C values of the STZ-induced mice increased significantly (p> 0.001 and p> 0.001, respectively) (Figure 3E, F). Compared with the STZ group, administration of SA1, SA2, or SA3 reduced blood glucose values (p>0.05, p>0.05, and p>0.001, respectively) (Figure 3E). Compared with the STZ group, SA3 treatment reduced the blood HbA1C value (p>0.05) (Figure 3F). Compared with the CON group, the plasma triglyceride (TG) and total cholesterol (TC) values of STZ-induced diabetic mice increased significantly (p>0.001 and p>0.05, respectively) (Figure 3G, H). Compared with the STZ group, treatment with SA1, SA2, SA3, Glib or Feno significantly reduced plasma TG values (p>0.05, p>0.01, p>0.001, p>0.05 and p>0.001, respectively) (Figure 3G) . Compared with the STZ group, treatment with SA1, SA2, SA3, Glib or Feno showed decreased plasma TC values (p>0.05, p>0.01, p>0.01, p>0.05, and p>0.05, respectively) (Figure 3H). Compared with the CON group, STZ-induced blood insulin values were significantly reduced (p>0.001). Compared with the STZ group, treatment with SA1, SA2, or SA3 significantly increased blood insulin concentration (p>0.05, p>0.01 and respectively). p >0.01) (Figure 3I).

Compared with the CON group, the STZ group significantly reduced the adiponectin (Figure 3J, p>0.001) and leptin concentration in the blood of mice (Figure 3K, the statistical analysis result was p>0.001). Treatment with SA2, SA3, Glib or Feno can increase the concentration of adiponectin in the blood of mice (as shown in Figure 3J, the statistical analysis results are p>0.01, p>0.01, p>0.05, and p>0.001 in order). Compared with the STZ group, the administration of SA3 and Feno significantly increased the leptin concentration (as shown in Figure 3K, the statistical analysis results were p> 0.001 and p> 0.001). Compared with the CON group, the STZ group significantly increased the plasma free fatty acid (FFA) concentration (Figure 3L, the statistical analysis result is p>0.001). Treatment with SA2, SA3, Glib or Feno can significantly reduce the plasma FFA concentration (as shown in Figure 3L, the statistical analysis results are p> 0.001, p> 0.001, p> 0.001, and p> 0.001).

[Histological status of STZ-induced diabetic mice]

Compared with the CON group, the STZ group showed a slight ballooning of hepatocytes in mice, but there was no ballooning of hepatocytes after treatment with SA1, SA2, SA3, Glib or Feno (as shown in the figure). 4A). Compared with the CON group, the pancreatic islets of the STZ group showed a phenomenon of retraction from its classic circular shape, and after treatment with SA1, SA2 and SA3, the size change of the mouse pancreatic islets was improved and reduced Degeneration in the pancreatic islets (Figure 4B). As shown in Figure 4C, compared with the CON group, STZ induction resulted in a decrease in the average area of pancreatic Langerhans islets (the statistical analysis result was p>0.001). Compared with the STZ group, after treatment with SA1, SA2 and SA3, the average area of the pancreatic islets increased (the statistical analysis results were p> 0.001, p> 0.001 and p> 0.001). Compared with STZ group, STZ mice treated with Glib and Feno had no significant difference in the average area of pancreatic islets. The immunostaining results of insulin (brown) and glucagon (green) are shown in Figure 4D. After treatment with SA3, the insulin concentration and the number of β cells were significantly increased.

[MRNA expression of liver target genes in STZ-induced diabetic mice]

As shown in Figure 5, the concentrations of G6Pase, PEPCK, SREBP1c, and SREBP2 in the STZ group were lower than those in the CON group (the statistical analysis results were p>0.001, p>0.001, p>0.001, and p>0.001 in order). Administration of SA2 or SA3 to treat diabetic mice can reduce the mRNA expression of G6Pase and PEPCK. Compared with the STZ group, treatment with SA1, SA2, SA3, Glib or Feno can reduce the mRNA expression of SREBP1c and SREBP2 (Figure 5A, 5B).

[Expression of target genes in different tissues of STZ-induced diabetic mice]

As shown in Figure 6B, the expression levels of GLUT4 protein on the cell membrane of skeletal muscle in the STZ group were lower than those in the CON group (the statistical analysis result was p>0.001). Compared with the expression of GLUT4 protein on the cell membrane of the STZ group, the STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group, and STZ+Feno group administered with drugs significantly enhanced the expression of GLUT4 membrane protein ( The results of statistical analysis were p> 0.001, p> 0.001, p> 0.001, p> 0.001, p> 0.001 and p> 0.001 in order. The protein expression levels of p-AMPK/t-AMPK and p-Akt/t-Akt in skeletal muscle of STZ group were lower than those of CON group (statistical analysis results in order: P>0.001 and P>0.001); compared with STZ group Compared with the STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group or STZ+Feno group given drug treatment, the protein expression of p-AMPK/t-AMPK was significantly enhanced, and STZ+ The SA1 group, STZ+SA2 group or STZ+SA3 group significantly enhanced the protein expression of p-Akt/t-Akt (Figure 6A, 6B).

As shown in Figure 7, the expression level of p-Akt/t-Akt protein in the liver tissue of the STZ group was lower than that of the CON group (the statistical analysis result was p>0.001). Compared with the STZ group, the STZ+SA1 group, STZ+SA2 group or STZ+SA3 group given drug treatment significantly enhanced the expression of p-Akt / t-Akt protein (the order of statistical analysis was: p>0.05, p >0.001 and p >0.001) (Figure 7A, 7B). The liver expression of phospho-forkhead transcription factor FoxO1 (phospho-forkhead transcription factor FoxO1, phospho-FoxO1)/total-FoxO1 (p-FoxO1 / t-FoxO1) was lower in the STZ group than in the CON group (statistical analysis result is p >0.001). Compared with the STZ group, the STZ+SA1 group, STZ+SA2 group or STZ+SA3 group given drug treatment increased the liver expression of p-FoxO1/t-FoxO1 (Figure 7A, 7B). The liver manifestations of p-AMPK / t-AMPK and PPARα in the STZ group were significantly lower than those in the CON group; compared with the STZ group, the STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb were given medical treatment Group or STZ+Feno group improved the liver expression of p-AMPK/t-AMPK and PPARα (Figure 7C, 7D). The liver manifestations of FAS and PPARγ in the STZ group were lower than those in the CON group; compared with the STZ group, the STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group, or STZ+Feno group that were given drug treatment decreased Compared with the STZ group, the STZ+SA2 group, STZ+SA3 group, STZ+Gilb group or STZ+Feno group reduced the liver expression of PPARγ (Figure 7C, 7D).

In summary, the purpose of the present invention is to study the anti-diabetic and hypolipidemic activity of the triterpenoid compound "Sulphoporosic acid (SA)" extracted from Antrodia cinnamomea and its possible molecular mechanism in STZ-induced diabetic mice. In the in vitro experiments of the present invention, the dosage of sulfoporosic acid and the significantly increased Akt phosphorylation showed a dose-dependent manner. The expression level of p-Akt was higher than that of sulfoporosic acid for 30-60 minutes. The maximum amount measured in C2C12 myotubes (C2C12 myotubes) indicates that SA exhibits enhanced Akt pathway phosphorylation and has an effect similar to insulin (Figure 2). However, the anti-diabetic effects of sulphoporosic acid are still poorly understood. In order to determine whether sulphoporosic acid has a hypoglycemic effect, the present invention uses STZ-induced diabetic mice as an animal model to evaluate the anti-diabetic activity of sulphoporosic acid, and compares sulphoporosic acid with the clinical drug Gliben Urea (glibenclamide, Glib for short) was compared. Although Glib is generally not used for the treatment of insulin-dependent diabetes (IDDM) patients, Glib may stimulate the release of insulin in mice with multiple low-dose (MLD) injections of STZ-induced diabetes, although certain β-cell regions still exist , The islets of each pancreas are reduced by 70%. The animal model of STZ-induced diabetes has been used in the animal model of type 1 diabetes. Therefore, the STZ mouse model was chosen to solve the anti-diabetic activity and elucidate the possible mechanism of SA. Overall, the data provided by the present invention proves that SA shows anti-diabetic activity in type 1 diabetic mice.

Multiple low-dose (MLD)-STZ injections are usually used to simulate the destruction of pancreatic β-cells and hyperglycemia, and can be used as a model for insulin-dependent diabetes (IDDM). The animal experiment results of the present invention show that MLD-STZ injection may cause obvious hyperglycemia in C57BL6J mice, which means that STZ induction will cause the loss of β-cell quality and insufficient insulin secretion, thereby leading to hyperglycemia. STZ induces an increase in the concentration of HbA1C (glycated hemoglobin); the concentration of HbA1C is a blood glucose-related marker during the past 2 to 3 months, which is used to imply oxidation and damage in the tissue, show the existence of oxidative damage, and continue and enhance oxidation The cycle of stress and injury. STZ-induced diabetes is characterized by severe weight loss. The weight loss is due to the loss and degradation of structural proteins and changes in carbohydrate metabolism. The animal experiment results of the present invention show that STZ induction leads to a decrease in body weight and blood insulin concentration. In addition to hyperglycemia and hypoinsulinemia, the animal experiments of the present invention also showed weight loss and increased blood HbA1C concentration, further confirming that the present invention successfully established an STZ-induced diabetes animal model.

Then, administration of SA3 (sulfoporocic acid, 40 mg/kg body weight) to STZ-induced diabetic mice for 3 consecutive weeks can significantly reduce the value of glycated hemoglobin (HbA1C) in the blood (Figure 3F), indicating that SA3 can prevent diabetes under diabetic conditions Oxidative damage caused by saccharification. One of the problems of the biochemical test is the small size of the blood sample, especially the HbA1C value detection is easily affected; the animal experiment results of the present invention show that compared with the CON group mouse HbA1C value increased by 4.0%, the STZ group The value of HbA1C in mice was significantly increased to 6.0%. At the end of the animal experiment of the present invention, the experimental mice were about 11 weeks old. Different induced animal models, different STZ doses (the dose used in the previous study is 90 mg/kg, and the dose used in the present invention is 55 mg/kg per day for five days), and different mouse strains (the previous study DdY mice are used) are the reasons for the difference between the experiment of the present invention and the previous study. Although the administration of SA1, SA2, and SA3 for treatment significantly reduced blood glucose values, there was no significant statistical difference in the performance of HbA1C values between the STZ+SA1 group and STZ+SA2 group, and it was compared with the STZ group (6.0 %) Compared with mice, only the STZ+SA3 group (5.1%) had lower HbA1C values. The explanation for this result is that different mouse strains, STZ doses and mouse ages, as well as the 3-week sulfoporosic acid (SA) treatment time, are not enough to recover the damaged hemoglobin and it is difficult to show the decline in HbA1C values. Variety. The experiment of the present invention shows that sulphur-colored porous bacteric acid (SA) can reduce the blood sugar value of STZ-induced diabetic mice and increase the blood insulin value (as shown in Fig. 3E, 3I). Furthermore, compared with the STZ group (fed with vehicle) mice, the mice treated with sulfoporosic acid (SA) (STZ+SA1 group, STZ+SA2 group, and STZ+SA3 group) caused pancreas The size of the Langis islets increases (as shown in Figures 4B and 4C). Morphological and immunohistochemistry (IHC) showed that after STZ-induced diabetes was treated with sulfoporosic acid (SA), the pancreas showed an increase in the average area and number of islets Increased (Figure 4B, 4C) and significantly increased insulin secretion β cells (Figure 4D). The above phenomena indicate that sulfoporosic acid (SA) can improve insulin secretion. In summary, the experiments of the present invention show that in in vitro studies, SA may stimulate the Akt signal pathway in a way similar to that of insulin (Figure 2); in animal model experiments, Polyporus sulphur after STZ destruction Acid (SA) plays a hypoglycemic effect, which is achieved by regenerating and/or antioxidant capacity from the remaining β cells after STZ destruction, and improving the value of HbA1C, as it does in the pancreas, achieving an insulin secretion effect.

Because acute STZ injection will produce reactive oxygen species and reduce the antioxidant enzymes in the pancreas (including superoxide dismutase, catalase and glutathione peroxidase), etc. Activity), which causes severe deterioration in the pancreas. Therefore, the animal model experiment of the present invention forms oxidative damage to cells in this way. A previous study showed that compared with normal islets, the shape of diabetic islets exhibits retraction from its classic circular shape. Antioxidants are currently known to protect the pancreas from the oxidative stress of diabetes. Through histological examination, the pancreatic islet cells of diabetic mice induced by STZ shrank, indicating the formation of degenerative and vacuolative changes. Mice treated with sulfoporosic acid (SA) were administered after STZ induced diabetes. , Then there is an increase in the size and number of islet Langerhans cells, accompanied by less structural distortion of the pancreas (Figure 4B), indicating that the β-cells in the pancreas have antioxidant effects to combat STZ-induced oxidative stress. By reducing the content of reactive oxygen species in β cells damaged by STZ, the oxidation of sulphoporosic acid (SA) can be improved.

Phosphorylation of insulin and AMPK are the two main mechanisms that explain the decrease in mRNA expression and gene expression of PEPCK and G6 Pase. The forkhead transcription factor forkhead box O1 (FoxO1) plays a crucial role in the regulation of liver gluconeogenesis by insulin. When the blood glucose concentration is high, the pancreas releases insulin into the blood. Insulin causes PI3K activation, which then phosphorylates Akt; Akt then phosphorylates FoxO1. Phosphorylation of FoxO1 is irreversible; this prolongs the inhibitory effect of insulin on glucose metabolism and hepatic glucose production. The transcription of G6Pase is subsequently reduced, thus reducing the rate of gluconeogenesis and glycogenolysis. Insulin can inhibit this pathway (gluconeogenesis and glycolysis) by reducing the transcription of G6 Pase. Insulin inhibits gluconeogenesis via Akt-dependent phosphorylation of the forkhead transcription factor FoxO1, which in turn inhibits gene transcription of PEPCK and G6 Pase. The experiment of the present invention shows that sulphur-colored polyporic acid (SA) increases the blood insulin concentration and the liver expression of p-Akt and p-FoxO1, which may lead to the decrease of the mRNA expression of G6Pase and PEPCK, thereby inhibiting the production of hepatic glucose Accompanied by hypoglycemic effect. The effective anti-diabetic effect of sulphoporosic acid (SA) may be due to the increase in blood insulin, which is partly through the insulin-Akt-FoxO1 interaction, thereby reducing the mRNA expression of G6 Pase and PEPCK, which has an impact on liver glucose production. Has an inhibitory effect, thereby helping to lower blood sugar.

Skeletal muscle is considered to be the main part of systemic insulin regulating glucose uptake. Therefore, the purpose of the present invention is to evaluate the expression of GLUT4 on the cell membrane in the skeletal muscle of STZ-induced diabetic mice treated with sulfoporosic acid (SA), as well as the measurement results of the protein expression of many target genes in different tissues. The experimental results of the present invention show that, compared with the CON group, STZ induces a decrease in the expression level of GLUT4 on the cell membrane in the skeletal muscle of diabetic mice. Compared with the STZ group, the expression of GLUT4 on the cell membrane in the skeletal muscle of the mice (STZ+SA1 group, STZ+SA2 group, STZ+SA3 group) treated with sulfoporosic acid (SA) increased. In addition, after treatment with SA, the blood insulin concentration increased, and the expression levels of p-Akt/t-Akt and p-AMPK/t-AMPK in skeletal muscle were also significantly increased, indicating that SA stimulated by increasing membrane glucose transport activity Insulin-Akt and/or AMPK activation pathways further help reduce blood glucose concentration. The net effect of sulphoporosic acid (SA) showed an anti-diabetic effect in a mouse model of type 1 diabetes. The experimental data of the present invention shows that SA can alleviate the symptoms of type 1 diabetes, or can be used in combination with insulin, and it is not a separate treatment method.

In general, the STZ+Gilb group mice treated with glibenclamide and the STZ+SA1 group, STZ+SA2 group and STZ+SA3 group treated with thioporic acid (SA) induced MLD-STZ There are differences in the effect of diabetic mice in regulating blood sugar. After long-term drug treatment, the blood insulin concentration decreased. Although the glucose uptake on the cell membrane was increased, glibenclamide (Gilb) had no significant effect on the blood glucose and HbA1C values of STZ-induced diabetic mice or the size of residual pancreatic islet cells. effect. The explanation for this result is not clear, but it may be related to the reduced residual islet cells, which will hinder the secretion of insulin, which in turn causes the insulin secretion concentration to be too low to inhibit the production of hepatic glucose. The experimental results of the present invention show that the treatment of glibenclamide (Gilb) has no effective effect on the blood sugar control of STZ-induced diabetic mice, and the treatment of type 1 diabetes with glibenclamide (Gilb) for 3 weeks does not Effective response.

In addition to the hypoglycemic effect of sulfoporosic acid (SA), another purpose of the present invention is to clarify the blood lipid-lowering effect of sulphoporosic acid (SA) and the underlying molecular mechanism of its formation. Both Hypertriglyceridemia and Hypercholesterolemia are symptoms that appear in STZ-induced diabetic mice. The animal model experiment of the present invention shows that STZ induces diabetes to increase the concentration of triglycerides and total cholesterol in the blood. This result is similar to the results of previous studies by other scholars; compared with the STZ group of mice, these test items (triglycerides) Ester and total cholesterol concentration) in diabetic mice treated with sulfoporosic acid (SA) will cause a decrease in blood values (Figure 8).

PPARα affinity agent can reduce the concentration of triglycerides in the blood. Fenofibrate (Feno) is one of the known PPARα affinity agents, used to reduce the concentration of triglycerides through a mechanism related to fatty acid oxidation. PPARα affinity agents are known to be used to down-regulate many genes involved in lipid synthesis. Therefore, PPARα or target gene expression including fatty acid synthase (FAS) needs to be measured. The experiment of the present invention shows that STZ-induced diabetes can reduce the expression of PPARα, but increase the expression of FAS. Fatty acid synthase is a key enzyme in fatty acid synthesis. The experiment of the present invention shows that administering the drugs thiochromoporosic acid (SA), glibenclamide (Glib) or fenofibrate (Feno) to STZ-induced diabetic mice can reduce the triglyceride concentration in the blood. The induction of liver PPARα receptors leads to increased liver fatty acid oxidation, which may be evidence of the observed results. In this observation, sulfoporosic acid (SA), glibenclamide (Glib) or fenofibrate (Feno ) Reduce the blood triglyceride concentration by increasing liver β-oxidation activity and reducing hepatic triglyceride synthesis. In addition, PPARα-deficient mice exhibit dysregulated SREBP-regulated adipogenic genes. The role of SREBP1c as an adipogenic transcription factor may be to stimulate the expression of adipogenic enzymes and contribute to fatty acid synthesis and triglyceride accumulation. In the experiment of the present invention, the treatment of sulfoporosic acid (SA) or fenofibrate (Feno) reduced the mRNA expression of the adipogenic transcription factor SREBP1c, thereby reducing the output of hepatic triglycerides, which obviously resulted in The anti-high triglyceride effect of SA or Feno. The above all help to improve the accumulation of triglycerides in the liver in lipid droplets (for histological examination), and use sulfoporosic acid (SA) or fenofibrate ( The lipid droplets of Feno treated mice disappeared, which in turn reduced the triglyceride concentration in the blood.

It is currently known that SREBP2 may play an important role in the regulation of cholesterol synthesis. It can be seen from the experiment of the present invention that the total cholesterol concentration in the blood of the STZ-induced diabetic mice after being treated with sulfoporosic acid (SA) decreases, which means that STZ treated with sulphoporosic acid (SA) induces diabetes. Cholesterol synthesis in mice is inhibited. This is due to the reduction of SREBP2 mRNA in the liver and the restoration of the normal mechanism of total cholesterol synthesis. The final effect is to restore the total cholesterol concentration in the blood.

According to the above, STZ-induced diabetic mice treated with sulfoporosic acid (SA) can reduce the expression of FAS and SPARBP2 mRNA but increase the expression of PPARα in the liver, thereby including total triglycerides, Hyperlipidemia, an indicator of total cholesterol concentration, tends to normalize.

PPARγ plays a key role in the process of adipogenesis and lipogenesis. After the administration of sulfoporosic acid (SA), glibenclamide (Glib) or fenofibrate (Feno) treatment, the expression of PPARγ is reduced, which may lead to inhibition of adipogenesis and reduction of lipid accumulation in liver tissue . Previous literature has shown that the administration of globular domains of adiponectin may enhance glucose uptake and fatty acid oxidation, which is negatively correlated with the source of plasma lipid production. According to previous literature, leptin plays a key role in regulating fat cell differentiation and fat tissue metabolism. In the experiment of the present invention, the administration of SA2, SA3, Glib or Feno to STZ-induced diabetic mice not only increased the concentration of adiponectin and leptin in the blood (only SA3 had statistical significance), but also reduced the concentration of FFA. Among them, the fluctuation of blood lipids in mice is worthy of attention; therefore, sulfoporosic acid (SA) has a beneficial effect on blood lipids, which is partly attributed to the inhibition of liver lipid synthesis and enhancement of fat oxidation, as well as adiponectin The regulation of Leptin and/or the secretion of leptin, and sulfoporosic acid (SA) is acting in a dose-dependent manner.

Liver tissue plays a key role in the metabolism of lipids and lipoproteins, and the lipids accumulated in adipose tissue are mainly derived from blood triglycerides, which means that sulfoporosic acid (SA) can reduce fat formation in the liver And improve the lipid catabolism in the liver, including increasing the expression of PPARα but reducing FAS, and reducing the expression of SREBP1c mRNA. Therefore, the reduction of liver lipid droplets (Figure 4A) leads to a decrease in plasma triglyceride concentration.

After administering sulphoporosic acid (SA) to STZ-induced diabetic mice for 3 weeks, the experimental results of the present invention showed that there were no adverse reactions. A previous study disclosed the toxicity evaluation of 90-day oral Antrodia camphorata immersed cultures in male and female Sprague-Dawley rats; at the end of the study, the control group rats and the experimental group There were no significant differences in the performance of urinalysis, hematology and serum biochemical parameters between the rats; the autopsy and histological examination of the rats showed no treatment-related changes. According to the above results, in the animal experiments of Shi-Daw’s rats, the highest dose of the Antrodia cinnamomea immersed culture (no observed adverse effect level, referred to as NOAEL, is a substance that is harmless to humans or animals. The highest dose) was determined to be greater than 3000 mg/kg BW/day. In this study, it is impossible to estimate the median lethal dose (LD50) or median toxic dose (median toxic dose) of sulphur-colored polyporic acid (SA). , TD50, refers to the dose at which 50% of laboratory animals are poisoned by drugs or toxins), so it needs to be further clarified in the future.

In summary, the purpose of the present invention is to evaluate the protective effect of the purified sulphoporosic acid (SA) extracted from Antrodia cinnamomea on diabetes and hyperlipidemia in animal model studies, and to clarify its potential molecular mechanism. In animal models, diabetes is induced by intraperitoneal injection of 55 mg/kg streptozotocin (STZ) solution to mice every day for five consecutive days. The successfully induced diabetic mice were randomly divided into six groups, and were orally administered sulfoporosic acid (SA) (three doses), glibenclamide (glibenclamide, Glib), fenofibrate (Fenofibrate, Feno) or Fu Vehicle for 3 weeks. In the experiment of the present invention, the fasting blood glucose (fasting blood glucose), HbA1C (glycated hemoglobin), plasma triglyceride (TG) and total cholesterol (TC) of diabetic mice induced by STZ The concentration of blood insulin increased significantly (statistical analysis results were expressed as p> 0.001, p> 0.001, p> 0.001 and p> 0.05), but compared with the control group (CON group), blood insulin (blood insulin), Adiponectin (adiponectin) and leptin (leptin) concentration decreased (statistical analysis results were expressed as p> 0.001, p> 0.001 and p> 0.001). The administration of sulfoporosic acid (SA) to STZ-induced diabetic mice may reduce blood sugar, but as the size of the islets of Langerhans cells in the pancreas recovers, the insulin concentration increases, which means that Polyporus sulphate Acid (SA) can resist STZ-induced diabetes in the pancreas. In terms of molecular concentration, sulfoporosic acid (SA) treatment can increase the expression of GLUT4 (glucose transporter 4) and phosphorylated Akt (phospho-Akt) on the cell membrane in the skeletal muscle, thereby increasing the expression on the cell membrane. The uptake of glucose (membrane glucose), but will reduce PEPCK (Phosphoenolpyruvate carboxykinase) and G6-Pase (glucose-6-phosphatase, glucose-6-phosphatase) mRNA expression to inhibit liver The production of hepatic glucose leads to its hypoglycemic effect. In addition, sulphur-colored porous bacteric acid (SA) can not only increase fatty acid oxidation by enhancing the expression of PPARα (peroxisome proliferator activated receptor α) in the liver, but also It can reduce the mRNA expression of lipogenic FAS (fatty acid synthase) and SREBP-1 C (sterol regulatory element binding protein 1C) and SREBP2 in the blood. The concentration of plasma triglycerides (TG) and total cholesterol (TC). In the experiment of the present invention, sulphoporosic acid (SA) showed protective effects against type 1 diabetes and anti-hyperlipidemia in STZ-induced diabetic mice.

without

Figure 1 shows the chemical structure of the purified sulphoporosic acid (SA) and its derivatives extracted from Antrodia cinnamomea. Figure 2 shows the experiment in the cell line of the present invention. The Akt signaling pathway was activated by sulphur-colored polyporic acid (SA), and the phosphorylated Akt (p-Akt, phospho-Akt) of the cell lysate was analyzed by Western blot analysis. ) And total-Akt (t-Akt). Shown in sequence according to the figure number is (A) Western blotting analysis figure, which is to measure Akt phosphorylation from C2C12 cells and administer 40μg/mL thiochromoporic acid within the specified time (5-60 minutes). Treatment; (B) Quantitative bar graph showing the activation of Akt by sulfoporosic acid and insulin in a time-dependent manner. Figures 3A to 3L show the experimental analysis of the animal model of the present invention in the CON group, STZ group, STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group, and STZ+Feno group. (SA) Influencing factors on STZ-induced diabetic mice. According to the figure number, it is (A) final weight, (B) food intake during 3 weeks of treatment, (C) relative fat tissue weight, (D) relative tissue weight, (E) blood glucose concentration, (F) glycosylated hemoglobin ( HbA1C) concentration, (G) triglyceride concentration, (H) total cholesterol concentration, (I) insulin concentration, (J) adiponectin concentration, (K) leptin concentration and (L) free fatty acid concentration. Among them, the dose of sulphur-colored polyporic acid (SA) includes: SA1 is 10 mg/kg body weight (10 mg per kg body weight), SA2 is 20 mg/kg body weight, and SA3 is 40 mg/kg body weight; The dose of this urea (Gilb) is 10 mg/kg body weight; the dose of fenofibrate (Feno) is 250 mg/kg body weight. EWAT, epididymal white adipose tissue; MWAT, mesenteric white adipose tissue; RWAT, retroperitoneal white adipose tissue; visceral fat is defined as EWAT + RWAT. RWAT, retroperitoneal white adipose tissue; MWAT, mesenteric white adipose tissue. 4A to 4D show the histological examination results of the CON group, STZ group, STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group, and STZ+Feno group in the animal model experiment of the present invention. Shown in sequence by figure number: (A) Pathological section of liver tissue, (B) Pathological section of pancreatic Lan's islet, (C) Quantitative bar graph of average area of pancreas Lan's islet, (D) Immunohistochemical staining method (Immunohistochemistry; IHC) staining image, which is a staining image of insulin (brown) and glucagon (green) in mouse pancreatic islets stained with hematoxylin and eosin and magnified 400 times. Figures 5A to 5B show the effects of the liver tissues of mice in the CON group, STZ group, STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group, and STZ+Feno group in the animal model experiment of the present invention The mRNA expression level of the target gene was measured by semiquantative reverse transcription-polymerase chain reaction (RT-PCR) analysis. Shown in sequence according to the figure number: (A) the target gene mRNA image. (B) Quantitative ratio of mRNA expression of target gene and β-actin. Figures 6A to 6B show that in the animal model experiment of the present invention, the CON group, STZ group, STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group, and STZ+Feno group, through oral administration of sulfur color porous The protein expression levels ^{of GLUT4, p-AMPK (Thr 172} )/t-AMPK and p-Akt (Ser ⁴⁷³ )/t-Akt (Ser ⁴⁷³ ) on the cell membrane of the skeletal muscle of mice with bacteric acid (SA)-induced diabetes. Shown in order by figure number: (A) Western dot ink analysis figure. (B) Quantitative graphs of p-AMPK/t-AMPK and p-Akt (Ser ⁴⁷³ )/t-Akt (Ser ⁴⁷³ ); the protein passes through 12% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel) Electrophoresis) separation, and Western blotting (Western blotting) determination. Figures 7A to 7D show that in the animal model experiment of the present invention, the CON group, STZ group, STZ+SA1 group, STZ+SA2 group, STZ+SA3 group, STZ+Gilb group and STZ+Feno group are shown in order according to the figure number (A) the expression level of p-Akt (Ser ⁴⁷³ )/t-Akt (Ser ⁴⁷³ ) and p-FoxO1 (Ser ²⁵⁶ )/t-FoxO1 (Ser ²⁵⁶ ); (B) oral administration of thiochromoporic acid (SA) The expression levels of p-AMPK (Thr ¹⁷² )/t-AMPK, PPARα, FAS and PPARγ in the liver tissues of diabetic mice. Among them, Fig. 7A and Fig. 7C are Western blot analysis diagrams; Fig. 7B and Fig. 7D are quantitative diagrams of p-AMPK/t-AMPK, PPARα, FAS and PPARγ.

Claims (11)

An Antrodia cinnamomea purified product is used to prepare a medicinal compound for the treatment of type 1 diabetes. The purified product is a purified substance extracted from the mycelium of Antrodia cinnamomea. The use as described in claim 1, which is used to prepare medicinal compounds for the treatment of hyperlipidemia associated with type 1 diabetes. The use as described in claim 1, which is used to prepare medicinal compounds for lowering blood sugar and glycosylated hemoglobin (HbA1C) and increasing insulin concentration. The use as described in claim 1, which can improve insulin secretion by increasing the size of pancreatic islets and increasing the number of β cells for insulin secretion. The use as described in item 1 of the scope of patent application is to increase the expression of phosphorylated Akt of C2C12 muscle fibers, the expression of p-AMPK protein and the expression of GLUT4 on the cell membrane, and increase the expression of GLUT4 on the cell membrane of skeletal muscle in vivo Protein and increase the expression of skeletal muscle p-AMPK protein, and enhance the liver expression of p-Akt and p-FoxO1, but reduce the mRNA of PEPCK and G6Pase to reduce the blood glucose concentration. The use according to claim 2, which is used to prepare medicinal compounds for reducing blood triglycerides and total cholesterol in type 1 diabetes. As described in item 6 of the scope of the patent application, it is to reduce the expression of FAS and PPAR γ in the liver with sulphoporosic acid and reduce the mRNA of SREBP1C, and increase the expression of PPAR α to induce the increase of liver fatty acid oxidation. Then increase the liver β-oxidation activity and reduce the synthesis of hepatic triglycerides, so as to reduce the concentration of triglycerides in the blood. As described in item 6 of the scope of patent application, it is to reduce the mRNA of SREBP2 with sulphur-colored polyporic acid to reduce the total cholesterol value in the blood. The use according to claim 1, which is used to prepare a pharmaceutical compound for treating fatty liver associated with type 1 diabetes and reducing vacuolation of the liver. As described in item 9 of the scope of patent application, it is through sulfoporosic acid to down-regulate the expression of lipid production genes of PPAR γ and FAS, reduce the differentiation of adipocytes, reduce the accumulation of fat in adipocytes, and alleviate fatty liver. Sulfoporic acid up-regulates the expression of liver fatty acid metabolism PPAR α to reduce the expression of PPAR γ gene, thereby reducing liver lipids and lowering the content of triglycerides in the blood. The use as described in claim 1, which is used to prepare a medicinal compound that increases leptin in the blood of type 1 diabetes.

Images