WO2019069093A1 - Microparticules de cellules souches pour la thérapie du cancer - Google Patents

Microparticules de cellules souches pour la thérapie du cancer Download PDF

Info

Publication number
WO2019069093A1
WO2019069093A1 PCT/GB2018/052852 GB2018052852W WO2019069093A1 WO 2019069093 A1 WO2019069093 A1 WO 2019069093A1 GB 2018052852 W GB2018052852 W GB 2018052852W WO 2019069093 A1 WO2019069093 A1 WO 2019069093A1
Authority
WO
WIPO (PCT)
Prior art keywords
hsa
mir
cells
cancer
exosomes
Prior art date
Application number
PCT/GB2018/052852
Other languages
English (en)
Inventor
Randolph Corteling
Victoria MARSH DURBAN
Original Assignee
Reneuron Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Reneuron Limited filed Critical Reneuron Limited
Publication of WO2019069093A1 publication Critical patent/WO2019069093A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0623—Stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/30—Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/15—Transforming growth factor beta (TGF-β)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/24—Interferons [IFN]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/25—Tumour necrosing factors [TNF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/08—Coculture with; Conditioned medium produced by cells of the nervous system
    • C12N2502/088—Coculture with; Conditioned medium produced by cells of the nervous system neural stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/50—Proteins
    • C12N2533/52—Fibronectin; Laminin

Definitions

  • This invention relates to neural stem cell microparticles and their use in the treatment of cancer.
  • Stem cells have the ability to self-renew and to differentiate into functionally different cell types. They have the potential to be a powerful therapeutic tool, for example in the growing field of Regenerative Medicine, in particular regenerative therapy requiring tissue replacement, regeneration or repair (Banerjee et al. 201 1). Endogenous stem cells have also been implicated as targets (endogenous "cancer stem cells") of anti-cancer therapy, where it is proposed to treat the cancer by eliminating the cancer stem cells that are thought to drive cancer growth and metastasis. More recently, engineered mesenchymal stem cells have been proposed as delivery vehicles in anti-cancer therapy (Dai et al., 2011 ; Shah et al. 2012).
  • stem cells in therapy: there is a need for a consistent and substantial supply of stem cells with functional and phenotypic stability and the associated high costs and time delay caused by cell generation, storage, transport and handling; there is a requirement for immunological compatibility to avoid rejection of the stem cells by the recipient; and there are complex regulatory issues related to potential safety risks of tumour or ectopic tissue formation. Further, despite the therapeutic efficacy of stem cell transplantation, there is no convincing evidence for a direct long-term effect of the transplanted stem cells, for example through engraftment and differentiation into reparative or replacement cells.
  • Neural stem cells are self-renewing, multipotent stem cells that generate neurons, astrocytes and oligodendrocytes (Kornblum, 2007). The medical potential of neural stem cells is well-documented. Damaged central nervous system (CNS) tissue has very limited regenerative capacity so that loss of neurological function is often chronic and progressive. Neural stem cells (NSCs) have shown promising results in stem cell-based therapy of neurological injury or disease (Einstein et al. 2008). Implanting neural stem cells (NSCs) into the brains of post-stroke animals has been shown to be followed by significant recovery in motor and cognitive tests (Stroemer et al. 2009).
  • NSCs are able to restore function in damaged tissues but it is now becoming increasingly recognised that NSCs have multimodal repairing properties, including site-appropriate cell differentiation, pro-angiogenic and neurotrophic activity and immunomodulation promoting tissue repair by the native immune system and other host cells (Miljan & Sinden, 2009, Horie et al., 201 1).
  • NSCs transiently express proinflammatory markers when implanted in ischaemic muscle tissue damage which directs and amplifies the natural pro- angiogenic and regulatory immune response to promote healing and repair
  • ischaemic muscle tissue damage which directs and amplifies the natural pro- angiogenic and regulatory immune response to promote healing and repair
  • WO-A-2013/150303 and WO-A-2014/013258 disclose that neural stem cells produce microparticles, such as exosomes. Methods for making those microparticles and uses of those microparticles, in particular for use in regenerative therapy, are also disclosed. Stevanato et al (2016) also describes neural stem cell exosomes, while Thery et al. (2011) provides a more general review of exosomes and other similar secreted vesicles.
  • WO-A-2015/022545 and WO-A-2015/052526 describe that neural stem cell-derived microparticles can have utility in the treatment of cancer, in particular glioblastoma. There remains a need for improved cancer therapies, for example to address the diversity of cancers and their clinical presentations.
  • the present invention is based on the finding that neural stem cell microparticles have anticancer effects on a number of diverse cancer cell types. Furthermore, the inventors have identified new insights into the effects that neural stem cell microparticles have on cancer cells, in particular that the microparticles have certain direct effects on the cancer cells. Typically, the microparticles are exosomes.
  • the invention provides neural stem cell exosomes for use in a method of treating a cancer selected from:
  • CNS cancer optionally glioma
  • Non-small-cell lung cancer is N-small-cell lung cancer
  • Example A demonstrate that neural stem cell exosomes have biological efficacy against cell lines from each of these cancer types.
  • the invention provides neural stem cell exosomes for use in a method of treating cancer by reducing the number of cancer cells. It has been observed in Example A that a reduction of cancer cell number follows direct exposure to the exosomes. In certain embodiments the exosomes reduce the cancer cell number by inducing apoptosis of the cancer cells.
  • the neural stem cell exosomes reduce the number of bladder cancer cells, breast cancer cells, glioma cells, liver cancer cells, melanoma cells, non-small-cell lung cancer cells, ovarian cancer cells, prostate cancer cells or renal cancer cells.
  • the exosomes induce apoptosis of breast, glioma, non-small-cell lung, liver, ovarian or renal cancer cells.
  • the exosomes reduce the number of cancer cells, for example bladder cancer cells, melanoma cells or prostate cancer cells, by a mechanism other than apoptosis.
  • the exosomes suppress growth of the cancer cells, in particular when apoptosis is induced.
  • the invention provides neural stem cell exosomes for use in a method of treating cancer by inducing cellular senescence in the cancer cells. It has been observed in Example A that senescence is induced by incubation of cancer cells with the exosomes and thereby appears to be a direct effect of the exosomes on the cancer cells.
  • the exosomes induce cellular senescence of lung cancer cells or a CNS cancer.
  • the lung cancer is non-small-cell lung cancer.
  • the CNS cancer is a glioma.
  • senescence is induced without overall inhibition of cell growth.
  • the exosomes induce cellular senescence of melanoma cells.
  • the neural stem cell exosomes have typically been isolated from a proliferating neural stem cell culture.
  • neural stem cell microparticles for use according to the invention is to isolate them from neural stem cells that have been cultured under standard conditions. These cells may be from the CTX0E03 cell line (deposited by the applicant with the ECACC as Accession No. 04091601).
  • the standard culture conditions typically maintain the characteristics of the cell line, in particular the sternness of the cell line, typically do not permit differentiation, and typically provides proliferating cells. Typically, the cells proliferate with a doubling time of 2 to 4 days and are passaged when sub-confluent.
  • Microparticles useful according to the invention are thus typically produced from neural stem cells that have not begun to differentiate, for example by isolation from sub-confluent cultured neural stem cells, or by isolation from cells that have been confluent for less than one week on the membrane of a multi-compartment bioreactor or in a standard cell culture flask such as a T- 175 flask.
  • the term "confluent” is given its usual meaning in the art, wherein the cells in the culture are all in contact and have no further room to grow; confluent cells cover substantially all of the membrane in the multi-compartment bioreactor.
  • cells positive for GFAP an astrocyte marker
  • DCX an early neuronal marker
  • Exosomes according to the invention may contain at least 5, at least 10, 15, 16, 17, 18, 19 or all 20 of the miRNAs identified in the results table in Example B.
  • at least the ten most abundant miRNAs in an exosome of the invention are selected from the twenty miRNAs identified in this table.
  • at least the fifteen most abundant miRNAs in an exosome of the invention are selected from the twenty miRNAs identified in this table.
  • hsa-miR-21-5p and hsa-miR-100-5p are present in the top five most abundant miRNAs in an exosome of the invention.
  • the microparticle may be derived from a neural stem cell line.
  • the neural stem cell line may be the "CTX0E03" cell line, the "STR0C05” cell line, the "HPC0A07” cell line or the neural stem cell line disclosed in Miljan et al Stem Cells Dev. 2009.
  • the microparticle is derived from a stem cell line that does not require serum to be maintained in culture.
  • the microparticle may have a size of between 30 nm and 1000 nm, or between 30 and 200 nm, or between 30 and 100 nm, as determined by electron microscopy; and/or a density in sucrose of 1.1-1.2 g/ml.
  • the microparticle may comprise RNA.
  • the RNA may be mRNA, miRNA, and/or any other small RNA.
  • the microparticle may comprise one, two, three, four or all five of hsa-miR-21-5p, hsa-miR-100-5p, hsa-let-7b-5p, hsa-let-7i-5p and has- miR-99a-5p.
  • the microparticle may comprise one, two, three or four of hsa-miR- 1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532; alternatively, it may comprise 1 , 2, 3, 4 or 5 of hsa-miR-181a-5p, hsa-miR-1246, hsa-miR-127-3p, hsa-miR-21-5p and hsa-miR-100-5p; or it may comprise 1 , 2, 3, 4 or 5 of hsa-miR-181a-5p, hsa-let-7a-5p, hsa-let-7f-5p, hsa-miR- 92b-3p, and hsa-miR-9-5p.
  • the microparticle may comprise one or more lipids, typically selected from ceramide, cholesterol, sphingomyelin, phosphatidylserine, phosphatidylinositol, phosphatidylcholine.
  • the microparticle may comprise one or more tetraspanins, typically CD63, CD81 , CD9, CD53, CD82 and/or CD37.
  • the microparticle may comprise one or more of TSG101 , Alix, CD109, thy-1 and CD133.
  • the microparticle may comprise at least 10 of the proteins present in Table 20 or Table 22.
  • the microparticle may comprise at least one biological activity of a neural stem cell or a neural stem cell-conditioned medium. At least one biological activity may be a pro-apoptotic or pro-senescent activity.
  • the microparticle of the invention is typically isolated or purified.
  • a fourth aspect of the invention provides a composition comprising a neural stem cell microparticle for use according to the first, second or third aspect and a pharmaceutically acceptable excipient, carrier or diluent.
  • the microparticle of the invention induces or enhances apoptosis or senescence of a cancer cell, typically as determined in an Annexin V or beta-galactosidase assay.
  • Figure 1 shows the Cancer cell line screening experiment workflow.
  • Figure 2 shows that a number of cancer cell lines show significant suppression of growth in response to exosome treatment.
  • Panel A Qualitative assessment of cells treated with increasing doses of CTX-derived exosomes for 72 hours revealed a dose-dependent reduction of DAPI-stained nuclei in a number of cell lines (MCF7 and SK-OV-3 shown as examples).
  • Panel B Automated image acquisition and quantitation using the InCell 2200 (GE Healthcare) revealed a statistically significant reduction in cell number in 7 of 23 cell lines screened. *p ⁇ 0.05; **p ⁇ 0.01 ; ***p ⁇ 0.001.
  • Figure 3 shows that exosome-mediated growth inhibition may be attributed to induction of apoptosis in a subset of cell lines.
  • Panel A A minor subset of cells showed an apparent dose-dependent increase in nuclear Annexin V staining as a marker of Apoptosis in response to treatment with CTX-derived exosomes (SNU-387 and SK-OV-3 cells shown as examples).
  • Panel B Quantitative analysis of nuclear-restricted Annexin V staining revealed 3 lines which showed a statistically significant increase in apoptosis in response to CTX-derived exosomes. All 3 of these lines also showed suppressed growth following exosome treatment. *p ⁇ 0.05; ***p ⁇ 0.001
  • Figure 4 shows that induction of cellular senescence is observed in two cell lines in response to exosome treatment.
  • Panel A Two cell lines (A549 and U118MG) showed visual evidence of a senescence response to CTX-derived exosome treatment by induction of beta-Galactosidase activity.
  • Panel B Quantification of this response revealed a statistically significant increase in cytoplasmic fluorescence intensity. Interestingly, induction of senescence in these two lines does not result in an overall inhibition of cell growth (see Figure 2).
  • *p ⁇ 0.05; ***p ⁇ 0.001 Figure 5 summarises the results depicted in Figures 2 to 4.
  • Figures 6 to 10 show responses to neural stem cell exosomes observed in breast cancer, glioblastoma, non-small-cell lung cancer, kidney and melanoma cell lines.
  • Figure 6 shows a trend towards increased apoptosis and decreased cell number in the breast cancer cell line BT-549.
  • Figure 7 shows a trend towards increased apoptosis and decreased cell number in the glioblastoma cell line U87.
  • Figure 8 shows a trend towards increased apoptosis and decreased cell number in the non- small-cell lung cancer cell line NCI-H23.
  • Figure 9 shows a trend towards increased apoptosis and decreased cell number in the renal adenocarcinoma cancer cell line ACHN.
  • Figure 10 shows a decreased cell number and increased senescence (as determined by beta- Galactosidase activity) in the melanoma cell line SK-MEL-28.
  • Figure 11 depicts electron micrographs of CTX0E03 conditionally-immortalised neural stem cells producing microparticles.
  • Panels A-E show intracellular multivesicular bodies (MVBs) containing exosomes between 30nm and 50nm in diameter and Panel F shows microvesicles >100nm in diameter released from neural stem cells through a process of budding at the cell membrane.
  • MVBs intracellular multivesicular bodies
  • Figure 12 is an outline protocol for the identification, characterisation and production of microparticles from stem cells.
  • Figure 13 shows the FACS detection (at 2ug/ml, 1 :250) of (i) CD63 in 2-week Integra cultured CTX0E03 exosomes (top left panel) and microvesicles (top right panel) and (ii) CD81 in 2-week Integra cultured CTX0E03 exosomes (bottom left panel) and microvesicles (bottom right panel).
  • Figure 14 shows the results of NanoSight analysis undertaken to determine the particle size and concentration of CTX0E03 exosomes (Figure 14A) and microvesicles (Figure 14B) cultured in the Integra Celline system for 1 , 2, 3, 4, 5 and 6 weeks.
  • Figure 15A shows the amount of protein (measured by BCA assay) extracted from 15ml of media containing microparticles purified from the Integra system compared to normal culture conditions (3 days T175).
  • Figure 15B shows the amount of isolated total RNA measured at 260/280nm extracted from 15ml of CTX0E03 conditioned media containing microparticles purified by filtration from the Integra system compared to normal culture conditions (3 days T175).
  • Figure 16 shows the quantity of purified exosomes obtained per ml culture medium from standard CTX0E03 (T175) cultures vs. the Integra CELLine system at the 3 week time point.
  • Figure 17A shows the concentration of exosomes harvested from two different flasks after 1 week, 2 weeks and 3 weeks of CTX0E03 Integra CELLine culture system.
  • Figure 17B shows the concentration of exosomes harvested from a single Integra CELLine flask during a 6 week continuous culture of CTX0E03 cells.
  • Figure 18 shows the fold change of expression levels of various mRNA markers measured in CTX0E03 cells cultured for 3 weeks in the Integra CELLine system compared to standard ("control") CTX0E03 (T175) cultures.
  • Figure 19 shows the fold up and down regulation of various miRNAs in exosomes obtained from CTX0E03 cells cultured for 3 weeks in Integra bioreactor culture and microparticles obtained from standard CTX0E03 (T175) cultures, assessed against a baseline expression level in CTX0E03 cells in standard (T175) culture.
  • Figure 20 depicts miRNA deep sequencing results. The miRNA profiles obtained from deep sequencing of miRNA from CTX0E03 cells ("CTX"), microvesicles (“MV”) and exosomes (“EXO”) cultured under standard (T175) conditions are shown in Figure 20A and 13B (results from two standard cultures, "EH” and "EL”).
  • CTX CTX0E03 cells
  • MV microvesicles
  • EXO exosomes
  • Figure 20C shows the percentage of miRNAs that are up-shuttled, the same, or down-shuttled in the exosomes compared to producer cells, for (i) the standard culture, (ii) 6 week Integra bioreactor culture and (iii) 1 1 week bioreactor culture (3 samples). Up-shuttled > 2, same ⁇ 2>, and down-regulated ⁇ 2 fold change (log2) accordingly.
  • Figures 20D to 20H show the miRNAs that are shuttled into exosomes compared with the cells producing them. Up-shuttled miRNAs are expressed as fold change calculated using the log2 of the normalized ratio of exosomes/cell producer. The normalization is obtained by dividing reads of each miRNA by total miRNA reads.
  • (D) summarises the most abundant miRNAs in exosomes obtained from the standard CTX0E03 cultures ("EH” and "EL”);
  • E shows exosomes obtained from CTX0E03 cells cultured for 6 weeks in an Integra bioreactor, and lists up-shuttled miRNAs with more than 250 reads per exosome sample;
  • F shows the miRNAs up-shuttled in exosomes when compared with the producer cells cultured for 11 weeks in an Integra bioreactor. 9 miRNA species are up-shuttled, all of which have more than 250 reads;
  • (G) shows a second sample of the miRNAs up-shuttled in exosomes when compared with the producer cells cultured for 11 weeks in an Integra bioreactor.
  • the diagram lists up-shuttled miRNAs with more than 250 reads per exosome sample; and (H) shows a third sample of the miRNAs up- shuttled in exosomes when compared with cell producer cultured for 11 weeks in an Integra bioreactor, showing up-shuttled miRNAs with more than 250 reads per exosome sample.
  • Figure 21 is an electropherogram showing the total RNA content profile in 2-week CTX0E03 cells, exosomes and microvesicles as determined by Agilent RNA bioanalyser.
  • Figure 22 is a schematic presentation of the percentage of coding genes fully overlapping exon, and non-coding transcripts located with intron or intergenic sequences (produced by running NGS BAM files against GENCODE sequence data set).
  • Figure 23 depicts the top ranking preferentially shuttled novel miRNAs in exosomes and MV compared to CTX0E03 producer cells.
  • Figure 24 shows Venn diagrams comparing the proteomic data from CTX0E03 exosomes and microvesicles (24A and 24B), and comparing neural stem cell exosomes with mesenchymal stem cell exosomes (24C and 24D).
  • Figure 24A illustrates the number of unique proteins within CTX0E03 exosomes and microvesicles, isolated from week 2 Integra culture system.
  • Figure 24B compares the biological processes associated with the identified proteins within the CTX0E03 exosomes and microvesicles.
  • Figure 24C compares the CTX0E03 neural stem cell exosome proteome to a Mesenchymal Stem Cell exosome
  • Figure 24D compares biological processes associated with the identified proteins in the MSC derived exosomes with the neural stem cell derived exosomes
  • Figure 25 shows the 30 biological processes found to be associated with NSC derived exosomes and not mesenchymal stem cell exosomes.
  • the present inventors have identified that neural stem cell derived exosomes show efficacy against a range of cancer cell lines, and that senescence or apoptosis is induced in discrete cancer cell lines.
  • the microparticles of the invention can be characterised and identified by these properties, using the assays described herein or other assays known to the skilled person.
  • the microparticles can be produced continuously, by isolation from conditioned media, for example in a bioreactor such as a multi-compartment bioreactor, which allows for large scale production and the provision of an "off-the-shelf" therapy.
  • the multi-compartment bioreactor is typically a two-compartment bioreactor.
  • An exemplary multi-compartment bioreactor is the CeLLine AD1000 bioreactor that is commercially available from Integra Biosciences AG, Zizers, Switzerland (Item No. 90025).
  • microparticles according to the invention are isolated from a proliferating neural stem cell culture.
  • This culture may be in a standard cell culture flask (such as a T-175 flask) or may be in a multi-compartment bioreactor.
  • the cells producing microparticles of this embodiment are cultured in a multi-compartment bioreactor, they are typically cultured for 4 weeks or less, for example 3 weeks or less, 2 weeks or less, or 1 week or less. This is because, as described elsewhere herein, prolonged culture in a multi-compartment bioreactor allows the stem cells to begin to differentiate, i.e. to express markers for defined neural cell types.
  • the microparticles are isolated from neural stem cells that are negative for markers of differentiated neural cells (e.g. GFAP " and/or DCX " ) but are positive for one or more markers of neural stem cells (e.g. Nesting.
  • the microparticles are exosomes isolated from proliferating neural stem cells that are negative for markers of differentiation.
  • the neural stem cells from which these microparticles are isolated are negative for DCX (doublecortin), which is an early neuronal marker.
  • the neural stem cells from which the microparticles are isolated are negative for GFAP (Glial fibrillary acidic protein), which is an astrocyte marker.
  • the neural stem cells have typically been cultured under conditions that maintain the characteristics of the cell line, in particular the sternness of the cell line. These are typically the standard culture conditions for a given cell or cell line, which do not permit differentiation of the stem cells.
  • proliferating cells have a doubling time of 2 to 4 days. These neural stem cells are typically passaged when sub-confluent.
  • micropartides of the invention can be produced by any method, not limited to those disclosed or exemplified herein. Whether or not a microparticle is efficacious against cancer cells can be readily determined using the assays described herein.
  • the invention provides, in one aspect, micropartides that are efficacious in reducing the number of cancer cells present in a culture or tumour, or efficacious in inducing senescence in cancer cells.
  • the microparticle is, in one embodiment, obtainable from a proliferating neural stem cell that has been cultured in: a standard cell culture flask such as a T-175 flask; or in a multicompartment bioreactor for 4 weeks or less.
  • a neural stem cell microparticle is a microparticle that is produced by a neural stem cell.
  • the microparticle is secreted by the neural stem cell.
  • the microparticle may be an exosome, microvesicle, membrane particle, membrane vesicle, exosome-like vesicle, ectosome-like vesicle, ectosome or exovesicle. More typically, the microparticle is an exosome or a microvesicle.
  • Micropartides from other cells, such as mesenchymal stem cells, are known in the art.
  • microparticle is an extracellular vesicle of 30 to 1000 nm diameter that is released from a cell. It is limited by a lipid bilayer that encloses biological molecules.
  • microparticle is known in the art and encompasses a number of different species of microparticle, including a membrane particle, membrane vesicle, microvesicle, exosome-like vesicle, exosome, ectosome-like vesicle, ectosome or exovesicle.
  • the different types of microparticle are distinguished based on diameter, subcellular origin, their density in sucrose, shape, sedimentation rate, lipid composition, protein markers and mode of secretion (i.e. following a signal (inducible) or spontaneously (constitutive)).
  • Microparticles are thought to play a role in intercellular communication by acting as vehicles between a donor and recipient cell through direct and indirect mechanisms.
  • Direct mechanisms include the uptake of the microparticle and its donor cell-derived components (such as proteins, lipids or nucleic acids) by the recipient cell, the components having a biological activity in the recipient cell.
  • Indirect mechanisms include microvesicle-recipient cell surface interaction, and causing modulation of intracellular signalling of the recipient cell.
  • microparticles may mediate the acquisition of one or more donor cell-derived properties by the recipient cell. It has been observed that, despite the efficacy of stem cell therapies in animal models, the stem cells do not appear to engraft into the host. Accordingly, the mechanism by which stem cell therapies are effective is not clear.
  • microparticles and stem cells of the invention are isolated.
  • isolated indicates that the microparticle, microparticle population, cell or cell population to which it refers is not within its natural environment.
  • the microparticle, microparticle population, cell or cell population has been substantially separated from surrounding tissue.
  • the microparticle, microparticle population, cell or cell population is substantially separated from surrounding tissue if the sample contains at least about 75%, in some embodiments at least about 85%, in some embodiments at least about 90%, and in some embodiments at least about 95% microparticles and/or stem cells.
  • the sample is substantially separated from the surrounding tissue if the sample contains less than about 25%, in some embodiments less than about 15%, and in some embodiments less than about 5% of materials other than the microparticles and/or stem cells.
  • Such percentage values refer to percentage by weight.
  • the term encompasses cells or microparticles which have been removed from the organism from which they originated, and exist in culture.
  • the term also encompasses cells or microparticles which have been removed from the organism from which they originated, and subsequently re- inserted into an organism.
  • the organism which contains the re-inserted cells may be the same organism from which the cells were removed, or it may be a different organism.
  • Neural stem cells naturally produce micropartides by a variety of mechanisms, including budding of the plasma membrane (to form membrane vesicles and microvesicles) and as a result of the fusion of intracellular multivesicular bodies (which contain micropartides) with the cell membrane and the release of the micropartides into the extracellular compartment (to secrete exosomes and exosome-like vesicles).
  • the neural stem cell that produces the micropartides of the invention can be a fetal, an embryonic, or an adult neural stem cell, such as has been described in US5851832, US6777233, US6468794, US5753506 and WO-A-2005121318.
  • the fetal tissue may be human fetal cortex tissue.
  • the cells can be selected as neural stem cells from the differentiation of induced pluripotent stem (iPS) cells, as has been described by Yuan et al. (2011) or a directly induced neural stem cell produced from somatic cells such as fibroblasts (for example by constitutively inducing Sox2, Klf4, and c-Myc while strictly limiting Oct4 activity to the initial phase of reprogramming as recently by Their et al, 2012).
  • iPS induced pluripotent stem
  • Human embryonic stem cells may be obtained by methods that preserve the viability of the donor embryo, as is known in the art (e.g. Klimanskaya et al., 2006, and Chung et al. 2008).
  • Such non-destructive methods of obtaining human embryonic stem cell may be used to provide embryonic stem cells from which micropartides of the invention can be obtained.
  • micropartides of the invention can be obtained from adult stem cells, iPS cells or directly-induced neural stem cells. Accordingly, micropartides of the invention can be produced by multiple methods that do not require the destruction of a human embryo or the use of a human embryo as a base material.
  • the neural stem cell population from which the micropartides are produced is substantially pure.
  • substantially pure refers to a population of stem cells that is at least about 75%, in some embodiments at least about 85%, in some embodiments at least about 90%, and in some embodiments at least about 95% pure, with respect to other cells that make up a total cell population.
  • this term means that there are at least about 75%, in some embodiments at least about 85%, in some embodiments at least about 90%, and in some embodiments at least about 95% pure, neural stem cells compared to other cells that make up a total cell population.
  • a neural stem cell microparticle comprises at least one lipid bilayer which typically encloses a milieu comprising lipids, proteins and nucleic acids.
  • the nucleic acids may be deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA).
  • RNA may be messenger RNA (mRNA), micro RNA (miRNA) or any miRNA precursors, such as pri-miRNA, pre-miRNA, and/or small nuclear RNA (snRNA).
  • a neural stem cell microparticle retains at least one biological function of the stem cell from which it is derived.
  • Biological functions that may be retained include the ability to reduce the cell count of a cancer cell culture, the ability to induce apoptosis in a cancer cell, or the ability to induce senescence in a cancer cell.
  • the at least one biological function is that of a proliferating neural stem cell, typically that of a neural stem cell that has been cultured in a T-175 flask under standard conditions.
  • Microparticles of the invention are efficacious against a range of cancer cells, as shown in Example A.
  • Example A in response to neural stem cell exosome treatment: (i) a number of cancer cell lines show reduced cell count; (ii) apoptosis increased in some cancer cell lines; and (iii) senescence increased in some cancer cell lines.
  • Efficacy is demonstrated against cancers of bladder, breast, CNS, liver, melanoma, lung, ovary prostate and renal tissue.
  • the exemplified cell lines are:
  • the cancer type is as set out in the second and/or third columns of this summary table.
  • the neural stem cell exosomes reduce the number of bladder cancer cells.
  • the neural stem cell exosomes reduce the number of breast cancer cells. In a further embodiment, the number of breast cancer cells is reduced by apoptosis of the cells. In one embodiment, the neural stem cell exosomes reduce the number of glioma cells.
  • the number of glioma cancer cells is reduced by apoptosis of the cells.
  • the neural stem cell exosomes reduce the number of liver cancer cells. In a further embodiment, the number of liver cancer cells is reduced by apoptosis of the cells.
  • the neural stem cell exosomes reduce the number of melanoma cells.
  • the neural stem cell exosomes reduce the number of non-small-cell lung cancer cells. In a further embodiment, the number of non-small-cell lung cancer cells is reduced by apoptosis of the cells.
  • the neural stem cell exosomes reduce the number of ovarian cancer cells. In a further embodiment, the number of ovarian cancer cells is reduced by apoptosis of the cells.
  • the neural stem cell exosomes reduce the number of prostate cancer cells.
  • the neural stem cell exosomes reduce the number of renal cancer cells.
  • the number of renal cancer cells is reduced by apoptosis of the cells.
  • the examples demonstrate an effect on renal adenocarcinoma cells.
  • the invention provides neural stem cell exosomes for use in a method of treating cancer by inducing senescence in the cancer cells.
  • the exosomes induce cellular senescence of lung cancer cells.
  • the exosomes induce cellular senescence of a CNS cancer.
  • the lung cancer is non-small-cell lung cancer.
  • the CNS cancer is a glioma.
  • the exosomes induce cellular senescence in melanoma cells.
  • the exosomes are able to reduce the number of cancer cells.
  • the reduction can be in a culture or in a tumour.
  • the ability of exosomes to reduce the number of cancer cells can be confirmed in a culture of cells, in vitro.
  • Methods to count cells are well known.
  • An exemplary cell count assay uses DAPI staining and cell imaging, as used in the Examples.
  • a reduced cell count in this assay may typically be defined as a decrease in the number of cells following incubation with the exosomes, compared to a control culture to which exosomes are not added.
  • the cell count is determined after the cells and exosomes have been incubated for 72 hours.
  • a typical range to test is the addition of 10 9 to 10 11 exosomes.
  • reduction of cancer cell number is a statistically significant reduction in the number of cells, with a p value of p ⁇ 0.05, typically p ⁇ 0.001 , in the presence of the exosomes, compared to the control culture without added exosomes.
  • the reduced cell count may be attributed to apoptosis in the cancer cells. It is observed in Example A that there is an increase in apoptosis in response to treatment with neural stem cell exosomes.
  • Assays for apoptosis are known, and typically involve detection of the fragmentation of the genome (e.g. mitochondrial membrane potential assays), or of apoptosis-related cellular proteins such as Annexin V or a caspase.
  • An exemplary assay detects Annexin V, as set out in the Examples, wherein an increase in Annexin V indicates induction of apoptosis.
  • An increase in Annexin V in this assay may typically be defined as an increase in Annexin V staining following incubation with the exosomes, compared to a control culture to which exosomes are not added. Typically the Annexin V staining is determined after the cells and exosomes have been incubated for 72 hours. A typical range to test is the addition of 10 9 to 10 11 exosomes. Dose dependency of the effect may be observed.
  • induction of apoptosis is a statistically significant increase in Annexin V staining with a p value of p ⁇ 0.05, typically p ⁇ 0.001 , in the presence of the exosomes, compared to the control culture without added exosomes. Increased senescence
  • the exosomes are able to induce, or increase, senescence in cancer cells.
  • Assays for senescence are known, and typically involve detection of proteins that are characteristic of senescent cells.
  • One such protein is beta-galactosidase, as set out in the between 30nm and 200nm, more typically between 50nm and 150nm.
  • exosomes are typically positive for the Alix marker (UNIPROT Accession No. Q8WUM4).
  • Figure 11 F and Table 21 shows the observed size of typical neural stem cell microvesicles, with a mode diameter of approximately 150nm - 200nm, or a median diameter of approximately
  • microvesicles of the invention typically have a diameter between 100 and 1000nm, more typically between 150nm and 350nm.
  • microparticles of the invention express the CD 133 surface marker. Other microparticles of the invention do not express the CD133 surface marker.
  • Exosomes refers to a biological molecule whose presence, concentration, activity, or phosphorylation state may be detected and used to identify the phenotype of a cell.
  • Exosomes are endosome-derived lipid microparticles of typically 30-1 OOnm diameter and sometimes between 100nm and 200nm diameter, that are released from the cell by exocytosis. Exosome release occurs constitutively or upon induction, in a regulated and functionally relevant manner. During their biogenesis, exosomes incorporate a wide range of cytosolic proteins (including chaperone proteins, integrins, cytoskeletal proteins and the tetraspanins) and genetic material.
  • cytosolic proteins including chaperone proteins, integrins, cytoskeletal proteins and the tetraspanins
  • exosomes are considered to be inter-cellular communication devices for the transfer of proteins, lipids and genetic material between cells, in the parent cell microenvironment and over considerable distance.
  • the invention is not bound by this theory, it is possible that the exosomes are responsible for the efficacy of the neural stem cells. Therefore, exosomes from neural stem cells are themselves expected to be therapeutically efficacious.
  • Microparticles retain at least some of the functions of the stem cells that produce them. Therefore, it is possible to design microparticles by manipulating the stem cell (which can be any stem cell type and is not limited to neural stem cells, although the neural stem cell microparticles of the invention are expressly included as an embodiment) to possess one or more desired functions, typically protein or miRNA. Microparticles for use according to the invention can be designed in this way. The manipulation will typically be genetic engineering, to introduce one or more exogenous coding, non-coding or regulatory nucleic acid sequences into the stem cell.
  • the exosome-producing stem cell can be transformed or transfected to express (high levels of) VEGF and/or bFGF, which would then be incorporated into the microparticles produced by that stem cell.
  • iPS cells can be used to produce microparticles, and these cells can be designed to produce the proteins and nucleic acids (e.g. miRNA) that are required in the microparticles produced by the iPS cells.
  • the invention therefore provides ad hoc neural stem cell microparticles that contain a function that is not naturally present in the stem cell from which is produced, i.e. the microparticles (e.g. exosomes) contain one or more exogenous protein or nucleic acid sequences, are not naturally-occurring and are engineered.
  • isolated or purified microparticles according to the invention are loaded with one or more exogenous nucleic acids, lipids, proteins, drugs or prodrugs which are intended to perform a desired function in a target cell.
  • exogenous material can optionally be directly added to the microparticles.
  • exogenous nucleic acids can be introduced into the microparticles by electroporation.
  • the microparticles can then be used as vehicles or carriers for the exogenous material.
  • microparticles that have been isolated from the cells that produced them are loaded with exogenous siRNA, typically by electroporation, to produce microparticles that can be deployed to silence one or more pathological genes.
  • microparticles can be used as vehicles to deliver one or more agents, typically therapeutic or diagnostic agents, to a target cell, for example to enhance or complement their endogenous ant-cancer effect.
  • a neural stem cell exosome comprising exogenous siRNA capable of silencing one or more pathological genes.
  • the abundance of one or more miRNAs that are identified in the microparticles is increased by introducing more of this miRNA into the exosomes.
  • hsa-miR-100-5p is endogenous to the neural stem cell exosomes of the invention.
  • additional hsa-miR-100-5-p can optionally be added into those exosomes.
  • the addition of this exogenous miRNA can further potentiate or enhance the exosome function.
  • the invention provides a population of isolated neural stem cell microparticles, wherein the population essentially comprises only microparticles of the invention, i.e. the microparticle population is pure.
  • the microparticle population comprises at least about 80% (in other aspects at least 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100%) of the microparticles of the invention.
  • the isolated neural stem cell microparticle of the invention is characterised in that it has a distinctive expression profile for certain markers and is distinguished from microparticles from other cell types.
  • a marker When a marker is described herein, its presence or absence may be used to distinguish the microparticle.
  • the term “may comprise” or “may express” also discloses the contrary embodiment wherein that marker is not present, e.g. the phrase "the microparticle may comprise one or more tetraspanins, typically CD63, CD81 , CD9, CD53, CD82 and/or CD37” also describes the contrary embodiment wherein the microparticle may not comprise one or more tetraspanins, typically CD63, CD81 , CD9, CD53, CD82 and/or CD37.
  • the neural stem cell microparticle of the invention is typically considered to carry a marker if at least about 70% of the microparticles of the population, e.g. 70% of the membrane particles, membrane vesicles, microvesicles, exosome-like vesicles, exosomes, ectosome-like vesicles, ectosomes or exovesicles show a detectable level of the marker. In other aspects, at least about 80%, at least about 90% or at least about 95% or at least about 97% or at least about 98% or more of the population show a detectable level of the marker. In certain aspects, at least about 99% or 100% of the population show detectable level of the markers.
  • Quantification of the marker may be detected through the use of a quantitative RT-PCR (qRT-PCR) or through fluorescence activated cell sorting (FACS). It should be appreciated that this list is provided by way of example only, and is not intended to be limiting.
  • qRT-PCR quantitative RT-PCR
  • FACS fluorescence activated cell sorting
  • a neural stem cell microparticle of the invention is considered to carry a marker if at least about 90% of the microparticles of the population show a detectable level of the marker as detected by FACS.
  • the markers described herein are considered to be expressed by a cell of the population of the invention, if its expression level, measured by qRT-PCR has a crossing point (Cp) value below or equal to 35 (standard cut off on a qRT-PCR array).
  • Cp represents the point where the amplification curve crosses the detection threshold, and can also be reported as crossing threshold (ct).
  • the invention relates to microparticles produced by a neural stem cell population characterised in that the cells of the population express one or more of the stem cell markers Nestin or Sox2.
  • the stem cells of the population are negative for one or more of the differentiation markers GFAP, ⁇ tubulin, DCX, GALC, TUBB3, GDNF and IDO.
  • the microparticle is an exosome and the population of exosomes is negative for DCX (doublecortin - an early neuronal marker), GFAP (Glial fibrillary acidic protein - an astrocyte marker), GALC, TUBB3, GDNF and IDO.
  • the neural stem cell microparticles of the invention may express one or more protein markers at a level which is lower or higher than the level of expression of that marker in a mesenchymal stem cell microparticle of the same species. Protein markers that are expressed by the CTX0E03 cell microparticles are identified herein and below.
  • the microparticles may express a protein marker at a level relative to a tubulin or other such control protein(s).
  • the microparticles of the invention may express that protein at a level of at least +/-1.2 fold change relative to the control protein, typically at least +/-1.5 fold change relative to the control protein, at least +1-2 fold change relative to the control protein or at least +/-3 fold change relative to the control protein.
  • the microparticles may express a protein marker at a level of between 10 "2 and 10 "6 copies per cell relative to a tubulin or other control protein. In some embodiments, the microparticles of the invention may express that protein at a level of between 10 "2 and 10 "3 copies per cell relative to a tubulin or other control protein.
  • the neural stem cell microparticles of the invention may express one or more miRNAs (including miRNA precursors) at a level which is lower or higher than the level of expression of that miRNA (including miRNA precursors) in a mesenchymal stem cell microparticle of the same species.
  • miRNA markers that are expressed by the CTX0E03 cell microparticles are identified below.
  • the microparticles of the invention may express the marker miRNA at a level of least +/- 1 .5 fold change, typically at least +/- 2 fold change or at least +/- 3 fold change (calculated according to the AAct method, which is well-known) relative to U6B or 15a, or any other miRNA reference gene, also referred to as an internal control gene.
  • the neural stem cell microparticles of the invention may express one or more mRNAs at a level which is lower or higher than the level of expression of that mRNA in a mesenchymal stem cell microparticle of the same species.
  • the microparticles of the invention may express the marker mRNA at a level of least +/- 1 .5 fold change, typically at least +/- 2 fold change or at least +/- 3 fold change (calculated according to the AAct method) relative to ATP5B or YWHAZ, or any other reference gene, also referred to as an internal control gene.
  • Exosomes of the invention typically express specific integrins, tetraspanins, MHC Class I and/or Class II antigens, CD antigens and cell-adhesion molecules on their surfaces, which may facilitate their uptake by specific cell types.
  • Exosomes contain a variety of cytoskeletal proteins, GTPases, clathrin, chaperones, and metabolic enzymes (but mitochondrial, lysosomal and ER proteins are excluded, so the overall profile does not resemble the cytoplasm). They also contain mRNA splicing and translation factors.
  • exosomes generally contain several proteins such as HSP70, HSP90, and annexins that are known to play signalling roles yet are not secreted by classical (ER-Golgi) mechanisms.
  • the lipid bilayer of an exosome is typically enriched with cholesterol, sphingomyelin and ceramide.
  • Exosomes also express one or more tetraspanin marker proteins. Tetraspanins include CD81 , CD63, CD9, CD53, CD82 and CD37. Exosomes can also include growth factors, cytokines and RNA, in particular miRNA. Exosomes typically express one or more of the markers TSG101 , Alix, CD109, thy-1 and CD133. Alix (Uniprot accession No. Q8WUM4), TSG101 (Uniprot accession No. Q99816) and the tetraspanin proteins CD81 (Uniprot accession No. P80033) and CDS (Uniprot accession No. P21926) are characteristic exosome markers.
  • Alix is an endosomal pathway marker. Exosomes are endosomal-derived and, accordingly, a microparticle positive for this marker is characterised as an exosome. Exosomes of the invention are typically positive for Alix. Microvesicles of the invention are typically negative for Alix.
  • Tables 19 and 21 list all proteins detected by mass spectrometry in exosomes and microvesicles, respectively, isolated from CTX0E03 cells cultured for two weeks in an Integra Celline multi-compartment bioreactor.
  • Exosomes and microvesicles of the invention may contain at least a proportion of the proteins identified in Tables 19 and 21 , respectively.
  • exosomes of the invention comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% of the proteins listed in Table 19.
  • microvesicles of the invention typically comprise at least 70% at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% of the proteins listed in Table 21.
  • the proteome of a microvesicle or exosome of the invention is least 70%, at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% identical to the proteome provided in Table 19 (exosome) or Table 21 (microvesicle).
  • mass spectrometry is typically used, for example the LC/MS/MS method described in Example 18.
  • Tables 20 and 22 show the 100 most abundant proteins detected by mass spectrometry in exosomes and microvesicles, respectively, isolated from CTX0E03 cells cultured for two weeks in an Integra Celline multi-compartment bioreactor.
  • Exosomes and microvesicles of the invention may contain at least a proportion of the proteins identified in Tables 20 and 22, respectively.
  • an exosome of the invention comprises the first ten proteins listed in Table 20, more typically the first 20, the first 30, the first 40 or the first 50 proteins listed in Table 20.
  • a microparticle of the invention typically comprises the first ten proteins listed in Table 22, more typically the first 20, the first 30, the first 40 or the first 50 proteins listed in Table 22.
  • an exosome of the invention comprises all 100 proteins listed in Table 20.
  • a microvesicle of the invention comprises all 100 proteins listed in Table 22.
  • the 100 most abundant proteins in an exosome or microvesicle of the invention contain at least 70 of the proteins identified in Table 20 (exosome) or Table 22 (microparticle). More typically, the 100 most abundant proteins in an exosome or microvesicle of the invention contain at least 80, at least 90, at least 95, 96, 97, 98 or 99, or all 100 of the proteins identified in Table 20 (exosome) or Table 22 (microparticle).
  • Example B provides the most abundant miRNAs identified by Next Generation Sequencing of four batches of exosomes derived from proliferating neural stem cells.
  • the results table in Example B therefore provides a typical miRNA profile of typical exosomes obtained from proliferating neural stem cells.
  • miRNAs are: hsa-miR-21-5p; hsa-miR-100-5p; hsa-let-7b-5p; hsa-let-7i-5p; hsa-miR-99a-5p; hsa-let 7a-5p; hsa-let-7c-5p; hsa-miR-151a-3p; hsa-miR-30d-5p; hsa-miR-10a-5p; hsa-let-7f-5p; hsa-miR-9-5p; hsa-miR-409-3p; hsa-miR-92a-3p; hsa-miR-148a-3p; hsa-miR-423-3p; hsa-miR-128-3p; hsa-miR-26a-5p; hsa-miR-370-3p; hsa-miR-30
  • Exosomes of according to the invention may contain at least 5, at least 10, 15, 16, 17, 18, 19 or all 20 of these miRNAs.
  • at least the ten most abundant miRNAs in an exosome of the invention are selected from the 20 miRNAs identified in Example B (and immediately above).
  • at least the fifteen most abundant miRNAs in an exosome of the invention are selected from the twenty miRNAs identified in Example B (and immediately above).
  • hsa-miR-21-5p and hsa-miR-100-5p are present in the top five most abundant miRNAs in an exosome of the invention; optionally hsa-let-7b-5p may also be also present in the five most abundant miRNAs in an exosome of the invention.
  • hsa-miR-21-5p, hsa-miR-100-5p and hsa-let-7b-5p are three of the four most abundant miRNAs in an exosome of the invention. Abundance may optionally be determined by next generation sequencing, for example as set out in Example B or as described in Example 17.
  • hsa-miR-21-5p or hsa-miR-100-5p is the most abundant miRNA in an exosome of the invention.
  • Example 17A-C shows the results of an earlier initial experiment to deep sequence miRNA present in CTX0E03 cells (standard culture) and in microvesicles and exosomes produced by these cells.
  • This Example shows that, surprisingly, the number of different miRNA species present in the microparticles is greatly reduced compared to the number of different miRNA species present in the cells; the microparticles contain fewer than 120 different miRNAs whereas the cells contain between 450 and 700 miRNA species.
  • the tested microparticles were observed to contain a majority of hsa-miR-1246.
  • Exosomes and microvesicles of the invention may contain at least a proportion of the miRNA species identified in Tables 7-10.
  • exosomes of the invention comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% of the miRNAs listed in Tables 8 and 10.
  • microvesicles of the invention typically comprise at least 70% at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% of the miRNAs listed in Tables 7 and 9.
  • the total miRNA profile of a microvesicle or exosome of the invention is least 70%, at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% identical to the total miRNA profile provided in Tables 8 and 10 (exosome) or Tables 7 and 9 (microvesicle).
  • deep sequencing is typically used, for example the method described in Example 17.
  • microparticles e.g. exosomes may contain one, two, three or all four of hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532.
  • each of hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and/or hsa-miR-4532 is present in the microparticle, e.g. exosome, at a higher read count than is present in the cell that produced the microparticle.
  • miR-1246 typically has a read count in the microparticle at least twice the read count in the cell, more typically at least 4, 5, 6, 7, or 8 times the read count in the cell, and optionally 10, 15 or 20 times the read count in the cell.
  • microparticles can contain hsa-let-7a-5p, has-miR-92b-3p, hsa-miR-21-5p, hsa-miR-92a-3p, hsa-miR-10a-5p, hsa-100-5p and/or hsa-99b-5p at a lower read count than is present in the cell that produced the microparticle.
  • each of these miRNAs has a read count of less than 1000 in the microparticles of the invention, more typically less than 100, for example less than 50.
  • microparticles of the invention contain hsa-let-7a-5p at a read count of less than 50 or less than 25.
  • microparticles of the invention contain fewer than 150 types of miRNA (i.e. different miRNA species) when analysed by deep sequencing, typically fewer than 120 types of miRNA.
  • hsa-miR-3676-5p hsa-miR-4485, hsa-miR-4497, hsa-miR-21-5p, hsa-miR- 3195, hsa-miR-3648, hsa-miR-663b, hsa-miR-3656, hsa-miR-3687, hsa-miR-4466, hsa-miR- 4792, hsa-miR-99b-5p and hsa-miR-1973 may be present in the microparticles of the invention.
  • hsa-miR-3195 Although the absolute reads of hsa-miR-3195 are in the range of -40 for exosomes and microvesides, there is no hsa-miR- 3195 detected in the cells. Accordingly, hsa-miR-3195 is uniquely found in the exosomes and microvesicles and, optionally, in one embodiment, an exosome or microvesicle of the invention comprises hsa-miR-3195. In one embodiment, microparticles of the invention comprise one or more of the following miRNA precursors:
  • microparticles of the invention comprise one, two or three of the following mature miRNAs derived from the precursors listed above (as detailed in part D of Example 17): ggcggagugcccuucuuccugg (derived from AL161626.1-201) (SEQ ID NO:743)
  • ggagggcccaaguccuucugau (derived from AP000318.1-201) (SEQ ID NO:744)
  • gaccaggguccggugcggagug (derived from AC079949.1-201) (SEQ ID NO:745)
  • the invention provides a composition comprising one or more of the miRNA precursors AC079949.1 , AP000318.1 , AL161626.1 , AC004943.1 and AL121897.1 in combination with a neural stem cell microparticle of the invention.
  • the invention provides a composition comprising one or more of the mature miRNAs ggcggagugcccuucuuccugg (derived from AL161626.1-201), ggagggcccaaguccuucugau (derived from AP000318.1-201) and gaccaggguccggugcggagug (derived from AC079949.1-201) in combination with a neural stem cell microparticle of the invention.
  • the composition is a pharmaceutical composition comprising one or more of the miRNA precursors and/or one or more of the mature miRNAs and a pharmaceutically-acceptable carrier or diluent in combination with a neural stem cell microparticle of the invention.
  • Example 17 shows that neural stem cell microparticles isolated from CTX0E03 cells comprise a variety of non-coding RNA species. It is expected that microparticles isolated from CTX0E03 cells cultured for at least 10 weeks, e.g. for about 11 weeks, in an Integra Celline multicompartment bioreactor will contain at least a proportion of those non-coding RNA species.
  • microparticles of the invention comprise one or more of ribosomal RNA, small nucleolar RNA, small nuclear RNA, microRNA, large intergenic non-coding RNA and miscellaneous other RNA (e.g. RMRP, vault RNA, metazoan SRP and/or RNY).
  • ribosomal RNA small nucleolar RNA
  • small nuclear RNA small nuclear RNA
  • microRNA large intergenic non-coding RNA
  • miscellaneous other RNA e.g. RMRP, vault RNA, metazoan SRP and/or RNY.
  • Example 12 shows miRNAs present in microparticles produced by the CTX0E03 cells and having a Cp below 35 as determined by a qRT-PCR array.
  • Microparticles isolated from CTX0E03 cells cultured for at least 10 weeks, e.g. for about 11 weeks, in an Integra Celline multi-compartment bioreactor may, in one embodiment contain 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 or more, or all, of the following miRNAs (identified according by name according to Ambros et al and accessible at www.mirbase.org):
  • the CTX0E03 micropartides contain 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or more of the following miRNAs (which are selected from the list above):
  • one, two, three, four, five, six, seven, eight, nine, ten, 15, 20, 25 or more of the following miRNAs are present in the exosomes of the invention.
  • Examples 17D and 17E demonstrate that hsa-miR-1246, hsa-miR-4492, hsa-miR-4532, and hsa-miR-4488 were still present in exosomes isolated from CTX0E03 cells that have been cultured in a bioreactor for six weeks.
  • hsa-miR-4492, hsa-miR-4532, and hsa-miR-4488 are shown to be almost absent in exosomes isolated from CTX0E03 cells that have been cultured in a bioreactor for eleven weeks.
  • Exosomes and microvesicles may contain at least a proportion of the miRNA species identified in Table E3, or at least a proportion of the miRNA species identified in Table E4.
  • exosomes comprise 1 , 2, 3, 4 or 5 of these miRNAs. In another embodiment, exosomes comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or all of the miRNAs listed in Table E3.
  • deep sequencing is typically used, for example the method described in Example 17.
  • exosomes can optionally comprise 1 , 2, 3, 4 or 5 of these miRNAs.
  • exosomes can comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or all of the miRNAs listed in Table E4.
  • exosomes may comprise hsa-miR-486-5p.
  • Example 13 shows proteins present in microparticles produced by the CTX0E03 cells, as detected by a dot-blot.
  • Microparticles of the invention may typically contain 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or all of the following proteins:
  • Galectin-3 and Thrombospondin-1 are also identified as present in exosomes and microvesicles in Example 18.
  • TIMP-1 is identified in Example 18 as being present in exosomes.
  • Microparticles of the invention may contain one or more of Galectin-3, Thrombospondin and TIMP-1.
  • Example 13 also shows that the microparticles produced by the CTX0E03 cells may also express 1 , 2, 3, 4 or 5 of the following proteins:
  • EGF-R and Csk are also identified as present in exosomes and microvesicles in Example 18.
  • Neural Stem cells in multi-compartment bioreactor culture are also identified as present in exosomes and microvesicles in Example 18.
  • neural stem cells express a number of markers at significantly higher levels than neural stem cells cultured according to standard procedure in a standard single-compartment T175 flask.
  • CTX0E03 neural stem cells cultured for three weeks in a multi-compartment bioreactor express DCX, GALC, GFAP, TUBB3, GDNF and IDO at a higher level than neural stem cells cultured in a standard single-compartment T175 cell culture.
  • Neural stem cells cultured for even longer periods, e.g. at least 10 weeks, may also express a number of these markers at significantly higher levels than neural stem cells cultured according to standard procedure in a standard single-compartment T175 flask or, optionally, than neural stem cells cultured in a multicompartment bioreactor culture for three weeks.
  • the upregulated markers include DCX (doublecortin - an early neuronal marker), GFAP (Glial fibrillary acidic protein - an astrocyte marker), GALC, TUBB3, GDNF and IDO.
  • CTX0E03 cells are able to differentiate into 3 different cell types: neurons, astrocytes and oligodendrocytes.
  • the high levels of DCX and GFAP after only three weeks in a multi-compartment bioreactor indicates that the cultured stem cells have partially differentiated and have entered the neuronal (DCX+ cells) and/or astrocytic (GFAP+ cells) lineage.
  • bioreactor is to be given its usual meaning in the art, i.e. an apparatus used to carry out a bioprocess.
  • the bioreactors described herein are suitable for use in stem cell culture.
  • Simple bioreactors for cell culture are single compartment flasks, such as the commonly-used T-175 flask (e.g. the BD FalconTM 175 cm 2 Cell Culture Flask, 750 ml, tissue-culture treated polystyrene, straight neck, blue plug-seal screw cap, BD product code 353028).
  • Bioreactors can have multiple compartments, as is known in the art. These multi-compartment bioreactors typically contain at least two compartments separated by one or more membranes or barriers that separate the compartment containing the cells from one or more compartments containing gas and/or culture medium. Multi-compartment bioreactors are well-known in the art.
  • An example of a multi-compartment bioreactor is the Integra CeLLine bioreactor, which contains a medium compartment and a cell compartment separated by means of a 10 kDa semi- permeable membrane; this membrane allows a continuous diffusion of nutrients into the cell compartment with a concurrent removal of any inhibitory waste product.
  • the individual accessibility of the compartments allows to supply cells with fresh medium without mechanically interfering with the culture.
  • a silicone membrane forms the cell compartment base and provides an optimal oxygen supply and control of carbon dioxide levels by providing a short diffusion pathway to the cell compartment. Any multi-compartment bioreactor may be used according to the invention.
  • Example 16 show that the miRNA content of exosomes produced by neural stem cells that have been cultured in a multi-compartment bioreactor, for three weeks, is different from the miRNA content of stem cells cultured in standard T-175 flasks and from microparticles produced by the neural stem cells cultured in a single-compartment T175 culture flask for three weeks.
  • the miRNA content of exosomes of the invention may also differ from the miRNA content of stem cells cultured in standard T-175 or microparticles derived therefrom.
  • the term “expressed” is used to describe the presence of a marker within a cell or microparticle. In order to be considered as being expressed, a marker must be present at a detectable level. By “detectable level” is meant that the marker can be detected using one of the standard laboratory methodologies such as qRT-PCR, or qPCR, blotting, Mass Spectrometry or FACS analysis. A gene is considered to be expressed by a cell or microparticle of the population of the invention if expression can be reasonably detected at a crossing point (cp) values below or equal 35.
  • the terms “express” and “expression” have corresponding meanings. At an expression level below this cp value, a marker is considered not to be expressed.
  • the comparison between the expression level of a marker in a stem cell or microparticle of the invention, and the expression level of the same marker in another cell or microparticle, such as for example an mesenchymal stem cell may preferably be conducted by comparing the two cell/microparticle types that have been isolated from the same species.
  • this species is a mammal, and more preferably this species is human.
  • Such comparison may conveniently be conducted using a reverse transcriptase polymerase chain reaction (RT-PCR) experiment.
  • RT-PCR reverse transcriptase polymerase chain reaction
  • the term "significant expression” or its equivalent terms "positive” and “+” when used in regard to a marker shall be taken to mean that, in a cell or microparticle population, more than 20%, preferably more than, 30%, 40%, 50%, 60%, 70%, 80%, 90% 95%, 98%, 99% or even all of the cells of the eel Is/micro particles express said marker.
  • microparticle surface markers may be determined, for example, by means of flow cytometry and/or FACS for a specific cell surface marker using conventional methods and apparatus (for example a Beckman Coulter Epics XL FACS system used with commercially available antibodies and standard protocols known in the art) to determine whether the signal for a specific microparticle surface marker is greater than a background signal.
  • the background signal is defined as the signal intensity generated by a non-specific antibody of the same isotype as the specific antibody used to detect each surface marker.
  • the specific signal observed is typically more than 20%, preferably stronger than 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 500%, 1000%, 5000%, 10000% or above, greater relative to the background signal intensity.
  • Alternative methods for analysing expression of microparticle surface markers of interest include visual analysis by electron microscopy using antibodies against cell-surface markers of interest. "Fluorescence activated cell sorting (FACS)" is a method of cell purification based on the use of fluorescent labelled antibodies. The antibodies are directed to a marker on the cell surface, and therefore bind to the cells of interest.
  • Microparticle markers can also be analysed by various methods known to one skilled in the art to assay protein expression, including but not limited to gel electrophoresis followed by western blotting with suitable antibodies, immunoprecipitation followed by electrophoretic analysis, and/or electron microscopy as described above, with microparticle permeabilisation for intraparticle markers.
  • expression of one or more tetraspanins may be assayed using one or more of the above methods or any other method known to one skilled in the art.
  • RNA levels may also be analysed to assess marker expression, for example qRT-PCR.
  • a neural stem cell microparticle typically retains at least one biological function of the stem cell from which it is derived.
  • the at least one biological activity is an activity of a proliferating neural stem cell.
  • CTX0E03 cells are known to inhibit T cell activation in a PBMC assay and, in one embodiment, the microparticles of the invention retain this ability to inhibit T cell activation in a PBMC assay.
  • PBMC assays are well-known to the skilled person and kits for performing the assay are commercially available.
  • Example 18 The proteomic analysis in Example 18 indicates that neural stem cell exosomes comprise biological functions associated with the production, packaging, function and degradation of genetic material. Accordingly, in one embodiment, exosomes of the invention retain these functions, typically one or more of RNA polymerase function, RNA degradation function, ribosome function and spliceosome function.
  • the (allogeneic) neural stem cell microparticles of the invention typically either do not trigger an immune response in vitro or in vivo or trigger an immune response which is substantially weaker than that which would be expected to be triggered upon injection of an allogeneic stem cell population into a patient.
  • the neural stem cell microparticles are considered not to trigger an immune response if at least about 70% of the microparticles do not trigger an immune response. In some embodiments, at least about 80%, at least about 90% or at least about 95%, 99% or more of the microparticles do not trigger an immune response.
  • the microparticles of the invention do not trigger an antibody mediated immune response or do not trigger a humoral immune response.
  • the microparticles of the invention do not trigger either an antibody mediated response or a humoral immune response in vitro. More preferably still, the microparticles of the invention do not trigger a mixed lymphocyte immune response. It will be understood by one skilled in the art that the ability of the cells of the invention to trigger an immune response can be tested in a variety of ways.
  • CTX0E03 cells transplanted in a rodent model of limb ischemia have been previously demonstrated a faster and transient up-regulation of host genes involved in angiogenesis, such as CCL11 , CCL2, CXCL1 , CXCL5, IGF1 ,
  • hNSC treatment transiently elevates host innate immune and angiogenic responses and accelerates tissue regeneration.
  • CTX0E03 cell line has been previously demonstrated, using a human PBMC assay, not to be immunogenic. Accordingly, microparticles produced by CTX0E03 cells are also expected to be non-immunogenic. The lack of immunogenicity allows the microparticles to avoid clearance by the host/patient immune system and thereby exert their therapeutic effect without a deleterious immune and inflammatory response.
  • the neural stem cell that produces the microparticle may be a stem cell line, i.e. a culture of stably dividing stem cells.
  • a stem cell line can to be grown in large quantities using a single, defined source.
  • Immortalisation may arise from a spontaneous event or may be achieved by introducing exogenous genetic information into the stem cell which encodes immortalisation factors, resulting in unlimited cell growth of the stem cell under suitable culture conditions.
  • exogenous genetic factors may include the gene "myc", which encodes the transcription factor Myc.
  • the exogenous genetic information may be introduced into the stem cell through a variety of suitable means, such as transfection or transduction.
  • a genetically engineered viral vehicle may be used, such as one derived from retroviruses, for example lentivirus.
  • a conditionally immortalised stem cell line in which the expression of the immortalisation factor can be regulated without adversely affecting the production of therapeutically effective microparticles.
  • This may be achieved by introducing an immortalisation factor which is inactive unless the cell is supplied with an activating agent.
  • an immortalisation factor may be a gene such as c-mycER.
  • the c-MycER gene product is a fusion protein comprising a c-Myc variant fused to the ligand-binding domain of a mutant estrogen receptor.
  • C-MycER only drives cell proliferation in the presence of the synthetic steroid 4-hydroxytamoxifen (4-OHT) (Littlewood et al.1995).
  • This approach allows for controlled expansion of neural stem cells in vitro, while avoiding undesired in vivo effects on host cell proliferation (e.g. tumour formation) due to the presence of c-Myc or the gene encoding it in microparticles derived from the neural stem cell line.
  • a suitable c-mycER conditionally immortalized neural stem cell is described in United States Patent 7416888. The use of a conditionally immortalised neural stem cell line therefore provides an improvement over existing stem cell microparticle isolation and production.
  • Preferred conditionally-immortalised cell lines include the CTX0E03, STR0C05 and HPC0A07 neural stem cell lines, which have been deposited by the applicant (Reneuron Ltd) at the European Collection of Animal Cultures (ECACC), Vaccine Research and Production laboratories, Public Health Laboratory Services, Porton Down, Salisbury, Wiltshire, SP4 0JG, with Accession No. 04091601 (CTX0E03); Accession No.04110301 (STR0C05); and Accession No.04092302 (HPC0A07).
  • CTX0E03 European Collection of Animal Cultures
  • STR0C05 Accession No.04110301
  • HPC0A07 Accession No.04092302
  • the cells of the CTX0E03 cell line may be cultured in the following culture conditions:
  • the cells can be differentiated by removal of the 4- hydroxytamoxifen.
  • the cells can either be cultured at 5% C0 2 /37°C or under hypoxic conditions of 5%, 4%, 3%, 2% or 1 % 0 2 .
  • These cell lines do not require serum to be cultured successfully. Serum is required for the successful culture of many cell lines, but contains many contaminants including its own exosomes.
  • a further advantage of the CTX0E03, STR0C05 or HPC0A07 neural stem cell lines, or any other cell line that does not require serum, is that the contamination by serum is avoided.
  • the cells of the CTX0E03 cell line are multipotent cells originally derived from 12 week human fetal cortex.
  • the isolation, manufacture and protocols for the CTX0E03 cell line is described in detail by Sinden, et al. (U.S. Pat. 7,416,888 and EP1645626 B1).
  • the CTX0E03 cells are not "embryonic stem cells", i.e. they are not pluripotent cells derived from the inner cell mass of a blastocyst; isolation of the original cells did not result in the destruction of an embryo.
  • CTX0E03 cells are nestin-positive with a low percentage of GFAP positive cells (i.e. the population is negative for GFAP).
  • CTX0E03 is a clonal cell line that contains a single copy of the c-mycER transgene that was delivered by retroviral infection and is conditionally regulated by 4-OHT (4-hydroxytamoxifen).
  • the C-mycER transgene expresses a fusion protein that stimulates cell proliferation in the presence of 4-OHT and therefore allows controlled expansion when cultured in the presence of 4-OHT.
  • This cell line is clonal, expands rapidly in culture (doubling time 50-60 hours) and has a normal human karyotype (46 XY). It is genetically stable and can be grown in large numbers.
  • the cells are safe and non-tumorigenic. In the absence of growth factors and 4-OHT, the cells undergo growth arrest and differentiate into neurons and astrocytes. Once implanted into an ischemia-damaged brain, these cells migrate only to areas of tissue damage.
  • CTX0E03 cell line has allowed the scale-up of a consistent product for clinical use. Production of cells from banked materials allows for the generation of cells in quantities for commercial application (Hodges et al, 2007).
  • CTX0E03 implants robustly recover behavioural dysfunction over a 3 month time frame and that this effect is specific to their site of implantation.
  • Lesion topology is potentially an important factor in the recovery, with a stroke confined to the striatum showing a better outcome compared to a larger area of damage.
  • Neural retinal stem cell lines may also be used according to the invention.
  • culture medium or “medium” is recognized in the art, and refers generally to any substance or preparation used for the cultivation of living cells.
  • Media may be solid, liquid, gaseous or a mixture of phases and materials.
  • Media include liquid growth media as well as liquid media that do not sustain cell growth.
  • Media also include gelatinous media such as agar, agarose, gelatin and collagen matrices.
  • Exemplary gaseous media include the gaseous phase to which cells growing on a petri dish or other solid or semisolid support are exposed.
  • the term “medium” also refers to material that is intended for use in a cell culture, even if it has not yet been contacted with cells.
  • a nutrient rich liquid prepared for culture is a medium.
  • a powder mixture that when mixed with water or other liquid becomes suitable for cell culture may be termed a "powdered medium”.
  • "Defined medium” refers to media that are made of chemically defined (usually purified) components.
  • "Defined media” do not contain poorly characterized biological extracts such as yeast extract and beef broth.
  • "Rich medium” includes media that are designed to support growth of most or all viable forms of a particular species. Rich media often include complex biological extracts.
  • a "medium suitable for growth of a high density culture” is any medium that allows a cell culture to reach an OD600 of 3 or greater when other conditions (such as temperature and oxygen transfer rate) permit such growth.
  • basal medium refers to a medium which promotes the growth of many types of microorganisms which do not require any special nutrient supplements. Most basal media generally comprise of four basic chemical groups: amino acids, carbohydrates, inorganic salts, and vitamins. A basal medium generally serves as the basis for a more complex medium, to which supplements such as serum, buffers, growth factors, lipids, and the like are added. In one aspect, the growth medium may be a complex medium with the necessary growth factors to support the growth and expansion of the cells of the invention while maintaining their self-renewal capability.
  • basal media examples include, but are not limited to, Eagles Basal Medium, Minimum Essential Medium, Dulbecco's Modified Eagle's Medium, Medium 199, Nutrient Mixtures Ham's F-10 and Ham's F-12, McCoy's 5A, Dulbecco's MEM/F-I 2, RPMI 1640, and Iscove's Modified Dulbecco's Medium (IMDM).
  • IMDM Iscove's Modified Dulbecco's Medium
  • “culturing” cells for specified periods of time refers to a time period wherein day zero or "day 0" is the time point at which the cells are transferred to the culture vessel.
  • the culture vessel may be a flask, for example the standard T- 175 cell culture flask.
  • the culture vessel is a multi-compartment bioreactor such as the Integra CELLine bioreactor, and day zero is the day on which the stem cells are transferred into the bioreactor.
  • cells “that have been cultured for at least 10 weeks” refers to cells that have been cultured for at least 10 weeks following transfer into the culture vessel. In this 10 week period, the cells are not passaged or subcultured, i.e.
  • cells can be removed from the culture vessel during the culture period, typically for sampling, but this does not change the cells that remain in the culture vessel, which have been in that culture vessel since day 0.
  • approximately 15x10 6 CTX0E03 cells in a total of 15ml of complete growth medium are introduced into the cell compartment of the CeLLine bioreactor, followed by the addition of a further 460ml of complete growth medium to the cell compartment.
  • the neural stem cell microparticle of the invention is useful in therapy and can therefore be formulated as a pharmaceutical composition.
  • a pharmaceutically acceptable composition typically includes at least one pharmaceutically acceptable carrier, diluent, vehicle and/or excipient in addition to the microparticles of the invention.
  • An example of a suitable carrier is Ringer's Lactate solution. A thorough discussion of such components is provided in Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th edition, ISBN: 0683306472.
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • compositions can also contain minor amounts of pH buffering agents.
  • the carrier may comprise storage media such as Hypothermosol®, commercially available from BioLife Solutions Inc., USA. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E W Martin.
  • Such compositions will contain a prophylactically or therapeutically effective amount of a prophylactic or therapeutic microparticle preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject.
  • the formulation should suit the mode of administration.
  • the pharmaceutical compositions are sterile and in suitable form for administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a human subject.
  • the pharmaceutical composition of the invention may be in a variety of forms. These include, for example, semi-solid, and liquid dosage forms, such as lyophilized preparations, liquid solutions or suspensions, injectable and infusible solutions.
  • the pharmaceutical composition is preferably injectable.
  • a particular advantage of the microparticles of the invention is their improved robustness compared to the stem cells from which they are obtained; the microparticles can therefore be subjected to formulation, such as lyophilisation, that would not be suitable for stem cells. This is also an advantage of the miRNA compositions of the invention.
  • the methods, medicaments and compositions and microparticles of the invention are used for treating cancer, and/or for the treatment, modulation, prophylaxis, and/or amelioration of one or more symptoms associated with cancer.
  • compositions will generally be in aqueous form.
  • Compositions may include a preservative and/or an antioxidant.
  • the pharmaceutical composition can comprise a physiological salt, such as a sodium salt.
  • Sodium chloride NaCI
  • Other salts that may be present include potassium chloride, potassium dihydrogen phosphate, disodium phosphate dehydrate, magnesium chloride and calcium chloride.
  • Compositions may include one or more buffers. Typical buffers include: a phosphate buffer; a Tris buffer; a borate buffer; a succinate buffer; a histidine buffer; or a citrate buffer. Buffers will typically be included at a concentration in the 5-20mM range.
  • the pH of a composition will generally be between 5 and 8, and more typically between 6 and 8 e.g. between 6.5 and 7.5, or between 7.0 and 7.8.
  • the composition is preferably sterile.
  • the composition is preferably gluten free.
  • the composition is preferably non-pyrogenic.
  • the microparticles are suspended in a composition comprising 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox®), Na + , K + , Ca 2+ , Mg 2+ , CI " , H 2 P0 4 " , HEPES, lactobionate, sucrose, mannitol, glucose, dextron-40, adenosine and glutathione.
  • the composition will not include a dipolar aprotic solvent, e.g. DMSO.
  • Suitable compositions are available commercially, e.g.
  • HypoThermasol ® -FRS HypoThermasol ® -FRS.
  • Such compositions are advantageous as they allow the microparticles to be stored at 4°C to 25°C for extended periods (hours to days) or preserved at cryothermic temperatures, i.e. temperatures below -20 C. The microparticles may then be administered in this composition after thawing.
  • the pharmaceutical composition can be administered by any appropriate route, which will be apparent to the skilled person depending on the disease or condition to be treated.
  • Typical routes of administration include intravenous, intra-arterial, intramuscular, subcutaneous, intracranial, intranasal or intraperitoneal.
  • one option is to administer the microparticles or miRNA intra-cerebrally, typically to the site of damage or disease.
  • microparticles or miRNA will be administered at a therapeutically or prophylactically- effective dose, which will be apparent to the skilled person. Due to the low or non-existent immunogenicity of the microparticles, it is possible to administer repeat doses without inducing a deleterious immune response. Therapeutic uses
  • the microparticles and miRNA of the invention are useful in the treatment or prophylaxis of disease, in particular cancer.
  • the cancers of particular interest are: Bladder cancer; Breast cancer; CNS cancer, optionally glioma; Liver cancer; Melanoma; Non-small-cell lung cancer; Ovarian cancer; Prostate cancer; and Renal cancer.
  • the data in Example A demonstrate that neural stem cell exosomes have biological efficacy against each of these cancer types.
  • the invention includes a method of treating or preventing cancer in a patient using a microparticle of the invention.
  • patient includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment.
  • the exosomes demonstrate that neural stem cell exosomes have been identified that act directly on cancer cells to reduce their number or increase senescence.
  • the exosomes reduce the cancer cell number by inducing apoptosis of the cancer cells.
  • the cancer is susceptible to treatment by inducing apoptosis in the cancer cells.
  • the cancer is susceptible to treatment by inducing senescence in the cancer cells.
  • Microparticles of the invention are therefore useful in treating or preventing cancer.
  • the microparticles are exosomes.
  • the cancer may, in one embodiment, comprise a liquid tumour. In another embodiment, the cancer may comprise a solid tumour.
  • Microparticles of the invention may also be used to treat or prevent metastatic cancers, for example metastasis of each of the cancers described herein.
  • microparticles of the invention may also be used to treat a benign (non-cancerous, non- malignant) solid tumour, or a premalignant solid tumour.
  • the microparticles and compositions containing them are not used for immune modulation.
  • the therapy is not related to immunomodulation.
  • the neural stem cell exosomes have direct effects on the cancer cells. Therapeutic benefits can therefore be obtained through the exemplified direct mechanisms, rather than by immune modulation.
  • the invention also provides a method for treating or preventing cancer comprising administering an effective amount of the microparticle of the invention, thereby treating or preventing the cancer.
  • the microparticles for use in therapy are typically isolated from proliferating NSCs (typically CTX0E03 cells) that have been cultured in a standard culture vessel such as a T-175 flask, or have been cultured in a multi-compartment bioreactor for 4 weeks or less, 3 weeks or less, 2 weeks or less, or 1 week or less e.g. exosomes isolated on day 0 of the multi-compartment culture. These cells are typically passaged when sub-confluent, are positive for a stem cell marker (e.g. nestin) and negative for markers of differentiated cells (e.g. GFAP or DCX).
  • the microparticles are exosomes.
  • microparticles produced according to this embodiment are shown to have anti-cancer effects. These exosomes may have a diameter greater than 100nm.
  • compositions or medicaments are administered to a patient susceptible to, or otherwise at risk of, a particular disease in an amount sufficient to eliminate or reduce the risk or delay the outset of the disease.
  • compositions or medicaments are administered to a patient suspected of, or already suffering from such a disease in an amount sufficient to cure, or at least partially arrest, the symptoms of the disease and its complications. An amount adequate to accomplish this is defined as a therapeutically-or pharmaceutically-effective dose.
  • agents are typically administered in several dosages until a sufficient response has been achieved. Typically, the response is monitored and repeated dosages are given if the response starts to fade.
  • the microparticles of the invention may optionally be combined with a stem cell to provide a combination therapy.
  • the stem cell is optionally the stem cell from which the microparticle is derived, e.g. if the microparticle is an exosome from a CTX0E03 cell, then the stem cell for use in combination therapy may be a CTX0E03 cell, typically but not necessarily cultured for the same period of time as the cells from which the microparticles were derived.
  • a stem cell and microparticle can optionally be (i) administered together in a single pharmaceutical composition, (ii) administered contemporaneously or simultaneously but separately, or (iii) administered separately and sequentially, e.g. stem cell followed by microparticle, or microparticle followed by stem cell.
  • the duration between the administration of the cell and microparticle may be one hour, one day, one week, two weeks or more.
  • Effective doses of the compositions of the present invention, for the treatment of the above described conditions vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Usually, the patient is a human.
  • the CTX0E03 cell line has been shown to be effective in treating stroke, peripheral arterial disease, brain damage such as motor, sensory and/or cognitive deficit, and psychiatric disorders.
  • the cells are currently being tested in a clinical trial for treatment of disabled stroke patients (Clinicaltrials.gov Identifier: NCT01151124).
  • WO- A-2012/004611 describes the use of the CTX0E03 cells in treating psychiatric disorders including unipolar and bipolar depression, schizophrenia, obsessive compulsive disorder, autism and autistic syndrome disorders.
  • the terms “treat”, “treatment”, “treating” and “therapy” when used directly in reference to a patient or subject shall be taken to mean the amelioration of one or more symptoms associated with a disorder, or the prevention or prophylaxis of a disorder or one or more symptoms associated with a disorder.
  • the disorders to be treated include, but are not limited to, cancer.
  • Amelioration or prevention of symptoms results from the administration of the microparticles of the invention, or of a pharmaceutical composition comprising these microparticles, to a subject in need of said treatment.
  • the present invention provides a distinct marker profile for microparticles produced by neural stem cells. It is therefore possible to detect the presence of these microparticles in vivo, by testing a sample obtained from a patient and determining whether the marker profile in the sample matches that of the microparticles. If the sample profile matches the profile of the microparticles described herein, then this confirms the presence of the microparticles. This can be used to detect not only the presence and/or biodistribution of the microparticles themselves, but also the presence of stem cells producing the microparticles. This is particularly useful when detecting whether a stem cell administered in vivo has engrafted into the host tissue, and/or has migrated, for example in ADME(T) studies.
  • Detection of the microparticles in vivo can be used to monitor the course of a treatment wherein microparticles or stem cells are administered to a patient. Determining the presence, absence or amount of microparticles or cells producing microparticles of the invention in a patient allows the dosage regime to be altered accordingly, e.g. to increase or decrease the dose as required to provide an effective amount of microparticles or stem cells in vivo.
  • CM stem cell conditioned media
  • the "conditioned medium” may be a growth medium for stem cells, which has been used to culture a mass culture of stem cells for at least about 12 hours, at least about 24 hours, at least about 48 hours or least about 72 hours, typically up to 168 hours (7 days), removed and sterilized by any suitable means, preferably by filtration, prior to use, if required.
  • Microparticles that are able to effect cancer cells have been isolated from proliferating stem cells. Accordingly, one way to produce microparticles according to the invention is to culture the cells so that they are able to proliferate, for example by culturing in a T-175 flask, or in a multi- compartment bioreactor for 4 weeks or less, 3 weeks or less, 2 weeks or less, or 1 week or less e.g. exosomes isolated on day 0 of the multi-compartment culture.
  • Microparticles may optionally be harvested from a multi-compartment, e.g. two-compartment, bioreactor which allows the cell culture, and hence the conditioned media, to be maintained for longer periods of time, for example more than 10 weeks, at least 1 1 weeks, at least 12 weeks, at least 13 weeks, at least 14 weeks, at least 15 weeks, and optionally no longer than 20 weeks.
  • the system maintains the cells and secreted microparticles within a small cell compartment (approximately 15ml) which is separated from a larger reservoir of medium by a 10kDa semi-permeable membrane. This allows the efficient removal of metabolic waste products while effectively maintaining an extremely high cell density to maximize micropartide production.
  • Example 14, and Figures 16 and 17, demonstrate that use of a two-compartment bioreactor results in a much higher yield of microparticles than is obtained when a standard cell culture flask (T175 flask) is used.
  • the microparticles may be separated from other media components based on molecular weight, size, shape, hydrodynamic radius, composition, charge, substrate-ligand interaction, absorbance or scattering of electromagnetic waves, or biological activity.
  • the conditioned media is filtered using a filter of appropriate size to separate the desired micropartide, for example a 100K MWCO filter.
  • the stem cell-conditioned medium is concentrated prior to the isolation of the microparticles by subjecting the concentrated NSC- conditioned medium to size exclusion chromatography. The UV absorbant fractions can then be selected for isolation of the microparticles of interest. Different microparticles can be isolated from the media by using different isolation techniques and parameters.
  • exosomes have a vesicle density of 1.13-1.19 g/mL and can be isolated by differential centrifugation and sucrose gradient ultracentrifugation at 100,000- 200,000g.
  • Microvesicles can be isolated by filtration (100K MWCO) and differential centrifugation at 18, 000-20, OOOg.
  • Membrane particles have a density of 1.04-01.07 g/ml and Exosome-like vesicles have a density of 1.1 g/ml.
  • a typical production method comprises: culturing stem cells to produce conditioned media; removing cell debris by centrifugation at 1500 rpm; isolating microvesicles ( ⁇ 1000kDa) by ultrafiltration through a 100K MWCO filter or isolating exosomes (30-1 OOnm) by ultracentrifugation at 120,000g; followed by quantification using a BCA protein assay.
  • conditionally immortalised neural stem cells are used to produce microparticles such as microvesicles and/or exosomes for use according to the invention.
  • a method of producing neural stem cell microparticles according to the invention comprising the steps of culturing conditionally-immortalised neural stem cells and harvesting the microparticles that are produced by the cells, as described above.
  • Conditional immortalisation of stem cells is known in the art, as described above. For the avoidance of doubt, this method is not limited to the use of neural stem cells.
  • the neural stem cell may be any of the neural stem cells described herein, for example the CTX0E03 conditionally-immortalised cell line which is clonal, standardised, shows clear safety in vitro and in vivo and can be manufactured to scale thereby providing a unique resource for stable exosome production.
  • the neural stem cells may be neural retinal stem cell lines, optionally as described in US 7514259. Method for screening total RNA composition of conditioned medium
  • RNA is obtained using trizol based extraction followed by purification using Qiagen RNaesy mini kit. The extract in water has a 260:280 nm absorbance suggesting that it may be RNA.
  • Total RNA is retro-transcribed with either a protocol suitable for mRNA (Superscript II RT, Invitrogen) or miRNA (mScript RT kit, Qiagen). Validation of mRNA and miRNA presence is proven by qRT-PCR using primers for ATP5B and YWHAZ for mRNA, and U6B and 15a for miRNA housekeeping genes respectively.
  • the RNA may further be assessed by a generic gene expression analysis assay such as an array (micro array or PCR based array), and sequencing.
  • the invention provides a kit for use in a method for producing the microparticle of the invention.
  • the kit comprises a neural stem cell culture medium, a neural stem cell and instructions for producing the microparticle of the invention using the kit.
  • the kit may also comprise a microparticle according to the invention, for use as a control.
  • the control microparticle is optionally lypohilised.
  • the kit may also contain optionally a detection agent suitable for detection of the produced microparticles, for example an antibody that binds specifically to a marker protein that can be used to identify the microparticle.
  • Example A Neural Stem Cell-derived exosomes induce senescence and apoptosis in cancer cell lines
  • a bespoke cell line panel was selected for screening, loosely based on the NCI-60 panel of cancer cell lines. In total, 22 lines were chosen, representing 1 1 common types of solid tumours and in most cases with a minimum of 2 different lines for each tumour type. Lines with contrasting mutational profiles were selected.
  • cells were plated in 96-well format at an appropriate density such that cell confluency was ⁇ 70% at the end of the assay.
  • Conditioned growth medium was collected from proliferating CTX0E03 cells and exosomes isolated using a filtration-based approach. Exosome particle number was quantified by Nanoparticle Tracking Analysis (NanoSight NTA Version 2.3, Malvern Instruments, UK).
  • Exosome concentrations were standardised by dilution in PBS before being applied to cells at increasing amounts (10 9 , 10 10 and 10 11 ).
  • Figure 1 shows the screening experiment workflow. Plated cells were allowed to adhere overnight before exposure to CTX-derived exosomes or PBS controls for 72 hours. As set out in the table below, cells were then exposed to fluorescent beta-Galactosidase substrate (C12FDG, Sigma-Aldrich) for 8h, before fixing (4% PFA), performing ICC against Annexin V and counterstaining with DAPI.
  • C12FDG fluorescent beta-Galactosidase substrate
  • Figure 2 panel A demonstrates that cancer cells treated with increasing doses of CTX-derived exosomes for 72-hours revealed a dose-dependent reduction of DAPI-stained nuclei in a number of the tested cell lines.
  • Breast cancer (MCF7) and ovarian cancer (SK-OV-3) are shown as examples.
  • Figure 2 panel B provides automated image acquisition and quantitation data, that reveal a statistically-significant reduction in cell number in the following cancer cell lines: bladder (HT- 1 197), prostate (DU-145), ovarian (OVCAR-3 and SK-OV-3), breast (MCF7), liver (SNU-387) and melanoma (SKMEL-5).
  • Exosome-mediated growth inhibition may be attributed to induction of apoptosis in a subset of cell lines
  • a minor subset of cancer cells showed an apparent dose- dependent increase in nuclear Annexin V staining as a marker of Apoptosis in response to treatment with CTX-derived exosomes.
  • the liver (SNU-387) and ovarian (SK-OV-3) cells are shown as examples.
  • Panel B of Figure 3 provides the quantitative analysis of nuclear-restricted Annexin V staining, which revealed 3 lines that showed a statistically significant increase in apoptosis in response to CTX-derived exosomes: liver (SNU-387) and ovarian (SK-OV-3 and OVCAR-3) cell lines.
  • SK-MEL-28 (melanoma).
  • CTX-derived exosomes show biological efficacy against cancer cell lines, inducing senescence and apoptosis in discrete cell lines.
  • Example B Next Generation Sequencing of the miRNA content of multiple exosome samples obtained from proliferating CTX0E03 cells.
  • Next generation sequencing of miRNA content was performed by a commercial provider, Exiqon A/S (Skelstedet 16, Vedbaek, Denmark), on four batches of exosomes derived from proliferating CTX0E03 cells. Briefly, the sequencing was performed using a NextSeq500, with an average number of reads at 10 million reads / sample, and a read length of 50nt (Single-end read).
  • the library preparation was done using the NEBNext® Small RNA Library preparation kit (New England Biolabs). A total of 6 ul of total RNA was converted into microRNA NGS libraries. Adapters were ligated to the RNA. Then RNA was converted to cDNA. The cDNA was amplified using PCR (18 cycles) and during the PCR indices were added. After PCR the samples were purified. Library preparation QC was performed using either Bioanalyzer 2100 (Agilent) or TapeStation 4200 (Agilent). Based on quality of the inserts and the concentration measurements the libraries were pooled in equimolar ratios.
  • the pool was then size selected using the LabChip XT (PerkinElmer) aiming to select the fraction with the size corresponding to microRNA libraries ( ⁇ 145 nt).
  • the library pool(s) were quantified using the qPCR KAPA Library Quantification Kit (KAPA Biosystems).
  • the library pool were then sequenced on a NextSeq500 sequencing instrument according to the manufacturer instructions. Raw data was demultiplexed and FASTQ files for each sample were generated using the bcl2fastq software (lllumina inc.). FASTQ data were checked using the FastQC tool
  • hsa-let-7c-5p is SEQ ID No. 17; hsa-miR-128-3p is SEQ ID No. 109; and hsa-miR-370-3p is SEQ ID No. 126.
  • Example 7 Preparation of neural stem cells and neural stem cell microparticles for visualisation by electron microscopy.
  • Figure 1 1A-E shows the electron micrographs of the multivesicular bodies (MVBs) containing exosomes of approximately 30nm - 50nm in diameter.
  • Figure 11 F shows microvesicles >100nm in diameter.
  • Example 8 Production of neural stem cell microparticles from a neural stem cell line.
  • Sub-confluent flasks containing the same culture of CTX0E03 cells were individually treated with either 10ng/ml TGF- ⁇ , 10ng/ml IFNy, or 10ng/ml TNFa alongside full growth media controls with or without the addition of 40HT. 72 hours after treatment, the cells were collected using trypzean/EDTA, washed and fixed overnight in 2.5% Gluteraldehyde in 0.1 M Cacodylate pH7.4 ready for electron microscopy evaluation.
  • the frequency of the occurrence of multivesicular bodies was observed to be altered by the presence of TGF- ⁇ , IFN- ⁇ or TNF-a.
  • the frequency was highest in the presence of TGF- ⁇ , followed by IFN- ⁇ , followed by TNF-a.
  • microparticles from neural stem cells can be stimulated by the addition of the factors TGF- ⁇ , IFN- ⁇ or TNF-a. This has the potential for more efficient production of microparticles.
  • Example 9 Purification, quantification and characterisation of neural stem cell microparticles.
  • FIG. 12 An outline protocol for producing large quantities of microparticles is provided in Figure 12. The main steps are purification, quantification, characterisation, efficacy testing and manufacture.
  • Microparticles can be purified from stem cell-conditioned medium by ultracentrifugation, e.g. at 100000 x g for 1-2 hours.
  • Alternative or additional methods for purification of may be used, such as antibody-based methods, e.g. immunoprecipitation, magnetic bead purification, resin-based purification, using specific antibodies.
  • Purified microparticles can be quantified by quantification of total nucleic acid or protein levels, e.g. various PCR or colorimetric protein quantification methods such as such as the BCA assay. Other quantification techniques may alternatively be used, including an electron microscopy grid or an immune-assay using antibodies or antibody fragments that specifically bind to microparticle-specific markers (e.g. ELISA, immunoblotting).
  • quantification techniques including an electron microscopy grid or an immune-assay using antibodies or antibody fragments that specifically bind to microparticle-specific markers (e.g. ELISA, immunoblotting).
  • the microparticles can be functionally or structurally characterised.
  • RNA/mRNA/miRNA and protein profiling can be used using methods well known in the art (SDS-PAGE, mass spectrometry, PCR).
  • Constitutively secreted microparticles can be tested and compared to microparticles that have been induced by addition of an inducing agent such as transforming growth factor-beta (TGF- ⁇ ), interferon-gamma (INF- ⁇ ) and/or tumour necrosis factor-alpha (TNF-a).
  • TGF- ⁇ transforming growth factor-beta
  • INF- ⁇ interferon-gamma
  • TNF-a tumour necrosis factor-alpha
  • neural stem cell microparticles can be added to cultures of monocytes, PBMCs, endothelial cells and/or fibroblasts and the effect of the microparticles on these cells evaluated.
  • Administration of neural stem cell microparticles to suitable animal models can be used to evaluate the in vivo efficacy.
  • Clinical trials can be performed to evaluate safety and outcome of neural stem cell microparticles in human subjects.
  • Bioreactors such as the Integra disposable T1000, can be used for the large-scale manufacture of neural stem cell microparticles.
  • the purified microparticles are then formulated as a therapeutic product.
  • Example 10 Integra CELLINE - Disposable Bioreactor for the production of Micro particles from CTX0E03 cells.
  • Efficient micro particle production and harvest from a cell line relies upon maintaining optimal culture conditions for the greatest density of cells. Any restriction in the oxygen or nutrients supplied to the cells or an accumulation of waste metabolic products will limit the life span of the culture, and hence the micro particle production.
  • the two-compartment CELLine AD 1000 is designed to accommodate adherent cells attached to a matrix inlay within a small cell compartment, separated from a larger media reservoir by means of a 10kDa semi-permeable membrane. This membrane allows a continuous diffusion of nutrients and removal of waste products, while concentrating any micro particles produced by the cell within the smaller cell compartment. Due to the large volume capacity (1 litre) of the media compartment, the system has the potential to maintain high density cultures for longer periods of time without the need for a media change. The production of exosomes from mesothelioma tumour cell cultures is described in Mitchell et al, 2008.
  • Figure 15A shows the amount of protein extracted from 15ml of media containing microparticles purified using the Integra system compared to normal culture conditions (3 days T175). Milligrams of protein measured by BCA assay.
  • Figure 15B shows the corresponding quantity of isolated total RNA measured at 260/280nm.
  • Example 11 Size distribution of Microparticles NanoSight analysis was undertaken to determine the particle size and concentration of microvesicles ("mv1” to “mv6”) and exosomes ("exo1” to “exo6”) isolated from CTX0E03 cells cultured in the Integra Celline system for 1 , 2, 3, 4, 5 and 6 weeks. All results are based on 5 replicate measurements.
  • NTA Nanoparticle Tracking Analysis
  • Exo1 A proportion of Exo1 was labelled with a fluorescent membrane-specific dye (CellMaskTM) and a combination of NTA analysis with the CellMaskTM labelling confirmed that the events detected by NTA correspond to membrane vesicles (data not shown).
  • CellMaskTM a fluorescent membrane-specific dye
  • the exosomes show a drop in size at week six, from a mode of approximately 110nm to approximately 70nm, or from a median of approximately 130nm to approximately 75nm.
  • the overall size range, from 70nm to 150nm, is consistent with the size of exosomes from other cell types, described in the art.
  • the observed reduction in size of the exosomes to around 70nm diameter after culturing the cells for 6 weeks correlates with the increased efficacy of exosomes isolated from CTX0E03 cells that have been cultured in a multi-compartment bioreactor for 6 weeks correlates, as reported in Example 2 and Figure 3.
  • microvesicles are, as expected, larger, with a mode diameter of approximately 150nm - 200nm, or a median diameter of approximately 180nm - 350nm.
  • Table 3 Size distribution of CTX0E03 microvesicles and exosomes.
  • Example 12 miRNA characterization in CTX0E03 microparticles Methods • 3 conditions: CTX0E03 cells in standard culture; microparticles obtained from CTX0E03 cells in standard culture; and purified exosomes derived from CTX0E03 cells in Integra CELLine system (see Examples 10 to 16)
  • Results A) List of miRNAs with a cp ⁇ 35 found in (i) standard CTX0E03 cells, (ii) filtered conditioned medium (0.02-0.2pm filter) i.e. microparticles and (iii) exosomes derived from Integra CELLine system (preliminary miRNA qRT-PCR miscript array (Qiagen) results).
  • Example 13 CTX0E03 conditioned medium analysis using a protein dot blot
  • the collected media has been 'concentrated' by dialysis and the proteins biotinylated (typical total protein concentration appears to be 0.5 mg/ml).
  • the media is then incubated with the Raybiotech L507 human protein arrays (total protein concentration 0.1 mg/ml). Following washing and incubation of the array with HRP-conjugated streptavidin, the presence of proteins is detected by chemiluminescence.
  • the array provides qualitative data (i.e. the protein is present, but no indication of its level of expression compared to other proteins).
  • Example 14 Production of exosomes using the Integra CELLine system.
  • CTX0E03 cells were cultured using the Integra CELLine system and exosomes were purified as described in Example 10.
  • Figure 16 shows that the production of exosomes using the Integra CELLine system is increased several fold, compared to using conventional culture (T175 flasks).
  • CTX0E03 cells were cultured over a 3-week period and medium was harvested at week 1 , 2 and 3 for purification and quantification of exosomes, as described in Example 10.
  • Figure 17A shows that the production of microparticles increases exponentially over the 3-week culture period, enabling efficient and large-scale production of microparticles.
  • the concentration of exosomes harvested from a single Integra CELLine flask was then monitored over 1-6 weeks of continuous CTX0E03 culture, with the results shown below and depicted in Figure 17B:
  • Example 15 Characterisation of phenotype of cells obtained from the Integra CELLine and the standard (T175) culture system.
  • CTX0E03 cells were cultured using the Integra CELLine bioreactor and standard culture, as described in Example 10. Expression of DCX and GFAP protein markers was confirmed using marker-specific antibodies and fluorescence microscopy. Expression of DCX, GALC, GFAP, TUBB3, GDNF and IDO markers was detected by qRT-PCR in samples obtained from the cells. Marker expression was compared between microparticles obtained from standard (T175) culture and exosomes obtained from the 3 week cultured Integra CELLine system, assessed against a baseline of the expression level in CTX0E03 cells in standard (T175) culture. The inventors observed a striking difference in marker expression of cells obtained from the Integra CELLine system as compared to control cells obtained from standard.
  • Markers of partially-differentiated cells were increased several fold in cells cultured in the Integra CELLine system, compared to control cells obtained from standard cultures ( Figure 18). Particularly striking changes are increased expression of the markers DCX1 (doublecortin - a marker for entry into the neural lineage), GFAP (glial fibrillary acidic protein - a marker for entry into the astrocytic lineage), GDNF (glial cell-derived neurotrophic factor) and IDO (indoleamine 2,3- dioxygenase). This indicates that in neural stem cells cultured in a two-compartment bioreactor partially differentiate into cells of neural (DCX+) or astrocytic (GFAP+) lineage.
  • DCX1 doublecortin - a marker for entry into the neural lineage
  • GFAP glial fibrillary acidic protein - a marker for entry into the astrocytic lineage
  • GDNF glial cell-derived neurotrophic factor
  • IDO indoleamine 2,3
  • Example 16 Characterisation of miRNA expression profiles of exosomes obtained from Integra CELLine cultures and microparticles obtained from standard (T175) cultures.
  • CTX0E03 cells were cultured for three weeks using the Integra CELLine culture and in the standard culture in single-compartment T-175 flasks. Exosomes were purified from the Integra culture and microparticles were purified from the standard T-175 culture as described in Example 10.
  • the relative expression levels of various miRNAs expressed in the exosomes and microparticles obtained from either the standard culture or the Integra CELLine system were determined with an miRNA array using qRT-PCR panel (Qiagen) according to manufacturer's instruction, and converted into fold up and down regulation levels as compared to a standard CTX0E03 cell line control group (see Table 4 and Figure 19). These data show a differential miRNA expression profile between exosomes obtained from the Integra CELLine culture system for 3 weeks, microparticles, and cells obtained from the standard single-flask culture.
  • Table 4 Fold-regulation of miRNAs in microparticles obtained from standard culture or exosomes from the Integra CELLine system, relative to control (CTX0E03 cells).
  • GOI gene of interest (investigated miRNA)
  • HKG housekeeping genes (reference miRNAs used to normalize the data)
  • RNA molecules can shuttle RNA into microparticles determined for release into the extracellular space. This allows the conveyance of genetically encoded messages between cells.
  • extracellular RNA we here collectively refer to extracellular RNA as 'shuttle RNA'.
  • NSCs neural stem cells
  • Non coding RNAs are divided in two categories (small and long).
  • Small non coding RNA biotypes include ribosomal RNA (rRNA), small nucleolar (snoRNA), small nuclear RNA (snRNA), microRNA (miRNA), miscellaneous other RNA (misc_RNA, e.g. RMRP, vault RNA, metazoa SRP, and RNY), and long non coding RNA biotypes includes long non-coding RNAs (IncRNAs) and large intergenic non-coding RNAs (lincRNAs).
  • shuttle RNAs including small and long non coding RNAs, released from NSC derived exosomes and microvesicles (MV) and compared with the RNA contents of the producer NSCs.
  • RNA in both exosomes and microvesicles mainly consists of small RNA species as shown in Fig. 14. The majority of the nucleotides (nt) was ⁇ 200 as shown against the molecular ladder.
  • Deep sequencing is based on the preparation of a cDNA library following by sequencing and provides information regarding the total sequence read out of different miRNAs in the microvesicles and exosomes. These deep sequence data complement the qRT-PCR array data shown above and provide a comprehensive analysis of the miRNA profile of the cells and microparticles. Unlike the qRT-PCR array analysis, deep sequencing is not restricted to identification of sequences present in the probe array and so the sequences to be identified do not need to be known in advance. Deep sequencing also provides direct read-out and the ability to sequence very short sequences. However, deep sequencing is not suitable for detection of transcripts with low expression.
  • hsa-miR-1246 specific primers for highly shuttled miRNAs (e.g. hsa-miR-1246) were designed and used in real-time reverse transcription PCR (qRT-PCR) to trace exosomes/microvesicles following in vivo implantation.
  • Deep sequencing was performed by GATC Biotech (Germany) and required the preparation of a tagged miRNA library for each samples followed by sequencing, and miRBase scanning: ⁇ Construction of tagged miRNA libraries (22 to 30 nt)
  • RNA libraries were generated by ligation of specific RNA adapter to both 3' and 5' ends for each sample followed by reverse transcription, amplification, and purification of smallRNA libraries (size range of contained smallRNA fraction 22 - 30 nt).
  • Sequencing was performed using lllumina HiSeq 2000 (single read). Analysis of one pool could include up to 45,000,000 single read, and each read length is up to 50 bases. Sequencing was quality controlled by using FastQ Files (sequences and quality scores).
  • RNA adapters were trimmed from resulting sequences and raw data cleaned.
  • miRNAs were enriched relative to the cells, indicating that cells specially sort miRNAs for extracellular release. Furthermore, miRNA contents were similar in both exosomes and microvesicles, indicating a common apparatus of selective miRNA uptake in excreted microvesicles. Without wishing to be bound by theory, this may indicate that miRNA content in secreted microvesicles and exosomes can be used as a fingerprint to identify hNSC subtypes.
  • the deep sequencing analysis therefore identified a unique set of miRNAs in both hNSC exosomes and microvesicles not previously reported. MiRNA content in excreted vesicles is similar, but showed a preferential miRNA uptake compared with hNSC. These findings could support biological effects mediated by shuttle miRNA not previously described for hNSC.
  • miRNA contents in exosomes, microparticles, and parental cells were also tested and validated using PCR array analysis.
  • the following miRNAs were found present by qRT-PCR: hsa-let-7g-5p, hsa-miR-101-3p, hsa-miR-10a-5p, hsa-miR-10b-5p, hsa- miR-125b-5p, hsa-miR-128, hsa-miR-130a-3p, hsa-miR-134, hsa-miR-137, hsa-miR-146b-5p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181 a-5p,hsa-miR- 182-5p, hsa
  • Table 12 Identification of putative novel miRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells.
  • EXO exosomes
  • MV microvesicles
  • CTX0E03 07EI MV reads are misrepresented due to the lower amount of starting material (table 11).
  • the transcript IDs are taken from the Ensembl database (www.ensembl.org).
  • gaccaggguccggugcggagug (SEQ ID NO:745) was identified as the possible 5' stem mature miRNA using http://mirna.imbb.forth.gr/MatureBayes.html, a tool for finding mature miRNA within a miRNA precursor sequence using a Naive Bays classifier. Its presence validation was performed using AGGGTCCGGTGCGGAGT (SEQ ID NO:746) primer sequence. This sequence was entered in mirbase (http://www.mirbase.org/) and the following miRNA was found with similar sequence: Bos taurus miR-2887-1 (Accession No. MIMAT0013845).
  • ggagggcccaaguccuucugau (SEQ ID NO:744) was identified as the possible 5' stem mature miRNA. Its presence validation was performed using GGAGGGCCCAAGTCCTTCTGAT (SEQ ID NO:749) primer sequence. Caenorhabditis remanei miR-55 stem-loop was identified as similar miRNA. Primer validation was again carried out by qRT-PCR.
  • ggcggagugcccuucuuccugg (SEQ ID NO:743) was identified as the possible 5' stem mature miRNA. Its presence validation was performed using CGGAGTGCCCTTCTTCCT (SEQ ID NO:751) primer sequence. Zea mays miR164c stem-loop and Achypodium distachyon miR164f stem-loop were identified as similar miRNA. Primer validation was again carried out by qRT-PCR. zma-miR164c-3p : 4-15 (SEQ ID NO:752)
  • miscellaneous RNA (misc_RNA), including novel putative
  • Misc_RNA is short for miscellaneous RNA, a general term for a series of miscellaneous small RNA. Miscellaneous transcript feature are not defined by other RNA keys.
  • Table 13 Identification of misc_RNA, including putative novel misc_RNA, sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. (CTX0E03 07EI MV reads are misrepresented due to the lower amount of starting material - Table 11).
  • the transcript IDs are taken from the Ensembl database (www.ensembl.org).
  • misc_RNA the following sequences were found preferentially down or up shuttled in exosomes and MV: RPHI, RMRP, and VTRNA1-1 up shuttled and Y_RNA.725-201 , and Y_RNA.125-201 down respectively.
  • RPHI is a ribonuclease P RNA component H1.
  • RMRP gene encodes the RNA component of mitochondrial RNA processing endoribonuclease, which cleaves mitochondrial RNA at a priming site of mitochondrial DNA replication.
  • RNA also interacts with the telomerase reverse transcriptase catalytic subunit to form a distinct ribonucleoprotein complex that has RNA-dependent RNA polymerase activity and produces double-stranded RNAs that can be processed into small interfering RNA.
  • VTRNA1-1 is vault RNA component 1.
  • Vaults are large cytoplasmic ribonucleoproteins and they are composed of a major vault protein, MVP, 2 minor vault proteins, TEP1 and PARP4, and a non-translated RNA component, VTRNA1-1.
  • Y_RNA.725-201 , and Y_RNA.125-201 are novel misc_RNAs and their function is not defined.
  • the signal recognition particle RNA also known as 7SL, 6S, ffs, or 4.5S RNA, is the RNA component of the signal recognition particle (SRP) ribonucleoprotein complex.
  • SRP is a universally conserved ribonucleoprotein that directs the traffic of proteins within the cell and allows them to be secreted.
  • the SRP RNA, together with one or more SRP proteins contributes to the binding and release of the signal peptide.
  • the RNA and protein components of this complex are highly conserved but do vary between the different kingdoms of life.
  • GENCODE in exosomes EXO
  • MV microvesicles
  • producer cells The transcript IDs are taken from the Ensembl database (www.ensembl.org).
  • RRNA ribosomal RNA
  • Ribosomal RNA forms part of the protein-synthesizing organelle known as a ribosome and that is exported to the cytoplasm to help translate the information in messenger RNA (mRNA) into protein.
  • Eukaryotic ribosome (80S) rRNA components are: large unit (rRNA 5S, 5.8S, and 28S) small unit (rRNA 18S). Both rRNA 28S and 5.8S are selectively up-shuttled in exosomes and MV.
  • Table 15 Identification rRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells.
  • EXO exosomes
  • MV microvesicles
  • producer cells The transcript IDs are taken from the Ensembl database
  • RNA Small nucleolar RNA: snoRNA
  • Small nucleolar RNAs are a class of small RNA molecules that primarily guides chemical modifications of other RNAs, mainly ribosomal RNAs, transfer RNAs and small nuclear RNAs. There are two main classes of snoRNA, the C/D box snoRNAs which are associated with methylation, and the H/ACA box snoRNAs which are associated with pseudouridylation.
  • Table 16 Identification of snoRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells.
  • EXO exosomes
  • MV microvesicles
  • producer cells The transcript IDs are taken from the Ensembl database (www.ensembl.org).
  • RNA Small nuclear RNA
  • snRNA Small nuclear ribonucleic acid
  • U-RNA Small nuclear ribonucleic acid
  • snRNA small nuclear ribonucleic acid
  • hnRNA pre-mRNA
  • B2 RNA RNA polymerase II
  • Table 17A Identification of snRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells.
  • EXO exosomes
  • MV microvesicles
  • the transcript IDs are taken from the Ensembl database (www.ensembl.org).
  • lincRNAs intergenic non-coding RNAs
  • long ncRNAs, IncRNA are non-protein coding transcripts longer than 200 nucleotides.
  • Table 17B Identification of lincRNA and putative novel lincRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells.
  • EXO exosomes
  • MV microvesicles
  • the transcript IDs are taken from the Ensembl database (www.ensembl.org).
  • GAS5 lincRNA is highly expressed in cell producer compared to in exosomes and microvesicles (down shuttled in both exosomes and MV).
  • Coding sequencing mRNA were also identified.
  • microvesicles and producer cells.
  • the transcript IDs are taken from the Ensembl database (www.ensembl.org).
  • the main scope of the deep sequence analysis was to identify their miRNA components in neural stem cell-derived vesicles (exosomes and microvesicles). This analysis identified a new set of known and novel miRNAs that are preferentially shuttled into both exosomes and MV.
  • hsa-miR-1246 hsa- miR-4488, hsa-miR-4492, hsa-miR-4508, hsa-miR-4516, hsa-miR-4532
  • novel miRNAs AC079949.1 , AP000318.1 , AL161626.1 , AC004943.1 , AL121897.1.
  • Top ranking shuttled miRNAs, including novel ones were validated by qRT-PCR in exosomes.
  • shuttle RNA as shown here, is mostly in the range of 20 to 200 nt and other RNA species are released by cells into the extracellular space.
  • deep sequencing and GENCODE sequence set analysis we found a greater complexity and diversity of non-coding RNA transcripts. We extended this analysis with detailed evaluation and this led to the discovery of preferentially up (defined as log2 fold change ⁇ 2) and down (defined as log2 fold change ⁇ - 2) shuttle of other non-coding RNAs in both exosomes and microvesicles.
  • rRNA ribosomal RNA
  • snoRNA small nucleolar
  • snRNA small nuclear RNA
  • miRNA miRNA
  • miRNA miRNA
  • miRNA miRNA
  • RMRP vault RNA
  • metazoa SRP metazoa SRP
  • RNY large intergenic non-coding RNAs
  • Hsa-miR-1246, hsa-miR-4492, hsa-miR-4532, and hsa-miR-4488 are still up-shuttled in EXO 6W as observed on proliferative EXO (07EI & EH; Figure 20 A&B).
  • New up-shuttled miRNAs are also identified, including hsa-miR-4792. 20.53 % of the identified miRNA are up-shuttled in the exosomes derived from 6 week Integra CTX cultures (shown in Figure 20C, middle panel).
  • FIG. 20H shows the three miRNA species with a read count >250: hsa-miR-10b-5p, hsa-miR-1246 and hsa-miR-486-5p.
  • Hsa-miR-1246 is present in 1 1 W exosomes, but was only observed to be up-shuttled in EX03.
  • Hsa-miR-4488, hsa-miR-4492, and hsa-miR-4532, identified in proliferative CTX0E03 cells and their exosomes, are almost absent in 11 week samples (both cells and exosomes).
  • Hsa-miR-486-5p was the only miRNA up-shuttled in all three EXO W1 1 samples.
  • Table E2 Summary table listing miRNA reads and log2.
  • Log2 is calculated using the normalized ratio of either EXO 6W or EXO 11W samples / averaged reads in EXO derived from proliferative cells.
  • Up-shuttled miRNAs (log2 > 2), in EXO derived from CTX0E03 cultured for 6 and 11 weeks in Integra flasks, are highlighted in lighter grey and down-shuttled (log2 ⁇ 2) in darker grey respectively.
  • the table presents only the top 30 more abundant miRNAs.
  • Table E3 Summary table listing miRNA reads and log2.
  • Log2 is calculated using the normalized ratio of either EXO 6W or EXO 11 W samples / averaged reads in EXO derived from proliferative cells.
  • Up-shuttled miRNAs (log2 > 2), in EXO derived from CTX0E03 cultured for 6 and 11 weeks in Integra flasks, are highlighted in lighter grey and down-shuttled (log2 ⁇ 2) in darker grey respectively.
  • the table presents only the top 30 more abundant miRNAs.
  • Table E4 Summary table listing miRNA reads and log2.
  • Log2 is calculated using the normalized ratio of either EXO 6W or EXO 11 W samples / averaged reads in EXO derived from proliferative cells.
  • Up-shuttled miRNAs (log2 > 2), in EXO derived from CTX0E03 cultured for 6 and 11 weeks in Integra flasks, are high-lighted in lighter grey and down-shuttled (log2 ⁇ 2) in darker grey respectively. The table presents only the top 30 more abundant miRNAs.
  • Hsa-miR-1246, hsa-miR-4492, hsa-miR-4532, and hsa-miR-4488 are the most up-shuttled miRNA types in exosomes derived from proliferative CTX0E03 cells.
  • Hsa-miR-1246, hsa-miR-4492, hsa-miR-4532, and hsa-miR-4488 are still present in EXO 6W sample, but hsa-miR-4492, hsa-miR-4532, and hsa-miR-4488 are almost absent in EXO 11 W samples.
  • Hsa-miR-181 a-5p, hsa-miR-1246, hsa-miR-127-3p, hsa-miR-21-5p, and hsa-miR-100-5p are the top 5 miRNAs present in EXO 6W sample.
  • Hsa-miR-181 a-5p, hsa-let-7a-5p, hsa-let-7f-5p, hsa-miR-92b-3p, and hsa-miR-9-5p are the top 5 miRNAs present in EXO 1 1 W samples.
  • Table E5 Summary table listing miRNA reads and log2.
  • Log2 is calculated using the normalized ratio of either cell 6W or cell 11W samples / averaged reads in proliferative cells. Up-expressed miRNAs (log2 > 2), in CTX0E03 cultured for 6 and 1 1 weeks in Integra flasks, are highlighted in lighter grey and down-expressed (log2 ⁇ 2) in darker grey respectively. The table presents only the top 30 more abundant miRNAs. Comparative analysis of miRNA expression in cell samples sorted by largest reads cultured for 6 week in Integra flasks (Cell 6W)
  • Table E6 Summary table listing miRNA reads and log2.
  • Log2 is calculated using the normalized ratio of either cell 6W or cell 11W samples / averaged reads in proliferative cells. Up-expressed miRNAs (log2 > 2), in CTX0E03 cultured for 6 and 11 weeks in Integra flasks, are high-lighted in lighter grey and down-expressed (log2 ⁇ 2) in darker grey respectively. The table presents only the top 30 more abundant miRNAs.
  • Table E7 Summary table listing miRNA reads and log2.
  • Log2 is calculated using the normalized ratio of either cell 6W or cell 11W samples / averaged reads in proliferative cells. Up-expressed miRNAs (log2 > 2), in CTX0E03 cultured for 6 and 1 1 weeks in Integra flasks, are high-lighted in lighter grey and down-expressed (log2 ⁇ 2) in darker grey respectively. The table presents only the top 30 more abundant miRNAs.
  • Hsa-let-7a-5p, hsa-miR-92b-3p, hsa-miR-21 -5p, hsa-miR-92a-3p, and hsa-miR-127-3p are the top 5 most expressed miRNA types in proliferative CTX0E03 cells.
  • Hsa-let-7a-5p, hsa-miR-181 a-5p, hsa-miR-26a-5p, hsa-miR-92a-3p, hsa-miR-100-5p are the top 5 most expressed miRNA types in CTX0E03 Integra 6W culture.
  • Hsa-miR-181 a-5p, hsa-miR-9-5p, hsa-let-7f-5p, hsa-let-7a-5p, and hsa-let-7i-5p are the top 5 most expressed miRNA types in CTX0E03 Integra 1 1W cultures.
  • Hsa-miR-181 a-5p and hsa-miR-9-5p are up-expressed in all cell samples cultured in Integra flasks (6 and 1 1 weeks).
  • Hsa-let-7i-5p, hsa-let-7c-5p (SEQ ID No.17), hsa-miR-181 a-3p and hsa-miR-181 b-5p were solely up-expressed in W11 cells.
  • Hsa-miR-181 family seems to play an important role in CTX0E03 long term culture and possible differentiation.
  • Exosomes and microvesicle fractions were prepared from a CTX0E03 cell Integra culture (week 2), using differential ultracentrifugation. Exosomes and microvesicles were disrupted in modified RIPA buffer (50mM Tris HCI, pH 8.0, 150mM NaCI, 1% SDS, 0.1% Triton X100, 10mM DTT, 1x Complete protease inhibitor (Roche) and 1x PhosStop phosphatase inhibitor (Roche)) and subjected to manual shearing using a 1 mL tuberculin syringe and 25 gauge needle. Samples were re- quantitated post disruption using the Qubit fluorometer (Invitrogen).
  • modified RIPA buffer 50mM Tris HCI, pH 8.0, 150mM NaCI, 1% SDS, 0.1% Triton X100, 10mM DTT, 1x Complete protease inhibitor (Roche) and 1x PhosStop phosphatase inhibitor (Roche)
  • Each gel digest was analysed by nano LC/MS/MS with a Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q Exactive. Peptides were loaded on a trapping column and eluted over a 75 ⁇ analytical column at 350nL/min; both columns were packed with Jupiter Proteo resin (Phenomenex). The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 FWHM and 17,500 FWHM resolution, respectively.
  • 2572 proteins were identified by Mass spectrometry in exosomes purified by ultracentrifugation.
  • the exosomes were isolated from the initial stages of an Integra culture (week 2).
  • the gene names and corresponding SWISSPROT accession numbers (in brackets) of all 2572 proteins are listed in Table 19 (in alphabetical order of gene name) and the 100 most abundant proteins are listed in Table 20, in order of decreasing abundance.
  • the characteristic exosome markers CD9, CD81 and Alix also known as PDCD6IP are present in the most abundant 100 proteins.
  • WDR43 (Q15061), WDR45L (Q5MNZ6), WDR48 (Q8TAF3), WDR5 (P61964), WDR54 (Q9H977), WDR55 (Q9H6Y2), WDR59 (Q6PJI9), WDR6 (Q9NNW5), WDR61
  • Table 19 Gene names and SWISSPROT accession numbers of all 2572 proteins identified in CTX0E03 exosomes (listed in alphabetical order of gene name).
  • Table 20 100 most abundant proteins (name and SwissProt accession number) observed in CTX0E03 exosomes Microvesicles
  • 2940 proteins were identified by Mass spectrometry in Microvesicles isolated from the initial stages of an Integra culture (week 2) and purified by centrifugation at 10,000 x g.
  • the gene names and corresponding SWISSPROT accession numbers (in brackets) of all 2940 proteins are listed in Table 21 (in alphabetical order of gene name) and the 100 most abundant proteins are listed in Table 22, in order of decreasing abundance.
  • Table 21 Gene names and SWISSPROT accession numbers of all 2940 proteins identified in CTX0E03 microvesicles (listed in alphabetical order of gene name).
  • CD63 also known as MLA1 and TSPAN30
  • TSG101 also known as ESCRT-I complex subunit TSG101
  • CD109 also known as 150 kDa TGF-beta-1-binding protein
  • thy-1 also known as CD90
  • Tetraspanin-4, -5, -6, -9 and 14 were detected in the exosome fraction; tetraspanins-6 and -14 were detected in the microvesicles.
  • CD133 also known as AC133, Prominin-1 , PROM1 , PROML1 and MSTP061 was detected in the exosomes but not the microvesicles.
  • CD53 also known as MOX44 and TSPAN25
  • CD82 also known as KAI 1 , SAR2, ST6 and TSPAN27
  • CD37 also known as TSPAN26
  • CD40 ligand also known as CD40LG, CD40L and TNFSF5
  • tubulin beta-3 chain also known as TUBB3
  • Nestin, GFAP and tubulin beta-3 chain were detected in both the exosome and microvesicle fractions, with tubulin beta-3 chain being particularly prominent within the top 100 proteins in both fractions.
  • Sox2, DCX, GALC, GDNF and I DO were not detected.
  • TNFRI also known as TNF receptor 1 , TNFRSF1A, TNFAR and TNFR1
  • Integrin alpha-2, -3, -4, -5, -6, -7, -V and integrin beta-1 , -4 and -8 were detected in both exosome and microvesicle fractions. Integrin beta-3 and -5 were detected in the microvesicles only.
  • MHC Class I antigens ⁇ e.g. HLA_A1 , HLA-A2 and HLA-B27) were detected in both the exosomes and microvesicles.
  • Cell-adhesion molecules ⁇ e.g. CADM1 , CADM4, ICAM1 , JAM3, L1CAM, NCAM) were detected in both the exosomes and microvesicles.
  • Cytoskeletal proteins e.g. actin, vimentin, keratins, catenins, dystroglucan, neurofilament polypeptide, microtubule-associated protein, tubulin, desmoplaktin, plectin, plakophilin, septin, spectrin, talin, vinculin and zyxin
  • Galectin-3, TIMP-1 , thrombosponding-1 , EGF receptor and CSK were detected in both the exosomes and microvesicles.
  • Figure 24 compares the proteomic data from the exosomes and microvesicles.
  • Figure 24A illustrates the number of unique proteins within each micro particle population, isolated from week 2 Integra culture system.
  • Figure 24B compares the biological processes associated with the identified proteins within each micro particle population, isolated from week 2 Integra system. The proteins identified within exosomes and microvesicles are associated with very similar biological processes.
  • Proteins associated with biotin metabolism were only found in exosomes and proteins involved in tryptophan biosynthesis and taurine/alpha-linolenic acid metabolism were only identified in microvesicles.
  • Figure 24C compares the CTX0E03 proteome to the Mesenchymal Stem Cell exosome proteome disclosed in Lai et al 2012, in which a total of 857 proteins were identified in exosomes released from mesenchymal stem cells.
  • Figure 24D compares the biological processes associated with the identified proteins within the MSC derived exosomes (Lim 2012) with the neural stem cell derived exosomes of the invention.
  • the three biological processes found to be associated with the MSC derived exosomes only are (in decreasing order of significance): Asthma; phenylalanine, tyrosine and tryptophan biosynthesis; and primary immunodeficiency.
  • the thirty biological processes found to be associated only with the neural stem cell derived exosomes are shown in Figure 25; the most significant biological function identified relates to RNA polymerase.
  • NSC exosomes contain notably more processes involved in RNA degradation, the Ribosome and spliceosomes, when compared to MSC exosomes.
  • the above comparison indicates a number of significant differences between NSC derived exosomes and MSC derived exosomes (as characterised by Lim et al 2012).

Abstract

L'invention concerne des particules de cellules souches neurales et leur utilisation pour le traitement du cancer. Les présents inventeurs ont découvert que des microparticules de cellules souches neurales peuvent être utilisées pour traiter un cancer par réduction directe du nombre de cellules cancéreuses chez un patient et/ou par induction de la sénescence dans des cellules cancéreuses chez un patient. La présente invention concerne également des compositions et des méthodes de traitement du cancer.
PCT/GB2018/052852 2017-10-06 2018-10-05 Microparticules de cellules souches pour la thérapie du cancer WO2019069093A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1716408.8 2017-10-06
GBGB1716408.8A GB201716408D0 (en) 2017-10-06 2017-10-06 Stem cell microparticles for cancer therapy

Publications (1)

Publication Number Publication Date
WO2019069093A1 true WO2019069093A1 (fr) 2019-04-11

Family

ID=60326655

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2018/052852 WO2019069093A1 (fr) 2017-10-06 2018-10-05 Microparticules de cellules souches pour la thérapie du cancer

Country Status (2)

Country Link
GB (1) GB201716408D0 (fr)
WO (1) WO2019069093A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110075122A (zh) * 2019-05-09 2019-08-02 复旦大学附属中山医院 一种肝癌治疗性外泌体药物
CN111920700A (zh) * 2020-09-17 2020-11-13 北京达熙生物科技有限公司 一种干细胞外泌体的制备技术及在药品和化妆品中的应用
CN113583965A (zh) * 2021-08-05 2021-11-02 大连干细胞与精准医学创新研究院 一种条件永生化人神经干细胞来源细胞膜纳米囊泡制剂及其制备方法和应用
CN113973498A (zh) * 2020-05-25 2022-01-25 希科医舒健株式会社 源自间充质干细胞的外泌体生产方法及利用其制备的培养液

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014013258A1 (fr) * 2012-07-19 2014-01-23 Reneuron Limited Microparticules de cellules souches
WO2014125277A1 (fr) * 2013-02-12 2014-08-21 Reneuron Limited Procédé de production de microparticules
WO2015022545A2 (fr) * 2013-08-14 2015-02-19 Reneuron Limited Microparticules de cellules souches et miarn
WO2015052526A1 (fr) * 2013-10-09 2015-04-16 Reneuron Limited Microparticules et micro-arn de cellules souches

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014013258A1 (fr) * 2012-07-19 2014-01-23 Reneuron Limited Microparticules de cellules souches
WO2014125277A1 (fr) * 2013-02-12 2014-08-21 Reneuron Limited Procédé de production de microparticules
WO2015022545A2 (fr) * 2013-08-14 2015-02-19 Reneuron Limited Microparticules de cellules souches et miarn
WO2015052526A1 (fr) * 2013-10-09 2015-04-16 Reneuron Limited Microparticules et micro-arn de cellules souches

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
E. VAN DER POL ET AL: "Classification, Functions, and Clinical Relevance of Extracellular Vesicles", PHARMACOLOGICAL REVIEWS, vol. 64, no. 3, 1 July 2012 (2012-07-01), pages 676 - 705, XP055155968, ISSN: 0031-6997, DOI: 10.1124/pr.112.005983 *
INDIRA VISHNUBHATLA ET AL: "The Development of Stem Cell-derived Exosomes as a Cell-free Regenerative Medicine", JOURNAL OF CIRCULATING BIOMARKERS, vol. 3, no. 2, 30 April 2014 (2014-04-30), pages 1 - 14, XP055155696, DOI: 10.5772/58597 *
N. KOSAKA ET AL: "Competitive Interactions of Cancer Cells and Normal Cells via Secretory MicroRNAs", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 287, no. 2, 6 January 2012 (2012-01-06), pages 1397 - 1405, XP055161557, ISSN: 0021-9258, DOI: 10.1074/jbc.M111.288662 *
STEFANIA BRUNO ET AL: "Effects of Mesenchymal Stromal Cell-Derived Extracellular Vesicles on Tumor Growth", FRONTIERS IN IMMUNOLOGY, vol. 5, 11 August 2014 (2014-08-11), XP055161795, DOI: 10.3389/fimmu.2014.00382 *
VALENTINA FONSATO ET AL: "Human Liver Stem Cell-Derived Microvesicles Inhibit Hepatoma Growth in SCID Mice by Delivering Antitumor MicroRNAs", STEM CELLS, vol. 30, no. 9, 20 September 2012 (2012-09-20), pages 1985 - 1998, XP055161662, ISSN: 1066-5099, DOI: 10.1002/stem.1161 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110075122A (zh) * 2019-05-09 2019-08-02 复旦大学附属中山医院 一种肝癌治疗性外泌体药物
CN110075122B (zh) * 2019-05-09 2021-04-20 复旦大学附属中山医院 一种肝癌治疗性外泌体药物
CN113973498A (zh) * 2020-05-25 2022-01-25 希科医舒健株式会社 源自间充质干细胞的外泌体生产方法及利用其制备的培养液
CN113973498B (zh) * 2020-05-25 2023-04-14 希科医舒健株式会社 源自间充质干细胞的外泌体生产方法及利用其制备的培养液、药学组合物、化妆品组合物
CN111920700A (zh) * 2020-09-17 2020-11-13 北京达熙生物科技有限公司 一种干细胞外泌体的制备技术及在药品和化妆品中的应用
CN113583965A (zh) * 2021-08-05 2021-11-02 大连干细胞与精准医学创新研究院 一种条件永生化人神经干细胞来源细胞膜纳米囊泡制剂及其制备方法和应用

Also Published As

Publication number Publication date
GB201716408D0 (en) 2017-11-22

Similar Documents

Publication Publication Date Title
JP6644851B2 (ja) 幹細胞微粒子
ES2705052T5 (es) Micropartículas de células madre y ARNmi
ES2927175T3 (es) Método de producción de micropartículas
JP6491661B2 (ja) 幹細胞微粒子及びｍｉＲＮＡ
CN104703609B (zh) 干细胞微粒
Abels et al. Glioblastoma-associated microglia reprogramming is mediated by functional transfer of extracellular miR-21
JP2016534036A (ja) 幹細胞微粒子及びｍｉＲＮＡ
WO2019069093A1 (fr) Microparticules de cellules souches pour la thérapie du cancer
Li et al. γδTDEs: an efficient delivery system for miR-138 with anti-tumoral and immunostimulatory roles on oral squamous cell carcinoma
US20210030807A1 (en) Cell-type specific exosomes and use thereof
EP3401393B1 (fr) Microarn pour la génération d'astrocytes
Marinaro et al. Unraveling the molecular signature of extracellular vesicles from endometrial-derived mesenchymal stem cells: potential modulatory effects and therapeutic applications
WO2017100403A1 (fr) Lymphocyte t humain dérivé de cellule souche pluripotente induite dérivée de lymphocyte t et procédés de fabrication et d'utilisation
Mohammadi et al. Isolation and characterization of microvesicles from mesenchymal stem cells
Moore et al. Downregulation of an evolutionary young miR-1290 in an iPSC-derived neural stem cell model of autism spectrum disorder
Didiano et al. Induction of a proliferative response in the zebrafish retina by injection of extracellular vesicles
US20190015453A1 (en) MicroRNAS FOR THE GENERATION OF ASTROCYTES
Wang et al. E3-ligase Skp2 regulates β-catenin expression and maintains hematopoietic stem cell homing
EP3384011A1 (fr) Procédés de différenciation de cellules en cellules stellaires hépatiques
Guru et al. HSF-1 enhances cardioprotective potential of stem cells via exosome biogenesis and their miRNA cargo enrichment
Abner Extracellular Vesicles: Mechanisms of Cargo Selection and Cell-Cell Communication
Tripathi et al. Dicer deficiency in microglia leads to accelerated demyelination and failed remyelination
Stephanou Advancing Lentiviral Gene Therapy Vectors for Β-thalassaemia
CN111315871A (zh) 系统

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18785726

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18785726

Country of ref document: EP

Kind code of ref document: A1