WO2019076477A1 - Induction de tregs spécifiques d'allergènes avant une immunothérapie orale ou sublinguale d'allergie alimentaire - Google Patents

Induction de tregs spécifiques d'allergènes avant une immunothérapie orale ou sublinguale d'allergie alimentaire Download PDF

Info

Publication number
WO2019076477A1
WO2019076477A1 PCT/EP2018/000478 EP2018000478W WO2019076477A1 WO 2019076477 A1 WO2019076477 A1 WO 2019076477A1 EP 2018000478 W EP2018000478 W EP 2018000478W WO 2019076477 A1 WO2019076477 A1 WO 2019076477A1
Authority
WO
WIPO (PCT)
Prior art keywords
hydrogel
liposomes
odn
plga
tolerance
Prior art date
Application number
PCT/EP2018/000478
Other languages
English (en)
Inventor
Reinhard Bredehorst
Thomas Grunwald
Catherine LEONARD
Markus Ollert
Original Assignee
Luxembourg Institute Of Health (Lih)
Tolerogenics S.A.R.L
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Luxembourg Institute Of Health (Lih), Tolerogenics S.A.R.L filed Critical Luxembourg Institute Of Health (Lih)
Priority to EP18803539.8A priority Critical patent/EP3787670A1/fr
Publication of WO2019076477A1 publication Critical patent/WO2019076477A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/35—Allergens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/577—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 tolerising response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6025—Nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6093—Synthetic polymers, e.g. polyethyleneglycol [PEG], Polymers or copolymers of (D) glutamate and (D) lysine

Definitions

  • the present invention relates to methods for the induction of food tolerance by a combination of subcutaneous hydrogel-based immunotherapy with food allergen-derived T cell peptides in the presence of tolerance-promoting concentrations of oligodeoxynucleotides with CpG or GpC or GpG motifs (Phase A) and subsequent oral or sublingual immunotherapy with natural or recombinant food allergens (Phase B) .
  • Food allergy is a potentially life-threatening condition with no approved therapies apart from avoidance and injectable epinephrine for treatment of acute allergic reactions (for a review, see Wood, 2017) .
  • food allergy is estimated to affect up to 8% of children and up to 2-3% of adults in the U.S. alone.
  • the foods most often associated with food allergy in the U.S. include cow's milk, hen's egg, peanut, tree nut, wheat, soy, fish, and shellfish. Most important is the growing incidence of peanut allergy which affects 1-2% of children in the U.S. and is implicated in over half of all fatal food allergy-related deaths in the U.S.
  • OIT Oral immunotherapy
  • OIT protocols include an initial escalation phase, followed by dose build-up phase and maintenance phases with considerable variability depending on the study.
  • the initial escalation phase is typically conducted over one to two days, using rapid up-dosing starting from a very small dose which is extremely unlikely to cause any adverse reaction, and progressing to a dose that is still likely safe for home administration.
  • the initial doses are in microgram quantities of allergenic protein and increases to several milligrams by the end of this phase.
  • the dose is escalated incrementally (usually bi-weekly over a period of approx. 6 months) until a target maintenance dose is reached or the subject reaches dose-limiting symptoms.
  • Maintenance therapy continues with daily administration in the home, and the length of maintenance therapy varies considerably, lasting from a few months to several years.
  • the present invention solves this problem by a novel combination of subcutaneous hydrogel-based immunotherapy with food allergen-derived peptides prior to OIT or sublingual immunotherapy with intact food allergens.
  • the present invention discloses a novel combination of subcutaneous hydrogel-based immunotherapy with food allergen-derived T cell peptides (Phase A) prior to oral (OIT) or sublingual (SLIT) immunotherapy with intact food allergens (Phase B) .
  • Subcutaneous immunotherapy with allergen- derived peptides is performed first to decrease disease- promoting effector T cells and to increase tolerance-promoting regulatory T cells (Tregs) , thereby re-directing the T cell status towards tolerance (Phase A) .
  • OIT or sublingual immunotherapy with intact food allergens is performed thereafter to induce the generation of protective allergen- specific antibodies and to further enhance the development of a tolerogenic T and B cell status (Phase B) .
  • Phase A modifies the allergic immune status towards tolerance without anaphylactic risks for food allergic patients since peptides are unable to cross- link IgE, b) Phase A minimizes adverse side effects of subsequent OIT or sublingual immunotherapy, and c) Phase A enhances the therapeutic efficacy of subsequent OIT or sublingual immunotherapy significantly.
  • the present invention discloses the novel application of tolerance-promoting amounts of synthetic oligodeoxynucleotides (ODN) with CpG or GpC or GpG motifs as adjuvant in hydrogel compositions for enhancement of the therapeutic efficacy of peptide immunotherapy in Phase A.
  • ODN synthetic oligodeoxynucleotides
  • the present invention discloses the application of tolerance-promoting anionic PLGA spheres as an alternative adjuvant in hydrogel compositions for Phase A.
  • the present invention discloses the application of find-me molecules in hydrogel compositions for Phase A for attracting peripheral antigen-presenting cells
  • APCs including dendritic cells (DCs) and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells
  • the present invention discloses the application of phosphatidyl-L-serine (PS) -presenting liposomes (PS-liposomes) in hydrogel compositions for Phase A in order to enhance phagocytosis and subsequent presentation of short food allergen-derived T cell peptides by antigen-presenting cells (APCs) .
  • PS- liposomes allow direct targeting of dendritic cells and macrophages due to the surface-exposed eat-me signal phosphatidyl-L-serine .
  • PS-liposomes mediate tolerance-promoting effects since they mimic the tolerance- promoting effects of apoptotic cells.
  • the present invention discloses allergen-derived T cell peptides which are suitable for Phase A immunotherapy.
  • T cell peptides which are derived from allergens in cow' s milk, hen ' s egg , peanut , tree nuts, wheat, soy, fish, and shellfish.
  • thermosensitive hydrogels which are suitable for subcutaneous administration and sustained local delivery of hydrogel- embedded components for peptide immunotherapy in Phase A.
  • Preferred thermosensitive hydrogels are injectable in situ- forming gel systems which a) undergo a sol-gel-sol transition, preferably forming a free flowing sol at room temperature and a non- flowing gel at body temperature, b) can serve as depot for sufficient quantities of above listed components, c) allow the release of sufficient quantities of the embedded components over a prolonged period of at least 2 to 3 days, d) are chemically and physically compatible with all embedded components, and e) are biodegradable.
  • Preferred biodegradable polymers approved by the FDA and used in clinical trials include but are not limited to poly (D, L-lactic acid), poly (lactic-co-glycolic acid) (PLGA) , and copolymers of L- lactide and D,L-lactide such as PLGA-PEG-PLGA copolymers.
  • the present invention discloses therapeutically effective doses of active substances and adjuvants in hydrogel compositions for peptide immunotherapy in Phase A including CpG-ODN, plain PLGA spheres, the immune modulators vitamin D3 derivative calcipotriol and glucocorticoids including dexamethasone phosphate, allergen- derived T cell peptides, and peptide-loaded PS-liposomes .
  • the present invention discloses pharmaceutical formulations of hydrogel compositions for peptide immunotherapy in Phase A.
  • the present invention discloses several methods for the first subcutaneous hydrogel-based immunotherapeutic step with food allergen-derived T cell epitope-containing peptides (T cell peptides) in Phase A including a) PS- liposomal approaches using tolerance-promoting ODN, b) PS-liposomal approaches using PLGA spheres as alternative tolerance-promoting adjuvant, c) PS-liposomal approaches using tolerance-promoting immune modulators, d) PS- liposomal approaches using a combination of tolerance- promoting immune modulators and adjuvants, e) PS-liposomal approaches without CpG-ODN or other adjuvants, and f) non- liposomal approaches.
  • the present invention discloses useful biomarkers for the induction of T cell-mediated tolerance by peptide immunotherapy in Phase A. Based on these biomarkers, reasonable induction of T cell-mediated tolerance by peptide immunotherapy in Phase A is considered to be achieved if at least 50% of CD4+ T cells express IL-10, c-Maf or LAG-3 , and the percentage of PD-1 + cells and TIGIT+ cells in the CD4+ T cell population has increased significantly.
  • the present invention discloses therapeutic protocols for a combined Phase A and Phase B immunotherapy of food allergy including an escalating dose protocol in Phase A or an identical dose protocol in Phase A, and subsequent OIT or SLIT protocols in Phase B including an escalating up-dosing phase and a subsequent maintenance phase.
  • FIG. 1 Experimental design for the evaluation of the tolerance-inducing efficacy of hydrogel compositions containing CpG-ODN for Fel d 1-specific immunotherapy using a murine acute airway allergy model.
  • Sensitization is performed by 3 successive intraperitoneal (IP) injections of 10 ⁇ g Fel d 1 (natural LoTox Fel d 1) with 500 ⁇ g Al(OH) 3 in 200 ⁇ PBS, at days 0, 14 and 28.
  • a control group receives 3 successive IP injections of 500 g Al(OH)3 in 200 ⁇ PBS.
  • Specific immunotherapy is performed by 3 successive subcutaneous (SC) injections (at days 42, 56 and 70) . Three groups of mice are compared.
  • SC subcutaneous
  • Group I Treatment with 200 ⁇ hydrogel composition of Example 16 comprising a) 15% w/v PLGA-PEG- PLGA, b) 20 ⁇ class B CpG-ODN 1826 (approx. 3.1 nmol), c) 10 ]ig Fel d 1, and d) 0.05 nmol ATP and 0.05 nmol UTP (the concentration of both nucleotides in the composition is 250 nM) (Hydrogel + Find Me) .
  • Group II Treatment with 200 ⁇ PBS via IP injections (Allergy) .
  • Group III Treatment with 200 ⁇ PBS via IP injections (Control) .
  • NI nasal instillation
  • Fel d 1 in 50 ⁇ PBS
  • Control mice receive only PBS during the nasal instillations.
  • serum immunoglobulin profiles are determined, the airway hyperreactivity of the mice is tested by flexiVent analysis upon methacholine challenges, then BALF analyses are performed.
  • FIG. 1 Analysis of immunoglobulin profiles in serum. Mice are bled at day 86 and analysed for Fel d 1-specific IgE, Fel d 1-specific IgA, and Fel d 1-specific IgGl by ELISA. Plates are coated with Fel d 1 in 100 ⁇ 0.1 M NaHC0 3 for 6 h at 37°C, followed by blocking with 200 ⁇ 3% BSA in PBS , pH 7.4, for 2 h at 37°C. After washing, 100 ⁇ of 1:40 serum dilutions with PBS, pH 7.4, containing 1% BSA are incubated overnight at 4°C.
  • the amount of bound antibody is analyzed using horseradish peroxidise-conjugated antibodies with specificity for murine heavy chain classes (IgE, IgGA, and IgGl) . Analysis is performed at 405 nm in a microplate autoreader .
  • mice of each group Three to five mice of each group are analyzed for airway resistance ( opposition to flow caused by the forces of friction, defined as the ratio of driving pressure to the rate of air flow) to inhaled methacholine.
  • a detailed description of the procedure for the assessment of airway responsiveness to inhaled methacholine in mice using the forced oscillation technique (flexiVent; SCIREQ Inc, Montreal, Qc, Canada) is provided by McGovern et al . (2013) .
  • mice of each group are analyzed for airway compliance (a measure of the ease of expansion of the lungs, determined by pulmonary volume and elasticity) to inhaled methacholine using the forced oscillation technique.
  • FIG. 1 TH2 cytokine pattern in the bronchoalveolar lavage fluid.
  • the lungs from three to five mice of each group are lavaged in situ with three 3 successive washes: first with 700 ⁇ PBS- BSA-protease inhibitor to collect cells and cytokines, then 2 times with 700 ⁇ PBS only to collect the rest of the cells.
  • the BAL is centrifuged and the cytokine supernatant is profiled using a panel of cytokines including IL-4, IL-5, IL- IL-13, IL-17, IFN-Y and TNF- .
  • Figure 6. TH1 cytokine pattern in the bronchoalveolar lavage fluid.
  • BAL samples For the collection of cells from BAL samples see figure 5. The cells are analyzed by fluorescence flow cytometry. For these analyses, BAL samples are washed in phosphate-buffered saline (PBS) containing 0.2% bovine serum albumin and 0.1% Na 3. Aliquots containing 10 4 to 10 5 cells are incubated with 100 ⁇ of appropriately diluted antibodies for 30 min at 4°C. After staining, the cells are washed twice with the above PBS solution, and relative fluorescence intensities are determined on a -decade log scale by flow cytometric analysis using a FACScan (Beeton Dickinson) .
  • PBS phosphate-buffered saline
  • Figure 12 Release of ATP from PLGA-PEG-PLGA hydrogels. For details see Example 8.
  • Figure 13 Release of liposome-complexed oligodeoxynucleotides from PLGA-PEG-PLGA hydrogels. For details see Example 9.
  • Successful desensitization includes an increase in Treg cells and food-specific IgG4 antibodies, an initial increase followed by a decrease in food-specific IgE, a decrease in the number and reactivity of both mast cells and basophils (early desensitization effect) , and a reduction in skin prick test (for a review, see Cavkaytar et al . , 2014).
  • Sublingual food allergen immunotherapy mimics some of the immune changes seen with OIT.
  • SLIT for food allergy can result in decreased titrated skin prick test and specific IgE levels, with associated allergen-specific increases in IgG4 (for a review, see Vazquez-Ortiz and Turner, 2016) .
  • both humoral and cellular responses as well as innate and adaptive immune responses seem to play a role in successful OIT and sublingual food allergen immunotherapy (Food SLIT) . Therefore, novel therapeutic approaches are needed to address the different arms of the immune system.
  • the present invention discloses a novel approach for the treatment of food allergy by combining subcutaneous hydrogel-based immunotherapy with food allergen- derived T cell epitope-containing peptides (Phase A) and OIT or sublingual immunotherapy with intact food allergens (Phase B) .
  • Subcutaneous immunotherapy with allergen-derived peptides is performed first to decrease disease-promoting effector T cells and to increase tolerance-promoting regulatory T cells (Tregs) , thereby re-directing the T cell status towards tolerance (Phase A) .
  • OIT or sublingual immunotherapy with intact food allergens is performed thereafter to induce the generation of protective allergen-specific antibodies and to further enhance the development of a tolerogenic T and B cell status (Phase B) .
  • OIT or sublingual immunotherapy with intact food allergens in Phase B is performed as described in the literature (for reviews, see Uyenphuong and Burks, 2014; Vazquez-Ortiz and Turner, 2016) .
  • the first immunotherapeutic step modifies the allergic immune status towards tolerance without anaphylactic risks for food allergic patients since peptides are unable to cross- link IgE and, therefore, are unable to activate mast cells.
  • OVA ovalbumin
  • the therapeutic efficacy of oral immunotherapy with OVA could be improved significantly by concomitant application of regulatory T cell- inducer kakachi, a traditional Japanese herbal medicine (Nagata et al., 2017).
  • the increased presence of allergen-specific Tregs during the second oral or sublingual immunotherapeutic step provides another important advantage in that adverse side effects of OIT or sublingual immunotherapy are minimized.
  • a T cell status that is already re-directed towards tolerance is likely to allow a shorter up-dosing phase which will reduce costs and provides faster relief for food allergic patients.
  • the present invention discloses novel technologies which provide both significantly improved cellular uptake of short T cell peptides by APCs and simultaneous efficient tolerogenic priming of such APCs by tolerance-promoting adjuvants.
  • the present invention discloses the novel application of tolerance-promoting amounts of synthetic oligodeoxynucleotides (ODN) with CpG or GpC or GpG motifs as adjuvant in hydrogel compositions for Phase A.
  • ODN synthetic oligodeoxynucleotides
  • the present invention discloses the application of tolerance-promoting anionic PLGA spheres as an alternative adjuvant in hydrogel compositions for Phase A.
  • the present invention discloses the application of find-me molecules in hydrogel compositions for Phase A for attracting peripheral antigen-presenting cells (APCs) including dendritic cells (DCs) and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells (APC) .
  • APCs peripheral antigen-presenting cells
  • DCs dendritic cells
  • APC antigen-presenting cells
  • PS-liposomes phosphatidyl-L-serine (PS) -presenting liposomes (PS-liposomes) in hydrogel compositions for Phase A.
  • PS-liposomes allow direct targeting of dendritic cells and macrophages due to the surface-exposed eat-me signal phosphatidyl-L-serine .
  • PS-liposomes mediate tolerance-promoting effects since they mimic the tolerance-promoting effects of apoptotic cells.
  • PS-liposomes have been shown to inhibit the maturation of dendritic cells and to enhance their secretion of antiinflammatory cytokines. 1. Enhancement of peptide-based immunotherapy in Phase A by tolerogenic amounts of synthetic ODN
  • the present invention discloses the application of tolerance-promoting amounts of synthetic oligodeoxynucleotides (ODN) with CpG or GpC or GpG motifs as adjuvant in hydrogel compositions for enhancement of the therapeutic efficacy of peptide immunotherapy in Phase A.
  • ODN synthetic oligodeoxynucleotides
  • CpG-ODN not only act as immune stimulatory agents (Hemmi et al., 2000) but can also induce strong immune suppression depending on the route of administration (Wingender et al . , 2006) and the quantity of administered CpG-ODN (Volpi et al . , 2013).
  • the suppressive effect is mediated by indoleamine 2,3- dioxygenase 1 (IDOl) (Mellor et al . , 2005; Fallarino and Puccetti, 2006) as indicated by the observation that CpG-ODN induced T cell suppression could be abrogated by 1-methyl- tryptophan (1-MT) , an inhibitor of IDO.
  • IDOl indoleamine 2,3- dioxygenase 1
  • CpG-ODN 7909 a synthetic 24mer single stranded ODN ( 5 1 -TCGTCGTTTTGTCGTTTTGTCGTT-3 ' ) containing 4 unmethylated CpG motifs (Robesdorfer et al . , 2005) with a phosphorothioate backbone resistant to degradation by DNAse (class B ODN) .
  • CLL chronic lymphocyte leukemia
  • CpG 7909 had a maximum tolerated dose of 0.45 mg/kg with dose limiting toxicity of myalgia and constitutional effects (Zent et al . , 2012).
  • Subcutaneous administration of this dose level resulted in an increase in activated T cells, associated with local inflammation at the site of injection and in draining lymph nodes as has been observed in other trials of CpG 7909 (Kim et al., 2010).
  • Both i.v. and s.c. therapy resulted in changes in natural killer ( ) cells and T cells consistent with systemic immune activation and cytokine-induced immune activation (Zent et al . , 2012) .
  • the present invention solves this problem by using a hydrogel- based technology for subcutaneous administration of CpG-ODN in combination with a technology for attraction of antigen- presenting cells to the subcutaneously injected hydrogel composition by hydrogel-embedded find-me signals.
  • the tolerance- inducing concentration of CpG-ODN can be reduced to an extent that does not exceed the maximum tolerated dose .
  • encapsulation of CpG-ODN together with food allergen-derived T cell peptides in phosphatidylserine- liposomes allows direct targeting of macrophages and dendritic cells by the tolerance-promoting eat-me signal phosphatidyl-L-serine on the surface of PS- liposomes, which further reduces the tolerance- inducing concentration of CpG-ODN significantly.
  • Fel d 1-specific IgE and Fel d 1-specific IgGl decreased significantly after 3 successive subcutaneous injections at days 42, 56 and 70 (figure 2) , indicating the successful induction of tolerance since IgE and IgGl are good markers of an allergic TH2 response in mice (Adel -Patient et al. , 2000) .
  • the effect of immunotherapy on IF - ⁇ is difficult to evaluate since significant variations in the Bal levels of this cytokines are observed in control animals, allergic animals and therapeutically treated animals (figure 6) .
  • the increased BAL level of TNF- in therapeutically treated mice (figure 6) is due to the fact that high doses of CpG-ODN elicit TNF-a- dependent toxicity in rodents.
  • Rodents express TLR9 in monocyte/macrophage lineage cells as well as in plasmacytoid DCs (pDCs) and B cells, whereas in humans B cells are the principal TLR9 -expressing cells (Campbell et al . , 2009) .
  • Suitable synthetic CpG-ODN for the present invention.
  • synthetic CpG-ODN differ from microbial DNA in that they have a partially or completely phosphorothioated backbone instead of the typical phosphodiester backbone and a poly G tail at the 3' end, 5 1 end, or both.
  • the phosphorothioated backbone modification protects the ODN from being degraded by nucleases in the body and poly G tails enhances cellular uptake due the formation of intermolecular tetrads resulting in high molecular weight aggregates.
  • Class A CpG-ODN contain a central palindromic phosphodiester CpG sequence and a phosphorothioate-modified 3' poly-G tail.
  • Class B CpG-ODN are 18-28mer linear oligodeoxynucelotides . They contain a fully nuclease-resistant phosphorothioated backbone with one or more 6mer CpG motifs. The optimal motif is GTCGTT in human and GACGTT in mouse.
  • Class C ODN combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif.
  • CpG-ODN For the method of the present invention, all three classes of CpG-ODN are suitable. Although class A ODNs are rapidly degraded in vivo with a half-life of nearly 5 to 10 min, they are also applicable for the method of the present invention if they are protected by encapsulation in PS-liposomes . Furthermore, for liposome-based approaches cellular uptake- enhancing poly G tails are not required. In addition, ODNs with one or more CpG motifs are suitable for the present invention which are fully nuclease-susceptible if they are protected by encapsulation in PS- liposomes . Promotion of tolerance by GpC-ODN.
  • GpC-ODN GpC oligodeoxynucleotides
  • DCs dendritic cells
  • TLR7 recognizes and responds to viral ssRNA through a signal transduction pathway leading to both induction of type I IF s, typically involved in virus elimination—and differentiation of DCs (Kawai and Akira, 2006) . It is well documented that TLR7 activation by ssRNA is mainly MyD88 dependent. However, TLR7 is also capable of mediating opposite functional effects, depending on the ligand nature and experimental setting, resulting either in Thl7-type responses in humans (Yu et al . , 2010) or in inhibition of Thl7 responses via induction of lL-10 (Vultaggio et al . , 2011) .
  • GpC-ODN are capable to confer highly suppressive activity on mouse and human splenic plasmacytoid dendritic cells (pDCs) via the TLR7-TRIF pathway (Volpi et al . , 2012).
  • pDCs splenic plasmacytoid dendritic cells
  • IDOl indoleamine 2,3- dioxygenase 1
  • GpC-ODN are suitable which are capable of inducing tolerance via the TLR7- TRIF pathway.
  • Preferred GpC-ODN include but are not limited to GpC-ODN 1826 (5 ' -TCCATGAGCTTCCTAAGCTT-3 ' ) and GpC-ODN 1668 ( 5 ' - CCATGAGCTTCCTGATGC -3 ' ) both of which have been shown to confer suppressive properties on human splenic plasmacytoid dendritic cells (pDCs) , contingent on functional indoleamine 2, 3-dioxygenase 1 (Volpi et al., 2012).
  • pDCs human splenic plasmacytoid dendritic cells
  • the present invention discloses synthetic GpG oligodeoxynucleotides (GpG-ODN) capable of attenuating experimental immune diseases.
  • GpG-ODN include but are not limited to GpG-ODN 5- TGACTGTGAAGGTTAGAGATGA-3 which has been demonstrated to suppress the severity of experimental autoimmune encephalomyelitis, to downregulate autoreactive Thl and to induce an altered isotype switching of autoreactive B cell to a protective IgGl isotype (Ho et al . , 2003).
  • this GpG-ODN delayed the onset and attenuated the severity of lupus nephritis by antagonizing and blocking the activation of multiple TLRs (Graham et al . , 2010).
  • the present invention discloses hydrogel-embedded anionic poly ( lactic-co-glycolic acid) spheres (PLGA spheres) as tolerance-promoting adjuvant for peptide immunotherapy in Phase A.
  • PLGA belongs to a family of biodegradable polymers that are highly biocompatible. In water, PLGA biodegrades by hydrolysis of its ester linkages, which leads to metabolite monomers, lactic acid and glycolic acid. Because these two monomers are endogenous and easily metabolized by the body via the Krebs cycle, a minimal systemic toxicity is associated with the use of PLGA for drug delivery (for a review, see Makadia and Siegel, 2011) or biomaterial applications (for a review, see Gentile et al . , 2014) . Due to these properties, PLGA has been approved by the US FDA and European Medicine Agency (EMA) in various drug delivery systems for humans.
  • EMA European Medicine Agency
  • plain PLGA microspheres size range of 1-10 ⁇
  • plain PLGA microspheres size range of 1-10 ⁇
  • PDA2 bee venom phospholipase A2
  • Both cationic and anionic plain PLGA microspheres were capable to downregulate allergic responses in this model and mice were even protected against an otherwise lethal challenge with phospholipase A2.
  • the peak of PLA2 -specific IgG2a antibody preceded that of IgGl (Th2 marker) .
  • PLA2-specific IgGl and IgG2a production turned out to be 2 times higher using cationic microspheres compared to anionic microspheres.
  • the initial Thl bias observed at the level of immunoglobulin was sustained transiently, followed by a mixed Thl/Th2 response supported by a similar expression of IL-4 and IF - ⁇ .
  • PLGA nanoparticles For the promotion of tolerance according to the method of the present invention, anionic PLGA nanoparticles are preferred.
  • anionic PLGA nanospheres are supported by the observation that cationic nanoparticles can alter mitochondrial and endoplasmic reticulum function, triggering the production of reactive oxygen species and pro- inflammatory cytokines, as well as cell death (Hawang et al . , 2015; Chiu et al., 2015; Xia et al . , 2008), whereas anionic nanoparticles have been associated with little to no toxicity (Park et al . , 2011) .
  • cationic nanoparticles are likely to induce Thl-type immune responses rather than tolerance- promoting effects.
  • Positively charged nanoparticles seem to be able to escape from lysosomes after being internalized and exhibit perinuclear localization, whereas negatively and neutrally charged nanoparticles prefer to colocalize with lysosomes (for a review, see Danhier et al., 2012) .
  • Escape of cationic nanoparticles from lysosomes into the cytosol is likely to favor presentation of allergenic or auto-immunogenic proteins adsorbed onto the surface of these cationic nanoparticles in the hydrogel via MHC class I, which leads to Thl-type immune responses.
  • PLGA particles with a size of more than 100 nm are suitable. Nanoparticles with a size of less than 100 nm are not suitable since they tend to interact with cellular organelles, including the mitochondria and nucleus, and these interactions can trigger cellular respiratory and gene toxicity in cells (Park et al . , 2011). This risk is reduced with increasing NP size, presumably because larger NPs tend to initiate phagocytosis, which effectively isolates particles from the more sensitive cytoplasmic environment (for a review, see Getts et al., 2015) .
  • Preferred for the method of the present invention are PLGA particles with a size of more than 200 nm.
  • Small particles with a size of less than 200 nm may drain freely from subcutaneous sites of application to local lymph nodes (Xiang et al., 2013), whereas particles with a size of more than 200 nm must be phagocytosed by local phagocytes before transport to the draining lymph nodes .
  • phagocytosis of released PLGA particles close to the injected hydrogel composition is preferred.
  • PLGA-particle-induced secretion of the antiinflammatory cytokines TGF- ⁇ and IL-10 by macrophages and DCs will create a tolerogenic environment in proximity of the injection site for the presentation of allergenic or auto- immunogenic proteins upon their release from the injected hydrogel composition.
  • Preferred for the method of the present invention are PLGA spheres.
  • APCs antigen-presenting cells
  • DCs dendritic cells
  • uptake is also impacted by shape, with spherical nanoparticles having more favorable uptake kinetics than rodshaped nanoparticles, irrespective of nanoparticle size (Champion and Mitragotri, 2006) .
  • PLGA nanospheres with a size of 300-500 nm are rapidly taken up by local APCs as demonstrated in a recent study (Nicolete et al., 2011).
  • spherical PLGA particles with a size ranging from 200 nm to 10 ⁇ are applicable for the method of the present invention.
  • the present invention discloses hydrogel-embedded find-me molecules capable of attracting APCs to the site of subcutaneously injected hydrogel compositions for peptide immunotherapy in Phase A.
  • apoptotic cells are quickly recognized and removed by phagocytes, which can be either neighboring healthy cells or professional phagocytes recruited to the site of apoptotic cell death. Phagocytes are extremely efficient in sensing and detecting the dying cells at the earliest stages of apoptosis. This is a result of find-me signals released from apoptotic and the exposure of eat-me signals on apoptotic cells.
  • find-me signals released from apoptotic cells have been identified (for a review, see Ravichandran, 2011) .
  • the present invention utilizes these find-me signals capable of triggering effective local phagocytosis including but not limited to fractalkine (chemokine CXC3CL1) , lysophosphatidylcholine (LPC) , sphingosine-1-phosphate (SIP) and the nucleotides ATP and UTP. Both nucleotides have been described as non-redundant find-me signals released by apoptotic cells (Elliott et al . , 2009).
  • UTP acts only on P2Y- family receptors and UDP produced via degradation of released UTP by extracellular enzymes has been shown to promote phagocytic activity via the P2Y6 nucleotide receptor.
  • ATP acts on P2X- and P2Y- family receptors, whereas ADP produced via degradation of released ATP by extracellular enzymes acts only on P2Y-family receptors (for a review, see Gombault et al . , 2013).
  • find-me signals which can be embedded in thermosensitive hydrogels in sufficient quantities for efficient chemotaxis, which are chemically and physically compatible with such hydrogels, and which can be released from such hydrogels over a period of one to two days in a way that resembles the release of find-me from apoptotic cells.
  • only one find-me signal selected from ATP, UTP, ADP or UDP is employed.
  • equimolar quantities of ATP and UTP are employed as find-me signals.
  • both nucleotides have been demonstrated to effect maximal migration of phagocytes at a concentration of about 100 nM (Elliott et al . , 2009) .
  • ATP activates receptors such as P2Y2 (EC 50 ⁇ 1 ⁇ ) which mediate chemotaxis.
  • P2Y2 EC 50 ⁇ 1 ⁇
  • ATP exerts antiinflammatory effects by suppressing the secretion of pro- inflammatory cytokines and promoting the release of of antiinflammatory cytokines (for a review, see Chekeni and Ravichandran, 2011) .
  • the present invention discloses hydrogel-embedded phosphatidyl-L-serine (PS) -presenting liposomes for peptide immunotherapy in Phase A which are a) capable of targeting antigen-presenting cells (APC) including dendritic cells (DCs) and macrophages, and b) capable of inducing tolerogenic effects in these cells after release from subcutaneously injected hydrogel compositions.
  • PS hydrogel-embedded phosphatidyl-L-serine
  • PS-mediated targeting of APC In viable cells, PS is kept exclusively on the inner leaflet of the lipid bilayer via ATP- dependent translocases . In apoptotic cells, the concentration of PS on the outer leaflet of the lipid bilayer is estimated to increase by more than 280 -fold within only a few hours after induction of apoptosis. PS exposed on the surface of apoptotic cells represents the key signal for triggering phagocytosis by macrophages (for a review, see Hochreiter- Hufford and Ravichandran, 2013) .
  • phosphatidyl-L- serine-enriched membranes engage phosphatidyl-L-serine receptors.
  • Two types of phosphatidyl-L-serine receptor have been described, those that bind the phospholipid directly and those that use bridging molecules to associate with it.
  • Direct phosphatidyl-L-serine-binding receptors include T cell immunoglobulin and mucin receptor (TIM) proteins (TIM1, TIM3 and TIM4) ; the CD300 family members CD300a and CD300f (also known as CLM1) ; and the seven-transmembrane spanning receptors brain-specific angiogenesis inhibitor 1 (BAI1) , stabilin 1 and receptor for advanced glycosylation end products (RAGE) .
  • the phosphatidyl-L-serine-bridging molecule MFGE8 is used for apoptotic clearance through ⁇ 3 and ⁇ 5 integrins, which are indirect phosphatidyl-L-serine receptors.
  • GAS6 and protein S are the bridging molecules that link the indirect phosphatidylserine receptors of the tyrosine protein kinase receptor 3 (TYR03 ) -AXL-MER (TAM) family to phosphatidyl-L-serine to mediate apoptotic clearance (for a review, see Amara and Mercer, 2015) .
  • PS-liposomes Liposomes containing phosphatidyl-L-serine (PS-liposomes) mimic apoptotic cells and are engulfed by phagocytes including macrophages, dendritic cells and microglia (e.g., Wu et al . , 2010) . Therefore, components encapsulated in PS-liposomes are effectively targeted to APC, resulting in optimal presentation of encapsulated T cell peptides by these APC, and optimal interaction of encapsulated ODN with endosomal/lysosomal Toll- like receptor molecules.
  • PS-mediated tolerogenic effects in APC Phosphatidyl-L-serine (PS) -presenting liposomes are also capable of inducing tolerance-promoting antigen-presenting cells (APC) including dendritic cells (DCs) and macrophages.
  • APC antigen-presenting cells
  • DCs dendritic cells
  • Phagocytosis of apoptotic cells inhibits the maturation of dendritic cells, their secretion of pro- inflammatory cytokines (Steinman et al . , 2000; Chen et al . , 2004), and there is evidence that PS-dependent phagocytosis of apoptotic cells transforms macrophages to an anti- inflammatory phenotype (Fadok et al. f 1998; Hoffmann et al . , 2001; Huynh et al . , 2002) .
  • PS-liposomes mimic the tolerogenic effects of apoptotic cells in macrophages and microglia via induction and secretion of anti-inflammatory mediators including TGF- ⁇ and PGE2 (Otsuka et al., 2004; Zhang et al. , 2006b).
  • TGF- ⁇ and PGE2 anti-inflammatory mediators including TGF- ⁇ and PGE2
  • MyD88 which is essential for the signal transduction in lipopolysaccharide (LPS) stimulation, is suppressed when macrophages are treated with PS-liposomes (Tagasugi et al . , 2013).
  • PS-liposomes inhibit the maturation of dendritic cells and enhance their secretion of anti-inflammatory cytokines.
  • large unilamellar PS-liposomes have been shown to inhibit the up-regulation of HLA-ABC, HLA-DR, CD80, CD86, CD40, and CD83 , as well as the production of IL- 12p70 in human DCs in response to LPS.
  • DCs exposed to PS had diminished capacity to stimulate allogeneic T cell proliferation and to activate IF -y-producing CD4(+) T cells (Chen et al . , 2004).
  • DCs treated with PS-liposomes also suppressed DNCB- induced CD4(+) T cell proliferation and IFN- ⁇ production. Furthermore, DCs treated with PS-liposomes enhanced the ratio of CD4( +) CD25 (high) Foxp3 ( +) T cells to CD4 ( +) T cells and PD- 1 expression on CD4(+) T cells.
  • PS-liposomes specifically inhibited responses in mice to antigens as determined by decreased draining lymph node tissue mass, reduced numbers of total leukocytes and antigen-specific CD4+ T cells and decreased levels of antigen- specific IgG in blood.
  • TGF- ⁇ appears to play a critical role in this inhibition, as the inhibitory effects of PS-liposomes were reversed by in vivo administration of anti-TGF- ⁇ antibodies (Hoffmann et al . , 2005).
  • PS-liposomes include but are not limited to PS-liposomes which contain a) one or more allergen- -derived T cell peptides, b) one or more allergen- -derived T cell peptides, and CpG-ODN or GpC-ODN or GpG-ODN, or c) one or more allergen- -derived T cell peptides, CpG-ODN or GpC-ODN or GpG-ODN, and one or more tolerance-promoting immune modulators.
  • PS-Liposomes are thermodynamically stable vesicles composed of one or more concentric lipid bilayers.
  • PS-liposomes have two compartments, an aqueous central core, and a lipophilic area within the lipid bilayer.
  • Hydrophilic molecules such as hydrophilic T cell peptides, oligodeoxynucleotides (ODN) with CpG or GpC or GpG motifs and the hydrophilic tolerance- promoting immune modulator dexamethasone phosphate can be encapsulated in the inner aqueous volume, while hydrophobic molecules such as the tolerance-promoting immune modulator calcipotriol can be incorporated into the lipid bilayer.
  • liposomal carrier systems have been used for encapsulating hydrophilic and incorporating hydrophobic molecules including conventional liposomes, ethosomes, niosomes, and elastic liposomes (the initial formulation approach being termed transferosomes) .
  • Preferred for the method of the present invention are conventional PS-containing liposomes .
  • PS-liposomes are composed of PS and other phospholipids such as phosphatidylcholine (PC) from soybean or egg yolk, with or without cholesterol (CH) .
  • PC phosphatidylcholine
  • CH cholesterol
  • the most common applied PS is derived from bovine brain, but other PS sources and synthetic PS preparations such as 1-palmitoyl-2-oleyl-sr.- 3 -glycerophospho-L-serine or 1, 2-distearoyl--sn-3-glycero- phospho-L-serine are also suitable. Cholesterol is used to stabilize the system.
  • lipid mixtures containing PS, PC and, optionally, CH are applicable including but not limited to lipid mixtures comprising molar ratios of PS: PC of 30:70 (Gilbreath et al . , 1985) or 50:50 (Fadok et al . , 2001) for PS- liposomes without cholesterol and molar ratios of PS:PC:CH of 30:30:40 (Hoffmann et al., 2005; Harel-Adar et al., 2011) for PS- liposomes with cholesterol.
  • efficient uptake by macrophages can also be achieved with liposomes containing PS as low as 6 mol% (Geelen et al . , 2012) .
  • PS-liposomes can be prepared in several ways. Most frequently, a film hydration method is employed, where a thin layer of lipid is deposited on the walls of a container by evaporation of a volatile solvent. An aqueous solution, optionally containing the molecule to be entrapped, is added at a temperature above the transition temperature of the lipids, resulting in the formation of multilamellar vesicles. These systems contain several lipid bilayers surrounding the aqueous core. Further processing by sonication or filter extrusion generates large unilamellar vesicles (LUV, 1-5 ⁇ diameter), or small unilamellar vesicles (LUV, 0.1-0.5 ⁇ diameter) . PS-liposomes with 1 ⁇ diameter have been shown to trigger efficient uptake by macrophages (Harel-Adar et al . , 2011) .
  • thermosensitive hydrogels comprising PLGA-PEG-PLGA are employed for sustained local delivery of PS-liposomes at the site of autoantigen or allergen presentation.
  • liposome-loaded PLGA-PEG-PLGA hydrogels exhibit still reversible thermosensitive properties (Xing et al . , 2014).
  • the present invention discloses tolerance-promoting immune modulators for encapsulation or incorporation in hydrogel-embedded PS-liposomes or for direct embedment into hydrogels.
  • tolerance-promoting immune modulators into hydrogels does not provide for maximal effective tolerizing immune modulation of APCs, it allows extension of the tolerizing effect of these hydrogel-embedded immune modulators also to other immune cells in addition to APCs.
  • DexP dexamethasone phosphate
  • Suitable tolerance-promoting immune modulators for the method of the present invention are those which are capable of a) inducing tolerogenic APCs (including DCs and macrophages) and tolerance-promoting Tregs, b) suppressing effector T cell- mediated responses, and c) inhibiting pro-inflammatory cytokines and pro- inflammatory complement factors at the site of autoantigen or allergen presentation.
  • Such immune modulators include but are not limited to a) vitamin D3 and selected analogs such as calcipotriol, b) glucocorticoids such as dexamethasone phosphate, c) Janus kinase inhibitors, also known as JAK inhibitors or jakinibs, such as tofacitinib, d) antagonistic cytokine molecules such as I1-4/IL-13 muteins, e) salicylate-based therapeutics for the inhibition of T FR1- mediated pathways such as acetylsalicylic acid and salicylic acid, f) peptide-based complement inhibitors such as the 13- residue cyclic peptide (H-I [CWQDWGHHRC] T-NH 2 or peptidomimetica-based complement inhibitors such as cyclic PMX53, and g) aptamer-based inhibitors of pro- inflammatory cytokines .
  • vitamin D3 and selected analogs such as calcipotriol
  • Preferred tolerance-promoting immune modulators for direct embedment in a hydrogel include those which are soluble in the aqueous environment of the hydrogel such as the hydrophilic glucocorticoid dexamethasone phosphate and the hydrophilic citrate derivative of tofacitinib. Preferred are also those tolerance-promoting immune modulators which are characterized by a short serum half-life, since such immune modulators are removed rapidly from circulation, thereby minimizing potential systemic side effects.
  • Glucocorticoids exhibiting a short plasma half-life (ranging between 30 min and 2 hours) and a relatively short biological half-life of 8-12 hours include cortisone and hydrocortisone, glucocorticoids exhibiting an intermediate plasma half-life (ranging between 2.5 and 5 hours) and an intermediate biological half-life of 18-36 hours include prednisone, prednisolone, methylprednisolone and triamcinolone, and glucocorticoids exhibiting a long plasma half-life (up to 5 hours) and a relatively long biological half-life of 36-54 hours include dexamethasone , betamethasone and fludrocortisone (for a review, see Longui, 2007) .
  • glucocorticoid potency which defines the capacity to elevate glycemia and which is proportional to the anti-inflammatory potency.
  • cortisone and hydrocortisone exhibit a rather low potency
  • prednisone, prednisolone, methylprednisolone and triamcinolone an intermediate potency
  • dexamethasone and betamethasone exhibit a rather high potency, which is 25- 30 -fold higher than that of cortisone or hydrocortisone (for a review, see Longui, 2007) . Therefore, glucocorticoids with a high anti-inflammatory potency are preferred for the method of the present invention despite their relatively long plasma and biological half-lives.
  • Hydrogel-embedded tofacitinib citrate formulations offer the possibility to use tofacitinib as supporting tolerance- promoting immune modulator at relatively low concentrations which provide therapeutic efficacy at the site of allergen or autoantigen presentation but minimize potential tofacitinib- mediated adverse effects.
  • the hydrogel serves as sustained delivery system for tofacitinib at the site of allergen or autoantigen presentation and, thereby, eliminates peak serum levels of tofacitinib as observed after oral administrations. Furthermore, the short in vivo half-life of tofacitinib (2-3 h) minimizes systemic effects of tofacitinib upon diffusion and transport away from injected hydrogel-based compositions.
  • Preferred tolerance-promoting immune modulators for encapsulation or incorporation into PS-liposomes include but are not limited to those a) which can be encapsulated in the aqueous compartment of liposomes such as the hydrophilic glucocorticoid derivative dexamethasone phosphate and the hydrophilic tofacitinib citrate, and b) which can be incorporated into the lipid layer of liposomes such as the lipophilic vitamin D3 derivative calcipotriol.
  • Calcipotriol (or calcipotriene) is a synthetic derivative of calcitriol, which has similar VDR binding properties as compared to calcitriol, but has low affinity for the vitamin D binding protein (DBP) (for a review, see Tremezaygues and Reichrath; 2011) .
  • DBP vitamin D binding protein
  • In vivo studies in rats showed that effects of calcipotriol on calcium metabolism are 100-200 times lower as compared to calcitriol while the tolerance-promoting effects of calcipotriol are comparable to those of calcitriol (e.g., Al-Jaderi et al . , 2013) .
  • the half-life of calcipotriol in circulation is measured in minutes (Kragballe, 1995) .
  • the rate of clearance (serum half-life of 4 min in rats) is approximately 140 times higher for calcipotriol than for calcitriol. Furthermore, calcipotriol is rapidly metabolized and effects of the metabolites have been demonstrated to be 100 times weaker than those of the parent compound ( issmeyer and Binderup, 1991) .
  • T cell peptides derived from various food allergens including but not limited to those derived from apple (Mai d allergens) , almond (Pru du allergens) , avocardo (Pers a allergens) , banana (Mus a allergens) , Brazil nut (Ber e allergens) , buckwheat (Fag e allergens) , carrot (Dau c allergens) , carp (Cyp c allergens) , cashew nut (Ana 0 allergens) , celery (Api g allergens) , cherry (Pru av allergens) , chestnut (Cas s allergens) , cod (Gad c allergens), cow's milk (Bos d allergens), frog (Ran e allergens), hazelnut (Cor a allergens), hen's egg (G
  • allergen-specific T cell lines and clones from large patient cohorts are screened for reactivity against overlapping synthetic peptides spanning the entire sequence of the allergen molecule, each usually 15 to 20 amino acids long with overlaps from 5 amino acids upwards.
  • Core epitopes within T cell-reactive peptides are mapped subsequently using peptide sets truncated from the N- and C-termini, typically revealing eight or nine residue core epitopes for CD4+ T cells.
  • Optimal T cell stimulation often requires longer sequences including flanking residues to stabilize the HLA-peptide-TCR complex and improve expression of peptide on the antigen presenting cell surface. Consistent with naturally processed peptides eluted from HLA class II molecules, candidate peptides for inclusion in short allergen peptide therapy range from 12-20 residues.
  • T cell epitopes can be performed using peripheral blood mononuclear cells (PBMC) from individuals with the specific allergy of interest, either directly ex vivo, or after enrichment for allergen-specificity as T cell lines (oligoclonal populations) or T cell clones (monoclonal populations) .
  • PBMC peripheral blood mononuclear cells
  • the most critical peptides are identified by a range of immunological assays using high-throughput methodologies including flow cytometry with dyes such as carboxyfluorescein diacetate succinimidyl ester (CFSE) to detect proliferating cells by decreased intensity of staining, cytokine capture, and fluorochrome-conjugated HLA class II-peptide tetramers (for a review, see O'Hehir et al., 2016) .
  • CFSE carboxyfluorescein diacetate succinimidyl ester
  • CFSE-based approaches are sensitive for detection of peptide- responsive T cells, particularly when combined with other activation markers such as CD25, but bystander proliferation may reduce specificity (Van Hemelen et al . , 2015).
  • ELISPOT-based approaches can be used for high-throughput screening of PBMC for T cell epitope peptide recognition (e.g., Tye-Din et al . , 2010).
  • Identified T cell epitopes are then validated by screening large patient population cohorts and using rigorous assay design and appropriate statistical methods (e.g., wok et al . , 2010).
  • HLA-peptide tetrameric complexes are sensitive and specific analytes for identification and characterization of allergen- specific T cells directly ex vivo, but tetramer synthesis is expensive and many HLA class II molecules are not easily isolated for use in tetramers, limiting the HLA-coverage obtainable .
  • silico algorithms consider thousands of known epitope sequences to predict CD4+ T cell epitopes by- detecting theoretical HLA class II binding motifs within protein sequences (Schulten et al., 2013) [38]. While algorithms provide preliminary guidance cost-effectively, comprehensiveness is limited and HLA-binding motif predictions require validation in functional peripheral blood T cell assays (Van Hemelen et al . , 2015) .
  • T cell epitopes of food allergens include those from cow's milk ( sl -casein, ⁇ -lactoglobulin) , peanut (Ara hi and Ara h 2), hen's egg (ovomucoid (Gal d 1) and ovalbumin (Gal d 2) ) , hazelnut (Cor a 1.04), Brazil nut (Ber e 1) , beef (bovine serum albumin) , celery (Api g 1) , walnut (Jug r 2), and shrimp (Met e 1) (Bohle, 2006; Prickett et al . , 2011; Prickett et al . , 2013; Archila et al . , 2015; Wai et al . , 2015; Ramesh et al . , 2016).
  • T cell epitopes are found scattered throughout an allergen sequence, but consideration of collective properties of the epitopes allows ranking according to dominance to optimize peptide candidates for therapy (Schulten et al . , 2013. Important properties for the method of the present invention include donor and T cell line/clone responder frequency, patterns of reactivity, reproducibility of T cell response and, importantly, ability to induce a response in patient PBMC in large patient cohorts. The ability of T cell epitope peptide candidates for the method of the present invention to show widespread degeneracy of binding to a range of MHC class II molecules is important for targeting genetically diverse patient populations.
  • HLA-binding T cell epitope prediction algorithms include those for HLA-DR, HLA- DP, or HLA-DQ.
  • thermosensitive hydrogels which are suitable for subcutaneous administration and sustained local delivery of hydrogel- embedded components for peptide immunotherapy in Phase A.
  • thermosensitive hydrogels are injectable in situ- forming gel systems which a) undergo a sol-gel-sol transition, preferably forming a free flowing sol at room temperature and a non- flowing gel at body temperature, b) can serve as depot for sufficient quantities of above listed components, c) allow the release of sufficient quantities of the embedded components over a prolonged period of at least 2 to 3 days, d) are chemically and physically compatible with all embedded components, and e) are biodegradable.
  • biodegradable thermogelling hydrogels are used which are composed of FDA- approved biodegradable polymers .
  • Preferred biodegradable polymers approved by the FDA and used in a clinical trial include but are not limited to poly (D, L-lactic acid), poly (lactic-co-glycolic acid) (PLGA) , and copolymers of L- lactide and D,L-lactide. All FDA approved polymers have been studied extensively for their biocompatibility, toxicology, and degradation kinetics. Furthermore, these polymers have been shown to release embedded therapeutics for several hours up to several weeks in vivo.
  • thermogelling block polymers which are based on monomethoxy poly (ethylene glycol) (MPEG) including but not limited to a) diblock copolymers consisting of MPEG and poly ( ⁇ -caprolactone) (PCL) (Hyun et al . , 2007), b) MPEG-jb- (PCL-ran-PLLA) diblock copolymers (Kang et al . , 2010), and c) diblock copolymers consisting of MPEG and PLGA (Peng et al . , 2010) .
  • MPEG copolymers containing PCL provide the advantage that they do not create an acidic environment upon biodegradation in contrast to MPEG copolymers containing PLLA and PLGA (Hyun et al., 2007).
  • biodegradable thermogelling triblock polymers including but not limited to a) PLGA-PEG-PLGA (Qiao et al . , 2005), b) PEG- PLGA-PEG (Zhang et al . , 2006a), and c) PEG-PCL-PEG (PECE) (Gong et al . , 2009).
  • Various biodegradable thermogelling triblock polymers made up of PLGA and PEG are disclosed in patent W099/18142. At lower temperatures, hydrogen bonding between hydrophilic PEG segments of the copolymer chains and water molecules dominate in aqueous solutions, resulting in the dissolution of these copolymers in water.
  • thermogelling PLGA-PEG-PLGA triblock polymers Most preferred for the method of the present invention are biodegradable thermogelling PLGA-PEG-PLGA triblock polymers.
  • injectable thermo- gelling PLGA-PEG-PLGA polymers possess several advantages including easy preparation, a formulation process which is free of harmful organic solvents (e.g., Qiao et al. 2005), application of building blocks which are approved for parenteral use in humans by the FDA, excellent biocompatibility, and well established procedures for the production of composits comprising liposomes (e.g., Xing et al., 2014).
  • PLGA-PEG-PLGA hydrogels provide another important advantage in that tolerance-interfering Thl- type or Th2-type immune responses are avoided.
  • the present invention discloses biodegradable thermogelling polymers which allow modification of their degradation kinetics.
  • biodegradable thermogelling polymers for the method of the present invention which maintain their structural integrity for a few days but do not remain in the body for more than a month. Therefore, biodegradable thermogelling polymers which allow modification of their degradation kinetics, are preferred for the method of the present invention.
  • PLLA segments can be incorporated into the PCL segment of MPEG-PCL copolymers, since PLLA provides better accessibility of water to the ester bonds of PLLA which enhances the hydrolytic degradation of the copolymer ( ang et al . , 2010) .
  • the rate of PLGA-PEG-PLGA hydrogel erosion can be modified by altering the molar ratio of DL-lactide/glycolide in the PLGA segment.
  • the DL-lactide moiety is more hydrophobic than the glycolide moiety. Therefore, by increasing the molar ratio of DL- lactide/glycolide in the PLGA segment of PLGA-PEG-PLGA triblock copolymers, more stable hydrogels are formed due to stronger hydrophobic interactions among the copolymer molecules (Qiao et al. 2005) . 8.
  • the therapeutically effective dose can be estimated initially in animal models, usually mice, rats, rabbits, dogs, pigs, or non-human primates.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Dosage regimens may be adjusted to provide the optimum therapeutic response.
  • the quantity of the hydrogel-embedded components depends on the release kinetics of the depot- providing hydrogel and is adjusted to a level that guarantees the continuous release of therapeutically effective doses over a period of at least 2 to 5 days .
  • the quantity of embedded components will vary according to factors such as the weight and the age of the individual, and the ability of the composition to induce an effective immune response in the individual .
  • CpG-ODN have been studied in various experimental models and clinical trials.
  • CpG-ODN 1826 Allergic bronchopulmonary aspergillosis is a Th2- sustained allergic condition.
  • CpG-ODN 182 6 5 ' - CCATGACGTTCCTGACGTT- 3 ' , phosphorothioate- stabilized B-class CpG-ODN
  • the animals were treated intraperitoneally with 30 ⁇ g CpG-ODN 1826 (approx. 5 nmol; M approx. 6059) per mouse twice, on the same days as the first and second administration of A. fumigatus culture filtrate extract.
  • the Th2 -dependent allergic phenotype was greatly attenuated by CpG, which enhanced the production of IL-10, a marker of protective Treg activity in Aspergillus allergy.
  • CpG CpG-ODN 1668
  • CpG-ODN 1668 induced innate immunity as indicated by the finding that these doses drastically reduced the load of adenovirus in the host after i.v. infection with adenovirus expressing OVA.
  • Hydrogel-embedded PS- liposomes containing PO CpG-ODN Hydrogel-embedded PS- liposomes containing PO CpG-ODN. Taking the slow release of PS-liposomes from PLGA-PEG-PLGA hydrogels into consideration, administration of PLGA-PEG-PLGA hydrogel- embedded PS- liposomes containing up to 120 ⁇ g of PO CpG-ODN/20 g mouse (corresponds to 6.0 mg/kg) appears to be a tolerable dose. This would lead to the release of approx. 12 ⁇ g liposomal PO CpG-ODN within the first 12 hours (10% release) , approx. 20 ⁇ g liposomal PO CpG-ODN within 24 hours (17% release) , and approx.
  • PLGA particles have been studied in a variety of animal models in the recent past. Results obtained from these studies provide useful information for the application of plain anionic PLGA nanoparticles in humans.
  • Calcipotriol (or calcipotriene) is a synthetic derivative of calcitriol, which has similar VDR binding properties as compared to calcitriol, but has low affinity for the vitamin D binding protein (DBP) (for a review, see Tremezaygues and Reichrath; 2011) .
  • DBP vitamin D binding protein
  • calcipotriol The half-life of calcipotriol in circulation is measured in minutes (Kragballe, 1995) .
  • the rate of clearance (serum half- life of 4 min in rats) is approximately 140 times higher for calcipotriol than for calcitriol.
  • calcipotriol is rapidly metabolized and effects of the metabolites have been demonstrated to be 100 times weaker than those of the parent compound (Kissmeyer and Binderup, 1991) .
  • Calcipotriol Uptake of calcipotriol. Calcipotriol has been used clinically for more than 10 years for topical treatment of psoriasis without systemic toxicity (for a review, see Plum and DeLuca, 2010) . Clinical studies with radiolabeled ointment indicate that approximately 6% of the applied dose of calcipotriene is absorbed systemically when the ointment is applied topically to psoriasis plaques or 5% when applied to normal skin.
  • mice can become hypercalcemic on day 2 or day 3 at calcitriol doses higher than 750 ng/mouse when administered as a single bolus i.p. (Muindi et al . , 2004). According to this study, however, calcitriol can be administered as a single bolus i.p. injection up to 500 ng/mouse (in 0.2 ml of normal saline) .
  • mice were treated by a single i.p. injection of 0.1 ml propylene glycol containing 300 ng calcitriol (Cantorna et al . , 1998a), or by a single i.p. injection of 0.1 ml scafflower oil containing up to 400 ng calcitriol (Nashold et al., 2013).
  • mice were treated on their shaved dorsal skin with 30 mg/day of calcipotriol ointment (contains 50 ⁇ g calcipotriol/g 1.5 pg calcipotriol/30 mg) (Donovex, Leo Pharma) for three days followed by transcutaneous immunization with OVA in the presence of CpG adjuvant.
  • This treatment abolished antigen-specific CD8+ T cell priming and induced CD4+CD5+ Tregs, thereby promoting antigen- specific tolerance (Ghoreishi et al . , 2009).
  • a diet containing 50 ng calcitriol/mouse/day (corresponding to approx. 5-10 ⁇ g calcipotriol/mouse/day) was administered three times/week. This treatment prevented diabetes onset in NOD mice as of 200 days (Zella et al . , 2003) .
  • mice received a daily diet supplemented with 20 ng calcitriol/mouse/day (corresponding to approx. 2-4 ⁇ g calcipotriol/mouse/day) . This dose was found to be effective in inhibiting the progression of arthritis without producing hypercalcemia (Cantorna et al . , 1998b).
  • Liposomal calcipotriol is lipophilic and is incorporated into the lipid bilayer of liposomes.
  • Tolerance-inducing dose of hydrogel-embedded PS-liposomes containing calcipotriol As demonstrated in the study of Ghoreshi et al .
  • mice with 1.5 g calcipotriol for three days abolished antigen-specific CD8+ T cell priming and induced CD4+CD5+ Tregs, thereby promoting antigen-specific tolerance.
  • calcipotriol permeates through murine skins to only a limited extent over 20h after application, but is efficiently retained in murine skins at a level of 60% of the applied dose after 2Oh.
  • transdermal uptake of less than 3 calcipotriol (1 ⁇ g over 3 days) into the skin mediated the induction of tolerance in mice.
  • subcutaneous administration of hydrogel-embedded 20 g liposomal calcipotriol/mouse will deliver a sufficiently tolerizing quantity of liposomal calcipotriol to APC via PS-liposomes .
  • Release studies with hydrogel-embedded PS-liposomes have demonstrated that 20 ⁇ g liposomal calcipotriol embedded in PLGA-PEG-PLGA hydrogels leads to the release of approx. 2.0 ⁇ g liposomal calcipotriol within the first 12 hours (10% release), approx. 3.4 ⁇ g liposomal calcipotriol within 24 hours (17% release), and approx. 7.0 ⁇ g liposomal calcipotriol within 48 hours (35% release) .
  • These amounts are equivalent to the tolerizing quantity of calcipotriol in the study of Ghoreshi et al . (2009).
  • hydrogel-embedded 20 ⁇ g liposomal calcipotriol/mouse represents a tolerable dose.
  • Calcitriol can be administered as a single bolus i.p. injection up to 500 ng/mouse (Muindi et al . , 2004). Assuming only a 100-times lower effect of calcipotriol on calcium metabolism as compared to calcitriol, 500 ng calcitriol corresponds to 50 g calcipotriol.
  • glucocorticoids for the method of the present invention are those which exhibit a high anti- inflammatory potency which is proportional to their glucocorticoid potency established for their capacity to elevate glycemia.
  • Glucocorticoids with a high anti- inflammatory potency include but not limited to dexamethasone and betamethasone (for a review, see Longui, 2007) .
  • glucocorticoids with a moderate anti- inflammatory potency such as prednisone, prednisolone, methylprednisolone, and triamcinolone, as well as those with a lower anti-inflammatory potency such as cortisone and hydrocortisone are also applicable for the method of the present invention.
  • a dexamethasone dose of 0.25 mg/m 2 /day corresponds to 2.5 mg/m 2 /day of prednisolone and hydrocortisone 10 mg/m 2 /day (for a review, see Gupta and Bhatia, 2008) .
  • glucocorticoids have been studied in a variety of animal models and evaluated in clinical trials.
  • dexamethasone has been administered by i.p. injection at doses of 10-40 ⁇ g/20-g mouse (0.5-2.0 mg/kg) for 7 days, leading to a 30% decrease in the number of intestinal VDRs (Hirst and Feldman, 1982a) .
  • dexamethasone has been administered at doses of 0.15-7.5 mg/150-g female rat (1.0- 50.0 mg/kg) for 7 days (Hirst and Feldman, 1982b).
  • glucocorticoids In clinical trials, different glucocorticoids and varying combinations thereof have been evaluated. For example, several randomized controlled trials comparing dexamethasone with prednisolone in the treatment of acute asthma exacerbations in children have been published.
  • One study compared emergency department (ED) treatment with an initial dose of oral prednisolone 2 mg/kg (max. 60 mg) followed by 1 mg/kg daily for four days with oral dexamethasone 0.6 mg/kg (max. 16 mg) daily for two days (Qureshi et al . , 2001) .
  • Another study compared ED treatment with an initial dose of oral prednisolone 1 mg/kg (max. 30 mg) followed by 1 mg/kg twice daily for five days with a single dose of oral dexamethasone 0.6 mg/kg (max. 18 mg) (Altamimi et al . , 2006) .
  • Still another study compared ED treatment with a single dose of prednisolone 2 mg/kg (max. 80 mg) followed by 1 mg/kg (max. 30 mg) twice daily for five days with a single dose of 0.6 mg/kg oral dexamethasone (max. 16 mg) followed by one dose of 0.6 mg/kg oral dexamethasone to take the next day (Greenberg et al. , 2008) .
  • Liposomal dexamethasone phosphate (DexP) .
  • liposomal DexP has been administered i.v. at a concentration of 11.2 DexP/20-g mouse (adult male C57BL/6 mice with a body weight of 20-24g) .
  • the DexP to lipid ratio was 28 ⁇ g DexP/ ⁇ lipid (comprising PC, cholesterol and PE at a molar ration of 55:40:5) .
  • liposomal DexP has been administered i.v.
  • the DexP to lipid ratio was 40 ⁇ g DexP/ ⁇ lipid (comprising DPPC, DPPG and cholesterol at a molar ration of 50:10:40) .
  • a more than three-fold higher amount of liposomal DexP (3.75 mg liposomal DexP/kg body weight, corresponding to 75 ⁇ g/20-g mouse or 563 ⁇ g/l50-g female rat) has been administerd i.v to rats 6, 24 and 48 hours after induction of antigen- induced arthritis (US20060147511A1) .
  • Tofacitinib has been approved by FDA to treat adults with moderately to severely active rheumatoid arthritis (RA) who have had an inadequate response to, or who are intolerant of, methotrexate .
  • RA rheumatoid arthritis
  • tofacitinib as tolerance-promoting immune modulator is restricted to a few days until its release from injected hydrogels is completed. Therefore, short-term clinical studies with tofacitinib provide valuable information about therapeutically effective doses of tofacitinib.
  • Treatment with tofacitinib at a dose of ⁇ 3 mg twice a day resulted in a rapid response with significant efficacy compared with placebo, as indicated by the primary end point (ACR20 response at week 12), achieved in 39.2% (3 mg) , 59.2% (5 mg) , 70.5% (10 mg) and 71.9% (15 mg) in the tofacitinib group compared with 22.0% of patients receiving placebo.
  • Preferred concentration of tofacitinib at the site of allergen or autoantigen presentation On oral administration of tofacitinib 5 or 10 mg twice a day, serum levels of approximately 100-300 nM are achieved, and such therapeutic levels are known to last for 4-6 h ( ubo et al .
  • tofacitinib Based on the different inhibitory potency of tofacitinib for the four members of the Janus kinase family in enzyme assays (Flanagan et al . , 2010; Meyer et al . , 2010), lower concentrations of tofacitinib inhibit signalling via JA 1 and JAK3 (IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, and IF - ⁇ ) , whereas higher concentrations of tofacitinib inhibit also signalling via JAK1 and TY 2 (IL-10, IL-12, IL-20, IL-22, IL- 23 and IFNs) , and via JAKl, JAK2 and TYK2 (IL-6, IL-11, IL-27 and G-CSF) .
  • JAK1 and TY 2 IL-10, IL-12, IL-20, IL-22, IL- 23 and IFNs
  • T cell reactive sites have been mapped for many allergens including food allergens and are catalogued in The Immune Epitope Database (www.iedb.org). A meta-analysis of this database confirmed 1406 allergen-derived CD4+ T cell epitopes based on human T cell reactivity (for a review, see Prickett et al . , 2015) . Some of these T cell reactive sites (allergen- derived T cell peptides) have been evaluated for the treatment of allergy in murine and human studies which provide useful guidelines .
  • Murine study with food allergen-derived T cell peptides In a murine egg allergy model (Yang et al . , 2010), BALB/c mice were sensitized by oral gavage at a dose of 1.0 mg of OVA and 10 ⁇ g of cholera toxin twice per week for a period of 4 weeks, and subsequently treated at week 6 by subcutaneous injection of 100 ⁇ g of a single OVA-derived T cell peptide or 300 g of a mixture of three OVA-derived T cell peptides (each peptide: 100 /g) in PBS three times weekly for a period of 3 weeks.
  • mice treated with the three OVA-derived peptides significantly decreased anaphylactic responses (two- to threefold difference to placebo-treated mice) , accompanied by lower serum histamine and OVA-specific IgE levels.
  • Further analyses of splenocytes obtained from treated mice revealed a T helper type 1-biased response (increase of IFN- ⁇ , IL-12p40) with a diminished T helper type 2-reponse (decrease of IL-4, IL-5 and IL-13) .
  • T helper type 1-biased response increase of IFN- ⁇ , IL-12p40
  • T helper type 2-reponse decrease of IL-4, IL-5 and IL-13
  • a similar cytokine expression profile was determined in intestinal tissues, accompanied by a pronounced mR A expression of regulatory molecules TGF- ⁇ and forkhead box transcription factor 3 (FOXP3) . Based on these data, 300 ⁇ g of subcutaneously injected T cell peptides are sufficient to induce in mice local repressive mechanisms
  • T cell peptides derived from cat allergen Fel d 1 and bee venom allergen Ap m 1 have been used for immunotherapeutic studies.
  • subcutaneously administered Fel d 1 peptides comprised an equimolar mixture of two long 27 amino acid sequences from the two chains of Fel d 1 and contained multiple T cell epitopes.
  • clinical benefit was demonstrable at 6 weeks but adverse events included nasal congestion, flushing, pruritus and chest tightness for minutes to hours after peptide delivery.
  • the possibility of retained conformational structure within the long peptides and IgE-mediated reactivity likely explained the early adverse events .
  • the treatment included injection, in successive doses, of 0.1 ⁇ g of an equimolar mixture consisting of the three peptides, followed by 1 ⁇ g, 3 ⁇ g, 6 ⁇ g, 12 ⁇ g f 25 g, 50 ⁇ g, and then three times 100 ⁇ g in weekly intervals, resulting in a cumulative dose of 397.1 ⁇ g of the peptide mixture. Consistent with linked suppression, clinical efficacy was achieved to a subsequent PLA2 challenge and live whole bee sting challenge. However, some subjects developed peptide-specific IgE and two subjects developed local erythema with occasional palmar pruritus. These findings emphasize the importance of using the shortest possible peptides comprising T cell epitopes to minimize the risk of IgE-mediated adverse events.
  • T cell peptides Another important consideration is the quantity of subcutaneously or intradermally administered T cell peptides. Since administration of T cell peptides at a concentration of 750 g caused several adverse events, including late asthma responses due to a flare of released cytokines from peptide- stimulated T cells, the quantity of T cell peptides was tenfold reduced to approx. 75 ⁇ g (for a review, see Prickett et al., 2015). Early-phase studies with short T cell peptides, typically 13-17 amino acids in length, administered at this concentration via the intradermal route into non- inflamed skin demonstrated safety and clinical efficacy (Worm et al . , 2013) .
  • PS-liposomes Animal studies with PS-liposomes . While PS- liposomes have not been evaluated in humans, PS-liposomes have been studied in a variety of animal models in the recent past. Results obtained from these studies provide useful information for the application of PS-liposomes in humans.
  • PS- containing liposomes promoted angiogenesis, preservation of small scars, and prevented ventricular dilatation and remodeling.
  • the cells secreted high levels of the anti- inflammatory cytokines TGF- ⁇ and IL-10 and upregulated the expression of the mannose receptor CD206, concomitant with downregulation of proinflammatory markers such as T F- and the surface marker CD86 (Harel-Adar et al . , 2011).
  • Encapsulation efficiencies of peptides into liposomes depend on the hydrophilicity or hydrophobicity of the peptides, the lipid composition and the molar ratio of lipid to peptide.
  • TRP2 tyrosinase-related protein 2
  • SVYDFFVWL tyrosinase-related protein 2
  • the encapsulation efficiency of TRP2 ranged between 20-50% (Konur et al . , 2008).
  • MBP 46-62 three peptides derived from the myelin basic protein (MBP 46-62, MBP 124-139; MBP 147-170) were encapsulated in mannosylated liposomes (prepared from egg phosphatidyl-choline and 1% monomannosyl dioleyl glycerol) at a lipid-to-peptide weight ratio of 330:1.
  • mannosylated liposomes prepared from egg phosphatidyl-choline and 1% monomannosyl dioleyl glycerol
  • the resulting small unilamellar liposomes entrapped more than 90% of the initial peptide amount (Belogurov et al . , 2013). Same considerations apply to allergen-derived T cell peptides.
  • hydrogel-embedded PS-liposome containing encapsulated allergen-derived peptides The effective dose of PS-liposome-encapsulated peptides in PLGA- PEG-PLGA hydrogels depends on the injection protocol in Phase A. Calculations of therapeutically effective concentrations of hydrogel-embedded liposome-encapsulated allergen-derived peptides are based on the data of clinical trials with short allergen-derived T cell peptides (for a review, see Prickett et al . , 2015).
  • the amount of allergen-derived peptides in PLGA-PEG-PLGA hydrogel compositions needs to be higher than those in previous clinical trials with short allergen-derived T cell peptides, since the release of PS- liposomes from subcutaneously injected PLGA-PEG-PLGA hydrogels is relatively slow (approx. 10% within the first 12 hours, approx. 17% with 24 hours and approx. 35% within 48 hours) .
  • the treatment is performed in monthly intervals by 4 to 6 subcutaneous injections of increasing doses of hydrogel-embedded PS-liposomes containing short allergen-derived T cell peptides.
  • the first injected hydrogel composition may contain 50 ⁇ g of liposomal T cell peptides, the second 100 ⁇ g, the third 200 g, the fourth 400 ⁇ g, and the last two also 400 ⁇ g .
  • the 400 ⁇ g doses lead to the release of approx.
  • the treatment is performed in monthly- intervals by 4 to 6 subcutaneous injections of identical doses of hydrogel-embedded PS-liposomes containing short allergen- derived T cell peptides.
  • each injected hydrogel composition contains an amount of 200 ⁇ g to 600 ⁇ g liposomal peptides. In a more preferred embodiment, each injected hydrogel composition contains an amount of 400 ⁇ g of liposomal peptides.
  • compositions of the present invention are incorporated into pharmaceutical compositions suitable for administration.
  • Such compositions typically comprise the therapeutic compositions of the present invention and pharmaceutically acceptable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic systems, and the like, compatible with the components of the therapeutic compositions of the present invention.
  • pharmaceutically acceptable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic systems, and the like compatible with the components of the therapeutic compositions of the present invention.
  • the use of such media and agents for pharmaceutically active substances is well known in the art.
  • Solutions or suspensions used for subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediaminetetraacetic acid, buffers such as acetates, citrates or phosphates and agents for the adjustment of toxicity such as sodium chloride or dextrose.
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition.
  • the composition should be fluid to the extent that easy syringability exists. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case dispersion and by use of surfactants.
  • the composition must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • composition must be sterile.
  • Sterile injectable solutions can be prepared by filtered sterilization. The preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof. 10. Tolerance- inducing strategies with allergen- derived T cell peptides in Phase A
  • the present invention discloses several methods for the first subcutaneous hydrogel-based immunotherapeutic step with food allergen-derived T cell epitope-containing peptides (T cell peptides) in Phase A including a) PS-liposomal approaches using tolerance-promoting ODN, b) PS-liposomal approaches using PLGA spheres as alternative tolerance-promoting adjuvant, c) PS-liposomal approaches using tolerance-promoting immune modulators, d) PS- liposomal approaches using a combination of tolerance- promoting immune modulators and adjuvants, e) PS-liposomal approaches without CpG-ODN or other adjuvants, and f) non- liposomal approaches.
  • hydrogel-embedded PS-liposomes provide several important therapeutic advantages over currently available peptide-based techniques. Most important, peptides encapsulated in PS-liposomes are preferentially recognized and phagocytosed by antigen-presenting cells (APCs) . Phosphatidyl- L-serine residues on the surface of the PS-liposomes represent eat-me signals for dendritic cells and macrophages. As a result, hydrogel-embedded PS-liposome-encapsulated peptides are targeted directly to these cells and most efficiently presented to tolerance-promoting Tregs, whereas the uptake and subsequent presentation of non-encapsulated peptides by APCs is significantly less effective.
  • APCs antigen-presenting cells
  • PS-liposomes are capable of inducing tolerance- promoting antigen-presenting cells (APC) including dendritic cells (DCs) and macrophages. They mimic the tolerance- promoting effects of apoptotic cells and have been shown to inhibit the maturation of dendritic cells and to enhance their secretion of anti-inflammatory cytokines.
  • APC antigen-presenting cells
  • DCs dendritic cells
  • macrophages macrophages
  • the uptake of hydrogel-embedded PS- liposomal T cell peptides by peripheral APC is further optimized by the hydrogel- embedded find-me molecules ATP and UTP.
  • the hydrogel-mediated sustained delivery technology of the present invention mimics the physiological role of find-me signals which are released continuously from apoptotic cells, thereby establishing a chemotactic gradient that stimulates the migration of APC to the subcutaneous injection site of the hydrogel composition.
  • the hydrogel-mediated sustained delivery technology of the present invention provides an additional advantage in that also low molecular weight find-me molecules with a short plasma half-life such as ATP and UTP can be used for establishing a chemotactic gradient for efficient peripheral phagocytosis. Thereby, expenses for production and clinical testing can be reduced significantly. 10.1. PS-liposomal approaches using tolerance-promoting ODN as adjuvant
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel-embedded phosphatidyl-L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, b) tolerance-promoting amounts of hydrogel-embedded CpG-ODN or GpC-ODN or GpG-ODN, and c) one or more hydrogel-embedded find- me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen- presenting cells (APC) .
  • PS hydrogel-embedded phosphatidyl-L- serine
  • PS-liposomes phosphatidyl-L- serine
  • tolerance-promoting amounts of hydrogel-embedded CpG-ODN or GpC-ODN or GpG-ODN c)
  • Method A provides an approach for amplified induction of tolerance using CpG-ODN or GpC-ODN or GpG-ODN as tolerance- promoting adjuvant.
  • CpG-ODN CpG-rich oligodeoxynucleotides
  • TLR9, TRIF and TRAF6 CpG-rich oligodeoxynucleotides
  • GpC-ODN GpC oligodeoxynucleotides
  • DCs dendritic cells
  • GpG-ODN have been demonstrated to delay the onset and to attenuate the severity of lupus nephritis by antagonizing and blocking the activation of multiple TLRs (Graham et al . , 2010).
  • T cell peptides are presented by APC which have been effectively tolerized by two mechanisms including the tolerance-promoting effects of PS- liposomes and those of CpG-ODN or GpC-ODN or GpG-ODN.
  • Preferred find-me molecules for Method A are ATP and/or UTP.
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel-embedded phosphatidyl-L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, and tolerance-promoting amounts of hydrogel-embedded CpG-ODN or GpC-ODN or GpG-ODN, and b) one or more hydrogel-embedded find- me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen- presenting cells (APC) .
  • PS hydrogel-embedded phosphatidyl-L- serine
  • PS-liposomes phosphatidyl-L- serine
  • hydrogel-embedded CpG-ODN or GpC-ODN or GpG-ODN b) one or more hydrogel-e
  • Method B allows the induction of tolerance via lower amounts of CpG-ODN or Gpc-ODN or GpG-ODN due to direct targeting of dendritic cells and macrophages by the tolerance-promoting eat-me signal phosphatidyl-L-serine on the surface of the CpG- ODN- or GpC-ODN- or GpG-ODN-containing PS-liposomes .
  • uptake of encapsulated CpG-ODN or GpC-ODN or GpG-ODN together with encapsulated T cell peptides by antigen-presenting cells is most efficient and the intracellular concentration of CpG- ODN or GpC-ODN or GpG-ODN in APC is increased significantly.
  • ODN in PS-liposomes allows the application of ODN with a regular phosphodiester backbone which are fully nuclease-susceptible . Thereby, intracellular accumulation of phagocytosed CpG-ODN is prevented.
  • Preferred find-me molecules for Method B are ATP and/or UTP.
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel-embedded phosphatidyl-L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, b) tolerance-promoting amounts of hydrogel-embedded anionic poly (lactic-co-glycolic acid) (PLGA) spheres, and c) one or more hydrogel-embedded find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells (APC) .
  • PS hydrogel-embedded phosphatidyl-L- serine
  • PLGA hydrogel-embedded anionic poly
  • APC antigen-presenting cells
  • Method C provides an approach for amplified induction of tolerance using plain anionic PLGA spheres as tolerance- promoting adjuvant. As demonstrated in several studies, even plain PLGA spheres have the capacity to promote tolerance (for a review, see Getts et al., 2015) . For example, using a murine phospholipase A2- induced allergy model, Jilek et al . (2004) have demonstrated that plain PLGA microspheres (size range of 1-10 ⁇ ) can induce tolerance for as long as 6 months post- sensitization. Preferred find-me molecules for Method C are ATP and/or UTP.
  • plain anionic PLGA spheres Similar to Method A, the addition of plain anionic PLGA spheres to the hydrogel composition provides the advantage that T cell peptides are presented by APC which have been effectively tolerized by two mechanisms including the tolerance-promoting effects of PS- liposomes and those of plain anionic PLGA spheres .
  • the application of plain anionic PLGA spheres as alternative tolerance-promoting adjuvant provides an important advantage in that PLGA spheres are already in clinical use (for a review, see Lii et al . , 2009) .
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel-embedded phosphatidyl -L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, b) one or more hydrogel-embedded tolerance-promoting immune modulators, and c) one or more hydrogel-embedded find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel -embedded components by antigen-presenting cells (APC) .
  • PS phosphatidyl -L- serine
  • PS-liposomes phosphatidyl -L- serine
  • APC antigen-presenting cells
  • Method D provides an approach for enforced induction of tolerance using one or more tolerance-promoting immune modulators.
  • hydrogel -embedded tolerance- promoting immune modulators allows to target in addition to antigen-presenting cells (APC) including dendritic cells and macrophages also other immune cells and, thereby, to extend the tolerizing effect of such molecules.
  • APC antigen-presenting cells
  • DexP dexamethasone phosphate
  • T cells eosinophils, mast cells, and neutrophils.
  • Preferred immune modulators for this approach are NF - KB inhibitors including but not limited to vitamin D3 and analogs thereof with short plasma half- lives such as calcipotriol, and glucocorticoids.
  • NF- ⁇ inhibitors are known to inhibit the maturation process of dendritic cells (DCs) , thereby generating tolerizing DCs which are capable of inducing tolerance-promoting regulatory T cells.
  • Preferred find-me molecules for Method D are ATP and/or UTP.
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel-embedded phosphatidyl-L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, and one or more tolerance-promoting immune modulators, and b) one or more hydrogel-embedded find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells (APC) .
  • PS phosphatidyl-L- serine
  • PS-liposomes phosphatidyl-L- serine
  • APC antigen-presenting cells
  • Method E allows the enforcement of tolerance with relatively low amounts of immune modulators due to direct targeting of dendritic cells and macrophages by the tolerance-promoting eat-me signal phosphatidyl-L-serine on the surface of the immune modulator-containing PS-liposomes .
  • immune modulators for this approach are also NF-KB inhibitors including but not limited to vitamin D3 and analogs thereof with short plasma half- lives such as calcipotriol , and glucocorticoids .
  • Vitamin D3 and analogs thereof are incorporated in the lipid bilayer of PS-liposomes and water- soluble glucocorticoids such as dexamethasone phosphate are encapsulated in PS-liposomes.
  • Preferred find-me molecules for Method E are ATP and/or UTP.
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel-embedded phosphatidyl-L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, b) one or more hydrogel-embedded tolerance-promoting immune modulators, c) tolerance-promoting amounts of hydrogel-embedded ODN (selected from CpG-ODN, GpC-ODN or GpG-ODN) , or tolerance- promoting amounts of hydrogel-embedded plain anionic PLGA spheres, and d) one or more hydrogel-embedded find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by anti
  • Method F provides an approach for most enforced induction of tolerance using one or more tolerance-promoting immune modulators in addition to plain anionic PLGA spheres or oligodeoxynucleotides with CpG or GpC or GpG motifs as tolerance-promoting adjuvant.
  • Preferred immune modulators for this approach are also NF- ⁇ inhibitors including but not limited to vitamin D3 and analogs thereof with short plasma half-lives such as calcipotriol , and glucocorticoids.
  • Method F Since each of the tolerance- inducing mechanisms in Method F including CpG-ODN or GpC-ODN or GpG-ODN, PS- liposomes and NF- B inhibitors targets different receptors, this approach is suited to synergistically induce tolerance in a very efficient manner. Furthermore, the application of hydrogel-embedded tolerance-promoting immune modulators allows to target also other immune cells in addition to APCs and, thereby, to extend the tolerizing effect of such molecules.
  • Preferred find-me molecules for Method F are ATP and/or UTP.
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel-embedded phosphatidyl-L- serine (PS) -presenting liposomes (PS- liposomes) containing one or more food allergen-derived short T cell peptides, and one or more tolerance-promoting immune modulators, b) tolerance- promoting amounts of hydrogel-embedded plain anionic PLGA spheres or tolerance-promoting amounts of hydrogel-embedded CpG-ODN or GpC-ODN or GpG-ODN, and c) one or more hydrogel- embedded find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells (APC) .
  • PS hydrogel-embedded phosphatidyl-L- serine
  • PS- liposomes containing one or more food allergen-derived short T cell peptides,
  • Method G provides also an approach for most enforced induction of tolerance using one or more tolerance-promoting immune modulators in addition to plain anionic PLGA spheres or oligodeoxynucleotides with CpG or GpC or GpG motifs as tolerance-promoting adjuvant.
  • Preferred immune modulators for this approach are also NF- ⁇ inhibitors including but not limited to vitamin D3 and analogs thereof with short plasma half-lives such as calcipotriol , and glucocorticoids.
  • the tolerance-promoting immune modulators are incorporated into the lipid bilayer (e.g., calcipotriol) or encapsulated (e.g., dexamethasone phosphate) in PS- liposomes together with food allergen-derived T cell peptides.
  • This allows the application of lower amounts of immune modulators since PS-liposomal immune modulators are targeted directly to APC.
  • the intracellular concentration of immune modulators in APC is high despite low concentrations in the hydrogel composition.
  • Preferred find-me molecules for Method G are ATP and/or UTP.
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel -embedded phosphatidyl-L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, and one or more tolerance-promoting immune modulators, and tolerance- promoting amounts of hydrogel -embedded CpG-ODN or GpC-ODN or GpG-ODN, and b) one or more hydrogel-embedded find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells (APC) .
  • PS hydrogel -embedded phosphatidyl-L- serine
  • PS-liposomes phosphatidyl-L- serine
  • tolerance-promoting immune modulators and tolerance- promoting amounts of hydrogel -embedded Cp
  • Method H provides another approach for most enforced induction of tolerance.
  • hydrogel-embedded PS-liposomes contain three components, food allergen-derived short T cell peptides, tolerance-promoting immune modulators and tolerance- promoting amounts of oligodeoxynucleotides with CpG or GpC or GpG motifs.
  • tolerance-promoting immune modulators and tolerance- promoting amounts of oligodeoxynucleotides with CpG or GpC or GpG motifs.
  • Preferred immune modulators for this approach are also NF- ⁇ inhibitors including but not limited to vitamin D3 and analogs thereof with short plasma half- lives such as calcipotriol , and glucocorticoids.
  • Preferred find-me molecules for Method H are ATP and/or UTP.
  • thermosensitive hydrogels for a locally restricted but sustained delivery of a) hydrogel -embedded phosphatidyl -L- serine (PS) -presenting liposomes (PS-liposomes) containing one or more food allergen-derived short T cell peptides, and b) one or more hydrogel-embedded find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells (APC) .
  • PS phosphatidyl -L- serine
  • PS-liposomes phosphatidyl -L- serine
  • find-me signals for attracting peripheral DCs and macrophages to the site of the injected hydrogel in order to enhance phagocytosis of hydrogel-embedded components by antigen-presenting cells (APC) .
  • API antigen-presenting cells
  • Method J in another embodiment, the hydrogel -based compositions of Methods A-I are employed without PS-liposomes.
  • compositions are embedded directly in the hydrogel . While the omission of PS-liposomes eliminates a direct targeting effect to APC, Method J provides the advantage of a simplified production and clinical testing procedure.
  • Methods A-J discloses combinations of Methods A-J. All combinations are based on thermosensitive hydrogels for subcutaneous injection, containing at least one or more allergen-derived T cell peptides, either as hydrogel-embedded components or as encapsulated components in hydrogel-embedded PS-liposomes.
  • Additional hydrogel-embedded components are selected from a) one or more find-me molecules, b) one or more tolerance- promoting NF- ⁇ inhibitors, either directly embedded in the hydrogel or as PS- liposomal NF- ⁇ inhibitors, and c) plain anionic PLGA spheres or oligodeoxynucleotides (ODN) with CpG or GpC or GpG motifs as tolerance-promoting adjuvant, wherein the ODN are embedded in the hydrogel either directly or as PS- 1iposoma1 adjuvant .
  • ODN plain anionic PLGA spheres or oligodeoxynucleotides
  • the present invention discloses useful biomarkers for a successful induction of T cell-mediated tolerance by peptide immunotherapy in Phase A. Although these biomarkers have been identified in a recent dose escalation study for subcutaneous auto-antigen-specific tolerance induction (Burton et al . , 2014), they provide also useful biomarkers for the induction of T cell-mediated tolerance in food-allergic patients.
  • the s.c. route of administration proved to be more effective than the intranasal route, with a 1,000-fold lower dose of antigen being effective for anergy induction when compared with previous studies.
  • CD4+ T-cell phenotype has been characterized.
  • the gradual establishment of a regulatory CD4 + T-cell phenotype was characterized by expression of specific negative co- stimulatory molecules and transcription factors, in addition to the regulatory cytokine IL-10, all of which are used as surrogate markers for allergen/autoantigen-specific tolerance induction according to the method of the present invention.
  • Transcription factors previously associated with IL-10 expression include Maf, Ahr and Nfil3 (Pot et al . , 2009; Motomura et al., 2011; Apetoh et al . , 2010).
  • IL-21 contributes to the IL-27-driven production of IL-10 in murine T cells (Pot et al . , 2009) .
  • the most notable correlation with effective immunotherapy was the induction of a set of negative co-stimulatory molecules including PD-1, LAG-3, TIM-3 and TIGIT. Some of these molecules have previously been associated with T cell exhaustion (Wherry, 2011) , while others have been described as markers of IL-10-secreting Trl cells (Gagliani et al . , 2013; Okamura et al., 2009). Burton et al.
  • CD49b (integrin -2) was also found to correlate with IL-10 expression in CD4+ T cells from autoantigen-treated mice; however, within the LAG-3+ CD49b+ population, only 33% of cells were found to express IL-10 (Burton et al . , 2014) .
  • mice were treated every 3-4 days six times s.c. with an escalating dose of autoantigen (escalating from 0.08 ⁇ g to 0.8 ⁇ g and then to 4 x 8 ⁇ g, or escalating from 0.08 /xg to 0.8 ⁇ g and then to 8 ⁇ g and finally to 3 x 80 ⁇ g) .
  • Induction of tolerance was associated with a percentage of CD4+ T cells expressing IL-10, c-Maf or LAG-3 in at least 50% of the cells.
  • TIGIT+ cells A rising percentage of TIGIT+ cells also accumulated during autoantigen-specific immunotherapy (20% of activated CD4 + T cells) .
  • the proportion of cells expressing TIM-3 remained relatively stable throughout the treatment, while the percentage of PD-1 + cells increased upon initial CD4+ T-cell activation and further increased during the later stages of the treatment .
  • T cell-mediated tolerance by peptide immunotherapy in Phase A is considered to be achieved if at least 50% of CD4+ T cells express IL-10, c- Maf or LAG-3 , and the percentage of PD-1 + cells and TIGIT+ cells in the CD4+ T cell population has increased significantly.
  • the present invention discloses therapeutic protocols for the treatment of food allergy by combining subcutaneous hydrogel-based immunotherapy with food allergen-derived T cell epitope-containing peptides (Phase A) and OIT or sublingual immunotherapy with intact food allergens (Phase B) .
  • Subcutaneous immunotherapy with allergen-derived peptides is performed first to decrease disease-promoting effector T cells and to increase tolerance-promoting regulatory T cells (Tregs) , thereby re-directing the T cell status towards tolerance.
  • OIT or sublingual immunotherapy with intact food allergens is performed thereafter to induce the generation of protective allergen-specific antibodies and to further enhance the development of a tolerogenic T and B cell status.
  • OIT or sublingual immunotherapy with intact food allergens in Phase B is performed as described in the literature including an escalating up-dosing phase and a subsequent maintenance phase (for reviews, see Uyenphuong and Burks, 2014; Vazquez-Ortiz and Turner, 2016).
  • the combination of subcutaneous immunotherapy with food allergen-derived T cell peptides and subsequent oral (OIT) or sublingual (SLIT) immunotherapy with intact food allergens has the potential to minimize adverse reactions. Although reactions are generally mild, the risk of anaphylactic reactions for each patient is substantial, given that doses are orally administered daily over an extended period of treatment .
  • the combination with a prior subcutaneous immunotherapy with food allergen- derived T cell peptides has the potential to increase the therapeutic efficacy of sublingual food allergen-specific immunotherapy significantly and, thereby, to make the SLIT approach for food allergy an attractive alternative to oral immunotherapy (OIT) .
  • OIT oral immunotherapy
  • the SLIT approach does not appear to be suitable for the treatment of food allergy since the increase in amount of food allergen that can be tolerated following SLIT is modest and significantly lower than that achievable with OIT (for a review, see Vazquez-Ortiz and Turner, 2016) .
  • the treatment in Phase A is performed in monthly intervals by 4 to 6 subcutaneous injections of increasing doses of hydrogel-embedded PS- liposomes containing short allergen-derived T cell peptides.
  • the first subcutaneously injected hydrogel composition may contain 50 ⁇ g of T cell peptides encapsulated in PS-liposomes, tolerance-promoting amounts of CpG-ODN, and sub-micromolar concentrations of ATP and UTP.
  • the first subcutaneously injected hydrogel composition may contain 50 ⁇ g of T cell peptides encapsulated in PS-liposomes, tolerance-promoting amounts of CpG-ODN, and sub-micromolar concentrations of ATP and UTP.
  • the second hydrogel composition may contain 100 ⁇ g of T cell peptides encapsulated in PS-liposomes, CpG-ODN, ATP and UTP.
  • the third hydrogel composition may contain 200 ⁇ g of T cell peptides encapsulated in PS-liposomes, CpG-ODN, ATP and UTP, and the fourth hydrogel composition may contain 300 ⁇ g of T cell peptides encapsulated in PS-liposomes, CpG-ODN, ATP and UTP.
  • the last two hydrogel compositions are identical with the fourth hydrogel composition. Hydrogel compositions containing 300 ⁇ g of T cell peptides in PS-liposomes release approx. 45 g of T cell peptides during the first 24 hours and approx. 105 ⁇ g of T cell peptides during the first 48 hours.
  • each injected hydrogel composition contains an amount of 100-600 ⁇ g liposomal peptides. In a preferred embodiment, each injected hydrogel composition contains an amount of 200-400 ⁇ g of liposomal peptides. In a more preferred embodiment, each injected hydrogel composition contains an amount of 300 ⁇ g of liposomal peptides
  • all subcutaneously injected hydrogel compositions may contain 300 g of T cell peptides encapsulated in PS-liposomes, tolerance-promoting amounts of CpG-ODN, and sub-micromolar concentrations of ATP and UTP.
  • Such hydrogel compositions release approx. 45 g of T cell peptides during the first 24 hours and approx. 105 ⁇ g of T cell peptides during the first 48 hours.
  • EXAMPLE 1 SYNTHESIS OF PL6A-PEG-PLGA HYDROGELS
  • the biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed according to published protocols (Qiao et a.1. , 2005) .
  • Polyethylene glycol (PEG 1000) is purchased from Fluka, poly (DL-lactide) from Sigma, glycolide (1, 4-Dioxane-2, 5-dione) from Sigma, and stannous 2- ethylhexanoate from Aldrich.
  • a total of 25 g of DL-lactide, glycolide and PEG are used for polymerization (16.6 g DL-lactide, 0.9 g glycolide, 7.5 g PEG 1000) (PLG/PEG weight ratio of 70/30 (2.3)) .
  • PEG 1000 is dried under vacuum and stirring at 120°C for 2 h in a vigorously dried Erlenmeyer reaction flask. Then the reaction flask is filled with dry argon.
  • DL-lactide and gycolide monomers are added under stirring followed by the addition of Stannous 2 -ethylhexanoate (0.2% w/w) . Then the tube is sealed under argon.
  • the sealed flask is immersed and kept in an oil bath thermostated at 130°C. After approx. 16 h the flask is cooled to room temperature, and the product is dissolved in cold water. After completely dissolved, the copolymer solution is heated to 80°C to precipitate the copolymer and to remove the water-soluble low molecular weight copolymers and unreacted monomers. The supernatant is decanted, the precipitated copolymer is again dissolved in cold water followed by heating to induce precipitation. This process of dissolution followed by precipitation is repeated three times. Alternatively the polymer can be dissolved in acetonitrile , sterile filtered, and precipitated by mixing with sterile water and heating. Finally, the copolymer is dried under vacuum at room temperature until constant weight.
  • the molecular weight of the copolymer is determined by gel permeation chromatography using polystyrene standards as described by Qiao et al . (2005) .
  • Figure 8 shows a representative GPC analysis of the copolymer of Example 1.
  • the gelation temperature is determined as described by Qiao et al . (2005) A 2 ml transparent vial is filled with 200 ⁇ water solution of the copolymer (20% w/w and 25% w/w) , is placed in a water bath. The solution is heated in 1°C steps beginning at 26 °C in a thermomixing device (Eppendorf) . At each temperature step the gelation is checked by careful inversion of the tube. When the solution is not free- flowing, gelation of the solution occurred, the temperature read from the thermometer is determined as gelation temperature.
  • Figure 9 shows the gelling temperature of the copolymer of Example 1 in dependence of the polymer concentration.
  • EXAMPLE 2 SYNTHESIS OF PS-LIPOSOMES
  • This example describes the synthesis of unilamellar PS- liposomes from a lipid mixture of phosphatidyldserine (PS) (either 1, 2-dipalmitoyl-sn-glycero-3-phospho-L-serine sodium salt (Sigma-Aldrich) , l-palmitoyl-2-oleoyl-sn-3-glycerophospho -L-serine (POP-L-S) , or bovine brain phosphatidyldserin (Avanti Polar Lipids)), phosphatidylcholine (PC) (either 1,2- dipalmitoyl-sn-glycero-3-phosphocholine (DMPC; Sigma-Aldrich) , l-palmitoyl-2-oleoyl-sn-3 -glycerophosphocholine (POPC; Avanti Polar Lipids) , or egg phosphatidylcholine (egg-PC; Avanti Polar Lipid
  • a chloroform/methanol (2:1, v/v) solution containing 30 pmol PS (approx. 22.7 mg) , 30 mol PC (approx. 22.0 mg) and 40 mol CH (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.7 ml of phosphate- buffered saline (PBS) is added (approx. 35 mg total lipid/ml) and multilamellar vesicles are generated by intense vortex dispersion.
  • PBS phosphate- buffered saline
  • the multilamellar preparation is extruded 10 times through a 1 m pore polycarbonate membrane (Nucleopore, USA) .
  • PS- liposomes with a particle size of approx. 1 m are suitable for efficient uptake by macrophages (Harel-Adar et al., 2011).
  • the liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes.
  • the final liposomal suspension contains approx. 59 ⁇ (approx.
  • the degree of PS exposure on liposomes is assessed by binding of FITC-annexin V to surface-exposed PS and subsequent analysis by FACS.
  • EXAMPLE 3 SYNTHESIS OF PS-LIPOSOMES CONTAINING OVALBUMIN (OVA) -DERIVED PEPTIDES
  • This example describes the synthesis of unilamellar PS- liposomes containing three OVA-derived peptides according to the method of Example 2.
  • OVA-derived peptides Three peptide sequences of OVA have been identified as immunodominant T cell determinants in the BALB/c mouse (Yang and Mine, 2008) . Subcutaneous immunotherapy with a cocktail of these peptides significantly decreased anaphylactic responses in OVA- sensitized mice upon oral challenge with a high dose of OVA (Yang et al . , 2010) .
  • AMVYLGAKDSTRTQI OVA region 39-53 (MW 1653.9) good water solubility
  • SWVESQTNGIIRNVL OVA region 147-161 (MW 1715.9) poor water solubility
  • the optimal peptide length of 15 aa was determined primarily based on the binding characteristics defined for BALB/c major histocompatibility complex (MHC) (H2d) class II molecules (Zhang et al . , 2005). Synthesis .
  • a conical flask 15.5 mg is placed in a conical flask and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.7 ml of phosphate-buffered saline (PBS) is added containing 8.5 mg of a peptide cocktail (5.0 mg/ml) comprising 3.4 mg of peptide 1 (2.0 mg/ml), 1.7 mg of peptide 2 (1.0 mg/ml), and 3.4 mg of peptide 3 (2.0 mg/ml).
  • PBS phosphate-buffered saline
  • Multilamellar vesicles are generated by intense vortex dispersion.
  • the multilamellar preparation is extruded 10 times through a 1 pm pore polycarbonate membrane (Nucleopore, USA) .
  • the liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes.
  • residual unincorporated peptides that have not been removed by the centrifugation step may be removed by subsequent size exclusion chromatography on a Sephadex G50 column. Analysis of the encapsulation efficiency.
  • the concentration of encapsulated peptides is determined after dissolution of the liposomes in 1% (v/v) Triton X-100 by a colorimetric peptide assay (Thermo Fisher Scientific) providing a linear range of
  • the final liposomal suspension contains approx. 59 pmol (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) and approx. 1.5 mg/ml OVA-derived peptides (based on 30% encapsulation efficiency) , comprising approx. 600 ⁇ g/ml OVA peptide 1, approx. 300 g/ml OVA peptide 2, and approx. 600 ⁇ g/ml OVA peptide 3.
  • EXAMPLE 4 SYNTHESIS OF PS-LIPOSOMES CONTAINING OVALBUMIN- DERIVED PEPTIDES AND CALCIPOTRIOL
  • This example describes the synthesis of unilamellar PS- liposomes containing bilayer-incorporated calcipotriol (Tocris Bioscience, UK) and encapsulated OVA-derived peptides according to the method of Example 3.
  • Calcipotriol molecules are incorporated into the lipid bilayer and intercalate between the hydrocarbon chains of phospholipid molecules (Merz and Sternberg, 1994) .
  • calcipotriol for incorporation into liposomes made of DMPPC or egg-PC in a molar ratio of calcipotriol (MW 412.6) to lipid of 0.03 to 1
  • incorporation rates of more than 80% have been reported (Merz and Sternberg, 1994) . Since in this example, a two- fold lower molar ratio of calcipotriol to lipid of 0.015 to 1 is used, the incorporation rate is slightly higher.
  • a chloroform/methanol (2:1, v/v) solution containing 30 pmol phosphatidylserine (PS) (approx. 22.7 mg) , 30 pmol phosphatidylcholine (PC) (approx. 22.0 mg) and 40 ⁇ cholesterol (CH) (approx. 15.5 mg) is placed in a conical flask, mixed with a stock solution of calcipotriol in methanol (10 mg/ml) in a molar ratio of calcipotriol to lipid of 0.015 to 1.0 (620 pg calcipotriol corresponding to approx. 1.5 ⁇ ) , and dried by rotary evaporation to prepare a thin lipid film.
  • PS pmol phosphatidylserine
  • PC 30 pmol phosphatidylcholine
  • CH 40 ⁇ cholesterol
  • phosphate-buffered saline PBS
  • a peptide cocktail (see Example 3) comprising 3.4 mg of peptide 1 (2.0 mg/ml), 1.7 mg of peptide 2 (1.0 mg/ml), and 3.4 mg of peptide 3 (2.0 mg/ml) .
  • Multilamellar vesicles are generated by intense vortex dispersion.
  • the multilamellar preparation is extruded 10 times through a 1 ⁇ pore polycarbonate membrane (Nucleopore, USA) .
  • the liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes.
  • residual unincorporated peptides that have not been removed by the centrifugation step may be removed by subsequent size exclusion chromatography on a Sephadex G50 column.
  • the calcipotriol concentration in the liposomal suspensions is determined by UV absorption at 252 nm (molar extinction coefficient of 42,000; Plum et al., 2004) after dissolution of the liposomes in ethanol.
  • the calcipotriol concentration in the liposomal suspensions can be determined by reversed phase HPLC using a C18-column and acetonitrile : water (77:23) as elution agent (Cirunay et al . , 1998). Calcipotriol is detected by UV absorption at 263 nm.
  • the concentration of encapsulated peptides is determined after dissolution of the liposomes in 1% (v/v) Triton X-100 by a colorimetric peptide assay (Thermo Fisher Scientific) providing a linear range of 15-1000 ⁇ g/ml .
  • the final liposomal suspension contains approx. 59 ⁇ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 310 ⁇ g (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate), and approx. 1.5 mg OVA- derived peptides/ml (based on 30% encapsulation efficiency) , comprising approx. 600 ⁇ g/ml OVA peptide 1, approx. 300 ⁇ g/ml OVA peptide 2, and approx. 600 ⁇ g/ml OVA peptide 3.
  • EXAMPLE 5 SYNTHESIS OF PS-LIPOSOMES CONTAINING OVA-DERIVED PEPTIDES AND CpG-ODN This example describes the synthesis of unilamellar PS- liposomes containing encapsulated PO CpG-ODN 1826 ( 5 ' - TCCATGACGTTCCTGACGT - 2 " ; MW approx. 6059) with a natural phosphodiester backbone (PO CpG-ODN 1826) and encapsulated OVA-derived peptides according to the method of Example 3.
  • CpG-ODN 1826 with a nuclease-resistant phosphorothioate backbone (PS CpG-ODN 1826) and CpG-ODN 1826 with a natural phosphodiester backbone (PO CpG-ODN 1826) are encapsulated with comparable efficiencies in large unilamellar liposomes (composed of distearoyl-phosphatidylcholine (DSPC) and cholesterol (chol) at a molar ratio of 2:1) .
  • DSPC distearoyl-phosphatidylcholine
  • chol cholesterol
  • Example 5 the ODN to lipid ratio of approx. 1:40 (2.5 ⁇ CpG-ODN 1826/100 ⁇ lipid) is similar to the conditions applied by Konur et al . (2008) . Synthesis .
  • a chloroform/methanol (2:1, v/v) solution containing 30 pmol phosphatidylserine (PS) (approx. 22.7 mg) , 30 ⁇ phosphatidylcholine (PC) (approx. 22.0 mg) and 40 ⁇ cholesterol (CH) (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipid film.
  • PS pmol phosphatidylserine
  • PC 30 ⁇ phosphatidylcholine
  • CH cholesterol
  • the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.5 ml PBS containing 15.0 mg of PO CpG-ODN 1826 (approx. 2.5 ⁇ ) and 1.7 ml PBS containing 8.5 mg of a peptide cocktail (see example 3) comprising 3.4 mg of peptide 1 (2.0 mg/ml) , 1.7 mg of peptide 2 (1.0 mg/ml), and 3.4 mg of peptide 3 (2.0 mg/ml) .
  • a peptide cocktail see example 3
  • Multilamellar vesicles are generated by intense vortex dispersion.
  • the multilamellar preparation is extruded 10 times through a 1 ⁇ pore polycarbonate membrane (Nucleopore, USA) .
  • the liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes.
  • residual un- incorporated CPG-ODN and OVA-derived peptides may be removed by subsequent size exclusion chromatography on a Sephadex G50 column.
  • the encapsulation efficiency of CpG-ODN 1826 is determined by generating a standard curve of free PO CpG-ODN 1826. All samples and standards contain normalized lipid amounts and the detergent C12E8 (dodecyl octaethylene glycol ether; Sigma-Aldrich) at a final concentration of 1%. Thereafter, SYBR Green I (Invitrogen) is added to the plate at a final dilution of 1:15,000 and the fluorescence quantified in a fluorescence plate reader using an excitation of 485 nra and emission of 528 nm.
  • the concentration of encapsulated peptides is determined after dissolution of the liposomes in 1% (v/v) Triton X-100 by a colorimetric peptide assay (Thermo Fisher Scientific) providing a linear range of 15-1000 ⁇ g/ml .
  • the final liposomal suspension contains approx. 59 ⁇ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 0.9 mg/ml of encapsulated PO CpG-ODN 1826 (approx. 150 nmol) , corresponding to an encapsulation efficiency of approx. 10%, and approx. 1.5 mg OVA-derived peptides/ml (based on 30% encapsulation efficiency) , comprising approx. 600 ⁇ g/ml OVA peptide 1, approx. 300 g/ml OVA peptide 2, and approx. 600 ⁇ g/ml OVA peptide 3.
  • thermogelling PLGA-PEG-PLGA hydrogels containing either empty or loaded phosphatidylserine (PS) -liposomes This example describes the synthesis and characterization of thermogelling PLGA-PEG-PLGA hydrogels containing either empty or loaded phosphatidylserine (PS) -liposomes .
  • Synthesis of PLGA-PEG-PLGA hydrogels The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed and characterized as described in example 1. Synthesis of empty PS-liposomes. PS-liposomes are prepared as described in Example 2. The final liposomal suspension contains approx. 59 ⁇ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) .
  • PS-liposomes loaded with OVA-derived peptides are prepared as described in Example 3.
  • the final liposomal suspension contains approx. 59 pmol (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) and approx. 1 mg OVA-derived peptides/ml (based on 40% encapsulation efficiency) .
  • PS-liposomes loaded with OVA-derived peptides and calcipotriol are prepared as described in Example 4.
  • the final liposomal suspension contains approx. 59 ymol (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 310 g (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate) , and approx. 1 mg OVA-derived peptides/ml (based on 40% encapsulation efficiency) .
  • PS-liposomes loaded with OVA-derived peptides and PO CpG-ODN 1826 are prepared as described in Example 5.
  • the final liposomal suspension contains approx. 59 ⁇ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 1.5 mg encapsulated PO CpG-ODN 1826 (approx. 0.247 ⁇ mol)/ml, corresponding to an encapsulation efficiency of approx. 10%, and approx. 1 mg OVA-derived peptides/ml (based on 40% encapsulation efficiency) .
  • Preparation of hydrogel/PS-liposome compositions Preparation of hydrogel/PS-liposome compositions.
  • Different concentrations of the PLGA-PEG-PLGA copolymer of Example 1 (22.5% w/w, and 30% w/w) in water are mixed with liposomal suspensions in PBS of example 2 at a ratio of two volumes hydrogel solution to one volume of liposomal suspension.
  • the final concentration of the hydrogel is 15% (w/w) or 20% (w/w) containing empty or loaded PS-liposomes at a concentration of approx. 20 ymol (12 mg) of lipid/ml.
  • Liposomal OVA-derived peptides are present at a concentration of approx. 330 ⁇ g/ml 7 liposomal calcipotriol at a concentration of approx. 103 ⁇ (250 nmol) calcipotriol/ml , and liposomal PO CpG-ODN 1826 at a concentration of approx. 500 (approx. 83 nmol) /ml.
  • the gelation temperature of hydrogel/PS-liposome compositions is determined as described by Qiao et al . (2005).
  • Transparent vials are filled with 200 ⁇ water containing different concentrations of the copolymer (22.5% w/w, and 30% w/w), cooled to 4°C and mixed with 100 ⁇ PBS containing empty or loaded PS-liposomes or 100 ⁇ PBS containing no liposomes.
  • the final concentration of the copolymer is 15% (w/w) and 20% (w/w) containing liposomes at a concentration of approx. 20 pmol (12 mg) of lipid/ml.
  • hydrogel/PS-liposome compositions The in vitro degradation behavior of hydrogel/PS-liposome compositions is evaluated by the mass loss and/or the molecular weight reduction with time upon incubation in PBS.
  • Samples (0.2 ml) are incubated in PBS , pH 7.4, at 37°C under mild agitation in a water bath.
  • the solid residues are removed from the incubation medium at scheduled time intervals and lyophilized.
  • the samples are weighted and the weight loss is calculated.
  • the solid residues are solved in cold water and analyzed by gel permeation chromatography using polystyrene standards as described by Qiao et al . (2005) .
  • This example describes the in vitro release characteristics of PS-Liposomes with encapsulated FITC-BSA from thermogelling PLGA-PEG-PLGA hydrogels.
  • thermogelling PLGA-PEG-PLGA hydrogels The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed as described in Example 1.
  • FITC-BSA-containing PS-liposomes A chloroform/methanol (2:1, v/v) solution containing 30 mol phosphatidylserine (PS) (approx. 22.7 mg) , 30 ymol phosphatidylcholine (PC) (approx. 22.0 mg) and 40 ymol cholesterol (CH) (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent.
  • PS mol phosphatidylserine
  • PC ymol phosphatidylcholine
  • CH ymol cholesterol
  • FITC-BSA FITC- labeled bovine serum albumin
  • FITC-BSA FITC-labed bovine serum albumin
  • the liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.5 ml of PBS and vortexed to resuspend the liposomes.
  • the final liposomal suspension contains approx. 66.7 mol (40.1 mg) of lipid/1.0 ml.
  • the amount of encapsulated FITC-BSA in liposomes is determined by dissolving the lipid vesicles with 1% (v/v) Triton X-100 and monitoring the absorbance of FITC-BSA at 495 nm. Using the conditions of this example, the encapsulation efficacy is 22% (220 ⁇ g FITC-BSA/ml PS- liposome suspension) .
  • FITC-BSA-containing PS-liposomes In vitro release of FITC-BSA-containing PS-liposomes from hydrogel/liposome compositions.
  • the in vitro release of FITC- BSA-containing PS-liposomes from hydrogel/PS-liposome compositions is determined after gelling of the hydrogel/PS- liposome compositions at 37°C by monitoring the supernatant for the development of absorbance at 495 nm in the presence of Triton X-100.
  • Vials are filled with 200 ⁇ water containing different concentrations of the copolymer (22.5% w/w, and 30% w/w) , cooled to 4°C and mixed with 100 ⁇ PBS containing FITC-BSA- loaded PS- liposomes .
  • the final concentrations of the copolymer are 15% (w/w) and 20% (w/w) containing PS-liposomes with encapsulated FITC-BSA at a concentration of 22.2 pmol lipid/ml (13.3 mg/ml) .
  • the reaction mixtures are incubated at 37°C under mild agitation in a water bath until gelling.
  • thermogelling PLGA-PEG-PLGA hydrogels for attraction of peripheral antigen-presenting cells to the injection site of hydrogel-based compositions.
  • thermogelling PLGA-PEG-PLGA hydrogels The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1.
  • the synthesis is performed as described in Example 1.
  • In vitro release of ATP from PLGA-PEG-PLGA hydrogels An aliquot of 20 ⁇ of a 10 mM solution of ATP is combined with 160 ⁇ of 25% hydrogel solution and 20 ⁇ of lOx PBS (final concentration of ATP: 1 mM) . The mixture is incubated for 2 minutes at 37°C to induce gelling and overlayed with 1 ml of PBS.
  • the supernatant is removed by pipetting and stored at 4°C.
  • the removed supernatant is replaced by fresh 1 ml of PBS.
  • the samples are measured at 260 nm and the amount of released ATP is calculated as percentage of a reference sample containing a concentration of ATP equaling 100% release.
  • EXAMPLE 9 RELEASE OF LIPOSOME-EMBEDDED OLIGODEOXYNUCLEOTIDES (ODN) FROM GELLED HYDROGELS
  • thermogelling PLGA-PEG-PLGA hydrogels This example describes the release of oligodeoxynucleotides complexed with a cationic liposomal preparation (Cellfectin II; Life Technologies, USA) from thermogelling PLGA-PEG-PLGA hydrogels.
  • the liposomal preparation contains the cationic lipids tetramethyltetra-palmitylspermine and dioleoyl- phosphatidyl-ethanolamine .
  • thermogelling PLGA-PEG-PLGA hydrogels The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. The synthesis is performed as described in Example 1.
  • a 22-mer ODN (sequence: agaatttttagtgtatgtacaa) at a concentration of 1.0 mM in 200 ml PBS, pH 7.4, is mixed with 20 ml of Cellfectin II in PBS, pH 7.4 (1 mg/ml) and incubated for a 15 min incubation at room temperature .
  • hydrogel-ODN/Cellfectin compositions Preparation of hydrogel-ODN/Cellfectin compositions.
  • the PLGA- PEG-PLGA triblock copolymer of Example 1 is dissolved at room temperature in water at a concentration of 30% w/v polymer, followed by the addition of 20 ml lOxPBS and 13 ml of ODN/Cellfectin complexes to 167 ml gel solution.
  • ODN/Cellfectin complexes from PLGA-PEG-PLGA.
  • the formulation is placed in a 2 ml vial, incubated at 37 °C for 2 min until gelling, and 1.8 ml of PBS, pH 7.4, is added.
  • the vial is incubated at 37°C.
  • the supernatant is withdrawn and replaced by an identical volume of PBS pH 7.4 to maintain release conditions.
  • EXAMPLE 10 SYNTHESIS OF HYDROGEL COMPOSITION A FOR THE TREATMENT OF OVA- LLERGIC MICE ( (NON-LIPOSOMAL COMPOSITION A)
  • This example describes the synthesis of PLGA-PEG-PLGA hydrogel compositions comprising hydrogel-embedded OVA-derived peptides, hydrogel-embedded B class CpG-ODN 1826 containing a full phosphorothioate backbone, and hydrogel-embedded ATP and UTP for the treatment of OVA-sensitized mice.
  • OVA-derived peptides Three peptide sequences of OVA identified as immunodominant T cell determinants in the BALB/c mouse (Yang and Mine, 2008) , are used as cocktail in this experiment. The primary sequence of these peptides are:
  • AMVYLGAKDSTRTQI OVA region 39-53 (MW 1653.9) good water solubility
  • SWVESQTNGIIRNVL OVA region 147-161 (MW 1715.9) poor water solubility
  • the optimal peptide length of 15 aa was determined on the binding characteristics defined for BALB/c major histocompatibility complex (MHC) (H2d) class II molecules (Zhang et al., 2005).
  • MHC major histocompatibility complex
  • OVA-sensitized BALB/c mice were treated by subcutaneous injection of 300 ⁇ g of a mixture of three OVA-derived T cell peptides (each peptide: 100 ⁇ g) in PBS three times weekly for a period of 3 weeks (900 ⁇ g of peptides/week) .
  • the hydrogel composition of each subcutaneous injection (300 ⁇ of a 15% w/v PLGA-PEG-PLGA hydrogel composition in three 100 ⁇ aliquots) contains 100 g of peptide 1 (40 ⁇ of 2.5 mg/ml PBS), 100 ⁇ g of peptide 3 (40 ⁇ of 2.5 mg/ml PBS), and 50 ⁇ g of peptide 2 (50 ⁇ of 1 mg/ml PBS) .
  • the 20-mer class B CpG-ODN 1826 (MW 6364; 5' - tccatgacgttcctgacgtt- 3 ' ) containing a full phosphorothioate backbone (specific for murine TLR9) is used.
  • Treatment with CpG-ODN 1826 was performed by intraperitoneal injection of 30 ⁇ g of class B CpG-ODN 1826 (approx. 4.7 nmol; MW approx. 6364) per mouse twice, on the same days as the first and second administration of Aspergillus fumigatus culture filtrate extract.
  • each subcutaneous hydrogel injection 300 ⁇ of a 15% w/v PLGA-PEG-PLGA hydrogel composition in three 100 ⁇ aliquots
  • ATP and UTP are important to restrict the concentration of released ATP and/or UTP to the nanomolar range since extracellular nucleotides at concentrations of more than 1 ⁇ are considered proinflammatory ( ono and Rock, 2008) . Therefore, for therapeutic applications PLGA-PEG-PLGA hydrogels are loaded with ATP and/or UTP at a concentration of approx. 1 ⁇ . Thereby, the concentration of released nucleotides will not exceed the critical limit of 1 ⁇ , since within the first hour only approx. 20% of embedded nucleotides are released, followed by another 10% with the next hour and decreasing percentages during the following hours.
  • the hydrogel composition of each subcutaneous injection contains 0.3 nmol ATP (5 ⁇ of a 60 ⁇ solution in PBS) and 0.3 nmol UTP (5 ⁇ of a 60 ⁇ solution in PBS) .
  • PLGA-PEG-PLGA hydrogel composition A comprising OVA-derived peptides, CpG-ODN, ATP and UTP.
  • the PLGA-PEG-PLGA triblock copolymer of Example 1 dried under vacuum at room temperature until constant weight, is dissolved at 4°C in PBS at a concentration of 30% w/v polymer, and then mixed with OVA-derived peptides, CpG-ODN 1826, ATP and UTP.
  • the hydrogel composition of each subcutaneous injection contains a) 150 ⁇ of a 30% w/v PLGA-PEG-PLGA solution in PBS, b) 40 ⁇ (100 ⁇ g) of OVA peptide 1 (2.5 mg/ml PBS), c) 50 ⁇ (50 ⁇ g) of OVA peptide 2 (1 mg/ml PBS) , d) 40 ⁇ (100 ⁇ g) of OVA peptide 3 (2.5 mg/ml PBS), e) 10 ⁇ (40 g) of class B CpG-ODN 1826 (4.0 mg/ml PBS), f) 5 ⁇ (0.3 nmol) of ATP (60 ⁇ in PBS), and g) 5 ⁇ (0.3 nmol) of UTP (60 ⁇ in PBS) .
  • the final concentration of the hydrogel is 15% (w/w) containing in 300 ⁇ a) 100 ⁇ g OVA peptide 1, b) 50 g OVA peptide 2, c) 100 ⁇ g OVA peptide 3, d) 40 ⁇ g of class B CpG- ODN 1826, e) 0.3 nmol ATP (1 ⁇ ) , and f) 0.3 nmol UTP (1 ⁇ ) .
  • EXAMPLE 11 SYNTHESIS OF HYDROGEL COMPOSITION B FOR THE TREATMENT OF OVA-ALLERGIC MICE (LIPOSOMAL PEPTIDE COMPOSITION B)
  • This example describes the synthesis of PLGA-PEG-PLGA hydrogel compositions B comprising hydrogel-embedded PS-liposomes containing encapsulated OVA-derived peptides, hydrogel- embedded B class CpG-ODN 1826 containing a full phosphorothioate backbone, and hydrogel-embedded ATP and UTP for the treatment of OVA-sensitized mice.
  • OVA-derived peptides encapsulated in PS-liposomes .
  • encapsulation of three OVA-derived peptides in PS-liposomes resulted in a final liposomal suspension which contains approx. 59 ⁇ (approx. 35 mg) of lipid/ml (59 m liposomal suspension) and approx. 1.5 mg/ml OVA-derived peptides (based on 30% encapsulation efficiency) , comprising 600 ⁇ g/ml OVA peptide 1, 300 ⁇ g/ml OVA peptide 2, and 600 ⁇ g/ml OVA peptide 3.
  • the hydrogel composition of each subcutaneous injection (300 ⁇ of a 15% w/v PLGA-PEG-PLGA hydrogel composition in three 100 ⁇ aliquots) contains 130 ⁇ of liposomal OVA peptides comprising approx. 4.6 mg of lipid, approx. 80 g of OVA peptide 1, approx. 40 g of OVA peptide 2, and approx. 80 g of OVA peptide 3 (total of approx. 200 ⁇ g of OVA-derived peptides) .
  • the 20-mer class B CpG-ODN 1826 (MW 6364; 5' -tccatgacgttcctgacgtt-3' ) containing a full phosphorothioate backbone (specific for murine TLR9) is used.
  • the hydrogel composition of each subcutaneous injection (300 ⁇ of a 15% w/v PLGA-PEG-PLGA hydrogel composition in three 100 ⁇ aliquots) contains 40 ⁇ g of class B CpG-ODN 1826 (10 ⁇ of a 4.0 mg/ml solution in PBS) . ATP and UTP .
  • the hydrogel composition of each subcutaneous injection (300 ⁇ of a 15% w/v PLGA-PEG-PLGA hydrogel composition in three 100 ⁇ aliquots) contains 0.3 nmol ATP (5 ⁇ of a 60 ⁇ solution in PBS) and 0.3 nmol UTP (5 ⁇ of a 60 ⁇ solution in PBS) .
  • PLGA-PEG-PLGA hydrogel composition B comprising liposomal OVA-derived peptides, CpG-ODN, ATP and UTP.
  • the PLGA-PEG-PLGA triblock copolymer of Example 1 dried under vacuum at room temperature until constant weight, is dissolved at 4°C in PBS at a concentration of 30% w/v polymer, and then mixed with liposomal OVA-derived peptides, CpG-ODN 1826, ATP and UTP.
  • the hydrogel composition of each subcutaneous injection contains a) 150 ⁇ of a 30% w/v PLGA-PEG- PLGA solution in PBS, b) 130 ⁇ of liposomal OVA-derived peptides (approx. 4.6 mg of lipid, approx. 80 ⁇ g of OVA peptide 1, approx. 40 ⁇ g of OVA peptide 2, and approx. 80 ⁇ g of OVA peptide 3 (total of approx.
  • the final concentration of the hydrogel is 15% (w/w) containing in 300 ⁇ a) approx. 80 ⁇ g liposomal OVA peptide 1, b) approx. liposomal 40 ⁇ g OVA peptide 2, c) approx. liposomal 80 ⁇ g OVA peptide 3, d) 40 ⁇ g of class B CpG-ODN 1826, e) 0.3 nmol ATP (1 ⁇ ) , and f) 0.3 nmol UTP (1 ⁇ ) .
  • EXAMPLE 12 SYNTHESIS OF HYDROGEL COMPOSITION C FOR THE TREATMENT OF OVA-ALLERGIC MICE (LIPOSOMAL PEPTIDE-CpG ODN COMPOSITION C)
  • This example describes the synthesis of PLGA-PEG-PLGA hydrogel compositions C comprising hydrogel -embedded PS- liposomes containing encapsulated OVA-derived peptides and PO CpG-ODN 1826, and hydrogel -embedded ATP and UTP for the treatment of OVA- sensitized mice.
  • OVA-derived peptides and PO CpG-ODN 1826 encapsulated in PS- liposomes are used.
  • the three OVA-derived peptides of Example 3 and PO CpG-ODN 1826 ( 5 ' -TCCATGACGTTCCTGACGTT- 3 ' ; MW approx. 6059) with a natural phosphodiester backbone of Example 5 are used.
  • the hydrogel composition of each subcutaneous injection (300 ⁇ of a 15% w/v PLGA-PEG-PLGA hydrogel composition in three 100 ⁇ aliquots) contains 130 ⁇ of liposomal OVA peptides comprising approx. 4.6 mg of lipid, approx. 80 ⁇ g of OVA peptide 1, approx. 40 ⁇ g of OVA peptide 2, approx. 80 ⁇ g of OVA peptide 3 (total of approx. 200 g of OVA-derived peptides) , and approx. 115 ⁇ g of encapsulated PO CpG-ODN 1826 (approx. 19 nmol) .
  • the hydrogel composition of each subcutaneous injection (300 ⁇ of a 15% w/v PLGA-PEG-PLGA hydrogel composition in three 100 ⁇ aliquots) contains 0.3 nmol ATP (5 ⁇ of a 60 ⁇ solution in PBS) and 0.3 nmol UTP (5 ⁇ of a 60 ⁇ solution in PBS) .
  • PLGA-PEG-PLGA hydrogel composition B comprising liposomal OVA-derived peptides, CpG-ODN, ATP and UTP .
  • the PLGA-PEG-PLGA triblock copolymer of Example 1 dried under vacuum at room temperature until constant weight, is dissolved at 4°C in PBS at a concentration of 30% w/v polymer, and then mixed with liposomal OVA-derived peptides and CpG-ODN 1826, ATP and UTP.
  • the hydrogel composition of each subcutaneous injection contains a) 150 ⁇ of a 30% w/v PLGA-PEG-PLGA solution in PBS, b) 130 ⁇ of liposomal OVA-derived peptides and PO CpG- ODN 1826 (approx. 4.6 mg of lipid, approx. 80 ⁇ g of OVA peptide 1, approx. 40 ⁇ g of OVA peptide 2, and approx. 80 ⁇ g of OVA peptide 3 (total of approx. 200 ⁇ g of OVA-derived peptides) , and approx. 115 ⁇ g of encapsulated PO CpG-ODN 1826 (approx. 19 nmol) , c) ) 5 ⁇ (0.3 nmol) of ATP (60 ⁇ in PBS), and d) 5 ⁇ (0.3 nmol) of UTP (60 ⁇ in PBS).
  • the final concentration of the hydrogel is 15% (w/w) containing in 300 ⁇ a) approx. 80 ⁇ g liposomal OVA peptide 1, b) approx. liposomal 40 ⁇ g OVA peptide 2, c) approx. liposomal 80 g OVA peptide 3, d) approx. liposomal 115 ⁇ g of PO CpG-ODN 1826, e) 0.3 nmol ATP (1 ⁇ ) , and f) 0.3 nmol UTP (1 ⁇ ) .
  • EXAMPLE 13 PEPTIDE-BASED IMMUNOTHERAPY OF MICE ORALLY SENSITZED WITH OVALBUMIN (OVA)
  • Murine model for OVA- induced food allergy A schematic outline of this experiment is shown in Fig. 14.
  • Female BALB/c mice (8 weeks old at starting day) are used. Animals are housed under an egg- free diet (14% protein (wheat and corn) and 3.5% fat) in a 12 h lighting cycle. Food and water are available ad libitum.
  • mice are sensitized by oral gavage at a dose of 1.0 mg of HPLC- purified OVA and 10 ⁇ g of cholera toxin (List Biologicals, Denver, CO, USA), twice per week at days 2 and 4 of week 2,3,4 and 5.
  • Specific immunotherapy is performed by 4 successive subcutaneous (SC) injections of the hydrogel compositions of Examples 10 and 11 at day 1 of week 6, 7, 8, 9.
  • SC subcutaneous
  • mice Four groups of mice (10 mice per group) are compared.
  • Group I Treatment with 300 ⁇ (administration in three 100 ⁇ aliquots) hydrogel composition A of Example 10 comprising a) 15% w/v PLGA-PEG-PLGA, b) 100 ⁇ g OVA peptide
  • Group II Treatment with 300 ⁇ (administration in three
  • hydrogel composition B of Example 11 comprising a) 15% w/v PLGA-PEG-PLGA, b) a) approx. 80 ⁇ g Ps-liposomal OVA peptide 1, b) approx. PS-liposomal 40 ⁇ g OVA peptide 2, c) approx. PS-liposomal 80 ⁇ g OVA peptide 3, d) 40 of class B CpG-ODN 1826, e) 0.3 nmol ATP, and f) 0.3 nmol UTP.
  • Group III (allergy group) : Placebo treatment with 300 ⁇ 15% w/v PLGA-PEG-PLGA.
  • Group IV Placebo treatment with 300 ⁇ 15% w/v PLGA-PEG-PLGA.
  • the cha11enge is performed by oral administration of 20 mg OVA in PBS at day 1 of week 10. Control mice receive only PBS.
  • OVA-specific IgA in fecal pellets. A mass of 1.0 g of fecal pellets are added to 7.5 ml of PBS pH 7.4 and homogenized for 2 x 30 s using a homogenizer. Samples are subsequently centrifuged at 500 g for 20 min and the supernatants are carefully passed through a 0.45 mm diameter syringe filter. Concentrations of OVA-specific IgA are determined by ELISA (Chondrex, Inc., Redmont, A USA).
  • RNA is extracted from individual mice (30 mg of tissue/mouse) using the spin column procedure from RNeasy kits (Qiagen Inc., Valencia, CA, USA). Total RNA integrity is assessed on 1% agarose gels, and the respective concentration and purity are determined by measuring the absorbance ratios A260/A280.
  • Complementary DNA cDNA is synthesized from 1.0 mg/mouse of total RNA using Quantitect Rev kit (Qiagen Inc.), following the manufacturer's instructions.
  • Real-time fluorescence-monitored PCR reactions are performed using an iCycler detection system.
  • the temperature profile is 95° C for 15 min, then 15 s at 95° C (denaturation) , 56° C for 15 s (annealing) and 72° C for 30 s (extension) , repeated for 45-50 cycles.
  • the efficiency of all qPCR reactions (primer pairs) is between 90% and 110% as per standard PCR primer design parameters. All data are normalized to the housekeeping gene encoding for glyceraldehyde- 3 -phosphate dehydrogenase (GAPDH) and the relative mRNA expression ratios are determined as described (Livak and Schmittgen, 2001) .
  • GPDH glyceraldehyde- 3 -phosphate dehydrogenase
  • spleens from individual mouse are aseptically removed into ice-cold RPMI-1640 medium (Gibco Invitrogen, New York, NY, USA) , containing sodium bicarbonate (1.5 g/1) , glucose (4.5 g/1) , L-glutamine (2mM) , sodium pyruvate (lmTh2 -biased cytokines including M) , penicillin (50 U/ml) and streptomycin (50 mg/ml) . Two whole spleens are pooled within each group.
  • Single cell suspensions are prepared as described previously (Rupa et al . , 2007) and cell viability is assessed by trypan blue exclusion.
  • Cells are cultured in 24-well plates (Corning Inc., Corning, NY, USA) at a density of 2.5 x 10 6 /ml in the absence (negative control wells) or presence of purified OVA (100 mg/ml) .
  • EXAMPLE 14 IMMUNOTHERAPY OF MICE ORALLY SENSITZED WITH OVALBUMIN (OVA) BY A COMBINATION OF OVA-DERIVED PEPTIDES AND INTACT OVA
  • Phase A the therapeutic efficacy of a combination of immunotherapy with OVA-derived peptides (Phase A) and subsequent oral immunotherapy with intact OVA (Phase B) is evaluated in mice orally sensitized with OVA.
  • Phase A is performed as described in Example 13 using the hydrogel compositions of Example 10.
  • Phase B is performed as described by Leonard et al . (2012) .
  • FIG. 15 A schematic outline of this experiment is shown in Fig. 15.
  • Female BALB/c mice (8 weeks old at starting day) are used. Animals are housed under an egg- free diet (14% protein (wheat and corn) and 3.5% fat) in a 12 h lighting cycle. Food and water are available ad libitum.
  • mice are sensitized by oral gavage at a dose of 1.0 mg of HPLC- purified OVA and 10 ⁇ g of cholera toxin (List Biologicals,
  • Phase A is performed by 4 successive subcutaneous (s.c.) injections of the hydrogel compositions of Example 10 at day 1 of week 6,7,8, and 9.
  • Phase B is performed as OIT over a period 14 days (week 10 and 11) by daily gavage of increasing doses of OVA from 0.5 mg (days 1,2 of week 10), 2.5 mg (days 3,4 of week 10), 5 mg (days 5-7 of week 10), 12.5 mg (days 8,9 of week 11) , 25 mg (days 10-14 of week 11) .
  • mice Four groups of mice (10 mice per group) are compared. Group I (sensitized mice) Phase A:
  • hydrogel composition A of Example 10 comprising a) 15% w/v PLGA-PEG-PLGA, b) 100 ⁇ g OVA peptide 1, c) 50 ⁇ g OVA peptide 2, d) 100 ⁇ g OVA peptide 3, e) 40 ⁇ g of class B CpG-ODN 1826, f) 0.3 nmol ATP, and g) 0.3 nmol UTP.
  • Treatment by daily gavage of increasing doses of OVA from 0.5 mg, 2.5 mg, 5 mg, 12.5 mg, and 25 mg.
  • Phase A Phase A:
  • hydrogel composition comprising 15% w/v PLGA-PEG-PLGA in PBS.
  • Phase A Treatment with 300 ⁇ (administration in three 100 ⁇ aliquots) hydrogel composition comprising 15% w/v PLGA-PEG-PLGA in PBS.
  • the challenge is performed in by oral administration of 50 mg OVA in PBS at day 1 of week 12.
  • Control mice receive only PBS .
  • mice After recovery from the oral challenge, the development of systemic tolerance is analyzed by intraperitoneal injection of increasing amounts of OVA starting with 1 ⁇ g, then 10 ⁇ g and finally 100 ⁇ . After discontinuation of OIT for 2 weeks, mice are re- challenged by oral administration of 50 mg OVA in PBS at day 1 of week 14 to assess tolerance.
  • mice are euthanized one day after the final challenge (5 mice of each group after the first oral and subsequent systemic challenge and 5 mice of each group after the oral re-challenge and subsequent systemic challenge) .
  • Example 13 Analysis of oral tolerance. Analyzed are anaphylactic responses (temperature, scoring system) after oral challenge (see Example 13) , levels of OVA- specific IgA in fecal pellets (see Example 13) , and intestinal gene expression pattern by RT-PCR of 11-4, IL-5, IL-13, IL-12p40, IL-10, IL-18, IF - ⁇ , TGF- ⁇ , F0XP3 (see Example 13) .
  • serum levels of histamine and OVA-specific immunoglobulins including IgE and IgG are determined as described in Example 13.
  • peritoneal lavage is collected and cells are stimulated as described for peripheral basophils and stained for ckit and IgE to detect mast cells, and CD107a (LAMP-1) as an activation marker according to Leonard et al . (2012) .
  • Fadok V.A. et al., J. Clin. Invest. 101: 890-898; 1998. Fadok V.A., et al . , J. Biol. Chem. 276 : 1071-1077 ; 2001.
  • Fleischmann R. et al . , N. Engl. J. Med. 367: 495-507; 2012a. Fleischmann R. , et al., Arthritis Rheum. 64: 617-629; 2012b. Fromen C.A. , et al . , Proc . Natl. Acad. Sci. USA 112: 488-493;
  • Rhen T. Cidlowski J.A. , N. Engl. J. Med. 353 : 1711- 1723 ;
  • Valenta R. et al., Gastroenterol. 148 : 1120-1131 ; 2015. Van Hemelen D. , et al., Allergy 70: 49-58; 2015.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Pulmonology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention concerne des procédés pour l'induction de la tolérance aux aliments par une combinaison d'immunothérapie à base d'hydrogel sous-cutanée avec des peptides de lymphocytes T dérivés d'allergènes alimentaires en présence de concentrations favorisant la tolérance d'oligodésoxynucléotides avec des motifs CpG ou GpC ou GpG (Phase A) suivie d'une immunothérapie par voie orale ou sublinguale avec des allergènes alimentaires naturels ou recombinants (Phase B).
PCT/EP2018/000478 2017-10-18 2018-10-18 Induction de tregs spécifiques d'allergènes avant une immunothérapie orale ou sublinguale d'allergie alimentaire WO2019076477A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP18803539.8A EP3787670A1 (fr) 2017-10-18 2018-10-18 Induction de tregs spécifiques d'allergènes avant une immunothérapie orale ou sublinguale d'allergie alimentaire

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17001742 2017-10-18
EP17001742.0 2017-10-18

Publications (1)

Publication Number Publication Date
WO2019076477A1 true WO2019076477A1 (fr) 2019-04-25

Family

ID=60269587

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/000478 WO2019076477A1 (fr) 2017-10-18 2018-10-18 Induction de tregs spécifiques d'allergènes avant une immunothérapie orale ou sublinguale d'allergie alimentaire

Country Status (2)

Country Link
EP (1) EP3787670A1 (fr)
WO (1) WO2019076477A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114010766A (zh) * 2021-11-11 2022-02-08 浙江工商大学 一种经皮肤致敏的食物过敏动物模型的建立方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999018142A1 (fr) 1997-10-03 1999-04-15 Macromed, Inc. Copolymeres trisequences de poly(lactide-co-glycolide) polyethylene-glycol, de faible poids moleculaire, biodegradables dotes de caracteristiques de gelification thermique inverses
US6287588B1 (en) 1999-04-29 2001-09-11 Macromed, Inc. Agent delivering system comprised of microparticle and biodegradable gel with an improved releasing profile and methods of use thereof
US20060147511A1 (en) 2002-11-24 2006-07-06 Steffen Panzner Liposomal glucocorticoids
EP2918262A1 (fr) * 2014-03-10 2015-09-16 PLS-Design GmbH Induction d'une tolérance spécifique à des antigènes par phagocytose périphérique
WO2016020336A1 (fr) * 2014-08-04 2016-02-11 Dbv Technologies Compositions d'allergènes alimentaires
EP3095440A1 (fr) 2015-05-19 2016-11-23 PLS-Design GmbH Immunothérapie spécifique d'un antigène à l'aide de liposomes de tolérance

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999018142A1 (fr) 1997-10-03 1999-04-15 Macromed, Inc. Copolymeres trisequences de poly(lactide-co-glycolide) polyethylene-glycol, de faible poids moleculaire, biodegradables dotes de caracteristiques de gelification thermique inverses
US6287588B1 (en) 1999-04-29 2001-09-11 Macromed, Inc. Agent delivering system comprised of microparticle and biodegradable gel with an improved releasing profile and methods of use thereof
US20060147511A1 (en) 2002-11-24 2006-07-06 Steffen Panzner Liposomal glucocorticoids
EP2918262A1 (fr) * 2014-03-10 2015-09-16 PLS-Design GmbH Induction d'une tolérance spécifique à des antigènes par phagocytose périphérique
WO2016020336A1 (fr) * 2014-08-04 2016-02-11 Dbv Technologies Compositions d'allergènes alimentaires
EP3095440A1 (fr) 2015-05-19 2016-11-23 PLS-Design GmbH Immunothérapie spécifique d'un antigène à l'aide de liposomes de tolérance

Non-Patent Citations (167)

* Cited by examiner, † Cited by third party
Title
ADEL-PATIENT K. ET AL., J. IMMUNOL. METH., vol. 235, 2000, pages 21 - 32
AL-JADERI Z. ET AL., TOXINS, vol. 5, 2013, pages 1932 - 1947
ALTAMIMI S. ET AL., PEDIATR. EMERG. CARE, vol. 22, 2006, pages 786 - 793
AMARA A.; MERCER J., NAT. REV. MICROBIOL., vol. 13, 2015, pages 461 - 469
ANDERSON R. ET AL., ARTHR. RES. THER., vol. 12, 2010, pages R147
APETOH L. ET AL., NAT. IMMUNOL., vol. 11, 2010, pages 854 - 861
ARCHILA L.D. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 136, 2015, pages 983 - 992
BAL S.M. ET AL., VACCINE, vol. 29, 2011, pages 1045 - 1052
BARNES P.J., ALLERGY, vol. 56, 2001, pages 928 - 936
BELOGUROV JR. A. ET AL., FASEB J., vol. 27, 2013, pages 222 - 231
BETTELLI E. ET AL., NATURE, vol. 441, 2006, pages 235 - 238
BOHLE B., CLIN. REV. ALLERGY IMMUNOL., vol. 30, 2006, pages 97 - 108
BRANISTEANU D.D. ET AL., J. NEUROIMMUNOL., vol. 61, 1995, pages 151 - 160
BURTON B.R. ET AL., NATURE COMMUNICATIONS, vol. 5, 2014
CAMPBELL J.D. ET AL., J. CLIN. INVEST., vol. 119, 2009, pages 2564 - 2576
CANTORNA M.T. ET AL., J. IMMUNOL., vol. 160, 1998, pages 5314 - 5319
CANTORNA M.T. ET AL., J. NUTR., vol. 128, 1998, pages 68 - 72
CAVKAYTAR O. ET AL., CURR. OPIN. PHARMACOL., vol. 17, 2014, pages 30 - 37
CHAMPION J.A.; MITRAGOTRI S., PROC. NATL. ACAD. SCI. USA, vol. 103, 2006, pages 4930 - 4944
CHEKENI F.B.; RAVICHANDRAN K.S., J. MOL. MED., vol. 89, 2011, pages 13 - 22
CHEN X. ET AL., J. IMMUNOL., vol. 173, 2004, pages 2985 - 2994
CHIU H.W. ET AL., NANOSCALE, vol. 7, 2015, pages 736 - 746
CHRISTIAN BODE ET AL: "CpG DNA as a vaccine adjuvant", EXPERT REVIEW OF VACCINES, vol. 10, no. 4, 1 April 2011 (2011-04-01), GB, pages 499 - 511, XP055551929, ISSN: 1476-0584, DOI: 10.1586/erv.10.174 *
CIRUNAY J.J.N. ET AL., J. CHROMATOGR. SCI., vol. 36, 1998, pages 417 - 421
COHEN S. ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1063, 1991, pages 95 - 102
DANHIER F. ET AL., J. CONTROL. RELEASE, vol. 161, 2012, pages 505 - 522
DE SOUZA REBOUCAS J. ET AL., J. BIOMED. BIOTECH., 2012
ELLIOTT, M.R. ET AL., NATURE, vol. 461, 2009, pages 282 - 286
FADOK V.A. ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 1071 - 1077
FADOK V.A. ET AL., J. CLIN. INVEST., vol. 101, 1998, pages 890 - 898
FADOK V.A. ET AL., J. IMMUNOL., vol. 148, 1992, pages 2207 - 2216
FALLARINO F.; PUCCETTI, P., EUR. J. IMMUNOL., vol. 36, 2006, pages 8 - 11
FLANAGAN M.E. ET AL., J MED CHEM., vol. 53, 2010, pages 8468 - 8484
FLEISCHER D.M. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 131, 2013, pages 119 - 127
FLEISCHMANN R. ET AL., ARTHRITIS RHEUM., vol. 64, 2012, pages 617 - 629
FLEISCHMANN R. ET AL., N. ENGL. J. MED., vol. 367, 2012, pages 495 - 507
FROMEN C.A. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 112, 2015, pages 488 - 493
FROSSARD C.P. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 114, 2004, pages 377 - 382
GAGLIANI N. ET AL., NAT. MED., vol. 19, 2013, pages 739 - 746
GEELEN T. ET AL., J. NANOBIOTECHNOLOGY, vol. 10, 2012, pages 37 - 48
GENTILE P. ET AL., INT. J. MOL. SCI., vol. 15, 2014, pages 3640 - 3659
GETTS D.R. ET AL., TRENDS IMMUNOL., vol. 36, 2015, pages 419 - 427
GHOREISHI M. ET AL., J. IMMUNOL., vol. 182, 2009, pages 6071 - 6078
GILBREATH M.J. ET AL., J. IMMUNOL., vol. 134, 1985, pages 3420 - 3425
GOLALI E. ET AL., IRANIAN J. BASIC MED. SCI., vol. 15, 2012, pages 1032 - 1045
GOMBAULT A. ET AL., FRONTIERS IMMUNOL., vol. 3, 2013
GONG C.Y. ET AL., INT. J. PHARM., vol. 365, 2009, pages 89 - 99
GOYAL P. ET AL., ACTA PHARM., vol. 55, 2005, pages 1 - 25
GRAHAM K.L. ET AL., AUTOIMMUNITY, vol. 43, 2010, pages 140 - 155
GREENBERG R.A. ET AL., CLIN. PEDIATR. (PHILA., vol. 47, 2008, pages 817 - 823
GUPTA P.; BHATIA V., INDIAN J. PEDIATR., vol. 75, 2008, pages 1039 - 1044
HAREL-ADAR T. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 108, 2011, pages 1827 - 1832
HAWANG T.L. ET AL., INT. J. NANOMED., vol. 10, 2015, pages 371 - 385
HEGEMAN M.A. ET AL., BRIT. J. PHARMACOL., vol. 163, 2011, pages 1048 - 1058
HEMMI H. ET AL., NATURE, vol. 408, 2000, pages 740 - 745
HIRST M.; FELDMAN D., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 105, 1982, pages 1590 - 1596
HIRST M.; FELDMAN D., ENDOCRINOL., vol. 111, 1982, pages 1400 - 1402
HO P.P., P. ET AL., J. IMMUNOL., vol. 171, 2003, pages 4920 - 4926
HOCHREITER-HUFFORD A.; RAVICHANDRAN K.S., COLD SPRING HARB. PERSPECT. BIOL., vol. 5, 2013, pages a008748
HOFFMANN P.R. ET AL., J. CELL BIOL., vol. 155, 2001, pages 649 - 659
HOFFMANN P.R. ET AL., J. IMMUNOL., vol. 174, 2005, pages 1393 - 1404
HUYNH M.L. ET AL., J. CLIN. INVEST., vol. 109, 2002, pages 41 - 50
HYUN H. ET AL., BIOMACROMOLECULES, vol. 8, 2007, pages 1093 - 1100
IMAIZUMI T. ET AL., J. TOXICOL. SCI., vol. 21, no. II, 1996, pages 277 - 285
JAHRSDORFER B. ET AL., CLIN. CANCER RES., vol. 11, 2005, pages 1490 - 1499
JILEK S. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 114, 2004, pages 943 - 950
JILEK S. ET AL., PHARM. RES., vol. 21, 2004, pages 1240 - 1247
JULIA M MARTÍNEZ GÓMEZ ET AL: "A Protective Allergy Vaccine Based on CpG and Protamine-Containing PLGA Microparticles", PHARMACEUTICAL RESEARCH, KLUWER ACADEMIC PUBLISHERS-PLENUM PUBLISHERS, NL, vol. 24, no. 10, 31 May 2007 (2007-05-31), pages 1927 - 1935, XP019532578, ISSN: 1573-904X, DOI: 10.1007/S11095-007-9318-0 *
JULIANA DE SOUZA REBOU?AS ET AL: "Nanoparticulate Adjuvants and Delivery Systems for Allergen Immunotherapy", JOURNAL OF BIOMEDICINE AND BIOTECHNOLOGY, vol. 156, no. 8, 1 January 2012 (2012-01-01), pages 2809 - 13, XP055061036, ISSN: 1110-7243, DOI: 10.1073/pnas.0509541102 *
KANG Y.M. ET AL., BIOMATERIALS, vol. 31, 2010, pages 2453 - 2460
KAWAI T.; AKIRA S., NAT. IMMUNOL., vol. 7, 2006, pages 131 - 137
KEET C.A. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 129, 2012, pages 448 - 455
KEIJZER C. ET AL., J. CONTROL. RELEASE, vol. 168, 2013, pages 35 - 40
KEIJZER C. ET AL., PLOS ONE, vol. 6, no. 11, 2011, pages e26684
KIM W.-U. ET AL., ARTHRITIS RHEUM., vol. 46, 2002, pages 1109 - 1120
KISSMEYER A.-M.; BINDERUP, L., BIOCHEM. PHARMACOL., vol. 41, 1991, pages 1601 - 1606
KONO H.; ROCK, K.L., NATURE REV. IMMUNOL., vol. 8, 2008, pages 279 - 289
KONUR A. ET AL., OPEN CANCER J., vol. 2, 2008, pages 15 - 24
KOPPOLU B.; ZAHAROFF D.A., BIOMATERIALS, vol. 34, 2013, pages 2359 - 2369
KRAGBALLE K., PHARMACOL. TOXICOL., vol. 77, 1995, pages 241 - 246
KREMER J.M. ET AL., ARTHRITIS RHEUMATISM, vol. 60, 2009, pages 1895 - 1905
KUBO S. ET AL., ANN. RHEUM. DIS., vol. 73, 2014, pages 2192 - 2198
LEONARD S.A. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 129, 2012, pages 1579 - 1587
LI X. ET AL., BIOMED. CHROMATOGR., vol. 27, 2013, pages 1714 - 1719
LI X. ET AL., J. IMMUNOL., vol. 162, 1999, pages 3045 - 3052
LIVAK K.J.; SCHMITTGEN T.D., METHODS, vol. 25, 2001, pages 402 - 408
LONGUI C.A., J. PEDIATR. (RIO J., vol. 83, 2007, pages 163 - 171
LORENZ A.-R. ET AL., J. CHROMATOGR. B, vol. 756, 2001, pages 255 - 279
LU J.-M. ET AL., EXPERT RE. MOL. DIAGN., vol. 9, 2009, pages 325 - 341
MAKADIA H.K; SIEGEL S.J., POLYMERS (BASEL, vol. 3, 2011, pages 1377 - 1397
MELLOR A.L. ET AL., J. IMMUNOL., vol. 175, 2005, pages 5601 - 5605
MERZ K.; STERNBERG B., J. DRUG TARGET., vol. 2, 1994, pages 411 - 417
MEYER D.M. ET AL., J. INFLAMM. (LOND, vol. 7, 2010, pages 41
MICHAEL H. LAND ET AL: "Oral Desensitization for Food Hypersensitivity", IMMUNOLOGY AND ALLERGY CLINICS OF NORTH AMERICA, vol. 31, no. 2, 1 May 2011 (2011-05-01), US, pages 367 - 376, XP055552365, ISSN: 0889-8561, DOI: 10.1016/j.iac.2011.02.008 *
MOHAN A. ET AL., RSC ADVANCES, vol. 5, 2015, pages 79270
MONASTRA G. ET AL., NEUROLOGY, vol. 43, 1993, pages 153 - 163
MONASTRA G.; BRUNI, A., LYMPHOKINE CYTOKINE RES., vol. 11, 1992, pages 39 - 43
MONDOULET L. ET AL., PLOS ONE, vol. 7, 2012, pages e31967
MOTOMURA Y. ET AL., NAT. IMMUNOL., vol. 12, 2011, pages 450 - 459
MUINDI J.R. ET AL., ONCOLOGY, vol. 66, 2004, pages 62 - 66
MULLER U. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 101, 1998, pages 747 - 754
NAGATA Y. ET AL., PLOS ONE, vol. 12, no. 1, 2017, pages e01170577
NARISETY S.D., J. ALLERGY CLIN. IMMUNOL., vol. 135, 2015, pages 1275 - 1282
NASHOLD F.E. ET AL., J. NEUROIMMUNOL., vol. 263, 2013, pages 64 - 74
NICOLETE R. ET AL., INT. IMMUNOPHARMACOL., vol. 11, 2011, pages 1557 - 1563
NIE S. ET AL., INTERNATL. J. NANOMED., vol. 6, 2011, pages 151 - 166
NORMAN P.S ET AL., AM. J. RESPIR. CRIT. CARE MED., vol. 154, 1996, pages 1623 - 1628
O'HEHIR R.E. ET AL., CURR. ALLERGY ASTHMA REP., vol. 16, 2016, pages 14
OKAMURA T. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 106, 2009, pages 13974 - 13979
OTSUKA M. ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 324, 2004, pages 1400 - 1405
PARK M.V. ET AL., BIOMATERIALS, vol. 32, 2011, pages 9810 - 9817
PATIL S.U. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 136, 2015, pages 125 - 134
PENG K.T. ET AL., BIOMATERIALS, vol. 31, 2010, pages 5227 - 5236
PLUM L.A. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 1001, 2004, pages 6900 - 6904
PLUM L.A.; DELUCA H.F., NAT. REV. DRUG DISCOV., vol. 9, 2010, pages 941 - 955
PONZIN D. ET AL., IMMUNOPHARMACOL., vol. 18, 1989, pages 167 - 176
POT C. ET AL., J. IMMUNOL., vol. 183, 2009, pages 797 - 801
PRICKETT ET AL., CLIN. EXP. ALLERGY, vol. 43, 2013, pages 684 - 697
PRICKETT S.R. ET AL., CLIN. EXP. ALLERGY, vol. 45, 2015, pages 1015 - 1026
PRICKETT S.R. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 127, 2011, pages 608 - 615
QIAO M. ET AL., INT. J. PHARM., vol. 294, 2005, pages 103 - 112
QURESHI F. ET AL., J. PEDIATR., vol. 139, 2001, pages 20 - 26
RAMESH M. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 137, 2016, pages 1764 - 1771
RAVICHANDRAN K.S., IMMUNITY, vol. 35, 2011, pages 445 - 455
RHEN T.; CIDLOWSKI J.A., N. ENGL. J. MED., vol. 353, 2005, pages 1711 - 1723
ROBINSON D.S., J. ALLERGY CLIN. IMMUNOL., vol. 126, 2010, pages 1081 - 1091
RUPA P. ET AL., CLIN. EXP. ALLERGY, vol. 37, 2007, pages 918 - 928
SABATOS-PEYTON C. A. ET AL., CURR. OPIN. IMMUNOL., vol. 22, 2010, pages 609 - 615
SCHOLL I. ET AL., CLIN. EXP. ALLERGY, vol. 34, 2004, pages 215 - 321
SCHULTEN V. ET AL., ANN. ALLERGY ASTHMA IMMUNOL., vol. 110, 2013, pages 7 - 10
SHI D. ET AL., ARCH. DERMATOL. RES., vol. 299, 2007, pages 327 - 336
STEINMAN R.M. ET AL., J. EXP. MED., vol. 191, 2000, pages 411 - 416
STEPHANIE A LEONARD ET AL: "Oral immunotherapy induces local protective mechanisms in the gastrointestinal mucosa", JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 129, no. 6, 4 April 2012 (2012-04-04), pages 1579 - 1587.e1, XP028512124, ISSN: 0091-6749, [retrieved on 20120413], DOI: 10.1016/J.JACI.2012.04.009 *
STRAIT R.T. ET AL., J. CLIN. INVEST., vol. 116, 2006, pages 833 - 841
SYED A. ET AL., J. ALLERGY CLIN. IMMUNOL., vol. 133, 2014, pages 500 - 510
TAHER Y.A. ET AL., J. IMMUNOL., vol. 180, 2008, pages 5211 - 5221
TAKASUGI Y. ET AL., PHARMACOL. PHARMACY, vol. 4, 2013, pages 248 - 254
THIELE L. ET AL., PHARM. RES., vol. 20, 2003, pages 221 - 228
TREMEZAYGUES L.; REICHRATH J., DERMATOENDOCRINOL., vol. 3, 2011, pages 180 - 186
TYE-DIN J.A. ET AL., SCI. TRANSL. MED., vol. 2, 2010, pages 41ra51
UYENPHUONG H LE ET AL: "Oral and sublingual immunotherapy for food allergy", WORLD ALLERGY ORGANIZATION JOURNAL, BIOMED CENTRAL LTD, LONDON, UK, vol. 7, no. 1, 8 December 2014 (2014-12-08), pages 35, XP021205456, ISSN: 1939-4551, DOI: 10.1186/1939-4551-7-35 *
UYENPHUONG H.K.; BURKS, W.A., WORLD ALLERGY ORG. J., vol. 7, 2014, pages 35
VALENTA R. ET AL., GASTROENTEROL., vol. 148, 2015, pages 1120 - 1131
VAN HEMELEN D. ET AL., ALLERGY, vol. 70, 2015, pages 49 - 58
VAZQUEZ-ORTIZ M.; TURNER P.J., PEDIAT. ALLERGY IMMUNOL., vol. 27, 2016, pages 117 - 125
VOLLMER J.; KRIEG A.M., ADVANCED DRUG DELIVERY REV., vol. 61, 2009, pages 195 - 204
VOLPI C. ET AL., J. IMMUNOL, vol. 189, 2012, pages 2283 - 2289
VOLPI C. ET AL., NAT. COMMUN., vol. 4, 2013, pages 1852
VULTAGGIO A. ET AL., J. IMMUNOL., vol. 186, 2011, pages 4707 - 4715
WAI C.Y.Y. ET AL., CLIN. EXP. ALLERGY, vol. 46, 2015, pages 491 - 503
WASSERMAN R.L. ET AL., J ALLERGY CLIN IMMUNOL PRACT., vol. 2, 2014, pages 91 - 96
WHERRY E.J., NAT. IMMUNOL., vol. 12, 2011, pages 492 - 499
WINGENDER G. ET AL., EUR. J. IMMUNOL., vol. 36, 2006, pages 12 - 20
WOOD R.A., J. INVESTIG. ALLERGOL. CLIN. IMMUNOL., vol. 27, no. 3, 2017
WORM M. ET AL., EXPERT OPIN. INVESTIG. DRUGS, vol. 22, 2013, pages 1347 - 1357
WU Z. ET AL., J. IMMUNOL., vol. 184, 2010, pages 3191 - 3201
XIA T. ET AL., ACS NANO, vol. 2, 2008, pages 85 - 96
XIANG S.D. ET AL., METHODS, vol. 60, 2013, pages 232 - 241
XING Y.B. ET AL., J. LIPOSOME RES., vol. 24, 2014, pages 10 - 16
YANG M. ET AL., CLIN. EXP. ALLERGY, vol. 40, 2010, pages 668 - 678
YANG M.; MINE Y., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 378, 2008, pages 203 - 208
YU C.F. ET AL., J. IMMUNOL., vol. 184, 2010, pages 1159 - 1167
ZELLA J.B. ET AL., ARCH. BIOCHEM. BIOPHYS., vol. 417, 2003, pages 77 - 80
ZENT C.S. ET AL., LEUK. LYMPHOMA, vol. 53, 2012, pages 211 - 217
ZHANG G.L. ET AL., NUCLEIC ACIDS RES., vol. 33, 2005, pages W180 - 183
ZHANG J. ET AL., BIOMACROMOLECULES, vol. 7, 2006, pages 2492 - 2500
ZHANG J. ET AL., J. NEUROIMMUNOL., vol. 172, 2006, pages 112 - 120

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114010766A (zh) * 2021-11-11 2022-02-08 浙江工商大学 一种经皮肤致敏的食物过敏动物模型的建立方法

Also Published As

Publication number Publication date
EP3787670A1 (fr) 2021-03-10

Similar Documents

Publication Publication Date Title
Elamanchili et al. “Pathogen-mimicking” nanoparticles for vaccine delivery to dendritic cells
EP3095440B1 (fr) Immunothérapie spécifique d'un antigène à l'aide de liposomes de tolérance
CA2296750C (fr) Preparation d'un exosome et utilisation de cette vesicule cellulaire dans la stimulation d'une reponse immunitaire
US11065330B2 (en) Induction of antigen-specific tolerance by peripheral phagocytosis
US20180085452A1 (en) Matrix-embedded tolerance-promoting adjuvants for subcutaneous immunotherapy
US20160271257A1 (en) Low Molecular Weight Immune-Modulators As Adjuvants for Specific Immunotherapy
JP2010505883A (ja) 免疫応答を調節するための組成物および方法
US20240075117A1 (en) Microbiota sequence variants of tumor-related antigenic epitopes
IL277421A (en) compounds
KR20200067862A (ko) 종양-관련된 항원 에피토프의 미생물 서열 변이체
EP1750707A1 (fr) Composition immunostimulante comprenant au moins un agoniste des recepteurs toll-like 7 ou du recepteur toll-like 8 et un agoniste du recepteur toll-like 4
JP7376208B2 (ja) 抗原特異的製剤の投与による免疫疾患の治療
Liu et al. Oral pretreatment with β-lactoglobulin derived peptide and CpG co-encapsulated in PLGA nanoparticles prior to sensitizations attenuates cow’s milk allergy development in mice
WO2019076477A1 (fr) Induction de tregs spécifiques d'allergènes avant une immunothérapie orale ou sublinguale d'allergie alimentaire
WO2019076478A1 (fr) Oligodésoxynucléotides incorporés à un hydrogel en tant qu'adjuvant tolérogène pour l'immunothérapie sous-cutanée
US20240335511A1 (en) Therapeutic rna for treating cancer
Yotsumoto et al. Enhancement of IFN-γ production for Th1-cell therapy using negatively charged liposomes containing phosphatidylserine
JP6062360B2 (ja) 改良された糖被覆リポソーム組成物
Steptoe et al. Antigen-Specific Suppression of
Peine Formulation of Particulate-based Immunomodulatory Therapeutics for the Treatment of Diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18803539

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018803539

Country of ref document: EP

Effective date: 20200518