WO2019039810A1 - Composition comprising extract of lonicera coerulea for prevention or treatment of pain - Google Patents

Composition comprising extract of lonicera coerulea for prevention or treatment of pain Download PDF

Info

Publication number
WO2019039810A1
WO2019039810A1 PCT/KR2018/009517 KR2018009517W WO2019039810A1 WO 2019039810 A1 WO2019039810 A1 WO 2019039810A1 KR 2018009517 W KR2018009517 W KR 2018009517W WO 2019039810 A1 WO2019039810 A1 WO 2019039810A1
Authority
WO
WIPO (PCT)
Prior art keywords
pain
group
control group
extract
administration
Prior art date
Application number
PCT/KR2018/009517
Other languages
French (fr)
Korean (ko)
Inventor
엄주환
Original Assignee
주식회사 에이치앤케이바이오사이언스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 에이치앤케이바이오사이언스 filed Critical 주식회사 에이치앤케이바이오사이언스
Publication of WO2019039810A1 publication Critical patent/WO2019039810A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/35—Caprifoliaceae (Honeysuckle family)
    • A61K36/355—Lonicera (honeysuckle)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health

Definitions

  • the present invention relates to a composition for prevention or treatment of pain comprising a farinacea tree extract, and more particularly to a pharmaceutical composition for preventing or treating pain, including a farinacea tree extract or a fraction thereof, a food composition, a quasi-drug composition, .
  • Pain is caused by a variety of causes. If the pain persists for a long period of time or if the stimulus is too severe, it may interfere with daily life and cause anxiety and fear. Therefore, people with chronic pain often have depression. In particular, it is known that 7-8% of the population is suffering from neuropathic pain caused by injury or disease. Primary dysmenorrhea, or menses, has a prevalence of 45- 95%, it is urgent to develop materials and methods for treating such diseases.
  • acetylsalicylic acid, ibuprofen, acetaminophen, and indomethacin are widely used to treat pain.
  • the above-mentioned painkillers are effective when they are administered in a high dose, and when they are effective in the early stage, they are resistant to long-term use and often have no effect.
  • amitriptyline is widely used as an analgesic and antidepressant in chronic pain patients, and is known to exhibit relatively strong anti-inflammatory and antioxidative effects.
  • cardiac toxicity Goodnick PJ, Expert Opin Pharmacother. 2002, 3: 479-98 .; Thanacoody HK, Toxicol Rev. 2005, 24: 205-14.
  • a new analgesic agent having excellent analgesic effect even at a low dose is urgently required.
  • an analgesic agent including gold silver is developed (Korean Patent Registration No. 10-0554079). It is well known that Lonicera japonica Thunb. Has excellent thermoregulation, antipyretic, detoxification and antiinflammatory effects, and in particular, it has antiseptic and analgesic effects. Earthen flower buds or flowers that start to bloom are widely used as traditional medicines as medicines.
  • Lonicera caerulea var. Edulis is a plant in Korea, China and Japan. Its fruit has been used as a traditional medicine.
  • the fruit of the japanese tree is rich in ascorbic acid, phenolic compounds such as anthocyanins and flavonoids having excellent antioxidative effects, and has excellent lipid and glucose metabolism improving effect, liver protecting effect, anti-inflammatory effect and promoting wound healing It is known.
  • its analgesic effect was not known.
  • the herbal extract according to the present invention exhibits analgesic effects such as suppression of weight loss, cold allodynia, mechanical allodynia, menstrual pain and the like, and thus can be effectively used for preventing, improving or treating analgesia.
  • FIG. 1 is an image showing a step-by-step process of CCI (Chronic Constriction Injury) surgery according to an embodiment of the present invention.
  • FIG. 2 is a schematic diagram of an experiment for confirming the analgesic effect on neuropathic pain of a farina tree extract (hereinafter referred to as 'BH') according to an embodiment of the present invention.
  • FIG. 3 is a schematic view of an experiment for confirming the analgesic effect on the menstrual cramp of the Butterfly tree extract according to an embodiment of the present invention.
  • FIG. 4 is a graph showing the effect of weight gain of the above-described Swine Extract on the neuropathic pain rat model.
  • Fig. 5 is a graph showing writhing, i.e., abdominal pain-reducing effect, of the abdomen in the model of the rats.
  • 500 mg / kg body weight 500 mg / kg BH 500 mg / kg body weight, and 500 mg / kg BH 500 mg / kg body weight, respectively, for intact control, / kg, 250 BH for 250 mg / kg BH, and 125 BH for 125 mg / kg BH.
  • a indicates that p ⁇ 0.01 as compared with the normal control as a result of LSD test
  • b indicates that p ⁇ 0.01 as compared with the pseudorabies control group as a result of LSD test.
  • Fig. 6 is an image showing the effect of reducing the uterine congestion and enlargement of the above-described Swallow's tree extract in a ricket-cell rat model. Scale bars represent 11 mm, A is a normal control group, B is a menstrual control group, C is an indomethacin 5 mg / kg, D is a 500 mg / kg LF group, and E is 500 mg / kg BH , F means 250 mg / kg BH, and G means 125 mg / kg BH.
  • FIG. 7 is a graph showing the effect of uterus weights reduction on the uterine weight of the above-described Swallow's tree extract in a menses-based rat model.
  • a and b indicate that p ⁇ 0.01 and p ⁇ 0.05, respectively, as compared with the normal control group, and c indicates that p ⁇ 0.01 as compared with the control group, and d indicates the MW test as compared with the normal control group p < 0.01, and e indicates that p < 0.01 as compared to the dumbbell control group as a result of MW test.
  • FIG. 8 is an image showing the effect of reducing the inflammation in the uterine tissue of the above-described Swine Extract in the model of the rats in the rats.
  • FIG. 8 shows the thickness of the entire uterus.
  • B is a 500 mg / kg BH group
  • F is a BH group
  • B is a normal control group.
  • B is a control group
  • C is an indomethacin 5 mg / kg group
  • D is LF 500 mg / kg group, 250 mg / kg administration group
  • G means 125 mg / kg BH administration group.
  • a and b indicate that p ⁇ 0.01 and p ⁇ 0.05, respectively, as compared with the normal control group, and c indicates that p ⁇ 0.01 as compared with the control group, and d indicates the MW test as compared with the normal control group p ⁇ 0.01, and e indicates that p ⁇ 0.01 as compared to the dumbbell control group as a result of MW test.
  • FIG. 9 shows immunoreactive cells against TNF-.alpha. And iNOS-2 as an image showing the effect of reducing the inflammation in the uterine tissue of the above-described Butterfly tree extract in a menses-rat model.
  • B is a 500 mg / kg BH group
  • F is a BH group
  • B is a normal control group.
  • B is a control group
  • C is an indomethacin 5 mg / kg group
  • D is LF 500 mg / kg group, 250 mg / kg administration group
  • G means 125 mg / kg BH administration group.
  • one aspect of the present invention provides a pharmaceutical composition for preventing or treating pain, comprising a farina tree extract or a fraction thereof.
  • the present inventors have confirmed that the extract of Staphylococcus aureus reduces weight loss, cold / mechanical allodynia and abdominal pain by relieving pain in rats induced pain, and the pain relieving effect is inhibited by peroxidation, microglial cell / Inhibition of expression of proinflammatory cytokines, promotion of antioxidative activity, and inhibition of inflammation.
  • the above-described Butterfly tree extract can be effectively used for preventing, ameliorating or treating pain.
  • buttock tree refers to Lonicera caerulea var. means a deciduous broad-leaved shrub and has a scientific name of edulis L, honeysuckle, and more Blueberry (var. emphyllocalyx), broad leaf daengdaengyi (var. longibracteata), round leaves daengdaengyi include various sub-species, called the like (var. venulosa) one , But is not limited thereto.
  • the fruit of the buttock tree is elliptical berry, which is blackened in autumn and eaten raw. It is known that the fruit of the buttock tree is effective for dementia, wrinkle improvement, whitening, etc. However, the therapeutic effect on the pain has not been known and it was firstly described by the present inventors.
  • roots, stems, leaves, fruits, flowers and the like of the buttock tree may be used for preventing or treating pain, and more specifically, fruits may be used.
  • fruits may be used.
  • it is not limited.
  • the butt-knot can be purchased commercially, sold in the nature, or cultivated.
  • extract refers to an extract obtained by extracting the buttock tree, a diluted solution or concentrate of the extract, a dried product obtained by drying the extract, a controlled preparation or a purified product of the extracted solution, Itself and extracts of all formulations which can be formed using extracts.
  • the method of extracting the buttock wood is not particularly limited, and may be extracted according to a method commonly used in the art.
  • Non-limiting examples of the extraction method include hydrothermal extraction, ultrasonic extraction, filtration, and reflux extraction. These may be performed alone or in combination with two or more methods.
  • the type of the extraction solvent used for extracting the butte wood is not particularly limited, and any solvent known in the art can be used.
  • Nonlimiting examples of the extraction solvent include water, alcohols having 1 to 4 carbon atoms, and mixed solvents thereof. These solvents may be used alone or in combination.
  • fraction of the present invention means a product obtained by performing fractionation to separate a specific component or a specific component group from a mixture containing various components.
  • the fractionation method for obtaining the fraction is not particularly limited and may be carried out according to a method commonly used in the art.
  • Non-limiting examples of the fractionation method include a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed through an ultrafiltration membrane having a constant molecular weight cut-off value, various chromatography (size, charge, hydrophobicity Or affinity-based separation), and a combination thereof, and the like.
  • the kind of the fraction solvent used for obtaining the fraction in the present invention is not particularly limited, and any solvent known in the art can be used.
  • Non-limiting examples of the fraction solvent include polar solvents such as water and alcohols having 1 to 4 carbon atoms; Non-polar solvents such as hexane (Hexan) and ethyl acetate (Ethyl acetate); Or a mixed solvent thereof. These may be used alone or in combination of one or more, but the present invention is not limited thereto.
  • extract or fraction may be prepared and used in the form of a dry powder after extraction, but is not limited thereto.
  • pain refers to an unpleasant sensation caused by stimulation of a specific nerve having a pain receptor, and includes all symptoms that the sensation is alleviated, prevented or cured by the leaves of the Japanese persimmon tree or its fractions . It is commonly referred to as headache, chest pain, abdominal pain, back pain, etc., depending on the area of the pain. Somatic pain, visceral pain, and neuropathic pain are classified according to the generation of the pain.
  • the pain may include anatomically distinct pain, such as neck pain, back pain, back pain, chest pain, head pain, and the like.
  • the pain is caused by nociceptive pain due to cell damage, psychogenic pain caused by psychological conditions, inflammatory pain associated with tissue damage and immune cell infiltration, Or neuropathic pain caused by its abnormal function, and the like.
  • the painful water-soluble pain may include a somatic tube and a visceral tube.
  • the pain may be at least one selected from the group consisting of achromatic pain, cardiogenic pain, inflammatory pain and neuropathic pain, and more particularly, it may be at least one selected from the group consisting of painful pain, inflammatory pain, cancer pain and postoperative pain; Trigeminal neuralgia pain corresponding to neuropathic pain, idiopathic pain and diabetic neuropathic pain; And a migraine head and a menstrual cramp corresponding to a visceral tube, but the present invention is not limited thereto.
  • prophylactic of the present invention refers to any act that inhibits or delays pain by administration of a composition comprising the Swallow's tree extract or its fractions.
  • treatment refers to any action in which the pain is alleviated, improved or beneficially altered by the administration of a composition comprising the farinacea tree extract.
  • composition of the present invention can also treat or prevent secondary symptoms such as appetite suppression and weight gain caused by pain.
  • the extract of Staphylococcus aureus exhibits analgesic effects such as inhibition of weight loss, cold allodynia and mechanical allodynia in rats induced by chronic constriction injury (CCI) surgery 4, and Tables 3 to 5), the analgesic effect was due to a decrease in spinal lipid peroxidation, an increase in antioxidant activity of the spinal cord, a decrease in the expression of microglia / astrocytic cell activation factor in spinal cord tissues, and a decrease in expression of proinflammatory cytokines (Tables 6, 7, 9 and 11).
  • estradiol benzoate and oxytocin induced weight loss inhibition and abdominal analgesia (Table 12 and Fig.
  • the herb extract or its fractions exhibit therapeutic effects of pain caused by various causes, and exhibit effects such as suppression / reduction / alleviation / improvement of pain. Therefore, the pharmaceutical composition of the present invention Suggesting that the composition can be usefully used for preventing or treating pain. Moreover, such an effect is higher or similar to existing drugs such as amitriptyline, indomethacin or gingival extract, and provides a possibility as a therapeutic agent derived from safe natural products.
  • the pharmaceutical composition of the present invention may include, but is not limited to, 0.001 to 80, specifically 0.001 to 70, more specifically 0.001 to 60% by weight of the above-described farinacea extract or fraction thereof, based on the total weight of the composition.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, excipient or diluent conventionally used in the manufacture of a pharmaceutical composition, which carrier may comprise a non-naturally occuring carrier have.
  • carrier examples include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, But are not limited to, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil.
  • the pharmaceutical composition may be formulated into tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze- And the formulations may be of various forms, such as oral or parenteral. In the case of formulation, it may be prepared by using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used, but the present invention is not limited thereto.
  • solid formulations for oral administration tablets, pills, powders, granules, capsules and the like may be used.
  • These solid preparations may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose lactose, gelatin and the like may be used.
  • excipients such as starch, calcium carbonate, sucrose or lactose lactose, gelatin and the like may be used.
  • lubricants such as magnesium stearate, talc, and the like may be used, but the present invention is not limited thereto.
  • liquid preparation for oral administration suspensions, solutions, emulsions, syrups and the like may be used.
  • various excipients such as wetting agents, sweeteners, Etc. may be used.
  • sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations or suppositories may be used.
  • non-aqueous solvent and suspension agent include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like.
  • suppository base examples include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like, but the present invention is not limited thereto.
  • Another embodiment provides a method for treating pain, comprising administering the pharmaceutical composition to a subject in which pain is caused or suspected of being caused.
  • administering means introducing a composition comprising said Swine Extract or fraction thereof to a subject in an appropriate manner.
  • individual of the present invention means all animals such as rats, mice, livestock, etc., including humans, in which pain can be induced or induced. As a specific example, it may be a mammal and may be an individual other than a human.
  • the pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the species and severity, age, sex, The sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts.
  • the pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. In addition, it can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by a person skilled in the art.
  • the pharmaceutical composition may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) depending on the intended method, and the dose may be determined depending on the condition and weight of the patient, , The type of drug, the route of administration, and the time, but may be suitably selected by those skilled in the art.
  • the pharmaceutical composition may be administered in an amount of generally 0.001 to 1000 mg / kg, more particularly 0.05 to 200 mg / kg, most specifically 0.1 to 100 mg / kg, once / ,
  • the preferred dosage may be appropriately selected by those skilled in the art depending on the condition and the weight of the individual, the degree of disease, the type of drug, the route of administration and the period of time.
  • Another embodiment provides a food composition for preventing or ameliorating pain comprising a farinacea tree extract or a fraction thereof.
  • the food composition of the present invention can be ingested routinely, it can be expected to have an excellent effect of improving pain and unlike general drugs, there is no side effect that may occur when a natural product is used as a raw material, It can be very useful for preventing or improving pain.
  • improvement of the present invention means any action that reduces the degree of the parameter associated with the condition being treated, such as the severity of symptoms, by administration of the food composition.
  • food of the present invention includes dairy products such as meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen and other noodles, gums, ice cream, various soups, drinks, tea, , A vitamin complex, a health functional food, and a health food, all of which include foods in a conventional sense.
  • the health functional food is the same term as food for special health use (FoSHU).
  • the health functional food has a high medical effect, It means food.
  • 'function (sex)' refers to the structure and function of the human body to obtain nutritional effects or obtain a beneficial effect for health use such as physiological action.
  • the health food refers to a food having an active health promotion or promotion effect compared with a general food, and a health supplement food refers to a food for health assistance.
  • the terms health functional foods, health foods, and health supplements may be used interchangeably.
  • the health functional food is a food prepared by adding the Swine Extract or its fraction of the present invention to a food material such as a beverage, a tea, a spice, a gum, or a confection, or encapsulating, pulverizing, , But it has the advantage that there is no side effect that can occur when a drug is taken for a long time using a food as a raw material unlike a general medicine.
  • the food of the present invention can be prepared by a method commonly used in the art, and can be prepared by adding raw materials and components which are conventionally added in the art.
  • the food composition can be produced in various forms without limitations as long as it is a food-acceptable formulation.
  • the food composition may further comprise a physiologically acceptable carrier.
  • the carrier is not particularly limited and any carrier conventionally used in the art can be used.
  • the food composition may contain additional components that are commonly used in food compositions and can improve odor, taste, visual appearance, and the like.
  • Minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu) and chromium (Cr); And amino acids such as lysine, tryptophan, cysteine, valine, and the like.
  • the food composition may contain at least one kind selected from the group consisting of preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate), disinfectants (such as bleaching powder and highly bleached white powder, sodium hypochlorite), antioxidants (butylhydroxyanisole (BHA) (Sodium nitrite), bleach (sodium sulfite), seasoning (sodium MSG glutamate, etc.), sweeteners (dicin, cyclamate, saccharin, etc.), coloring agents , Sodium, etc.), perfume (vanillin, lactones, etc.), swelling agents (alum, potassium hydrogen D-tartrate), emulsifiers, thickeners (foams), encapsulating agents, gum bases, foam inhibitors, solvents, And may include food additives.
  • the additives can be selected according to the type of food and used in an appropriate amount.
  • the extract of Staphylococcus aureus exhibits analgesic effects such as inhibition of weight loss, cold allodynia and mechanical allodynia in rats induced by chronic constriction injury (CCI) surgery 4, and Tables 3 to 5), the analgesic effect was due to a decrease in spinal lipid peroxidation, an increase in antioxidant activity of the spinal cord, a decrease in the expression of microglia / astrocytic cell activation factor in spinal cord tissues, and a decrease in expression of proinflammatory cytokines (Tables 6, 7, 9 and 11).
  • estradiol benzoate and oxytocin induced weight loss inhibition and abdominal analgesia (Table 12 and Fig.
  • the herb extract or its fractions exhibit the effect of treating or improving the pain caused by various causes, and exhibit the effects of inhibiting / reducing / alleviating / improving the pain.
  • the present invention Suggesting that the food composition of the present invention can be usefully used for prevention or improvement of pain.
  • Another embodiment provides a quasi-drug composition for preventing or ameliorating pain comprising a farina tree extract or a fraction thereof.
  • quasi-drug product of the present invention refers to products which are used for diagnosis, treatment, improvement, alleviation, treatment or prevention of diseases of human beings or animals, and whose action is less than that of drugs.
  • Quasi-drugs are products that are used for the treatment or prevention of diseases of humans / animals, products which are mild to the human body or which do not act directly.
  • the quasi-drug composition of the present invention may be manufactured by, but not limited to, a body cleanser, a foam, a soap, a mask, an ointment, a cream, a lotion, an essence and a spray.
  • the composition may be manufactured in the form of bands, sanitary napkins, etc., but is not limited thereto.
  • the composition may be added as it is or may be used together with other quasi-drugs or quasi-drugs, and may be suitably used according to a conventional method.
  • the amount of the active ingredient to be mixed can be appropriately determined depending on the purpose of use.
  • the extract of Staphylococcus aureus exhibits analgesic effects such as inhibition of weight loss, cold allodynia and mechanical allodynia in rats induced by chronic constriction injury (CCI) surgery 4, and Tables 3 to 5), the analgesic effect was due to a decrease in spinal lipid peroxidation, an increase in antioxidant activity of the spinal cord, a decrease in the expression of microglia / astrocytic cell activation factor in spinal cord tissues, and a decrease in expression of proinflammatory cytokines (Tables 6, 7, 9 and 11).
  • estradiol benzoate and oxytocin induced weight loss inhibition and abdominal analgesia (Table 12 and Fig.
  • the herb extract or its fractions exhibit the effect of treating or improving the pain caused by various causes, and exhibit the effects of inhibiting / reducing / alleviating / improving the pain.
  • the present invention Of quasi-drug compositions may be useful for preventing or improving pain.
  • the BH contained 4.54 ⁇ 0.09% of betaine, 210.63 ⁇ 23.65 mg of GAE / g of total phenols, 159.30 ⁇ 12.51 mg of CE / g of total flavonoids, 133.5 of total antocyanins ⁇ 4.06 mg M3GE / g was included.
  • Example 1-1 1 liter of 25% ethyl alcohol was added to 100 g of pulverized royal jelly as in Example 1-1, and the mixture was thoroughly stirred. Then, the mixture was heat-refluxed for 3 hours at an extraction temperature of 80 to 90 ° C., The herbal medicine extract was concentrated under reduced pressure at 55 to 65 ° C and then lyophilized to obtain 19.5 g of herbal composition powdery extract.
  • BH contained 4.54 ⁇ 0.09% of betaine, 210.63 ⁇ 23.65 mg of GAE / g of total phenol, 159.30 ⁇ 12.51 mg of CE / g of total flavonoid and 133.57 ⁇ 4.06 mg of M3GE / g of total anthocyanin.
  • Experimental Example 1-1 An experimental animal in which neuropathic pain was induced
  • a total of 70 male rats (SPF / VAF Outbred Crl: CD) were obtained (OrientBio, Seungnam, Korea) for 7 days and then subjected to sham-surgery or CCI constriction injury) surgery. After 24 hours of operation, eight experimental animals of similar weight were selected for each group. At this time, the control group and the experimental group are shown in Table 1 below, and classified according to the type of surgery and the drug to be administered.
  • a total of 73 female SD (SPF / VAF Outbred Crl: CD) rats were obtained (OrientBio, Seungnam, Korea) and purified for 28 days, and menstrual cramps were induced by administering a damping inducer according to the method described in Experimental Example 3 below. Then, 10 animals with similar body weights were selected for each group. At this time, the control group and the experimental group are as shown in Table 2 below, and classified according to the type of surgery and the drug to be administered.
  • CCI chronic constriction injury
  • the sham control was not closed after confirming the left sciatic nerve by the same method, and the muscle and the skin were closed in the same manner.
  • rats were administered estradiol benzoate and oxytocin.
  • estradiol benzoate was subcutaneously administered once a day for 10 days (2.5 mg / kg at the initiation and final administration and 1 mg / kg when administered 2 to 9 times), and then the estradiol One hour after administration of benzoate, 1 U / kg of oxytocin was administered in a single dose.
  • estradiol benzoate and oxytocin were suspended or dissolved in physiological saline and administered subcutaneously or intraperitoneally with a 26 G needle attached to a 5 ml syringe.
  • physiological saline was subcutaneously or intraperitoneally injected at the same dose and frequency.
  • FIG. 2 The method of administering the drug to the control group, the comparative group and the experimental group according to the present invention is shown in detail in FIG. 2 and FIG.
  • the test drug, BH was dissolved in sterile distilled water at concentrations of 100, 50, and 25 mg / ml, and adhered to a 5 ml syringe for 14 days at a dose of 5 ml / kg (500, 250 and 125 mg / Orally administered with zonde.
  • the highest dose of BH 500 mg / kg was set based on the results of previous studies on the evaluation of pharmacological effect and mouse toxicity in hypothyroidism rat models of the present inventors (Kim HS, Toxicol Res. 2015, 31 : 61-8.).
  • intermediate doses (250 mg / kg) and low doses (125 mg / kg) were set for half the doses.
  • the comparative drug, LF was dissolved in sterilized distilled water at a concentration of 100 mg / ml and orally administered at the dose of 5 ml / kg (500 mg / kg) for the same period and method as the BH administration.
  • Amitriptyline another comparative drug, was dissolved in saline at a concentration of 2 mg / ml and was injected with a dose of 5 ml / kg (10 mg / kg) from 24 hours after CCI surgery, Were intraperitoneally administered using a 26 G needle attached to the mouse.
  • the administration dose and administration method of amitriptyline were set as known in the art (Berrocoso E, Eur J Pharmacol. 2011, 655: 46-51).
  • Indomethacin another comparative drug, was suspended in sterile distilled water at a concentration of 1 mg / ml and dosed with 5 ml / kg (5 mg / kg) once daily for 10 days with estradiol benzoate Min, orally administered with sonde attached to a syringe.
  • the dosage and administration method of the indomethacin were set as known in the art (Kim et al., J Periodontal Res. 2012, 47: 800-10).
  • distilled water was orally administered by the same period and in the same manner as the BH administration in order to apply the same correction and stress to the administration.
  • Example 1-1 Check changes in weight and weight gain
  • body weight was measured once a day on the 1st, 3rd, 7th, 10th, and 14th days after the administration of the drug (day 0) and 24 hours after the CCI surgery, respectively.
  • the weight gain after 14 days of administration was calculated as shown in Equation 1 below. The results are shown in FIG. 4 and Table 3 below.
  • the body weight was increased 3 days after the start of administration compared with the CCI control.
  • the body weight gain was increased by 2200.00 and 1291.67%, respectively, as compared with the CCI control group
  • the 500 mg / kg BH group showed similar or better weight gain and reduced body weight gain than the amitriptyline 10 mg / kg group and LF 500 mg / kg group.
  • CCI causes a variety of allodynia, such as cold allodynia, very similar to the clinical symptoms of human neuropathic pain (Jasmin L, KPain 1998, 75: 367-82.).
  • the rats were placed on a metal plate at a low temperature (4 ⁇ 1 ° C), and a transparent plastic box (280 ⁇ 250 ⁇ ) was prepared using a hot / cold plate test system (Model 35150, Ugo Basile SRL) 210 mm 3 , Varese, Italy). The number of times the rats lifted the left hind paw for 2 minutes was then calculated as a painful response. At this time, this experiment was performed at 24 hours after CCI surgery, before (0 day) and 1, 3, 7, 10 and 14 days after administration of the drug, respectively.
  • a hot / cold plate test system Model 35150, Ugo Basile SRL
  • cold allodynia decreased from 3 days after administration of BH 500, 250 and 125 mg / kg, respectively, as compared with CCI control.
  • the three BH-treated groups showed a dose-dependent reduction of cold allodynia, and it was confirmed that the cold allodynia was reduced by -55.93, -41.81 and -31.07% on the 14th day of the drug administration .
  • the BH 500 mg / kg group showed a similar cold aldosterol reduction effect as the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group also showed lower LF 500 mg / It was confirmed that it exhibits excellent cold allodynia reduction effect.
  • CCI causes a variety of allodynia, including mechanical allodynia, which is very similar to the clinical symptoms of human neuropathic pain (Jasmin L, KPain 1998, 75: 367-82.).
  • the rat subjected to the low-temperature plate test according to Example 1-2 was put on a wire net in the air and was confined in Perspex boxes (185 x 210 x 135 mm 3 ). The pain was then measured using a dynamic plantar aesthesiometer system (Model 37450, Ugo Basile SRL, Varese, Italy) and von Frey filament (Bio-VF -M, Bioseb, Chaville, France) in grams (g). 50 g was set as the cutoff limit, and the force inducing the retraction reaction was set as a threshold. At this time, this experiment was performed at 24 hours after CCI surgery, at 1, 3, 7, 10, and 14 days after administration of the drug (0 day), and the results are shown in Table 5 below.
  • the threshold value was increased 3 days after the start of administration compared with the CCI control group. Also, at the 14th day of drug administration, the threshold value was increased by 126.13 and 43.24%, respectively, as compared with the CCI control group.
  • the threshold values of BH 500, 250 and 125 mg / kg administration groups were significantly increased after 3 days of administration compared to the CCI control group.
  • the dose-dependent threshold increase was observed in the three BH-treated groups, and that the threshold values were increased by 121.62, 81.08 and 48.65%, respectively, on the 14th day of the administration of the drug compared to the CCI control group.
  • the 500 mg / kg BH group exhibited a similar or better threshold increase effect than the amitriptyline 10 mg / kg group and the LF 500 mg / kg group.
  • Example 2-1 Decreased effect of spinal lipid peroxidation
  • oxidative stress is one of the causes of chronic neuropathic pain
  • MDA is the final product of lipid peroxidation, which is useful as a measure of lipid peroxidation (Messarah M, Exp. Toxicol Pathol. 2010, 62: 301-10 .).
  • the lumbosacral spinal cord of the L4-L6 portion was separated from the rats in which the von Frey hair filament test according to Example 1-3 was completed, and the weight thereof was measured. Thereafter, a bead beater (Model TacoTMPre, GeneResearch Biotechnology Corp., Taichung, Taiwan) and an ultrasonic cell crusher (manufactured by Takara Shuzo) in a buffer solution composed of 10 mM sucrose, 10 mM Tris-HCl and 0.1 M MEDTA (Model KS-750, Madell Technology Corp., Ontario, CA) and centrifuged at 12,000 g for 15 minutes. The homogenate of the obtained spinal cord tissues was stored at -150 ° C until use with a cryocooler (MDF-1156, Sanyo, Tokyo, Japan).
  • a cryocooler MDF-1156, Sanyo, Tokyo, Japan
  • the degree of peroxidation of the spinal cord lipid was confirmed by measuring the absorbance at 525 nm using a thiobarbituric acid test and a UV / Vis spectrophotometer (OPTIZEN POP, Mecasys, Daejeon, Korea) Concentration (nM). Total protein content was calculated using bovine serum albumin as the internal standard. The results are shown in Table 6 below.
  • d shown in Table 6 indicates that p ⁇ 0.01 as compared with the surgical control group as a result of MW test, and e indicates that p ⁇ 0.01 as compared with the CCI control as a result of MW test.
  • the MDA content that is, the peroxidation of the spinal cord lipid was significantly increased and the peroxidation was increased by 264.60% as compared with the gastric surgery control group.
  • the spinal lipid peroxidation was decreased in comparison with the CCI control group.
  • the degree of peroxidation was -55.27, -51.26 and -41.99% Respectively.
  • the BH 500 mg / kg group showed a similar decrease in peroxidation compared with the 10 mg / kg group of amitriptyline and the 500 mg / kg group of LF, and the lower dose of 125 mg / kg of BH was also superior to the LF 500 mg / kg group And it was confirmed that it showed the effect of reducing the degree of peroxidation.
  • the extract of P. japonica reduces the MDA content of the rat, i.e., the lipid peroxidation of the spinal cord lipid, and exhibits a similar or better spinal lipid peroxidation effect as that of amitriptyline or gingival extract, Therefore, it can be used as a preventive or therapeutic agent for neuropathic pain.
  • Example 2-2 Identification of function improvement of spinal cord antioxidant defense system
  • GSH glutathione
  • SOD superoxide dismutase
  • CAT catecholamines
  • GSH is a typical endogenous antioxidant, which controls tissue injury by removing ROS at a relatively low concentration in cells (Odabasoglu F, J Ethnopharmacol. 2006, 103: 59-65).
  • SOD and CAT are also endogenous antioxidant enzymes and act as part of the enzyme defense system of cells (Cheeseman KH, Br Med Bull. 1993, 49: 481-93).
  • the prepared homogenate was mixed with 0.1 ml of 25% trichloroacetic acid (Merck, San Francisco, Calif., USA) and centrifuged at 4,200 rpm for 40 minutes at 4,200 rpm.
  • GSH content was measured using a spectrophotometer at 412 nm using 2-nitrobenzoic acid (Sigma-Aldrich, St. Louis, Mo., USA) and expressed as concentration per gram of protein (nM).
  • CAT activity is defined as the amount of enzyme required to degrade 1 nM H 2 O 2 per minute at 25 ° C and pH 7.8, the amount of H 2 O 2 remaining measured using a spectrophotometer at an absorbance of 240 nm, Concentration (U).
  • SOD activity can be confirmed by the degree of formation of superoxide radicals.
  • SOD reacts with NBT (nitroblue tetrazolium) xanthine is produced, and xanthine oxidase ), Superoxide radicals are produced.
  • the supercoxide radical was measured at 560 nm using a spectrophotometer and expressed as a concentration (U) per mg of protein.
  • 1U means the amount of enzyme which reduces the initial absorbance of NBT by 50% for 1 minute. The results are shown in Table 7 below.
  • GSH content, SOD activity and CAT activity that is, antioxidative activity were significantly decreased in the CCI control group compared to the gastric surgery control group, and the degree of decrease was -59.62%, -63.41 % And -86.51%, respectively.
  • the antioxidant activity of spinal cord was increased in the case of 10 mg / kg of amitriptyline and 500 mg / kg of LF compared to the CCI control.
  • GSH content, SOD activity and CAT activity were increased by 76.43, 95.39 and 388.56%, respectively, in the amitriptyline-treated group.
  • GSH content, SOD activity and CAT activity were increased by 56.02, 48.39 and 160.70%, respectively, in the LF administration group.
  • the antioxidative activity of spinal cord was increased and the antioxidative activity was increased dose-dependently in comparison with the CCI control group in the BH 500, 250 and 125 mg / kg administration groups.
  • GSH content, SOD activity and CAT activity were 95.23, 100.46 and 402.49% for the 500 mg / kg BH group, respectively; 70.14, 87.10 and 317.41% for the BH 250 mg / kg administration group, respectively; , And 57.79, 48.39 and 157.21%, respectively, for the 125 mg / kg BH group.
  • BH 500 mg / kg administration group showed better antioxidant activity than amitriptyline 10 mg / kg and LF 500 mg / kg administration group.
  • the extract of Thymus nuts increases the GSH content, SOD activity and CAT activity of the rat, that is, the antioxidant activity of the spinal cord, and particularly the antioxidant activity of the amitriptyline or gallium arsenide extract As a result, it could be used as a preventive or therapeutic agent for neuropathic pain.
  • microglia and astrocytic activation factors in the spinal cord namely Iba-1 (Ionized calcium-binding adapter molecule-1) and GFAP fibrillary acidic protein expression was confirmed by RT-PCR analysis.
  • microglial cells and astrocytes are activated in response to nerve injury and are known to cause various neuropathies such as neurotoxicity, chronic inflammation and hyperpolarization, and chronic neuropathic pain (Milligan ED, Nat Rev Neurosci. 2009 , 10: 23-36).
  • Target factor 5 'to 3' order NCBI accession No. Iba-1 Forward CAGACTGCCAGCCTAAGACA (SEQ ID NO: 1) NM_017196 Reverse AGGAATTGCTTGTTGATCCC (SEQ ID NO: 2) GFAP Forward AGAAAACCGCATCACCATTCC (SEQ ID NO: 3) NM_017009 Reverse CAGGGCTCCATTTTCAATCTG (SEQ ID NO: 4) GAPDH Forward GCTAGGACTGGATAAGCAGGG (SEQ ID NO: 5) NM_017008 Reverse GCCAAATCCGTTCACACCG (SEQ ID NO: 6)
  • the expression of the activating factor was decreased in the 10 mg / kg group of amitriptyline and the 500 mg / kg of LF group compared to the CCI control group. Specifically, the amount of mRNA expression of Iba-1 and GFAP was decreased by -42.87 and -30.31%, respectively, in the group treated with amitriptyline. In addition, in the LF-treated group, mRNA expression levels of Iba-1 and GFAP were decreased by -30.18 and -17.53%, respectively.
  • the expression of the activating factor in the spinal cord was decreased and the expression level was decreased dose-dependently in the BH 500, 250 and 125 mg / kg administration group, as compared with the CCI control group.
  • the mRNA expression levels of Iba-1 and GFAP were -40.91 and -26.90%, respectively, in the group administered with BH 500 mg / kg; -37.07 and -23.56% for BH 250 mg / kg treated group, respectively; And decreased by -31.44 and -17.18%, respectively, in the 125 mg / kg BH group.
  • the BH 500 mg / kg group showed a decrease in the expression of microglial cells and astrocytic cell activation factors similar or superior to those of the amitriptyline 10 mg / kg group and LF 500 mg / kg group, and the low dose BH 125 mg / kg was also superior to the LF 500 mg / kg group.
  • the extract of Thymus nuts decreases the expression level of mRNA of Iba-1 and GFAP in the rat spinal cord, that is, the expression of microglial cells and astrocytic cell activating factor, and particularly amitriptyline And exhibit similar or better expression reduction effects as the Euglena extract, it can be used as a preventive or therapeutic agent for neuropathic pain.
  • Examples 2-4 Decreased expression of proinflammatory cytokines in spinal cord tissues
  • proinflammatory cytokines in the spinal cord namely TNF (Tumor Necrosis Factor) - ⁇ and iNOS (Inducible Nitric Oxide Synthase ) MRNA expression was confirmed by RT-PCR analysis.
  • proinflammatory cytokines are also involved in neuropathic pain, and the expression of proinflammatory cytokines such as TNF- ⁇ and iNOS following neuronal injury triggers an inflammatory reaction, resulting in pain (Liang F, Saudi Pharm J. 2017 , 25: 649-54.).
  • RT-PCR was carried out using primers as shown in Table 10 by the method according to Example 2-3, and the results are shown in Table 11 below.
  • Target factor 5 'to 3' order NCBI accession No. TNF-a Forward CTACTGAACTTCGGGGTGAT (SEQ ID NO: 7) NM_012675 Reverse CTTGGTGGTTTGTGAGTGTG (SEQ ID NO: 8) iNOS Forward AGCCTAGTCAACTGCAAGAG (SEQ ID NO: 9) NM_012611 Reverse TCTTGTATTGTTGGGCTGAGA (SEQ ID NO: 10)
  • c shown in Table 11 shows that p ⁇ 0.01 compared to the surgical control group as a result of MW test, and d indicates that p ⁇ 0.01 as compared with CCI control.
  • the expression level of TNF- ⁇ and iNOS mRNA was significantly increased in the CCI control group compared to the gastric surgery control group and increased by 291.01 and 538.28% Respectively.
  • the expression of the cytokine was decreased in the case of 10 mg / kg of amitriptyline and 500 mg / kg of LF compared to the CCI control.
  • the amount of mRNA expression of TNF- ⁇ and iNOS in the group treated with amitriptyline was -52.11 and -62.13%, respectively.
  • the amount of TNF- ⁇ and iNOS mRNA expression was decreased by -30.87 and -41.48%, respectively, in the LF-treated group.
  • the expression of the cytokine in the spinal cord was decreased in the BH 500, 250 and 125 mg / kg administration group as compared to the CCI control group.
  • the expression levels of TNF- ⁇ and iNOS mRNA were -53.58 and -62.11%, respectively, in the group administered with BH 500 mg / kg; -45.75 and -50.44% for the BH 250 mg / kg administration group, respectively; And -31.35 and -41.30%, respectively, for the 125 mg / kg BH group.
  • the BH 500 mg / kg group showed a similar or better effect to the activation factor than the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group also showed LF And 500 mg / kg, respectively.
  • the extract of Staphylococcus aureus decreases the expression level of TNF- ⁇ and iNOS mRNA in rat spinal cord, that is, the expression of proinflammatory cytokine, and is similar to that of amitriptyline or gingkoff extract Or exhibit a more excellent proinflammatory cytokine expression reduction effect, it can be used as a preventive or therapeutic agent for neuropathic pain.
  • Example 3-1 Check changes in weight and weight gain
  • estradiol benzoate promotes the secretion of endogenous and exogenous cholecystokinin hormones, and thus feels fullness. Therefore, the menstrual cramps caused by estradiol benzoate are directly linked to poor appetite, resulting in significant weight loss. Thus, inhibition of weight loss is an important indicator of analgesic effects on menstrual cramps (Asarian L et al., Endocrinology 2007, 148: 5656-66.).
  • body weight was measured once a day for 10 days before the treatment with estradiol benzoate (0 day) and last administration (9 days).
  • the weight gain after 10 days of administration was calculated as shown in Equation 2 below. The results are shown in Table 12 below.
  • the BH 500, 250, and 125 mg / kg administration groups showed significant weight gain compared to the menstrual control group.
  • dose-dependent weight gain was observed in the three BH-treated groups, and the body weight gain was increased by 141.98, 104.26, and 82.97% on the 10th day of drug administration, respectively.
  • the low dose of 125 mg / kg of BH showed similar or better inhibitory effects on body weight gain and body weight gain than the 5 mg / kg of indomethacin and 500 mg / kg of LF.
  • the degree of menstrual pain is measured through abdominal stiffness, and an increase in abdominal stiffness response generally means an increase in abdominal pain (Yang et al., J Agr Food Chem. 2004, 52: 6787-93).
  • the rats were placed in a separate polycarbonate box (280 x 420 x 180 mm) and the stump of the abdomen was recorded for 30 minutes. Two authors were recorded in a double-blind manner for the accuracy of the results.
  • the degree of strangulation was decreased in the BH 500, 250, and 125 mg / kg administration groups as compared with the menstrual control group.
  • the three BH-treated groups showed dose-dependent wrinkle reduction, and the degree of writhing was -42.78, -33.08, and -23.88%, respectively, as compared to the control group.
  • the 500 mg / kg BH group exhibited a similar or better abdominal weight reduction effect to the indomethacin 5 mg / kg group and the LF 500 mg / kg group.
  • Example 4-1 Confirming the effect of suppressing uterine congestion and enlargement
  • Oxidative stress or inflammation is one of the major pathogenesis of menstrual cramps, causing uterine congestion and edema resulting in increased uterine weight (Chen L et al., J Sci Food Agric., 2014, 94: 180- 8.).
  • the rats were sacrificed and uterine weights were measured at g level (absolute wet weight). To reduce individual differences, the weight of the relative uterus (% of body weight) was calculated using Equation 3 using the weight at sacrifice.
  • the BH 500, 250 and 125 mg / kg administration group also showed a decrease in uterine congestion and edema symptoms compared to the control group.
  • the three BH-treated groups showed a dose-dependent reduction in uterine conization and edema symptoms, and the relative weight of the uterus was decreased by -38.58, -34.55 and -25.01%, respectively, as compared with the control group.
  • the 500 mg / kg BH group had similar or better uterine weight reduction effects than the 5 mg / kg indomethacin group and 500 mg / kg LF group.
  • the extract of Staphylococcus aureus decreases the uterine weight by reducing the symptoms of uterine congestion and edema in rats induced by menstrual cramps, and in particular, a uterus similar or superior to the indomethacin or gingival extracts Weight reduction effect, it can be used as a preventive or therapeutic substance for menstrual cramps.
  • Oxidative stress is one of the causes of menstrual cramps, and MDA is the final product of lipid peroxidation, which is useful as a measure of lipid peroxidation (Chen L et al., J Sci Food Agric., 2014, 94: 180 -8.).
  • the left uterine horn tissues were separated from the uterus weight-measured rats according to Example 4-1, and their weights were measured. Thereafter, a homogeneous liquid of the uterine tissue was obtained by the method according to Example 2-1, and MDA was measured therefrom. The results are shown in Table 13 below.
  • the peritoneal lipid peroxidation was decreased in comparison with the control group, and the degree of peroxidation was -70.07, -56.90 and -46.46% Respectively.
  • the BH 500 mg / kg group showed a better reduction of peroxidation compared with the 10 mg / kg group of amitriptyline and the 500 mg / kg group of LF, and the LH 500 mg / kg group It was confirmed that it exhibited a superior degree of peroxidation reduction.
  • the extract of Thymus nuts decreases the MDA content of rats, i.e., the lipid peroxidation of uterine lipids, and exhibits a similar or better cervical lipid peroxidation effect than the indomethacin or gingkofumhara extracts, , And as a preventive or therapeutic agent for menstrual cramps.
  • Example 4-3 Improvement of function of antioxidant defense system in uterine tissues
  • Example 14 the activity of GSH content, SOD, and CAT was determined by the method according to Example 2-2 with respect to the homogeneous liquid of uterine tissue prepared in Example 4-2. The results are shown in Table 14 below.
  • GSH content, SOD activity, and CAT activity i.e., antioxidative activity, were significantly decreased in the case of the menstrual pain control group compared to the normal control group, which was -67.47%, -51.63%, and -66.55% Respectively.
  • the antioxidant activity of spinal cord was increased and the dose - dependent antioxidative activity was also increased in the BH 500, 250 and 125 mg / kg group, compared to the control group.
  • GSH content, SOD activity, and CAT activity were 105.82, 64.05, and 101.67% for the 500 mg / kg BH group, respectively; 83.32, 41.43 and 72.21% for the BH 250 mg / kg administration group, respectively; And BH 125 mg / kg, respectively, which were increased by 57.03, 29.43 and 49.36%, respectively.
  • the BH 500 mg / kg group showed a better antioxidant activity than the 5 mg / kg indomethacin group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group was also superior to the LF 500 mg / kg group Antioxidant activity was increased.
  • the extract of Staphylococcus aureus increases the GSH content, SOD activity and CAT activity of the rat, that is, the antioxidant activity of the uterus, and particularly the antioxidative activity increasing effect It can be used as a preventive or therapeutic agent for menstrual cramps.
  • Example 4-4 Decreased expression of inflammatory and proinflammatory factors in uterine tissues
  • Example 4-2 the homogenate of the cervical tissues prepared in Example 4-2 was subjected to RT-PCR in the same manner as in Example 2-3, and primers as shown in Table 15 were used. RT-PCR results are shown in Table 16 below.
  • Target factor 5 'to 3' order NCBI accession No. NF- ⁇ B Forward GCGCATCCAGACCAACAATAA (SEQ ID NO: 11) NM_001276711 Reverse GCCGAAGCTGCATGGAC ACT (SEQ ID NO: 12) COX-2 Forward CTGCATGTGGCTGATGTCATC (SEQ ID NO: 13) S67722 Reverse AGGACCCGTCATCTCCAG GGTAATC (SEQ ID NO: 14)
  • the expression of the factor was decreased as compared with the control group. Specifically, in the indomethacin-treated group, the amounts of mRNA expression of NF- ⁇ B and COX-2 were decreased by -53.49 and -44.93%, respectively. In addition, the amount of mRNA expression of NF- ⁇ B and COX-2 in the LF-treated group was decreased by -31.37 and -24.55%, respectively.
  • the expression of the above-mentioned factors in the uterus was decreased in the BH 500, 250 and 125 mg / kg administration group as compared to the control group.
  • the expression levels of NF- ⁇ B and COX-2 mRNA were -51.57 and -46.35%, respectively, in the 500 mg / kg BH group; -38.58 and -34.91% for BH 250 mg / kg treated group, respectively; And -31.51 and -25.62%, respectively, for the 125 mg / kg BH group.
  • the BH 500 mg / kg administration group exhibited a similar or better effect of the activation factor than the 5 mg / kg indomethacin group and the LF 500 mg / kg administration group, and the low dose BH 125 mg / mg / kg administration group, respectively.
  • Example 4-5 Identification of inflammation reduction in uterine tissues
  • the right uterine corpuscle was cut and fixed with 10% formalin, inserted into paraffin, cut into 3-4 ⁇ m sections, and HE stained with hematoxylin and eosin. Histopathological morphology of each sample was then observed with an optical microscope (Model 80i, Nikon, Tokyo, Japan).
  • the total thickness ( ⁇ m) and mucosal thickness ( ⁇ m) of uterine cornea and the number of inflammatory cells (cell / mucous membrane 2 ) penetrating into the mucosa were measured using a computer-based automatic image analyzer ( i Solution FL ver 9.1, IMT i -solution Inc ., Vancouver, Quebec, Canada), and the results are shown in Table 17 below.
  • a and b shown in Table 17 indicate that p ⁇ 0.01 and p ⁇ 0.05, respectively, as compared with the normal control group, and c indicates Will result indicating that the LSD test p ⁇ 0.01 compared with the control group cramps, d will result indicating that the MW black p ⁇ 0.01 compared with the control group, e is indicating that the test result MW p ⁇ 0.01 compared with the control group cramps.
  • the degree of inflammation was decreased compared to the control group.
  • the total thickness of the uterus, the thickness of uterine mucosa, and the number of inflammatory cells infiltrating into the mucosa were decreased by -26.55, -34.57 and -76.78%, respectively.
  • the LF administration group it was also found to decrease by -12.63, -18.61 and -42.38%, respectively.
  • the degree of inflammation was decreased and the dose of inflammation was decreased dose-dependently compared to the control group.
  • the changes in uterine total thickness, uterine mucosal thickness, and number of inflammatory cells infiltrated into the mucosa were -24.92, -34.65, and -76.65%, respectively, in the BH 500 mg / kg group; -17.06, -23.15 and -68.00%, respectively, for the BH 250 mg / kg administration group; And -14.26, -19.70 and -44.65%, respectively, for the 125 mg / kg BH group.
  • the BH 500 mg / kg group showed a better inflammation reduction effect than the 5 mg / kg indomethacin group and the LF 500 mg / kg group, and the low dose BH 125 mg / And it is confirmed that it shows a reduction effect.
  • reactive inflammatory cells for proinflammatory cytokines TNF-a and iNOS present in the right uterine mucosa were purified with ABC and peroxidase substrate kit (Vector Labs, Burlingame, Calif., USA) Primary antibodies were used to confirm.
  • the number of cells labeled with TNF- ⁇ and iNOS was calculated using a computer-based automatic image analyzer and the results are shown in Table 18 below. At this time, the cells that occupied more than 20% of the reactivity, that is, the density, of TNF- ⁇ and iNOS were regarded as reactive (positive) cells.
  • a and b shown in Table 18 indicate that p ⁇ 0.01 and p ⁇ 0.05, respectively, as compared with the normal control group, and c indicates Will result indicating that the LSD test p ⁇ 0.01 compared with the control group cramps, d will result indicating that the MW black p ⁇ 0.01 compared with the control group, e is indicating that the test result MW p ⁇ 0.01 compared with the control group cramps.
  • the numbers of TNF- ⁇ and iNOS-immunoreactive cells were decreased in the 5 mg / kg indomethacin group and the 500 mg / kg LF group compared to the control group.
  • the changes in the numbers of TNF- ⁇ and iNOS-immunoreactive cells were -82.01 and -79.06%, respectively.
  • the decrease was -35.70 and -41.22%, respectively.
  • the numbers of TNF- ⁇ and iNOS-immunoreactive cells were decreased in the BH 500, 250, and 125 mg / kg groups compared to the control group, and the number of immune response cells was decreased in a dose-dependent manner.
  • the degree of changes in the number of TNF- ⁇ and iNOS-immunoreactive cells was -79.61 and -76.85%, respectively, in the group administered with BH 500 mg / kg; -67.52 and -64.35% for the BH 250 mg / kg administration group, respectively; And -38.63 and -43.10%, respectively, for the 125 mg / kg BH group.
  • the BH 500 mg / kg group showed a similar effect to that of the indomethacin 5 mg / kg group and the LF 500 mg / kg group.
  • BH 125 mg / kg group LF 500 mg / kg of the control group.
  • the extract of Staphylococcus aureus decreases the number of immunoreactive cells present in the rat uterine mucosa, that is, the degree of inflammation, and exhibits a more excellent inflammation-reducing effect than the indomethacin or gingkofumara extract, Therefore, it can be used as a preventive or therapeutic agent for menstrual cramps.

Abstract

The present invention relates to a composition comprising an extract of Lonicera coerulea for prevention or treatment of pain and, specifically, to a pharmaceutical composition, a food composition, and a quasi-drug product composition, for prevention or treatment of pain, each of the compositions comprising an extract of Lonicera coerulea or a fraction thereof, and to a method for treatment of pain. The extract of Lonicera coerulea according to the present invention inhibits weight loss and shows pain-killing effects, such as inhibiting cold allodynia and mechanical allodynia, menstrual pain, and the like, and thus can be favorably used in the prevention, alleviation, or treatment of pain.

Description

댕댕이나무 추출물을 포함하는 통증의 예방 또는 치료용 조성물Compositions for preventing or treating pain, including buttock tree extract
본 발명은 댕댕이나무 추출물을 포함하는 통증의 예방 또는 치료용 조성물에 관한 것으로, 구체적으로 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 치료용 약학 조성물, 식품 조성물, 의약외품 조성물 및 통증의 치료 방법에 관한 것이다.The present invention relates to a composition for prevention or treatment of pain comprising a farinacea tree extract, and more particularly to a pharmaceutical composition for preventing or treating pain, including a farinacea tree extract or a fraction thereof, a food composition, a quasi-drug composition, .
통증은 다양한 원인에 의해 발생하며, 통증이 장기간 지속되거나 그 자극이 너무 심한 경우에는 일상생활에 지장이 생기고, 불안과 공포를 느끼기도 한다. 이 때문에 만성 통증을 가진 사람은 우울증을 가진 경우도 많다. 특히, 전 인구의 7-8% 정도가 상해나 질병에 의해 유발되는 신경병성 통증(neuropathic pain)에 의해 고통받고 있는 것으로 알려져 있으며, 원발성 생리장애(Primary dysmenorrhea), 즉 생리통의 경우 유병률이 45-95%에 육박하는 것으로 알려져 있는바, 이를 치료하기 위한 물질 및 방법의 개발이 시급한 실정이다.Pain is caused by a variety of causes. If the pain persists for a long period of time or if the stimulus is too severe, it may interfere with daily life and cause anxiety and fear. Therefore, people with chronic pain often have depression. In particular, it is known that 7-8% of the population is suffering from neuropathic pain caused by injury or disease. Primary dysmenorrhea, or menses, has a prevalence of 45- 95%, it is urgent to develop materials and methods for treating such diseases.
현재, 통증 치료에는 주로 아세틸살리실산(acetylsalicylic acid), 이부프로펜(ibuprofen), 아세트아미노펜(acetaminophen), 인도메타신(indomethacin) 성분의 진통제가 널리 사용되고 있다. 그러나, 상기 진통제들은 고용량으로 투여해야 그 효과를 나타내며, 초기에는 효과가 있더라도 장기간 사용시 내성이 생겨 효과가 없어지는 경우도 빈번하다. 또한, 위장관 출혈, 위장 장애, 간 손상 등의 부작용이 초래될 수 있어 단기간 고용량 투여 처방을 하고 있다. Currently, acetylsalicylic acid, ibuprofen, acetaminophen, and indomethacin are widely used to treat pain. However, the above-mentioned painkillers are effective when they are administered in a high dose, and when they are effective in the early stage, they are resistant to long-term use and often have no effect. In addition, gastrointestinal bleeding, gastrointestinal disorders, liver damage and may cause side effects such as prescribing a short-term high dose.
상술한 진통제 이외에도, 아미트리프틸린(amitriptyline)이 만성통증 환자에서 진통제 및 항우울제로 널리 이용되고 있으며, 이 외에도 비교적 강력한 항염 및 항산화 효과를 나타내는 것으로 알려져 있다. 그러나, 심각한 심장독성을 야기할 수도 있음이 발표된바(Goodnick PJ, Expert Opin Pharmacother. 2002, 3:479-98.; Thanacoody HK, Toxicol Rev. 2005, 24:205-14.), 부작용 없이 안전하며, 저용량으로도 진통 효과가 우수한 새로운 진통제의 개발이 절실히 요구되고 있다.In addition to the analgesic agents described above, amitriptyline is widely used as an analgesic and antidepressant in chronic pain patients, and is known to exhibit relatively strong anti-inflammatory and antioxidative effects. However, it has been reported that it may cause serious cardiac toxicity (Goodnick PJ, Expert Opin Pharmacother. 2002, 3: 479-98 .; Thanacoody HK, Toxicol Rev. 2005, 24: 205-14.), And a new analgesic agent having excellent analgesic effect even at a low dose is urgently required.
이에 따라, 부작용을 최소화하기 위하여, 천연 물질을 이용한 치료제가 개발되고 있으며, 그 예로 금은화를 포함하는 진통제제 등이 개발되었다(한국 등록특허공보 제10-0554079호). 상기의 금은화(Lonicera japonica Thunb.)는 체열 조절, 해열, 해독 및 항염 효과가 뛰어나며, 특히 진경, 진통 효과가 있음이 잘 알려져 있다. 금은화의 꽃봉오리 또는 막 피기 시작한 꽃이 약재로서 전통 한약의 처방에 널리 이용된다.Accordingly, in order to minimize side effects, a therapeutic agent using natural substances has been developed, for example, an analgesic agent including gold silver is developed (Korean Patent Registration No. 10-0554079). It is well known that Lonicera japonica Thunb. Has excellent thermoregulation, antipyretic, detoxification and antiinflammatory effects, and in particular, it has antiseptic and analgesic effects. Earthen flower buds or flowers that start to bloom are widely used as traditional medicines as medicines.
한편, 댕댕이나무(Lonicera caerulea var. edulis)는 한국, 중국 및 일본 등지에서 서식하는 식물로서, 그 열매는 전통 약재로 이용되어 왔다. 댕댕이나무의 열매는 아스코르브산, 항산화 효과가 우수한 안토시아닌, 플라보노이드 등의 페놀성 화합물을 풍부하게 함유하고 있는바, 지질 및 당 대사 개선효과, 간 보호 효과, 항염 효과 및 상처 치유 촉진 효과 등이 우수하다고 알려져 있다. 그러나, 이의 진통 효과는 알려진 바 없었다.On the other hand, Lonicera caerulea var. Edulis is a plant in Korea, China and Japan. Its fruit has been used as a traditional medicine. The fruit of the japanese tree is rich in ascorbic acid, phenolic compounds such as anthocyanins and flavonoids having excellent antioxidative effects, and has excellent lipid and glucose metabolism improving effect, liver protecting effect, anti-inflammatory effect and promoting wound healing It is known. However, its analgesic effect was not known.
이러한 배경하에, 본 발명자들은 통증을 완화 또는 개선할 수 있는 천연 물질을 개발하고자 예의 노력 연구한 결과, 댕댕이나무 추출물이 우수한 진통 효과를 나타냄을 확인하여, 본 발명을 완성하였다.Under these circumstances, the present inventors have made intensive efforts to develop a natural substance capable of alleviating or ameliorating pain, and as a result, it has been confirmed that Swallow's Tree extract has excellent analgesic effect, thus completing the present invention.
본 발명의 하나의 목적은 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 치료용 약학 조성물을 제공하는 것이다.It is an object of the present invention to provide a pharmaceutical composition for prevention or treatment of pain, comprising a farina tree extract or a fraction thereof.
본 발명의 다른 하나의 목적은 상기 약학 조성물을 통증이 유발되거나 유발이 의심되는 개체에 투여하는 단계를 포함하는, 통증의 치료 방법을 제공하는 것이다.It is another object of the present invention to provide a method for treating pain, comprising the step of administering the pharmaceutical composition to a subject suffering from or suspecting pain.
본 발명의 또 다른 하나의 목적은 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 개선용 식품 조성물을 제공하는 것이다.It is another object of the present invention to provide a food composition for prevention or improvement of pain, which comprises a farina tree extract or a fraction thereof.
본 발명의 또 다른 하나의 목적은 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 개선용 의약외품 조성물을 제공하는 것이다.It is another object of the present invention to provide a quasi-drug composition for prevention or improvement of pain, comprising a farina tree extract or a fraction thereof.
본 발명에 따른 댕댕이나무 추출물은 체중감소 억제, 한랭 이질통 및 기계적 이질통, 생리통 등을 억제하는 등의 진통효과를 나타내므로, 진통의 예방, 개선 또는 치료에 유용하게 사용될 수 있다.The herbal extract according to the present invention exhibits analgesic effects such as suppression of weight loss, cold allodynia, mechanical allodynia, menstrual pain and the like, and thus can be effectively used for preventing, improving or treating analgesia.
도 1은 본 발명의 일 실시예에 따른 CCI(Chronic constriction injury) 수술의 단계별 과정을 보여주는 이미지이다.1 is an image showing a step-by-step process of CCI (Chronic Constriction Injury) surgery according to an embodiment of the present invention.
도 2는 본 발명의 일 실시예에 따른 댕댕이나무 추출물(이하, 'BH'로 명명)의 신경병성 통증에 대한 진통 효과를 확인하기 위한 실험의 개략도이다.FIG. 2 is a schematic diagram of an experiment for confirming the analgesic effect on neuropathic pain of a farina tree extract (hereinafter referred to as 'BH') according to an embodiment of the present invention.
도 3은 본 발명의 일 실시예에 따른 댕댕이나무 추출물의 생리통에 대한 진통 효과를 확인하기 위한 실험의 개략도이다.FIG. 3 is a schematic view of an experiment for confirming the analgesic effect on the menstrual cramp of the Butterfly tree extract according to an embodiment of the present invention.
도 4는 신경병성 통증 랫트 모델에서, 상기 댕댕이나무 추출물의 체중 증가 효과를 확인한 그래프이다.FIG. 4 is a graph showing the effect of weight gain of the above-described Swine Extract on the neuropathic pain rat model.
도 5는 생리통 랫트 모델에서, 복부의 몸부림(writhing), 즉 복부 통증 감소 효과를 확인한 그래프이다. Intact Control은 정상 대조군, PD Control은 생리통 대조군, IND References는 인도메타신 5 mg/kg 투여군, LF References는 금은화 추출물(이하, 'LF'로 명명) 500 mg/kg 투여군, 500 BH는 BH 500 mg/kg 투여군, 250 BH는 BH 250 mg/kg 투여군, 및 125 BH는 BH 125 mg/kg 투여군을 의미한다. 이때, a는 LSD 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 LSD 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이다.Fig. 5 is a graph showing writhing, i.e., abdominal pain-reducing effect, of the abdomen in the model of the rats. (500 mg / kg body weight), 500 mg / kg BH 500 mg / kg body weight, and 500 mg / kg BH 500 mg / kg body weight, respectively, for intact control, / kg, 250 BH for 250 mg / kg BH, and 125 BH for 125 mg / kg BH. At this time, a indicates that p <0.01 as compared with the normal control as a result of LSD test, and b indicates that p <0.01 as compared with the pseudorabies control group as a result of LSD test.
도 6은 생리통 랫트 모델에서, 상기 댕댕이나무 추출물의 자궁 충혈 및 부종(enlargement) 감소 효과를 확인한 이미지이다. 스케일바(Scale bars)는 11 ㎜를 나타내며, A는 정상 대조군, B는 생리통 대조군, C는 인도메타신 5 mg/kg 투여군, D는 LF 500 mg/kg 투여군, E는 BH 500 mg/kg 투여군, F는 BH 250 mg/kg 투여군, 및 G는 BH 125 mg/kg 투여군을 의미한다. Fig. 6 is an image showing the effect of reducing the uterine congestion and enlargement of the above-described Swallow's tree extract in a ricket-cell rat model. Scale bars represent 11 mm, A is a normal control group, B is a menstrual control group, C is an indomethacin 5 mg / kg, D is a 500 mg / kg LF group, and E is 500 mg / kg BH , F means 250 mg / kg BH, and G means 125 mg / kg BH.
도 7은 생리통 랫트 모델에서, 상기 댕댕이나무 추출물의 자궁 무게(uterus weights) 감소 효과를 확인한 그래프이다. Intact Control은 정상 대조군, PD Control은 생리통 대조군, IND References는 인도메타신 5 mg/kg 투여군, LF References는 LF 500 mg/kg 투여군, 500 BH는 BH 500 mg/kg 투여군, 250 BH는 BH 250 mg/kg 투여군, 및 125 BH는 BH 125 mg/kg 투여군을 의미한다. 이때, a 및 b는 LSD 검정 결과 정상 대조군에 비하여 각각 p<0.01 및 p<0.05임을 나타내는 것이고, c는 LSD 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 MW 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, e는 MW 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이다.FIG. 7 is a graph showing the effect of uterus weights reduction on the uterine weight of the above-described Swallow's tree extract in a menses-based rat model. LH References for LF 500 mg / kg, 500 BH for BH 500 mg / kg, and 250 BH for BH 250 mg / kg, respectively, for Intact Control, PD Control, / kg < / RTI &gt; group, and 125 BH means 125 mg / kg BH group. As a result, a and b indicate that p <0.01 and p <0.05, respectively, as compared with the normal control group, and c indicates that p <0.01 as compared with the control group, and d indicates the MW test as compared with the normal control group p &lt; 0.01, and e indicates that p &lt; 0.01 as compared to the dumbbell control group as a result of MW test.
도 8은 생리통 랫트 모델에서, 상기 댕댕이나무 추출물의 자궁각 조직 내 염증 감소 효과를 확인한 이미지로서, 전체 자궁의 두께를 보여준다. 스케일바는 120 ㎛를 나타내며, A는 정상 대조군, B는 생리통 대조군, C는 인도메타신 5 mg/kg 투여군, D는 LF 500 mg/kg 투여군, E는 BH 500 mg/kg 투여군, F는 BH 250 mg/kg 투여군, 및 G는 BH 125 mg/kg 투여군을 의미한다. 이때, a 및 b는 LSD 검정 결과 정상 대조군에 비하여 각각 p<0.01 및 p<0.05임을 나타내는 것이고, c는 LSD 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 MW 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, e는 MW 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이다.FIG. 8 is an image showing the effect of reducing the inflammation in the uterine tissue of the above-described Swine Extract in the model of the rats in the rats. FIG. 8 shows the thickness of the entire uterus. B is a 500 mg / kg BH group, F is a BH group, and B is a normal control group. B is a control group, C is an indomethacin 5 mg / kg group, D is LF 500 mg / kg group, 250 mg / kg administration group, and G means 125 mg / kg BH administration group. As a result, a and b indicate that p <0.01 and p <0.05, respectively, as compared with the normal control group, and c indicates that p <0.01 as compared with the control group, and d indicates the MW test as compared with the normal control group p < 0.01, and e indicates that p < 0.01 as compared to the dumbbell control group as a result of MW test.
도 9는 생리통 랫트 모델에서, 상기 댕댕이나무 추출물의 자궁각 조직 내 염증 감소 효과를 확인한 이미지로서, TNF-α 및 iNOS-2에 대한 면역반응세포를 보여준다. 스케일바는 120 ㎛를 나타내며, A는 정상 대조군, B는 생리통 대조군, C는 인도메타신 5 mg/kg 투여군, D는 LF 500 mg/kg 투여군, E는 BH 500 mg/kg 투여군, F는 BH 250 mg/kg 투여군, 및 G는 BH 125 mg/kg 투여군을 의미한다.FIG. 9 shows immunoreactive cells against TNF-.alpha. And iNOS-2 as an image showing the effect of reducing the inflammation in the uterine tissue of the above-described Butterfly tree extract in a menses-rat model. B is a 500 mg / kg BH group, F is a BH group, and B is a normal control group. B is a control group, C is an indomethacin 5 mg / kg group, D is LF 500 mg / kg group, 250 mg / kg administration group, and G means 125 mg / kg BH administration group.
상기 목적을 달성하기 위하여, 본 발명의 하나의 양태는 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 치료용 약학 조성물을 제공한다.In order to accomplish the above object, one aspect of the present invention provides a pharmaceutical composition for preventing or treating pain, comprising a farina tree extract or a fraction thereof.
본 발명자들은 댕댕이나무 열매 추출물이 통증이 유발된 랫트의 통증을 완화함으로써 체중 감소, 한랭/기계적 이질통 및 복부 통증을 감소시킴을 확인하였고, 상기 통증 완화 효과는 과산화 억제, 미세아교세포/별아교세포 활성화 인자의 발현 억제, 전염증성 사이토카인의 발현 억제, 항산화 활성 촉진 및 염증 억제에 의해 나타나는 것임을 확인함에 따라, 상기 댕댕이나무 추출물은 통증의 예방, 개선 또는 치료에 유용하게 사용될 수 있음을 확인하였다.The present inventors have confirmed that the extract of Staphylococcus aureus reduces weight loss, cold / mechanical allodynia and abdominal pain by relieving pain in rats induced pain, and the pain relieving effect is inhibited by peroxidation, microglial cell / Inhibition of expression of proinflammatory cytokines, promotion of antioxidative activity, and inhibition of inflammation. Thus, it was confirmed that the above-described Butterfly tree extract can be effectively used for preventing, ameliorating or treating pain.
본 발명의 용어, "댕댕이나무"는 Lonicera caerulea var. edulis L의 학명을 갖는, 인동과의 낙엽활엽 관목을 의미하며, 개들쭉(var. emphyllocalyx), 넓은잎댕댕이(var. longibracteata), 둥근잎댕댕이(var. venulosa) 등으로 불리는 다양한 아종을 포함하나, 이에 제한되지 않는다. 댕댕이나무의 열매는 타원형의 장과(berry)로 가을에 검게 익으며, 생으로 먹는다. 댕댕이나무의 열매가 치매, 주름개선, 미백 등에 효과가 있음은 알려져 있으나, 통증에 대한 치료 효과는 밝혀진 바 없었으며, 본 발명자들에 의해 최초로 규명되었다.The term " buttock tree " of the present invention refers to Lonicera caerulea var. means a deciduous broad-leaved shrub and has a scientific name of edulis L, honeysuckle, and more Blueberry (var. emphyllocalyx), broad leaf daengdaengyi (var. longibracteata), round leaves daengdaengyi include various sub-species, called the like (var. venulosa) one , But is not limited thereto. The fruit of the buttock tree is elliptical berry, which is blackened in autumn and eaten raw. It is known that the fruit of the buttock tree is effective for dementia, wrinkle improvement, whitening, etc. However, the therapeutic effect on the pain has not been known and it was firstly described by the present inventors.
본 발명에서, 상기 댕댕이나무의 뿌리, 줄기, 잎, 열매, 꽃 등이 통증의 예방 또는 치료에 사용될 수 있으며, 더욱 구체적으로 열매가 사용될 수 있으나, 통증의 예방 또는 치료 효과를 갖는 한, 특별히 이에 제한되지 않는다.In the present invention, roots, stems, leaves, fruits, flowers and the like of the buttock tree may be used for preventing or treating pain, and more specifically, fruits may be used. However, as long as they have the effect of preventing or treating pain, It is not limited.
상기 댕댕이나무는 상업적으로 판매되는 것을 구입하거나, 자연에서 채취 또는 재배된 것을 사용할 수 있다.The butt-knot can be purchased commercially, sold in the nature, or cultivated.
본 발명의 용어, "추출물"은 상기 댕댕이나무를 추출 처리하여 얻어지는 추출액, 상기 추출액의 희석액이나 농축액, 상기 추출액을 건조하여 얻어지는 건조물, 상기 추출액의 조정제물이나 정제물, 또는 이들의 혼합물 등, 추출액 자체 및 추출액을 이용하여 형성 가능한 모든 제형의 추출물을 포함한다.The term " extract " of the present invention refers to an extract obtained by extracting the buttock tree, a diluted solution or concentrate of the extract, a dried product obtained by drying the extract, a controlled preparation or a purified product of the extracted solution, Itself and extracts of all formulations which can be formed using extracts.
상기 댕댕이나무를 추출하는 방법은 특별히 제한되지 않으며, 당해 기술 분야에서 통상적으로 사용하는 방법에 따라 추출할 수 있다. 상기 추출 방법의 비제한적인 예로는, 열수 추출법, 초음파 추출법, 여과법, 환류 추출법 등을 들 수 있으며, 이들은 단독으로 수행되거나 2종 이상의 방법을 병용하여 수행될 수 있다.The method of extracting the buttock wood is not particularly limited, and may be extracted according to a method commonly used in the art. Non-limiting examples of the extraction method include hydrothermal extraction, ultrasonic extraction, filtration, and reflux extraction. These may be performed alone or in combination with two or more methods.
본 발명에서, 상기 댕댕이나무를 추출하는데 사용되는 추출 용매의 종류는 특별히 제한되지 않으며, 당해 기술 분야에서 공지된 임의의 용매를 사용할 수 있다. 상기 추출 용매의 비제한적인 예로는 물, 탄소수 1 내지 4의 알코올 또는 이들의 혼합 용매 등을 들 수 있으며, 이들은 단독으로 사용되거나 1종 이상 혼합하여 사용될 수 있다.In the present invention, the type of the extraction solvent used for extracting the butte wood is not particularly limited, and any solvent known in the art can be used. Nonlimiting examples of the extraction solvent include water, alcohols having 1 to 4 carbon atoms, and mixed solvents thereof. These solvents may be used alone or in combination.
본 발명의 용어, "분획물"은 여러 다양한 구성 성분들을 포함하는 혼합물로부터 특정 성분 또는 특정 성분 그룹을 분리하기 위하여 분획을 수행하여 얻어진 결과물을 의미한다.The term " fraction " of the present invention means a product obtained by performing fractionation to separate a specific component or a specific component group from a mixture containing various components.
본 발명에서, 상기 분획물을 얻는 분획 방법은 특별히 제한되지 않으며, 당해 기술 분야에서 통상적으로 사용하는 방법에 따라 수행될 수 있다. 상기 분획 방법의 비제한적인 예로는, 다양한 용매를 처리하여 수행하는 용매 분획법, 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 통과시켜 수행하는 한외여과 분획법, 다양한 크로마토그래피(크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)를 수행하는 크로마토그래피 분획법, 및 이들의 조합 등이 있다. 구체적으로, 본 발명의 댕댕이나무를 추출하여 얻은 추출물에 소정의 용매를 처리하여 상기 추출물로부터 분획물을 얻는 방법을 들 수 있다.In the present invention, the fractionation method for obtaining the fraction is not particularly limited and may be carried out according to a method commonly used in the art. Non-limiting examples of the fractionation method include a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed through an ultrafiltration membrane having a constant molecular weight cut-off value, various chromatography (size, charge, hydrophobicity Or affinity-based separation), and a combination thereof, and the like. Specifically, there can be mentioned a method of obtaining a fraction from the extract by treating a predetermined solvent with the extract obtained by extracting the buttock tree of the present invention.
본 발명에서 상기 분획물을 얻는데 사용되는 분획 용매의 종류는 특별히 제한되지 않으며, 당해 기술 분야에서 공지된 임의의 용매를 사용할 수 있다. 상기 분획 용매의 비제한적인 예로는 물, 탄소수 1 내지 4의 알코올 등의 극성 용매; 헥산(Hexan), 에틸 아세테이트(Ethyl acetate) 등의 비극성 용매; 또는 이들의 혼합용매 등을 들 수 있다. 이들은 단독으로 사용되거나 1종 이상 혼합하여 사용될 수 있지만, 이에 제한되는 것은 아니다.The kind of the fraction solvent used for obtaining the fraction in the present invention is not particularly limited, and any solvent known in the art can be used. Non-limiting examples of the fraction solvent include polar solvents such as water and alcohols having 1 to 4 carbon atoms; Non-polar solvents such as hexane (Hexan) and ethyl acetate (Ethyl acetate); Or a mixed solvent thereof. These may be used alone or in combination of one or more, but the present invention is not limited thereto.
또한, 상기 추출물 또는 분획물은 추출 후 건조 분말 형태로 제조되어 사용될 수 있지만, 이제 제한되는 것은 아니다.In addition, the extract or fraction may be prepared and used in the form of a dry powder after extraction, but is not limited thereto.
본 발명의 용어, "통증"은 통증 수용체를 지닌 특수한 신경에 대한 자극으로 인해 생기는 불쾌한 감각을 의미하며, 본 발명의 댕댕이나무 추출물 또는 이의 분획물에 의해 그 감각이 완화, 예방 또는 치료되는 모든 증상을 포함한다. 일반적으로 통증 부위에 따라 두통, 흉통, 복통, 요통 등으로 부르며, 발생기전에 따라 체성통(somatic pain), 내장통(visceral pain), 신경병성 통증(neuropathic pain) 등으로 나뉜다. The term " pain " of the present invention refers to an unpleasant sensation caused by stimulation of a specific nerve having a pain receptor, and includes all symptoms that the sensation is alleviated, prevented or cured by the leaves of the Japanese persimmon tree or its fractions . It is commonly referred to as headache, chest pain, abdominal pain, back pain, etc., depending on the area of the pain. Somatic pain, visceral pain, and neuropathic pain are classified according to the generation of the pain.
구체적으로, 상기 통증은 해부학상 구분되는 통증, 구체적인 예로 목 통증, 등 통증, 허리 통증, 가슴 통증, 머리 통증 등을 포함할 수 있다.Specifically, the pain may include anatomically distinct pain, such as neck pain, back pain, back pain, chest pain, head pain, and the like.
또한, 상기 통증은 세포 손상 등에 의한 통각수용성 통증(nociceptive pain), 심리적 조건에 따라 발생하는 심인성 통증(psychogenic pain), 조직 손상 및 면역 세포의 침윤과 관련된 염증성 통증(inflammatory pain), 신경 시스템의 손상 또는 그것의 비정상적 기능에 의해 유발되는 신경병성 통증 등을 포함할 수 있다. 이때, 상기 통각수용성 통증은 체성통 및 내장통을 포함할 수 있다.In addition, the pain is caused by nociceptive pain due to cell damage, psychogenic pain caused by psychological conditions, inflammatory pain associated with tissue damage and immune cell infiltration, Or neuropathic pain caused by its abnormal function, and the like. At this time, the painful water-soluble pain may include a somatic tube and a visceral tube.
더욱 구체적으로, 상기 통증은 통각수용성 통증, 심인성 통증, 염증성 통증 및 신경병성 통증으로 이루어진 군에서 선택되는 하나 이상인 것일 수 있으며, 가장 구체적으로 통각성수용성 통증, 염증성 통증 등이 복합적으로 작용하는 암성 통증(cancer pain) 및 수술 후 통증(postoperative pain); 신경병성 통증에 해당하는 삼차 신경통(trigeminal neuralgia pain), 특발성 통증(idiopathic pain) 및 당뇨성 신경병성 통증(diabetic neuropathic pain); 및 내장통에 해당하는 편두통 및 생리통으로 이루어진 군에서 선택되는 하나 이상인 것일 수 있으나, 이에 제한되지 않는다.More specifically, the pain may be at least one selected from the group consisting of achromatic pain, cardiogenic pain, inflammatory pain and neuropathic pain, and more particularly, it may be at least one selected from the group consisting of painful pain, inflammatory pain, cancer pain and postoperative pain; Trigeminal neuralgia pain corresponding to neuropathic pain, idiopathic pain and diabetic neuropathic pain; And a migraine head and a menstrual cramp corresponding to a visceral tube, but the present invention is not limited thereto.
본 발명의 용어, "예방"은 상기 댕댕이나무 추출물 또는 이의 분획물을 포함하는 조성물의 투여로 통증을 억제 또는 지연시키는 모든 행위를 의미한다. The term " prophylactic " of the present invention refers to any act that inhibits or delays pain by administration of a composition comprising the Swallow's tree extract or its fractions.
본 발명의 용어, "치료"는 상기 댕댕이나무 추출물을 포함하는 조성물의 투여로 통증이 완화 또는 호전되거나 이롭게 변경되는 모든 행위를 의미한다.The term " treatment " of the present invention refers to any action in which the pain is alleviated, improved or beneficially altered by the administration of a composition comprising the farinacea tree extract.
이와 같은 본 발명의 조성물은 통증에 의해 발생되는 식욕억제, 체중증가와 같은 부차적 증상 역시 치료 또는 예방할 수 있다.The composition of the present invention can also treat or prevent secondary symptoms such as appetite suppression and weight gain caused by pain.
본 발명의 구체적인 일 실시예에서는, 댕댕이나무 열매 추출물은 CCI(Chronic constriction injury) 수술에 의해 통증이 유발된 랫트에 대하여, 체중감소 억제, 한랭 이질통 및 기계적 이질통을 억제하는 등의 진통효과를 나타내고(도 4, 및 표 3 내지 5), 상기 진통효과는 척수 지질 과산화의 감소, 척수의 항산화 활성 증가, 척수 조직 내 미세아교세포/별아교세포 활성화 인자의 발현 감소 및 전염증성 사이토카인의 발현 감소에 의해 달성됨을 확인하였다(표 6, 7, 9 및 11). 또한, 에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대하여, 체중감소 억제 및 복부 진통 효과를 나타내고(표 12 및 도 5), 상기 진통효과는 자궁 충혈 및 부종 억제, 자궁 조직 내 지질 과산화의 감소, 자궁의 항산화 활성 증가, 자궁 조직 내 염증성/전염증성 인자의 발현 감소 및 염증 감소에 의해 달성됨을 확인하였다(도 6 내지 9, 표 13 및 14, 및 표 16 내지 18).In one specific embodiment of the present invention, the extract of Staphylococcus aureus exhibits analgesic effects such as inhibition of weight loss, cold allodynia and mechanical allodynia in rats induced by chronic constriction injury (CCI) surgery 4, and Tables 3 to 5), the analgesic effect was due to a decrease in spinal lipid peroxidation, an increase in antioxidant activity of the spinal cord, a decrease in the expression of microglia / astrocytic cell activation factor in spinal cord tissues, and a decrease in expression of proinflammatory cytokines (Tables 6, 7, 9 and 11). In addition, estradiol benzoate and oxytocin induced weight loss inhibition and abdominal analgesia (Table 12 and Fig. 5), and the analgesic effect was shown to inhibit uterine conization and edema, lipid peroxidation in uterine tissues , Increased antioxidant activity of the uterus, decreased expression of inflammatory / proinflammatory factors in the uterus, and decreased inflammation (Figs. 6 to 9, Tables 13 and 14, and Tables 16 to 18).
이는, 상기 댕댕이나무 추출물 또는 이의 분획물은 다양한 원인에 의해 발생되는 통증의 치료 효과를 나타냄을 시사하는 것으로서, 통증의 억제/감소/완화/개선 등의 효과를 나타내므로, 이들을 포함하는 본 발명의 약학 조성물은 통증의 예방 또는 치료에 유용하게 사용될 수 있음을 시사하는 것이다. 더욱이, 이와 같은 효과는 기존 약물인 아미트리프틸린, 인도메타신 또는 금은화 추출물보다 높거나 유사한 것으로서, 안전한 천연물 유래의 치료제로서의 가능성을 제공한다.This suggests that the herb extract or its fractions exhibit therapeutic effects of pain caused by various causes, and exhibit effects such as suppression / reduction / alleviation / improvement of pain. Therefore, the pharmaceutical composition of the present invention Suggesting that the composition can be usefully used for preventing or treating pain. Moreover, such an effect is higher or similar to existing drugs such as amitriptyline, indomethacin or gingival extract, and provides a possibility as a therapeutic agent derived from safe natural products.
본 발명의 약학 조성물은 조성물 총 중량에 대하여 상기 댕댕이나무 추출물 또는 이의 분획물을 0.001 내지 80, 구체적으로 0.001 내지 70, 더욱 구체적으로 0.001 내지 60 중량%로 포함할 수 있으나, 이에 제한되지 않는다.The pharmaceutical composition of the present invention may include, but is not limited to, 0.001 to 80, specifically 0.001 to 70, more specifically 0.001 to 60% by weight of the above-described farinacea extract or fraction thereof, based on the total weight of the composition.
또한, 상기 약학 조성물은 약학 조성물의 제조에 통상적으로 사용하는 약학적으로 허용가능한 담체, 부형제 또는 희석제를 추가로 포함할 수 있고, 상기 담체는 비자연적 담체(non-naturally occuring carrier)를 포함할 수 있다.In addition, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, excipient or diluent conventionally used in the manufacture of a pharmaceutical composition, which carrier may comprise a non-naturally occuring carrier have.
상기 담체, 부형제 및 희석제의 구체적인 예로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있으나, 이에 제한되지 않는다.Specific examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, But are not limited to, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil.
또한, 상기 약학 조성물은 각각 통상의 방법에 따라 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결 건조제 및 좌제으로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있으며, 상기 제형은 경구 또는 비경구의 여러 가지 형태일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있으나, 이에 제한되지 않는다.The pharmaceutical composition may be formulated into tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze- And the formulations may be of various forms, such as oral or parenteral. In the case of formulation, it may be prepared by using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used, but the present invention is not limited thereto.
구체적인 예로, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 사용될 수 있으며, 상기 고형제제는 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등이 사용될 수 있다. 또한, 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제 등이 사용될 수 있으나, 이에 제한되지 않는다.As solid formulations for oral administration, tablets, pills, powders, granules, capsules and the like may be used. These solid preparations may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose lactose, gelatin and the like may be used. In addition to simple excipients, lubricants such as magnesium stearate, talc, and the like may be used, but the present invention is not limited thereto.
또한, 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 사용될 수 있으며, 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 사용될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제 또는 좌제 등이 사용될 수 있다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테로 등이 사용될 수 있으나, 이에 제한되지 않는다.As the liquid preparation for oral administration, suspensions, solutions, emulsions, syrups and the like may be used. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, Etc. may be used. For parenteral administration, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations or suppositories may be used. Examples of the non-aqueous solvent and suspension agent include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like.
또한, 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있으나, 이에 제한되지 않는다.Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like, but the present invention is not limited thereto.
다른 하나의 양태는 상기 약학 조성물을 통증이 유발되거나 유발이 의심되는 개체에 투여하는 단계를 포함하는, 통증의 치료 방법을 제공한다.Another embodiment provides a method for treating pain, comprising administering the pharmaceutical composition to a subject in which pain is caused or suspected of being caused.
이때, 상기 "통증" 및 "치료"의 정의는 전술한 바와 같다.Here, the definitions of the terms " pain " and " treatment " are as described above.
본 발명의 용어, "투여"는 적절한 방법으로 개체에게 상기 댕댕이나무 추출물 또는 이의 분획물을 포함하는 조성물을 도입하는 것을 의미한다.The term " administering " of the present invention means introducing a composition comprising said Swine Extract or fraction thereof to a subject in an appropriate manner.
본 발명의 용어, "개체"는 통증이 유발되거나 유발될 수 있는 인간을 포함한 쥐, 생쥐, 가축 등의 모든 동물을 의미한다. 구체적인 예로, 포유동물일 수 있으며, 인간을 제외한 개체일 수도 있다.The term " individual " of the present invention means all animals such as rats, mice, livestock, etc., including humans, in which pain can be induced or induced. As a specific example, it may be a mammal and may be an individual other than a human.
본 발명의 약학 조성물은 약학적으로 유효한 양으로 투여할 수 있다.The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.
상기 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. The term " pharmaceutically effective amount " means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the species and severity, age, sex, The sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts.
상기 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여할 수 있고 종래의 치료제와는 순차적 또는 동시에 투여할 수 있다. 또한, 단일 또는 다중 투여할 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.The pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. In addition, it can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by a person skilled in the art.
또한, 상기 약학 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. In addition, the pharmaceutical composition may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) depending on the intended method, and the dose may be determined depending on the condition and weight of the patient, , The type of drug, the route of administration, and the time, but may be suitably selected by those skilled in the art.
구체적인 예로, 상기 약학 조성물은 일반적으로 0.001 내지 1000 mg/kg, 더욱 구체적으로 0.05 내지 200 mg/kg, 가장 구체적으로 0.1 내지 100 mg/kg의 양을 1일 1회 내지 수회로 나누어 투여할 수 있으나, 바람직한 투여량은 개체의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 당업자에 의해 적절하게 선택될 수 있다.As a specific example, the pharmaceutical composition may be administered in an amount of generally 0.001 to 1000 mg / kg, more particularly 0.05 to 200 mg / kg, most specifically 0.1 to 100 mg / kg, once / , The preferred dosage may be appropriately selected by those skilled in the art depending on the condition and the weight of the individual, the degree of disease, the type of drug, the route of administration and the period of time.
다른 하나의 양태는 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 개선용 식품 조성물을 제공한다.Another embodiment provides a food composition for preventing or ameliorating pain comprising a farinacea tree extract or a fraction thereof.
이때, 상기 "댕댕이나무", "추출물", "분획물", "통증" 및 "예방"의 정의는 전술한 바와 같다.Herein, the definitions of the above-mentioned "buttock tree", "extract", "fraction", "pain" and "prevention" are as described above.
본 발명의 식품 조성물은 일상적으로 섭취하는 것이 가능하기 때문에 통증의 우수한 개선 효과를 기대할 수 있으며, 일반 약품과는 달리 천연물을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있으므로, 통증의 예방 또는 개선 목적으로 매우 유용하게 사용될 수 있다.Since the food composition of the present invention can be ingested routinely, it can be expected to have an excellent effect of improving pain and unlike general drugs, there is no side effect that may occur when a natural product is used as a raw material, It can be very useful for preventing or improving pain.
본 발명의 용어, "개선"은 상기 식품 조성물의 투여로 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.The term " improvement " of the present invention means any action that reduces the degree of the parameter associated with the condition being treated, such as the severity of symptoms, by administration of the food composition.
본 발명의 용어, "식품"은 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알코올음료, 비타민 복합제, 건강기능식품 및 건강식품 등이 있으며, 통상적인 의미에서의 식품을 모두 포함한다.The term " food " of the present invention includes dairy products such as meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen and other noodles, gums, ice cream, various soups, drinks, tea, , A vitamin complex, a health functional food, and a health food, all of which include foods in a conventional sense.
상기 건강기능(성)식품(health functional food)은 특정보건용 식품(food for special health use, FoSHU)과 동일한 용어로, 영양 공급 외에도 생체조절기능이 효율적으로 나타나도록 가공된 의학, 의료효과가 높은 식품을 의미한다. 여기서 '기능(성)'은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 상기 건강식품(health food)은 일반식품에 비해 적극적인 건강유지나 증진 효과를 가지는 식품을 의미하고, 건강보조식품(health supplement food)은 건강보조 목적의 식품을 의미한다. 경우에 따라, 건강기능식품, 건강식품, 건강보조식품의 용어는 혼용될 수 있다.The health functional food is the same term as food for special health use (FoSHU). In addition to the nutritional supply, the health functional food has a high medical effect, It means food. Here, 'function (sex)' refers to the structure and function of the human body to obtain nutritional effects or obtain a beneficial effect for health use such as physiological action. The health food refers to a food having an active health promotion or promotion effect compared with a general food, and a health supplement food refers to a food for health assistance. In some cases, the terms health functional foods, health foods, and health supplements may be used interchangeably.
구체적으로, 상기 건강기능식품은 본 발명의 댕댕이나무 추출물 또는 이의 분획물을 음료, 차류, 향신료, 껌, 과자류 등의 식품 소재에 첨가하거나, 캡슐화, 분말화, 현탁액 등으로 제조한 식품으로, 이를 섭취할 경우 건강상 특정한 효과를 가져오는 것을 의미하나, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용이 없는 장점이 있다.Specifically, the health functional food is a food prepared by adding the Swine Extract or its fraction of the present invention to a food material such as a beverage, a tea, a spice, a gum, or a confection, or encapsulating, pulverizing, , But it has the advantage that there is no side effect that can occur when a drug is taken for a long time using a food as a raw material unlike a general medicine.
본 발명의 식품은 당 업계에서 통상적으로 사용되는 방법에 의하여 제조 가능하며, 당업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한, 상기 식품 조성물은 식품으로 인정되는 제형이면 다양한 형태의 제형으로 제한 없이 제조될 수 있다.The food of the present invention can be prepared by a method commonly used in the art, and can be prepared by adding raw materials and components which are conventionally added in the art. In addition, the food composition can be produced in various forms without limitations as long as it is a food-acceptable formulation.
또한, 상기 식품 조성물은 생리학적으로 허용 가능한 담체를 추가로 포함할 수 있는데, 담체의 종류는 특별히 제한되지 않으며 당해 기술 분야에서 통상적으로 사용되는 담체라면 어느 것이든 사용할 수 있다.In addition, the food composition may further comprise a physiologically acceptable carrier. The carrier is not particularly limited and any carrier conventionally used in the art can be used.
또한, 상기 식품 조성물은 식품 조성물에 통상 사용되어 냄새, 맛, 시각 등을 향상시킬 수 있는 추가 성분을 포함할 수 있다. 예들 들어, 비타민 A, C, D, E, B1, B2, B6, B12, 니아신(niacin), 비오틴(biotin), 폴레이트(folate), 판토텐산(panthotenic acid) 등을 포함할 수 있다. 또한, 아연(Zn), 철(Fe), 칼슘(Ca), 크롬(Cr), 마그네슘(Mg), 망간(Mn), 구리(Cu), 크륨(Cr) 등의 미네랄; 및 라이신, 트립토판, 시스테인, 발린 등의 아미노산을 포함할 수 있다.In addition, the food composition may contain additional components that are commonly used in food compositions and can improve odor, taste, visual appearance, and the like. For example, vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, panthotenic acid and the like. Minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu) and chromium (Cr); And amino acids such as lysine, tryptophan, cysteine, valine, and the like.
또한, 상기 식품 조성물은 방부제(소르빈산 칼륨, 벤조산나트륨, 살리실산, 데히드로초산나트륨 등), 살균제(표백분과 고도 표백분, 차아염소산나트륨 등), 산화방지제(부틸히드록시아니졸(BHA), 부틸히드록시톨류엔(BHT) 등), 착색제(타르색소 등), 발색제(아질산 나트륨, 아초산 나트륨 등), 표백제(아황산나트륨), 조미료(MSG 글루타민산나트륨 등), 감미료(둘신, 사이클레메이트, 사카린, 나트륨 등), 향료(바닐린, 락톤류 등), 팽창제(명반, D-주석산수소칼륨 등), 강화제, 유화제, 증점제(호료), 피막제, 검기초제, 거품억제제, 용제, 개량제 등의 식품 첨가물(food additives)을 포함할 수 있다. 상기 첨가물은 식품의 종류에 따라 선별하고 적절한 양으로 사용할 수 있다.In addition, the food composition may contain at least one kind selected from the group consisting of preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate), disinfectants (such as bleaching powder and highly bleached white powder, sodium hypochlorite), antioxidants (butylhydroxyanisole (BHA) (Sodium nitrite), bleach (sodium sulfite), seasoning (sodium MSG glutamate, etc.), sweeteners (dicin, cyclamate, saccharin, etc.), coloring agents , Sodium, etc.), perfume (vanillin, lactones, etc.), swelling agents (alum, potassium hydrogen D-tartrate), emulsifiers, thickeners (foams), encapsulating agents, gum bases, foam inhibitors, solvents, And may include food additives. The additives can be selected according to the type of food and used in an appropriate amount.
본 발명의 구체적인 일 실시예에서는, 댕댕이나무 열매 추출물은 CCI(Chronic constriction injury) 수술에 의해 통증이 유발된 랫트에 대하여, 체중감소 억제, 한랭 이질통 및 기계적 이질통을 억제하는 등의 진통효과를 나타내고(도 4, 및 표 3 내지 5), 상기 진통효과는 척수 지질 과산화의 감소, 척수의 항산화 활성 증가, 척수 조직 내 미세아교세포/별아교세포 활성화 인자의 발현 감소 및 전염증성 사이토카인의 발현 감소에 의해 달성됨을 확인하였다(표 6, 7, 9 및 11). 또한, 에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대하여, 체중감소 억제 및 복부 진통 효과를 나타내고(표 12 및 도 5), 상기 진통효과는 자궁 충혈 및 부종 억제, 자궁 조직 내 지질 과산화의 감소, 자궁의 항산화 활성 증가, 자궁 조직 내 염증성/전염증성 인자의 발현 감소 및 염증 감소에 의해 달성됨을 확인하였다(도 6 내지 9, 표 13 및 14, 및 표 16 내지 18).In one specific embodiment of the present invention, the extract of Staphylococcus aureus exhibits analgesic effects such as inhibition of weight loss, cold allodynia and mechanical allodynia in rats induced by chronic constriction injury (CCI) surgery 4, and Tables 3 to 5), the analgesic effect was due to a decrease in spinal lipid peroxidation, an increase in antioxidant activity of the spinal cord, a decrease in the expression of microglia / astrocytic cell activation factor in spinal cord tissues, and a decrease in expression of proinflammatory cytokines (Tables 6, 7, 9 and 11). In addition, estradiol benzoate and oxytocin induced weight loss inhibition and abdominal analgesia (Table 12 and Fig. 5), and the analgesic effect was shown to inhibit uterine conization and edema, lipid peroxidation in uterine tissues , Increased antioxidant activity of the uterus, decreased expression of inflammatory / proinflammatory factors in the uterus, and decreased inflammation (Figs. 6 to 9, Tables 13 and 14, and Tables 16 to 18).
이는, 상기 댕댕이나무 추출물 또는 이의 분획물은 다양한 원인에 의해 발생되는 통증의 치료 또는 개선 효과를 나타냄을 시사하는 것으로서, 통증의 억제/감소/완화/개선 등의 효과를 나타내므로, 이들을 포함하는 본 발명의 식품 조성물은 통증의 예방 또는 개선에 유용하게 사용될 수 있음을 시사하는 것이다.This suggests that the herb extract or its fractions exhibit the effect of treating or improving the pain caused by various causes, and exhibit the effects of inhibiting / reducing / alleviating / improving the pain. Thus, the present invention Suggesting that the food composition of the present invention can be usefully used for prevention or improvement of pain.
또 다른 하나의 양태는 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 개선용 의약외품 조성물을 제공한다.Another embodiment provides a quasi-drug composition for preventing or ameliorating pain comprising a farina tree extract or a fraction thereof.
이때, 상기 "댕댕이나무", "추출물", "분획물", "통증", "예방" 및 "개선"의 정의는 전술한 바와 같다.Herein, the definitions of the above-mentioned "buttock tree", "extract", "fraction", "pain", "prevention" and "improvement" are as described above.
본 발명의 용어, "의약외품"은 사람이나 동물의 질병을 진단, 치료, 개선, 경감, 처치 또는 예방할 목적으로 사용되는 물품들 중 의약품보다 작용이 경미한 물품들을 의미하는 것으로, 예를 들어 약사법에 따르면 의약외품이란 의약품의 용도로 사용되는 물품을 제외한 것으로, 사람/동물의 질병 치료나 예방에 쓰이는 제품, 인체에 대한 작용이 경미하거나 직접 작용하지 않는 제품 등이 포함된다.The term " quasi-drug product " of the present invention refers to products which are used for diagnosis, treatment, improvement, alleviation, treatment or prevention of diseases of human beings or animals, and whose action is less than that of drugs. For example, Quasi-drugs are products that are used for the treatment or prevention of diseases of humans / animals, products which are mild to the human body or which do not act directly.
본 발명의 의약외품 조성물은 바디 클렌저, 폼, 비누, 마스크, 연고제, 크림, 로션, 에센스 및 스프레이로 이루어진 군에서 선택되는 하나 이상으로 제조할 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 조성물은 밴드, 생리대 등의 형태로 제조될 수 있으나, 이에 제한되지 않는다.The quasi-drug composition of the present invention may be manufactured by, but not limited to, a body cleanser, a foam, a soap, a mask, an ointment, a cream, a lotion, an essence and a spray. In addition, the composition may be manufactured in the form of bands, sanitary napkins, etc., but is not limited thereto.
본 발명에 따른 댕댕이나무 추출물 또는 이의 분획물을 의약외품 첨가물로 사용할 경우, 상기 조성물을 그대로 첨가하거나 다른 의약외품 또는 의약외품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합량은 사용 목적에 따라 적합하게 결정될 수 있다.When the Stalks extract or its fractions according to the present invention are used as a quasi-drug additive, the composition may be added as it is or may be used together with other quasi-drugs or quasi-drugs, and may be suitably used according to a conventional method. The amount of the active ingredient to be mixed can be appropriately determined depending on the purpose of use.
본 발명의 구체적인 일 실시예에서는, 댕댕이나무 열매 추출물은 CCI(Chronic constriction injury) 수술에 의해 통증이 유발된 랫트에 대하여, 체중감소 억제, 한랭 이질통 및 기계적 이질통을 억제하는 등의 진통효과를 나타내고(도 4, 및 표 3 내지 5), 상기 진통효과는 척수 지질 과산화의 감소, 척수의 항산화 활성 증가, 척수 조직 내 미세아교세포/별아교세포 활성화 인자의 발현 감소 및 전염증성 사이토카인의 발현 감소에 의해 달성됨을 확인하였다(표 6, 7, 9 및 11). 또한, 에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대하여, 체중감소 억제 및 복부 진통 효과를 나타내고(표 12 및 도 5), 상기 진통효과는 자궁 충혈 및 부종 억제, 자궁 조직 내 지질 과산화의 감소, 자궁의 항산화 활성 증가, 자궁 조직 내 염증성/전염증성 인자의 발현 감소 및 염증 감소에 의해 달성됨을 확인하였다(도 6 내지 9, 표 13 및 14, 및 표 16 내지 18).In one specific embodiment of the present invention, the extract of Staphylococcus aureus exhibits analgesic effects such as inhibition of weight loss, cold allodynia and mechanical allodynia in rats induced by chronic constriction injury (CCI) surgery 4, and Tables 3 to 5), the analgesic effect was due to a decrease in spinal lipid peroxidation, an increase in antioxidant activity of the spinal cord, a decrease in the expression of microglia / astrocytic cell activation factor in spinal cord tissues, and a decrease in expression of proinflammatory cytokines (Tables 6, 7, 9 and 11). In addition, estradiol benzoate and oxytocin induced weight loss inhibition and abdominal analgesia (Table 12 and Fig. 5), and the analgesic effect was shown to inhibit uterine conization and edema, lipid peroxidation in uterine tissues , Increased antioxidant activity of the uterus, decreased expression of inflammatory / proinflammatory factors in the uterus, and decreased inflammation (Figs. 6 to 9, Tables 13 and 14, and Tables 16 to 18).
이는, 상기 댕댕이나무 추출물 또는 이의 분획물은 다양한 원인에 의해 발생되는 통증의 치료 또는 개선 효과를 나타냄을 시사하는 것으로서, 통증의 억제/감소/완화/개선 등의 효과를 나타내므로, 이들을 포함하는 본 발명의 의약외품 조성물은 통증의 예방 또는 개선에 유용하게 사용될 수 있음을 시사하는 것이다.This suggests that the herb extract or its fractions exhibit the effect of treating or improving the pain caused by various causes, and exhibit the effects of inhibiting / reducing / alleviating / improving the pain. Thus, the present invention Of quasi-drug compositions may be useful for preventing or improving pain.
이하 본 발명을 하기 예에 의해 상세히 설명한다. 다만, 하기 예는 본 발명을 예시하기 위한 것일 뿐, 하기 예에 의해 본 발명의 범위가 제한되는 것은 아니다.Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.
제조예 1. 댕댕이나무 추출물의 제조방법PREPARATION EXAMPLE 1. Preparation method of Swallow's tree extract
제조예 1-1. 물 용매를 이용한 열수추출법Production Example 1-1. Hot water extraction method using water solvent
댕댕이나무(Lonicera caerulea var. edulis L)의 추출물, 구체적으로 댕댕이나무 열매(Blue honeysuckle)의 추출물(이하, 'BH'로 명명)을 제조하기 위하여, 아래와 같은 방법을 수행하였다.In order to prepare an extract of Lonicera caerulea var. Edulis L, specifically an extract of Blue honeysuckle (hereinafter referred to as 'BH'), the following method was carried out.
구체적으로, 분쇄한 상태의 댕댕이나무 열매 100g을 1 리터의 증류수에 가하여 잘 교반한 다음 90 내지 95℃를 유지하는 추출온도에서 3시간 동안 환류 추출한 후 여액을 분리하였고, 55 내지 65℃로 생약추출물을 감압농축한 후, 동결 건조시켜 생약조성물 분말 엑기스 21.2g을 얻었다.Specifically, 100 g of pulverized sole nut was added to 1 liter of distilled water and well stirred. After refluxing for 3 hours at an extraction temperature of 90 to 95 캜, the filtrate was separated. Was concentrated under reduced pressure, and then lyophilized to obtain 21.2 g of herbal composition powdery extract.
이후, 63 브릭스(brix)로 농축된 BH 200 g을 증류수를 이용하여 25배로 희석하고 동결건조하여 사용하였다.Then, 200 g of BH concentrated in 63 brix was diluted 25 times with distilled water and lyophilized to use.
한편, 상기 BH에는 베타인(Betaine) 4.54±0.09%, 총 페놀(total phenols) 210.63±23.65 mg GAE/g, 총 플라보노이드(total flavonoids) 159.30±12.51 mg CE/g, 총 안토시아닌(total antocyanins) 133.57±4.06 mg M3GE/g가 포함되어 있음을 확인하였다.The BH contained 4.54 ± 0.09% of betaine, 210.63 ± 23.65 mg of GAE / g of total phenols, 159.30 ± 12.51 mg of CE / g of total flavonoids, 133.5 of total antocyanins ± 4.06 mg M3GE / g was included.
제조예 1-2. 물-알콜 혼합용매를 이용한 열수추출법Production Example 1-2. Hot water extraction method using water-alcohol mixed solvent
또한, BH를 제조하기 위하여, 아래와 같은 방법을 수행하였다.Further, in order to produce BH, the following method was performed.
상기 실시예 1-1과 같이 분쇄된 댕댕이나무 열매 100g에 1 리터의 25% 에틸 알콜을 가해 잘 교반한 다음, 열을 가해 80 내지 90℃를 유지하는 추출온도에서 3시간 동안 환류 추출한 후 여액을 분리하였고 55 내지 65℃에서 생약추출물을 감압농축한 후, 동결 건조시켜 생약조성물 분말 엑기스 19.5g을 얻었다.1 liter of 25% ethyl alcohol was added to 100 g of pulverized royal jelly as in Example 1-1, and the mixture was thoroughly stirred. Then, the mixture was heat-refluxed for 3 hours at an extraction temperature of 80 to 90 ° C., The herbal medicine extract was concentrated under reduced pressure at 55 to 65 ° C and then lyophilized to obtain 19.5 g of herbal composition powdery extract.
이후, 63 브릭스(brix)로 농축된 BH 200 g을 증류수를 이용하여 25배로 희석하고 동결건조하여 사용하였다.Then, 200 g of BH concentrated in 63 brix was diluted 25 times with distilled water and lyophilized to use.
한편, 상기 BH에는 베타인 4.54±0.09%, 총 페놀 210.63±23.65 mg GAE/g, 총 플라보노이드 159.30±12.51 mg CE/g, 총 안토시아닌 133.57±4.06 mg M3GE/g가 포함되어 있음을 확인하였다.On the other hand, it was confirmed that BH contained 4.54 ± 0.09% of betaine, 210.63 ± 23.65 mg of GAE / g of total phenol, 159.30 ± 12.51 mg of CE / g of total flavonoid and 133.57 ± 4.06 mg of M3GE / g of total anthocyanin.
제조예 2. 금은화 추출물의 제조방법Production Example 2: Preparation method of gold europaea extract
댕댕이나무의 동속이종 식물인 금은화(Lonicera japonica Thunberg)의 추출물, 구체적으로 금은화의 꽃(Lonicerae Flos) 추출물(이하, 'LF'로 명명)을 제조하기 위하여, 아래와 같은 방법을 수행하였다.In order to prepare an extract of Lonicera japonica Thunberg, specifically Lonicerae Flos extract (hereinafter referred to as 'LF'), which is a cochlea of the Japanese thrush tree, the following method was performed.
구체적으로, 금은화의 말린 꽃 1 kg에 10배의 증류수를 가하고, 2.5 시간 동안 100℃로 가열하였다. 이후, 둥근 플라스크 증발기(N-1110, Eyela, Tokyo, Japan)를 사용하여 증발시킨 후 수득물을 동결건조하여 사용하였다.Specifically, 10 kg of distilled water was added to 1 kg of dried flowers of Gingko nuts and heated to 100 캜 for 2.5 hours. Thereafter, the mixture was evaporated using a round flask evaporator (N-1110, Eyela, Tokyo, Japan), and the obtained product was lyophilized and used.
실험예 1. 실험동물의 사용 방법EXPERIMENTAL EXAMPLE 1. Method of using an experimental animal
실험예 1-1. 신경병성 통증(neuropathic pain)이 유도된 실험동물Experimental Example 1-1. An experimental animal in which neuropathic pain was induced
총 70마리의 SD(SPF/VAF Outbred Crl:CD) 수컷 랫트를 입수하여(OrientBio, Seungnam, Korea) 7일간 순화한 후, 하기 실험예 2에 따른 방법으로 위(sham)-수술 또는 CCI(Chronic constriction injury) 수술을 실시하였다. 수술 24시간 후, 비슷한 체중을 갖는 8마리의 실험동물을 각 군별로 선별하였다. 이때, 각 대조군 및 실험군은 아래 표 1에 나타낸 바와 같으며, 수술 종류 및 투여 약물에 따라 구분하였다.A total of 70 male rats (SPF / VAF Outbred Crl: CD) were obtained (OrientBio, Seungnam, Korea) for 7 days and then subjected to sham-surgery or CCI constriction injury) surgery. After 24 hours of operation, eight experimental animals of similar weight were selected for each group. At this time, the control group and the experimental group are shown in Table 1 below, and classified according to the type of surgery and the drug to be administered.
구분division 수술 종류Type of surgery 투여 약물Administration drug
대조군Control group 위수술 대조군(Sham control)Sham control 위(Sham)-수술Sham - Surgery 증류수 경구 투여Oral administration of distilled water
CCI 대조군CCI control group CCICCI 증류수 경구 투여Oral administration of distilled water
비교군Comparative group 아미트리프틸린(Amitriptyline hydrochloride)Amitriptyline hydrochloride CCICCI 아미트리프틸린 10 mg/kg 복강 투여Amitriptyline 10 mg / kg intraperitoneally
LF(Lonicerae Flos)LF (Lonicerae Flos) CCI CCI LF 500 mg/kg 경구 투여LF 500 mg / kg oral administration
실험군Experimental group BH500(고용량)BH500 (high capacity) CCI CCI BH 500 mg/kg 경구 투여BH 500 mg / kg oral administration
BH250(중간용량)BH250 (medium capacity) CCI CCI BH 250 mg/kg 경구 투여BH 250 mg / kg orally
BH125(저용량)BH125 (low capacity) CCI CCI BH 125 mg/kg 경구 투여BH 125 mg / kg oral administration
본 발명에 따른 동물실험은 대구한의대학교 동물실험 윤리위원회의 사전 승인 하에 실시하였다(승인번호: DHU2017-046, 2017.05.10).Animal testing according to the present invention was carried out with the prior approval of Daegu Han University Animal Experimental Ethics Committee (Approval No. DHU2017-046, 2017.05.10).
실험예 1-2. 생리통(dysmenorrhea)이 유발된 실험동물Experimental Example 1-2. Dysmenorrhea-induced experimental animals
총 73마리의 SD(SPF/VAF Outbred Crl:CD) 암컷 랫트를 입수하여(OrientBio, Seungnam, Korea) 28일간 순화한 후, 하기 실험예 3에 따른 방법으로 생리통 유발제를 투여하여 생리통을 유도하였다. 이후, 비슷한 체중을 갖는 10마리의 실험동물을 각 군별로 선별하였다. 이때, 각 대조군 및 실험군은 아래 표 2에 나타낸 바와 같으며, 수술 종류 및 투여 약물에 따라 구분하였다.A total of 73 female SD (SPF / VAF Outbred Crl: CD) rats were obtained (OrientBio, Seungnam, Korea) and purified for 28 days, and menstrual cramps were induced by administering a damping inducer according to the method described in Experimental Example 3 below. Then, 10 animals with similar body weights were selected for each group. At this time, the control group and the experimental group are as shown in Table 2 below, and classified according to the type of surgery and the drug to be administered.
구분division 생리통 유발제의 종류Types of menstrual irritants 투여 약물Administration drug
대조군Control group 정상 대조군(Intact vehicle)Intact vehicle 식염수Saline solution 증류수 경구 투여Oral administration of distilled water
생리통 대조군Menstrual pain control 에스트라디올 벤조에이트 및 옥시토신 (estradiol benzoate 및 oxytocin, E/O)Estradiol benzoate and oxytocin (estradiol benzoate and oxytocin, E / O) 증류수 경구 투여Oral administration of distilled water
비교군Comparative group 인도메타신(Indomethacin, IND)Indomethacin (IND) E/OE / O 인도메타신 5 mg/kg 경구 투여Indomethacin 5 mg / kg Oral Administration
LF(Lonicerae Flos)LF (Lonicerae Flos) E/OE / O LF 500 mg/kg 경구 투여LF 500 mg / kg oral administration
실험군Experimental group BH500(고용량)BH500 (high capacity) E/OE / O BH 500 mg/kg 경구 투여BH 500 mg / kg oral administration
BH250(중간용량)BH250 (medium capacity) E/OE / O BH 250 mg/kg 경구 투여BH 250 mg / kg orally
BH125(저용량)BH125 (low capacity) E/OE / O BH 125 mg/kg 경구 투여BH 125 mg / kg oral administration
본 발명에 따른 동물실험은 대구한의대학교 동물실험 윤리위원회의 사전 승인 하에 실시하였다(승인번호: DHU2017-047, 2017.05.10).Animal testing according to the present invention was carried out with the prior approval of Daegu Han University Animal Experimental Ethics Committee (Approval No. DHU2017-047, 2017.05.10).
실험예 2. CCI(Chronic constriction injury) 수술 방법Experimental Example 2. Chronic constriction injury (CCI) operation method
신경병성 통증이 유발된 실험동물을 제작하기 위하여, 랫트에 CCI(Chronic constriction injury; 만성 수축 상해) 수술을 수행하였다. 상기 수술 과정은 도 1에 나타내었다.In order to produce experimental animals in which neuropathic pain was induced, rats underwent CCI (Chronic Constriction Injury) surgery. The surgical procedure is shown in Fig.
한편, 좌골 신경 결찰에 의한 만성 신경 압박성 통증(Chronic constriction injury; CCI) 랫트 모델은 일차 감각 뉴런에서 사람의 신경병성 통증에서 관찰되는 것과 매우 유사한 분자, 생화학 및 세포 구조 변화를 일으키며, 자발적 통증, 이질통 및 통각 과민 등 사람에서의 신경병성 통증과 동일한 임상증상을 나타내는바, 사람의 신경병성 통증을 연구하는 가장 일반적인 실험 동모델로 이용되고 있으며, 다양한 항우울제, 항염제 및 항산화제들의 이질통에 대한 진통효과가 이들 CCI 랫트 모델을 이용하여 평가되어 왔다(De Vry J, Eur J Pharmacol. 2004, 491:137-48.; Berrocoso E, Eur J Pharmacol. 2011, 655:46-51).On the other hand, a chronic constriction injury (CCI) rat model by sciatic nerve ligation causes molecular, biochemical and cellular structural changes very similar to those observed in human neuropathic pain in primary sensory neurons, and is associated with spontaneous pain, It has the same clinical symptoms as the neuropathic pain in humans, such as allodynia and hyperalgesia. It is used as the most common experimental model to study neuropathic pain in humans. It has been used as a model for analgesic effects of various antidepressants, Have been evaluated using these CCI rat models (De Vry J, Eur J Pharmacol 2004, 491: 137-48; Berrocoso E, Eur J Pharmacol. 2011, 655: 46-51).
구체적으로, 설치류용 흡입마취기(Surgivet, Waukesha, WI, USA), 환기 장치(Model 687, Harvard Apparatus, Cambridge, UK), 2~3% 이소플루레인(isoflurane, Hana Pharm. Co., Hwasung, Korea), 70% N2O 및 28.5% O2 혼합가스를 이용하여 랫트를 전신 흡입 마취하고, 1~1.5% 이소플루레인으로 마취를 유지하였다. 이후, 좌측 대퇴부 외측 부위를 절개하여 좌골신경을 노출시킨 다음 1~2 mm 간격으로 4-0 흡수성 봉합사(Catgut 4/0; F1154035, B. Braun Melsungen AG, Hessen, Germany)를 이용하여 4개의 결찰을 실시함으로써 만성 신경병증 통증을 유발하였다. 창상 주위 근육은 4/0 장선(catgut) 봉합사를 이용하여 봉합하였으며, 피부는 3/0 청색 나일론 실(blue nylon thread, NB324, Ailee, Busan, Korea)을 이용하여 일반적인 방법으로 폐쇄하였다. 수술 후 창상은 포비돈-요오드(Povidone Iodine, BetadineTM, Korea Pharma, Hwasung, Korea) 및 알러스프레이(AlusprayTM, Vetoquinol, Cedex, France)를 도포하여 보호하였다.(Hansen, Germany), a ventilator (Model 687, Harvard Apparatus, Cambridge, UK), 2-3% isoflurane (Hana Pharm. Co., Hwasung, ), 70% N 2 O and 28.5% O 2 mixed gas, and the anesthesia was maintained with 1 to 1.5% isoflurane. After the left lateral femoral region was dissected, the sciatic nerve was exposed, and 4 ligands (Catgut 4/0; F1154035, B. Braun Melsungen AG, Hessen, Germany) To cause chronic neuropathic pain. The wound muscle was sutured using 4/0 catgut suture, and the skin was closed using a 3/0 blue nylon thread (NB324, Ailee, Busan, Korea). After surgery, the wounds were protected by applying povidone-iodine (Povidone Iodine, Betadine ™ , Korea Pharma, Hwasung, Korea) and Aller spray (Aluspray ™ , Vetoquinol, Cedex, France).
또한, 위수술 대조군(Sham control)은 동일한 방법으로 좌측 좌골신경을 확인한 다음 결찰하지 않고, 동일한 방법으로 근육 및 피부를 봉합 폐쇄하였다.In the same way, the sham control was not closed after confirming the left sciatic nerve by the same method, and the muscle and the skin were closed in the same manner.
실험예 3. 생리통 유발 방법Experimental Example 3
생리통이 유발된 실험동물을 제작하기 위하여, 랫트에 에스트라디올 벤조에이트(estradiol benzoate) 및 옥시토신(oxytocin)을 투여하였다.In order to prepare experimental animals induced with menstrual cramps, rats were administered estradiol benzoate and oxytocin.
한편, 실험동물에 에스트라디올 벤조에이트 및 옥시토신을 반복적으로 투여한 후, 옥시토신을 단회 투여하는 경우에는 사람과 유사한 생리통이 쉽게 유발된다(Liu et al, Methods Find Exp Clin Pharmacol., 2003, 25:447-452.).On the other hand, human ostomy pain is easily induced when oxytocin is administered once after repeated administration of estradiol benzoate and oxytocin to experimental animals (Liu et al, Methods Find Exp Clin Pharmacol., 2003, 25: 447 -452.).
구체적으로, 에스트라디올 벤조에이트를 매일 1회씩 10일간 피하 투여(투여시작 및 최종 투여 시 2.5 mg/kg, 2회 내지 9회 투여시 1 mg/kg)한 후, 마지막 10회 투여 시에는 에스트라디올 벤조에이트를 투여한 뒤 1시간 후에 1 U/kg의 옥시토신을 단회 복강 투여하였다. Specifically, estradiol benzoate was subcutaneously administered once a day for 10 days (2.5 mg / kg at the initiation and final administration and 1 mg / kg when administered 2 to 9 times), and then the estradiol One hour after administration of benzoate, 1 U / kg of oxytocin was administered in a single dose.
이때, 에스트라디올 벤조에이트 및 옥시토신을 생리식염수에 현탁 또는 용해하여 5 ml 주사기에 부착된 26 G 니들(needle)로 피하 또는 복강 투여하였으며, 정상 대조군에 대해서는 동일한 보정 및 투여에 따른 스트레스를 가하기 위해 에스트라디올 벤조에이트 및 옥시토신 대신, 생리식염수를 동일한 용량 및 빈도로 피하 또는 복강 주사하였다.At this time, estradiol benzoate and oxytocin were suspended or dissolved in physiological saline and administered subcutaneously or intraperitoneally with a 26 G needle attached to a 5 ml syringe. For the normal control group, Instead of diol benzoate and oxytocin, physiological saline was subcutaneously or intraperitoneally injected at the same dose and frequency.
실험예 4. 약물 투여 방법EXPERIMENTAL EXAMPLE 4 Drug administration method
본 발명에 따른 대조군, 비교군 및 실험군에 대한 약물 투여 방법은 도 2 및 도 3에 자세히 나타내었다.The method of administering the drug to the control group, the comparative group and the experimental group according to the present invention is shown in detail in FIG. 2 and FIG.
먼저, 시험 약물인 BH는 멸균증류수에 100, 50 및 25 mg/ml 농도로 용해하였고, 5 ml/kg의 용량(500, 250 및 125 mg/kg)으로 매일 1회씩 14일간 5 ml 주사기에 부착된 존데(zonde)를 이용하여 경구 투여하였다. 이때, BH의 최고용량(500 mg/kg)은 본 발명자들의 갑상샘 기능저하증 랫트 모델에서의 약효 평가 및 마우스 독성 평가에 따른 기존 연구의 결과를 바탕으로 설정하였다(Kim HS, Toxicol Res. 2015, 31:61-8.). 아울러, 중간용량(250 mg/kg) 및 저용량(125 mg/kg)은 그에 대한 절반의 용량인 것으로 설정하였다.First, the test drug, BH, was dissolved in sterile distilled water at concentrations of 100, 50, and 25 mg / ml, and adhered to a 5 ml syringe for 14 days at a dose of 5 ml / kg (500, 250 and 125 mg / Orally administered with zonde. At this time, the highest dose of BH (500 mg / kg) was set based on the results of previous studies on the evaluation of pharmacological effect and mouse toxicity in hypothyroidism rat models of the present inventors (Kim HS, Toxicol Res. 2015, 31 : 61-8.). In addition, intermediate doses (250 mg / kg) and low doses (125 mg / kg) were set for half the doses.
또한, 비교 약물인 LF는 100 mg/ml의 농도로 멸균 증류수에 용해하였고, 5 ml/kg(500 mg/kg)의 용량으로 상기 BH 투여와 동일한 기간 및 방법으로 경구 투여하였다.In addition, the comparative drug, LF, was dissolved in sterilized distilled water at a concentration of 100 mg / ml and orally administered at the dose of 5 ml / kg (500 mg / kg) for the same period and method as the BH administration.
또한, 다른 비교 약물인 아미트리프틸린은 2 mg/ml의 농도로 식염수에 용해하였고, 5 ml/kg의 용량(10 mg/kg)으로 CCI 수술 24시간 후부터, 매일 1회씩 14일간 5 ml 주사기에 부착된 26 G 바늘(needle)을 이용하여 복강 투여하였다. 이때, 상기 아미트리프틸린의 투여 용량 및 투여 방법은 당업계에 공지된 바에 따라 설정하였다(Berrocoso E, Eur J Pharmacol. 2011, 655:46-51).Amitriptyline, another comparative drug, was dissolved in saline at a concentration of 2 mg / ml and was injected with a dose of 5 ml / kg (10 mg / kg) from 24 hours after CCI surgery, Were intraperitoneally administered using a 26 G needle attached to the mouse. At this time, the administration dose and administration method of amitriptyline were set as known in the art (Berrocoso E, Eur J Pharmacol. 2011, 655: 46-51).
아울러, 다른 비교 약물인 인도메타신(Indomethacin)은 1 mg/ml의 농도로 멸균 증류수에 현탁하여, 5 ml/kg의 용량(5 mg/kg)으로 매일 1회씩 10일간 에스트라디올 벤조에이트 투여 30분 후, 주사기에 부착된 존데를 이용하여 경구 투여하였다. 이때, 상기 인도메타신의 투여 용량 및 투여 방법은 당업계에 공지된 바에 따라 설정하였다(Kim et al., J Periodontal Res. 2012, 47:800-10.).Indomethacin, another comparative drug, was suspended in sterile distilled water at a concentration of 1 mg / ml and dosed with 5 ml / kg (5 mg / kg) once daily for 10 days with estradiol benzoate Min, orally administered with sonde attached to a syringe. At this time, the dosage and administration method of the indomethacin were set as known in the art (Kim et al., J Periodontal Res. 2012, 47: 800-10).
한편, 정상 대조군에는 동일한 보정 및 투여에 따른 스트레스를 가하기 위하여 증류수를 상기 BH 투여와 동일한 기간 및 방법으로 경구 투여하였다.On the other hand, in the normal control group, distilled water was orally administered by the same period and in the same manner as the BH administration in order to apply the same correction and stress to the administration.
실험예 5. 통계 분석 방법Experimental Example 5: Statistical analysis method
통계 분석은 SPSS(Release 14.0K, IBM SPSS Inc., Armonk, NY, USA)를 사용하여 수행하였고, 모든 결과 값은 8마리 랫트의 '평균 ± 표준 편차(S.D.)'로 나타내었다. Statistical analysis was performed using SPSS (Release 14.0K, IBM SPSS Inc., Armonk, NY, USA) and all results were expressed as 'mean ± SD' of 8 rats.
레빈(Levene's) 검정을 이용하여 분산 균질성을 조사하였고, 레빈 검정 결과에서 분산 균질성(variance homogeneity)이 유의한 편차가 없다면, 결과 값에 대하여 단방향 ANOVA(one-way ANOVA, two-analysis of variance) 검정을 수행한 후 LSD(least-significant difference multi-comparison) 검정을 수행함으로써 어느 군이 유의한 편차를 나타내는지 확인하였다. 레빈 검정 결과에서 분산 균질성이 크게 벗어난 경우, 비모수 비교 검정인 크루스칼-왈리스(Kruskal-Wallis H) 검정을 수행하였고, 크루스칼-왈리스 검정에서 유의한 차이가 확인되면 MW(Mann-Whitney U) 검정을 수행함으로써 어느 군이 유의한 편차를 나타내는지 확인하였다. Analysis of variance homogeneity was performed using Levene's test, and if the variance homogeneity was not significantly different in Levin test, one-way ANOVA (two-analysis of variance) And then performed a least-significant difference multi-comparison (LSD) test to determine which groups showed significant deviations. A Kruskal-Wallis H test was performed for non-parametric comparisons when the variance homogeneity was largely deviated from the Levin test results. When a significant difference was found in the Kruskal-Wallis test, MW (Mann-Whitney U ) Test to determine which groups showed significant deviations.
또한, 일측성 좌골 신경 차단 수술(unilateral sciatic CCI surgery)로 유발된 신경병성 통증의 정도를 관찰하기 위하여, 위수술 대조군과 CCI 대조군 사이의 백분율 변화; 및 CCI 대조군과 시험/비교 약물을 투여한 실험군/비교군 사이의 백분율 변화를 계산하였다.In addition, to observe the degree of neuropathic pain induced by unilateral sciatic CCI surgery, the percentage change between the gastric and CCI controls; And the percentage change between the CCI control and the test / comparator treated / comparative groups were calculated.
아울러, 에스트라디올 벤조에이트 및 옥시토신으로 유발된 생리통의 정도를 관찰하기 위하여, 생리식염수를 생리통 유발제로서 투여한 정상 대조군과 생리통 대조군 사이의 백분율 변화; 및 생리통 대조군과 시험/비교 약물을 투여한 실험군/비교군 사이의 백분율 변화를 계산하였다.In addition, in order to observe the degree of menstrual cough induced with estradiol benzoate and oxytocin, the percentage change between the normal control and the menstrual control treated with physiological saline as a damping agent; And the percentage change between the test group / control group and the test group / test group to which the test / comparison drug was administered were calculated.
실시예 1. 댕댕이나무 열매 추출물(BH)의 신경병증 통증에 대한 진통효과 확인Example 1. Confirmation of analgesic effect on neuropathic pain of Thymus nuts extract (BH)
실시예 1-1. 체중 및 증체량의 변화 확인Example 1-1. Check changes in weight and weight gain
CCI 수술에 의해 통증이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 체중 및 증체량의 변화를 확인하였다. To confirm the analgesic effect of BH on pain-induced rats by CCI surgery, changes in body weight and weight gain were determined.
한편, CCI에 의한 만성적이고 극심한 신경병성 통증은 식욕부진으로 직결되고, 결과적으로 현저한 체중 감소가 초래된다. 따라서, 이러한 체중 감소의 억제는 신경병성 통증에 대한 진통 효과를 나타내는 중요한 지표로 사용된다(Farghaly HS, Pain Physician. 2014, 17:187-95.). On the other hand, chronic and severe neuropathic pain caused by CCI is directly linked to anorexia, resulting in significant weight loss. Thus, inhibition of weight loss is an important indicator of analgesic effects on neuropathic pain (Farghaly HS, Pain Physician. 2014, 17: 187-95).
구체적으로, CCI 수술 24시간 후, 약물을 투여하기 전(0일)과 투여한 후 1, 3, 7, 10 및 14일째에 각각 하루에 한 번씩 체중을 측정하였다. 개체 차이를 줄이기 위하여, 14일간의 투여 후 체중 증가량을 하기 수학식 1과 같이 계산하였다. 이후, 그 결과를 도 4 및 하기 표 3에 나타내었다.Specifically, body weight was measured once a day on the 1st, 3rd, 7th, 10th, and 14th days after the administration of the drug (day 0) and 24 hours after the CCI surgery, respectively. In order to reduce individual differences, the weight gain after 14 days of administration was calculated as shown in Equation 1 below. The results are shown in FIG. 4 and Table 3 below.
[수학식 1][Equation 1]
약물 투여 후 14일간의 체중 증가량(g)Weight gain (g) for 14 days after drug administration
= 희생 시의 체중(투여 14일째의 체중) - CCI 수술 후 24시간 후의 체중 - 약물 투여 전의 체중(0일째의 체중)= Weight at sacrifice (body weight at 14 days of administration) - body weight at 24 hours after CCI surgery - body weight before drug administration (body weight at day 0)
구분division 체중 (g)Weight (g) 증체량(Body weight gains)[B - A]Body weight gains [B - A]
약물 투여 시작 시 [A]At the start of drug administration [A] 희생 시[B]At sacrifice [B]
대조군Control group 위수술 대조군Gastric surgery 269.50±11.07269.50 ± 11.07 318.00±14.00318.00 ± 14.00 48.50±9.1248.50 ± 9.12
CCI 대조군CCI control group 259.75±11.37259.75 ± 11.37 261.25±14.09a 261.25 ± 14.09 a 1.50±3.82a 1.50 ± 3.82 a
비교군 Comparative group 아미트리프틸린 10 mg/kg Amitriptyline 10 mg / kg 260.25±12.37260.25 + - 12.37 294.75±10.15ab 294.75 ± 10.15 ab 34.50±10.27ab 34.50 ± 10.27 ab
LF 500 mg/kg LF 500 mg / kg 258.88±11.56258.88 + - 11.56 279.75±12.67ab 279.75 ± 12.67 ab 20.88±5.25ab 20.88 ± 5.25 ab
시험군 Test group BH 500 mg/kgBH 500 mg / kg 259.75±15.55259.75 ± 15.55 292.00±12.24ab 292.00 ± 12.24 ab 32.25±11.63ab 32.25 ± 11.63 ab
BH 250 mg/kgBH 250 mg / kg 259.38±11.36259.38 + - 11.36 289.13±13.50ab 289.13 + 13.50 ab 29.75±6.61ab 29.75 ± 6.61 ab
BH 125 mg/kgBH 125 mg / kg 259.88±10.53259.88 ± 10.53 280.25±10.50ab 280.25 + 10.50 ab 20.38±5.40ab 20.38 ± 5.40 ab
이때, 상기 표 3에 나타낸 a는 LSD 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 LSD 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이다At this time, a shown in Table 3 LSD test showed that p <0.01 compared to the control group, and b LSD test showed that p <0.01 compared to CCI control
그 결과, 도 4 및 상기 표 3에서 볼 수 있듯이, CCI 대조군의 경우, 위수술 대조군에 비하여 투여 시작 1일 후부터 유의성 있는 체중 감소가 시작되며, 전체 투여기간인 14일 동안 현저한 체중 감소가 나타남을 확인하였다. 또한, 약물 투여 14일째, 체중의 증체량은 위수술 대조군에 비하여 -96.91% 감소한 것임을 확인하였다. As a result, as shown in FIG. 4 and Table 3, in the case of CCI control group, significant weight loss started from 1 day after the start of administration, and remarkable weight loss was observed during 14 days as a whole Respectively. On the 14th day of drug administration, the body weight gain was found to be -96.91% lower than the gastric surgery control group.
그러나, 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, CCI 대조군에 비하여 각각 투여 시작 3일 후부터 체중이 증가함을 확인하였다. 또한, 약물 투여 14일째, 체중의 증체량은 CCI 대조군에 비하여 각각 2200.00 및 1291.67% 증가함을 확인하였다However, in the case of 10 mg / kg of amitriptyline and 500 mg / kg of LF, the body weight was increased 3 days after the start of administration compared with the CCI control. On the 14th day after the administration of the drug, the body weight gain was increased by 2200.00 and 1291.67%, respectively, as compared with the CCI control group
특히, BH 500, 250 및 125 mg/kg 투여군의 경우, CCI 대조군에 비하여 투여 시작 7 및 10일 후부터 유의성 있는 체중 증가가 시작됨을 확인하였다. 또한, 상기 세 개의 BH 투여군에서는 용량 의존적인 체중 증가가 나타남을 확인하였고, 약물 투여 14일째, 체중의 증체량은 CCI 대조군에 비하여 각각 2050.00, 1883.33 및 1258.33% 증가함을 확인하였다. Particularly, in the BH 500, 250 and 125 mg / kg administration groups, significant weight increase started from 7 and 10 days after the start of administration compared with the CCI control. In addition, it was confirmed that dose-dependent weight gain was observed in the three BH administration groups, and that the body weight gain was increased by 2050.00, 1883.33, and 1258.33% on the 14th day of the drug administration, respectively.
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 체중 증가 및 증체량 감소 억제 효과를 나타냄을 확인하였다.Further, it was confirmed that the 500 mg / kg BH group showed similar or better weight gain and reduced body weight gain than the amitriptyline 10 mg / kg group and LF 500 mg / kg group.
상기 결과를 통해, 댕댕이나무 열매 추출물은 통증이 유발된 랫트의 무게를 증가시키고, 특히 진통제로서의 효과가 잘 알려진 아미트리프틸린 또는 금은화 추출물과 유사하거나 더 우수한 무게 증가 효과를 나타내므로, 신경병증 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Staphylococcus aureus increases the weight of pain-induced rats and exhibits a weight increasing effect similar or superior to that of amitriptyline or gingival extract, which is particularly well known as an analgesic agent, Can be usefully used as a preventive or remedy substance.
실시예 1-2. 한랭 이질통에 대한 진통효과 확인Examples 1-2. Confirming analgesic effect on cold allodynia
CCI 수술에 의해 통증이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 한랭 이질통(Cold-induced allodynia)에 대한 진통효과를 저온 플레이트 테스트(Cold plate test)를 통해 확인하였다. In order to confirm the analgesic effect of BH on pain-induced rats by CCI surgery, the analgesic effect on cold-induced allodynia was confirmed by cold plate test.
한편, CCI는 사람의 신경병성 통증의 임상 증상과 매우 유사한, 한랭 이질통 등의 다양한 이질통을 유발한다(Jasmin L, KPain. 1998, 75:367-82.).CCI, on the other hand, causes a variety of allodynia, such as cold allodynia, very similar to the clinical symptoms of human neuropathic pain (Jasmin L, KPain 1998, 75: 367-82.).
구체적으로, 저온(4 ± 1℃)의 금속판 위에 랫트를 올려놓고, 고온/저온 플레이트 시험 시스템(Hot/Cold Plate test system, Model 35150, Ugo Basile SRL)을 사용하여 투명한 플라스틱 상자(280 × 250 × 210 mm3, Varese, Italy)로 그 위를 덮었다. 이후, 랫트가 2분 동안 왼쪽 뒷발을 들어올린 횟수를 통각 반응으로 계산하였다. 이때, 본 실험은 CCI 수술 24시간 후, 약물을 투여하기 전(0일)과 투여한 후 1, 3, 7, 10 및 14일째에 각각 수행하였고, 그 결과를 하기 표 4에 나타내었다.Specifically, the rats were placed on a metal plate at a low temperature (4 ± 1 ° C), and a transparent plastic box (280 × 250 ×) was prepared using a hot / cold plate test system (Model 35150, Ugo Basile SRL) 210 mm 3 , Varese, Italy). The number of times the rats lifted the left hind paw for 2 minutes was then calculated as a painful response. At this time, this experiment was performed at 24 hours after CCI surgery, before (0 day) and 1, 3, 7, 10 and 14 days after administration of the drug, respectively.
구분division 약물 투여 후 기간 (일)After drug administration (days)
00 33 77 1010 1414
대조군Control group 위수술 대조군Gastric surgery 3.38±1.06  3.38 ± 1.06 3.25±1.04  3.25 ± 1.04 3.00±0.76  3.00 0.76 2.63±0.74  2.63 ± 0.74 2.50±0.53  2.50 ± 0.53
CCI 대조군CCI control group 25.88±2.42a 25.88 ± 2.42 a 26.13±1.73a 26.13 + 1.73 a 24.25±2.31c 24.25 + - 2.31 c 23.63±2.50c 23.63 + - 2.50 c 22.13±1.73c 22.13 ± 1.73 c
비교군 Comparative group 아미트리프틸린 10 mg/kg Amitriptyline 10 mg / kg 25.75±1.83a 25.75 ± 1.83 a 16.50±2.45ab 16.50 ± 2.45 ab 12.63±2.33cd 12.63 + - 2.33 cd 9.63±1.60cd 9.63 ± 1.60 cd 9.13±1.46cd 9.13 ± 1.46 cd
LF 500 mg/kg LF 500 mg / kg 26.00±1.31a 26.00 ± 1.31 a 22.38±2.62ab 22.38 ± 2.62 ab 20.88±2.23ce 20.88 ± 2.23 ce 16.63±2.72cd 16.63 ± 2.72 cd 15.63±2.33cd 15.63 ± 2.33 cd
시험군 Test group BH 500 mg/kgBH 500 mg / kg 25.75±1.91a 25.75 ± 1.91 a 17.50±3.34ab 17.50 ± 3.34 ab 13.25±2.60cd 13.25 ± 2.60 cd 10.38±1.69cd 10.38 ± 1.69 cd 9.75±1.28cd 9.75 ± 1.28 cd
BH 250 mg/kgBH 250 mg / kg 25.75±1.67a 25.75 ± 1.67 a 18.38±3.74ab 18.38 ± 3.74 ab 16.50±2.88cd 16.50 ± 2.88 cd 12.88±2.30cd 12.88 ± 2.30 cd 12.88±2.53cd 12.88 ± 2.53 cd
BH 125 mg/kgBH 125 mg / kg 26.13±1.64a 26.13 + 1.64 a 22.13±1.81ab 22.13 ± 1.81 ab 19.75±1.39cd 19.75 ± 1.39 cd 16.25±2.82cd 16.25 + - 2.82 cd 15.25±3.11cd 15.25 + - 3.11 cd
이때, 상기 표 4에 나타낸 a는 LSD 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 LSD 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이고, c는 MW 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, d 및 e는 MW 검정 결과 CCI 대조군에 비하여 각각 p<0.01 및 p<0.05임을 나타내는 것이다.At this time,aThe LSD test showed that p <0.01 compared with the above-mentioned surgery control group,bThe LSD test showed that p <0.01 compared to CCI control group,cShowed that the MW test showed p < 0.01 as compared with the gastric surgery control group,d AndeWere significantly lower than those of the CCI control group p < 0.05.
그 결과, 상기 표 4에서 볼 수 있듯이, CCI 대조군의 경우, 위수술 대조군에 비하여 왼쪽 뒷발을 들어올린 횟수, 즉 한랭 이질통이 CCI 수술 후부터 증가하여 약물 투여 14일까지 계속 지속됨을 확인하였다. 또한, 약물 투여 14일째, 이러한 한랭 이질통은 위수술 대조군에 비하여 785.00% 증가한 것임을 확인하였다.As a result, as shown in Table 4, in the case of CCI control group, it was confirmed that the number of lifting of the left hind paw, that is, cold allodynia increased from the CCI operation and continued until the 14th day of the drug administration. In addition, it was confirmed that the cold allodynia was increased by 785.00% on the 14th day after the drug administration compared with the gastric surgery control group.
그러나, 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, CCI 대조군에 비하여 각각 투여 시작 3일 후부터 한랭 이질통이 감소함을 확인하였다. 또한, 약물 투여 14일째, 이러한 한랭 이질통은 CCI 대조군에 비하여 각각 -58.76 및 -29.38% 감소함을 확인하였다.However, in the 10 mg / kg administration group of amitriptyline and 500 mg / kg of LF administration, it was confirmed that cold allodynia decreased from 3 days after the start of administration compared with the CCI control group. On the 14th day after the drug administration, it was confirmed that the cold allodynia was reduced by -58.76 and -29.38%, respectively, as compared with the CCI control group.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, CCI 대조군에 비하여 각각 투여 시작 3일 후부터 한랭 이질통이 감소함을 확인하였다. 또한, 상기 세 개의 BH 투여군에서는 용량 의존적인 한랭 이질통의 감소 효과가 나타남을 확인하였고, 약물 투여 14일째, 이러한 한랭 이질통은 CCI 대조군에 비하여 각각 -55.93, -41.81 및 -31.07% 감소함을 확인하였다. In particular, it was confirmed that cold allodynia decreased from 3 days after administration of BH 500, 250 and 125 mg / kg, respectively, as compared with CCI control. In addition, the three BH-treated groups showed a dose-dependent reduction of cold allodynia, and it was confirmed that the cold allodynia was reduced by -55.93, -41.81 and -31.07% on the 14th day of the drug administration .
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사한 한랭 이질통 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군보다도 우수한 한랭 이질통 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg group showed a similar cold aldosterol reduction effect as the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group also showed lower LF 500 mg / It was confirmed that it exhibits excellent cold allodynia reduction effect.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트의 한랭 이질통을 감소시키고, 특히 진통제로서의 효과가 잘 알려진 아미트리프틸린 또는 금은화 추출물과 유사하거나 더 우수한 통증 감소 효과를 나타내므로, 신경병증 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been found that the extract of Thymus nuts decreases the cold allodynia of rats and exhibits a similar or better pain reducing effect than amitriptyline or gingkofamily extract, which is particularly well known as an analgesic agent. Therefore, It can be used as a therapeutic substance.
실시예 1-3. 기계적 이질통에 대한 진통효과 확인Examples 1-3. Confirmation of analgesic effect on mechanical allodynia
CCI 수술에 의해 통증이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 기계적 이질통(Mechanical allodynia)에 대한 진통효과를 폰 프라이 모발 필라멘트 테스트(Von Frey hair filament test)를 통해 확인하였다. To confirm the analgesic effect of BH on pain-induced rats by CCI surgery, analgesic effects on mechanical allodynia were confirmed by Von Frey hair filament test.
한편, CCI는 사람의 신경병성 통증의 임상 증상과 매우 유사한, 기계적 이질통 등의 다양한 이질통을 유발한다(Jasmin L, KPain. 1998, 75:367-82.).On the other hand, CCI causes a variety of allodynia, including mechanical allodynia, which is very similar to the clinical symptoms of human neuropathic pain (Jasmin L, KPain 1998, 75: 367-82.).
구체적으로, 상기 실시예 1-2에 따른 저온 플레이트 테스트가 완료된 랫트를 공중의 와이어 망 위에 올려두고, 상자(Perspex boxes, 185×210×135 mm3) 안에 가두었다. 이후, 왼쪽 뒷발에 압력을 가함으로써 기계적 이질통을 주었고, 상기 통증은 동적 발바닥 측정 시스템(dynamic plantar aesthesiometer system, Model 37450, Ugo Basile SRL, Varese, Italy) 및 본 프라이 필라멘트(Von Frey filament, Bio-VF-M, Bioseb, Chaville, France)를 사용하여 그램(g) 단위로 측정하였다. 50g을 컷오프 한계로 두고, 철회 반응을 유도하는 힘을 역치(threshold)로 설정하였다. 이때, 본 실험은 CCI 수술 24시간 후, 약물을 투여하기 전(0일)과 투여한 후 1, 3, 7, 10 및 14일째에 각각 수행하였고, 그 결과를 하기 표 5에 나타내었다.Specifically, the rat subjected to the low-temperature plate test according to Example 1-2 was put on a wire net in the air and was confined in Perspex boxes (185 x 210 x 135 mm 3 ). The pain was then measured using a dynamic plantar aesthesiometer system (Model 37450, Ugo Basile SRL, Varese, Italy) and von Frey filament (Bio-VF -M, Bioseb, Chaville, France) in grams (g). 50 g was set as the cutoff limit, and the force inducing the retraction reaction was set as a threshold. At this time, this experiment was performed at 24 hours after CCI surgery, at 1, 3, 7, 10, and 14 days after administration of the drug (0 day), and the results are shown in Table 5 below.
구분division 약물 투여 후 기간 (일)After drug administration (days)
00 33 77 1010 1414
대조군Control group 위수술 대조군Gastric surgery 42.20±5.42 42.20 ± 5.42 41.88±5.51 41.88 + - 5.51 42.63±4.60 42.63 + - 4.60 41.75±5.50 41.75 + - 5.50 42.63±5.26 42.63 + - 5.26
CCI 대조군CCI control group 12.88±2.03a 12.88 ± 2.03 a 11.50±1.20a 11.50 ± 1.20 a 12.13±1.81a 12.13 + 1.81 a 12.88±1.55a 12.88 + 1.55 a 13.88±1.36a 13.88 ± 1.36 a
비교군 Comparative group 아미트리프틸린 10 mg/kg Amitriptyline 10 mg / kg 12.75±2.12a 12.75 ± 2.12 a 24.00±3.78ab 24.00 ± 3.78 ab 28.25±4.06ab 28.25 ± 4.06 ab 29.50±4.99ab 29.50 ± 4.99 ab 31.38±5.58ab 31.38 ± 5.58 ab
LF 500 mg/kg LF 500 mg / kg 13.00±2.27a 13.00 ± 2.27 a 16.50±1.20ab 16.50 ± 1.20 ab 18.50±1.77ab 18.50 ± 1.77 ab 19.00±1.51ab 19.00 ± 1.51 ab 19.88±1.55ab 19.88 ± 1.55 ab
시험군 Test group BH 500 mg/kgBH 500 mg / kg 12.75±2.25a 12.75 ± 2.25 a 23.63±2.62ab 23.63 ± 2.62 ab 28.63±2.67ab 28.63 ± 2.67 ab 29.13±2.90ab 29.13 ± 2.90 ab 30.75±3.37ab 30.75 ± 3.37 ab
BH 250 mg/kgBH 250 mg / kg 12.75±2.25a 12.75 ± 2.25 a 20.00±1.31ab 20.00 ± 1.31 ab 23.88±2.30ab 23.88 ± 2.30 ab 24.88±2.47ab 24.88 ± 2.47 ab 25.13±2.95ab 25.13 ± 2.95 ab
BH 125 mg/kgBH 125 mg / kg 12.75±2.12a 12.75 ± 2.12 a 16.88±2.10ab 16.88 ± 2.10 ab 18.63±1.92ab 18.63 ± 1.92 ab 19.88±1.73ab 19.88 ± 1.73 ab 20.63±2.26ab 20.63 ± 2.26 ab
이때, 상기 표 5에 나타낸 a는 MW 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 MW 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time,aThe MW test showed that p <0.01 compared to the control group,bThe MW test showed that p <0.01 compared to CCI control.
그 결과, 상기 표 5에서 볼 수 있듯이, CCI 대조군의 경우, 위수술 대조군에 비하여 CCI 수술 후부터 왼쪽 뒷발을 철회하는 힘의 크기, 즉 역치가 유의성 있게 감소하며, 전체 투여기간인 14일 동안 역치가 현저히 감소함을 확인하였다. 또한, 약물 투여 14일째, 역치는 위수술 대조군에 비하여 -67.45% 감소한 것임을 확인하였다.As a result, as shown in Table 5, in the case of CCI control, the magnitude of the force for withdrawing the left hind paw from the CCI operation was significantly decreased, and the threshold value for 14 days Respectively. On the 14th day of drug administration, the threshold value was -67.45% lower than that of the gastric surgery control group.
그러나, 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, CCI 대조군에 비하여 각각 투여 시작 3일 후부터 역치가 증가함을 확인하였다. 또한, 약물 투여 14일째, 역치는 CCI 대조군에 비하여 각각 126.13 및 43.24% 증가함을 확인하였다.However, in the group receiving 10 mg / kg of amitriptyline and 500 mg / kg of LF, the threshold value was increased 3 days after the start of administration compared with the CCI control group. Also, at the 14th day of drug administration, the threshold value was increased by 126.13 and 43.24%, respectively, as compared with the CCI control group.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우, CCI 대조군에 비하여 투여 시작 3일 후부터 역치가 유의성 있게 증가함을 확인하였다. 특히, 상기 세 개의 BH 투여군에서는 용량 의존적인 역치 증가가 나타남을 확인하였고, 약물 투여 14일째, 역치는 CCI 대조군에 비하여 각각 121.62, 81.08 및 48.65% 증가함을 확인하였다.In particular, the threshold values of BH 500, 250 and 125 mg / kg administration groups were significantly increased after 3 days of administration compared to the CCI control group. In particular, it was confirmed that the dose-dependent threshold increase was observed in the three BH-treated groups, and that the threshold values were increased by 121.62, 81.08 and 48.65%, respectively, on the 14th day of the administration of the drug compared to the CCI control group.
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 역치 증가 효과를 나타냄을 확인하였다.Furthermore, it was confirmed that the 500 mg / kg BH group exhibited a similar or better threshold increase effect than the amitriptyline 10 mg / kg group and the LF 500 mg / kg group.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트의 기계적 이질통을 감소시키고, 특히 진통제로서의 효과가 잘 알려진 아미트리프틸린 또는 금은화 추출물과 유사하거나 더 우수한 통증 감소 효과를 나타내므로, 신경병증 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been found that the extract of Thymus nuts decreases the mechanical allodynia of rats and exhibits a similar or better pain reducing effect than amitriptyline or gingkofamily extract, which is particularly well known as an analgesic agent. Therefore, It can be used as a therapeutic substance.
실시예 2. 댕댕이나무 열매 추출물(BH)의 신경병증 통증에 대한 진통효과 메커니즘 확인Example 2. Identification of Analgesic Effect Mechanism for Neuropathic Pain of Thymus nuts Extract (BH)
실시예 2-1. 척수 지질 과산화의 감소 효과 확인Example 2-1. Decreased effect of spinal lipid peroxidation
CCI 수술에 의해 통증이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 척수 지질 과산화(spinal cord lipid peroxidation)의 감소 효과를 MDA(malondialdehyde) 함량을 측정함으로써 확인하였다. To confirm the analgesic effect of BH on pain-induced rats by CCI surgery, the reduction effect of spinal cord lipid peroxidation was confirmed by measuring MDA (malondialdehyde) content.
한편, 산화 스트레스는 만성 신경병성 통증의 원인 중 하나이며, MDA는 지질 과산화의 최종 산물로서, 지질 과산화의 측정 지표로 유용하게 이용되고 있다(Messarah M, Exp Toxicol Pathol. 2010, 62:301-10.).On the other hand, oxidative stress is one of the causes of chronic neuropathic pain, and MDA is the final product of lipid peroxidation, which is useful as a measure of lipid peroxidation (Messarah M, Exp. Toxicol Pathol. 2010, 62: 301-10 .).
구체적으로, 상기 실시예 1-3에 따른 폰 프라이 모발 필라멘트 테스트가 완료된 랫트에서 L4-L6 부분의 복부 부분(lumbosacral spinal cord)을 분리하여 이의 무게를 측정하였다. 이후, 10 mM 수크로스(sucrose), 10 mM Tris-HCl 및 0.1 M MEDTA(pH 7.4)로 구성된 완충 용액에서 비드 비터(bead beater, Model TacoTMPre, GeneResearch Biotechnology Corp., Taichung, Taiwan) 및 초음파 세포 분쇄기(모델 KS-750, Madell Technology Corp., Ontario, CA)를 사용하여 균질화하였고, 12,000 g에서 15분간 원심분리하였다. 수득한 척수 조직의 균질액은 초저온 냉각기(MDF-1156, Sanyo, Tokyo, Japan)를 사용하여 사용 시까지 -150℃에서 보관하였다.Specifically, the lumbosacral spinal cord of the L4-L6 portion was separated from the rats in which the von Frey hair filament test according to Example 1-3 was completed, and the weight thereof was measured. Thereafter, a bead beater (Model TacoTMPre, GeneResearch Biotechnology Corp., Taichung, Taiwan) and an ultrasonic cell crusher (manufactured by Takara Shuzo) in a buffer solution composed of 10 mM sucrose, 10 mM Tris-HCl and 0.1 M MEDTA (Model KS-750, Madell Technology Corp., Ontario, CA) and centrifuged at 12,000 g for 15 minutes. The homogenate of the obtained spinal cord tissues was stored at -150 ° C until use with a cryocooler (MDF-1156, Sanyo, Tokyo, Japan).
척수 지질의 과산화 정도는 타이오바비투르산(thiobarbituric acid) 테스트와 UV/Vis 분광 광도계(OPTIZEN POP, Mecasys, Daejeon, Korea)를 사용하여 525 nm에서 흡광도를 측정함으로써 확인하였고, 단백질 g당 MDA의 농도(nM)로 나타내었다. 총 단백질의 함량은 소 혈청 알부민을 내부 표준으로 두어 계산하였다. 이후, 그 결과를 하기 표 6에 나타내었다.The degree of peroxidation of the spinal cord lipid was confirmed by measuring the absorbance at 525 nm using a thiobarbituric acid test and a UV / Vis spectrophotometer (OPTIZEN POP, Mecasys, Daejeon, Korea) Concentration (nM). Total protein content was calculated using bovine serum albumin as the internal standard. The results are shown in Table 6 below.
구분division 요추 척수 조직(Lumbosacral spinal cord tissues)Lumbosacral spinal cord tissues
MDA 함량 (nM/단백질 g)MDA content (nM / protein g)
대조군Control group 위수술 대조군Gastric surgery 2.97±1.012.97 ± 1.01
CCI 대조군CCI control group 10.83±1.79d 10.83 ± 1.79 d
비교군 Comparative group 아미트리프틸린10 mg/kgAmitriptyline 10 mg / kg 4.94±0.99de 4.94 ± 0.99 de
LF500 mg/kg LF 500 mg / kg 6.31±0.72de 6.31 ± 0.72 de
시험군 Test group BH500 mg/kgBH 500 mg / kg 4.84±0.67de 4.84 ± 0.67 de
BH250 mg/kgBH250 mg / kg 5.28±0.90de 5.28 ± 0.90 de
BH125 mg/kgBH125 mg / kg 6.28±1.32de 6.28 ± 1.32 de
이때, 상기 표 6에 나타낸 d는 MW 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, e는 MW 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time, d shown in Table 6 indicates that p <0.01 as compared with the surgical control group as a result of MW test, and e indicates that p <0.01 as compared with the CCI control as a result of MW test.
그 결과, 상기 표 6에서 볼 수 있듯이, CCI 대조군의 경우, 위수술 대조군에 비하여 MDA 함량, 즉 척수 지질의 과산화가 현저하게 증가하며, 이러한 과산화는 264.60% 증가한 것임을 확인하였다.As a result, as shown in Table 6, in the CCI control group, the MDA content, that is, the peroxidation of the spinal cord lipid was significantly increased and the peroxidation was increased by 264.60% as compared with the gastric surgery control group.
그러나, 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, CCI 대조군에 비하여 척수 지질의 과산화가 현저하게 감소하며, 이러한 과산화는 CCI 대조군에 비하여 각각 -54.40 및 -41.73% 감소함을 확인하였다.However, in the group receiving 10 mg / kg of amitriptyline and 500 mg / kg of LF, the peroxidation of spinal cord lipid was markedly decreased as compared with the CCI control group. This peroxidation was -54.40 and -41.73% lower than the CCI control group Respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, CCI 대조군에 비하여 각각 척수 지질의 과산화가 감소함을 확인하였고, 이러한 과산화 정도는 CCI 대조군에 비하여 각각 -55.27, -51.26 및 -41.99% 감소함을 확인하였다. In particular, in the BH 500, 250 and 125 mg / kg administration groups, the spinal lipid peroxidation was decreased in comparison with the CCI control group. The degree of peroxidation was -55.27, -51.26 and -41.99% Respectively.
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사한 과산화 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군보다도 우수한 과산화 정도 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg group showed a similar decrease in peroxidation compared with the 10 mg / kg group of amitriptyline and the 500 mg / kg group of LF, and the lower dose of 125 mg / kg of BH was also superior to the LF 500 mg / kg group And it was confirmed that it showed the effect of reducing the degree of peroxidation.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트의 MDA 함량, 즉 척수 지질의 과산화를 감소시키고, 특히 진통제로서의 효과가 잘 알려진 아미트리프틸린 또는 금은화 추출물과 유사하거나 더 우수한 척수 지질 과산화 감소 효과를 나타내므로, 신경병증 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of P. japonica reduces the MDA content of the rat, i.e., the lipid peroxidation of the spinal cord lipid, and exhibits a similar or better spinal lipid peroxidation effect as that of amitriptyline or gingival extract, Therefore, it can be used as a preventive or therapeutic agent for neuropathic pain.
실시예 2-2. 척수 항산화 방어 시스템의 기능 향상 효과 확인Example 2-2. Identification of function improvement of spinal cord antioxidant defense system
CCI 수술에 의해 통증이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 척수 항산화 방어 시스템(spinal cord antioxidant defense systems)의 기능 향상 효과를 GSH(Glutathione) 함량, SOD(Superoxide dismutase) 및 CAT(Catalase)의 활성 변화를 측정함으로써 확인하였다. The effects of spinal cord antioxidant defense systems on GSH (glutathione) content, SOD (superoxide dismutase) and CAT (catecholamines) were investigated in order to confirm the analgesic effect of BH on pain- Catalase) activity of the cells.
한편, GSH는 대표적인 내인성 항산화제의 일종으로 세포 내에서 비교적은 낮은 농도로 ROS를 제거하여 조직의 상해를 제어한다(Odabasoglu F, J Ethnopharmacol. 2006, 103:59-65.). 또한, SOD 및 CAT도 역시 내인성 항산화 효소로서, 세포의 효소 방어 시스템의 일환으로 작용한다(Cheeseman KH, Br Med Bull. 1993, 49:481-93.). On the other hand, GSH is a typical endogenous antioxidant, which controls tissue injury by removing ROS at a relatively low concentration in cells (Odabasoglu F, J Ethnopharmacol. 2006, 103: 59-65). SOD and CAT are also endogenous antioxidant enzymes and act as part of the enzyme defense system of cells (Cheeseman KH, Br Med Bull. 1993, 49: 481-93).
먼저, GSH 함량을 측정하기 위하여, 준비한 균질액을 25% 트라이클로로아세트산(trichloroacetic acid, Merck, San Francisco, CA, USA) 0.1ml와 혼합한 후, 4,200 rpm으로 4℃에서 40분간 원심분리하였다. GSH 함량은 2-니트로 벤조산(Sigma-Aldrich, St. Louise, MO, USA)을 사용하여 흡광도 412 nm에서 분광 광도계를 사용하여 측정하였고, 단백질 g당 농도(nM)로 나타내었다.First, to measure GSH content, the prepared homogenate was mixed with 0.1 ml of 25% trichloroacetic acid (Merck, San Francisco, Calif., USA) and centrifuged at 4,200 rpm for 40 minutes at 4,200 rpm. GSH content was measured using a spectrophotometer at 412 nm using 2-nitrobenzoic acid (Sigma-Aldrich, St. Louis, Mo., USA) and expressed as concentration per gram of protein (nM).
또한, CAT의 활성은 H2O2의 분해 정도를 통해 측정하였다. CAT 활성은 25℃ 및 pH 7.8에서 분당 1 nM의 H2O2를 분해하는데 필요한 효소의 양으로 정의되는데, 남은 H2O2의 양은 흡광도 240 nm에서 분광 광도계를 사용하여 측정하였고, 단백질 mg당 농도(U)로 나타내었다.The activity of CAT was also measured by the degree of decomposition of H 2 O 2 . CAT activity is defined as the amount of enzyme required to degrade 1 nM H 2 O 2 per minute at 25 ° C and pH 7.8, the amount of H 2 O 2 remaining measured using a spectrophotometer at an absorbance of 240 nm, Concentration (U).
또한, SOD 활성은 수퍼옥사이드 라디칼(superoxide radicals)의 생성 정도를 통해 확인할 수 있는데, SOD가 NBT(nitroblue tetrazolium)와 반응하면 크산틴(xanthine)이 생성되고, 상기 크산틴이 크산틴 옥시다아제(xanthine oxidase)와 반응하면 수퍼옥사이드 라디칼이 생성된다. 상기 수퍼옥사이드 라디칼을 흡광도 560 nm에서 분광 광도계를 사용하여 측정하였고, 단백질 mg당 농도(U)로 나타내었다. 이때, 1U는 1분 동안 NBT의 초기 흡광도를 50% 감소시키는 효소의 양을 의미한다. 이후, 그 결과를 하기 표 7에 나타내었다.In addition, SOD activity can be confirmed by the degree of formation of superoxide radicals. When SOD reacts with NBT (nitroblue tetrazolium), xanthine is produced, and xanthine oxidase ), Superoxide radicals are produced. The supercoxide radical was measured at 560 nm using a spectrophotometer and expressed as a concentration (U) per mg of protein. Here, 1U means the amount of enzyme which reduces the initial absorbance of NBT by 50% for 1 minute. The results are shown in Table 7 below.
구분division 요추 척수 조직Lumbar spinal cord tissue
GSH 함량(nM/단백질 g)GSH content (nM / protein g) SOD 활성(U/단백질 mg)SOD activity (U / protein mg) CAT 활성(U/단백질 mg)CAT activity (U / protein mg)
대조군Control group 위수술 대조군Gastric surgery 65.31±11.2665.31 + - 11.26 0.74±0.120.74 + - 0.12 186.25±27.15186.25 ± 27.15
CCI 대조군CCI control group 26.37±11.33a 26.37 ± 11.33 a 0.27±0.07a 0.27 ± 0.07 a 25.13±10.51d 25.13 + - 10.51 d
비교군 Comparative group 아미트리프틸린10 mg/kgAmitriptyline 10 mg / kg 46.53±10.58ab 46.53 ± 10.58 ab 0.53±0.08ab 0.53 ± 0.08 ab 122.75±29.31de 122.75 ± 29.31 de
LF500 mg/kg LF 500 mg / kg 41.15±4.83ab 41.15 ± 4.83 ab 0.40±0.10ac 0.40 0.10 ac 65.50±20.58de 65.50 ± 20.58 de
시험군 Test group BH500 mg/kgBH 500 mg / kg 51.49±11.77ab 51.49 ± 11.77 ab 0.54±0.12ab 0.54 ± 0.12 ab 126.25±32.30de 126.25 ± 32.30 de
BH250 mg/kgBH250 mg / kg 44.87±10.02ab 44.87 ± 10.02 ab 0.51±0.13ab 0.51 ± 0.13 ab 104.88±27.35de 104.88 ± 27.35 de
BH125 mg/kgBH125 mg / kg 41.61±7.18ab 41.61 ± 7.18 ab 0.40±0.08ac 0.40 + 0.08 ac 64.63±18.37de 64.63 ± 18.37 de
이때, 상기 표 7에 나타낸 a는 LSD 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, b 및 c는 LSD 검정 결과 CCI 대조군에 비하여 각각 p<0.01 및 p<0.05임을 나타내는 것이고, c는 MW 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 MW 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, e는 MW 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time, a shown in Table 7 LSD test showed that p <0.01 compared to the control group, and b and c LSD test showed that p <0.01 and p <0.05, respectively. Compared to the CCI control group, LSD showed p <0.01 and p <0.05, and c showed an MW test as p <0.01 compared to the control group and d as a MW test showed p <0.01 , And e indicates that p <0.01 as compared to CCI control as a result of MW assay.
그 결과, 상기 표 7에서 볼 수 있듯이, CCI 대조군의 경우, 위수술 대조군에 비하여 GSH 함량, SOD 활성 및 CAT 활성, 즉 항산화 활성이 현저하게 감소하며, 이러한 감소 정도는 각각 -59.62%, -63.41% 및 -86.51%임을 확인하였다.As a result, as shown in Table 7, GSH content, SOD activity and CAT activity, that is, antioxidative activity were significantly decreased in the CCI control group compared to the gastric surgery control group, and the degree of decrease was -59.62%, -63.41 % And -86.51%, respectively.
그러나, 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, CCI 대조군에 비하여 척수의 항산화 활성이 증가함을 확인하였다. 구체적으로, 아미트리프틸린 투여군의 경우 GSH 함량, SOD 활성 및 CAT 활성은 각각 76.43, 95.39 및 388.56% 증가함을 확인하였다. 또한, LF 투여군의 경우 GSH 함량, SOD 활성 및 CAT 활성은 각각 56.02, 48.39 및 160.70% 증가함을 확인하였다.However, it was confirmed that the antioxidant activity of spinal cord was increased in the case of 10 mg / kg of amitriptyline and 500 mg / kg of LF compared to the CCI control. Specifically, GSH content, SOD activity and CAT activity were increased by 76.43, 95.39 and 388.56%, respectively, in the amitriptyline-treated group. In addition, GSH content, SOD activity and CAT activity were increased by 56.02, 48.39 and 160.70%, respectively, in the LF administration group.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, CCI 대조군에 비하여 척수의 항산화 활성이 증가하며, 용량 의존적으로 항산화 활성이 증가함을 확인하였다. 구체적으로, GSH 함량, SOD 활성 및 CAT 활성은 BH 500 mg/kg 투여군의 경우 각각 95.23, 100.46 및 402.49%; BH 250 mg/kg 투여군의 경우 각각 70.14, 87.10 및 317.41%; BH 125 mg/kg 투여군의 경우 각각 57.79, 48.39 및 157.21% 증가함을 확인하였다. In particular, the antioxidative activity of spinal cord was increased and the antioxidative activity was increased dose-dependently in comparison with the CCI control group in the BH 500, 250 and 125 mg / kg administration groups. Specifically, GSH content, SOD activity and CAT activity were 95.23, 100.46 and 402.49% for the 500 mg / kg BH group, respectively; 70.14, 87.10 and 317.41% for the BH 250 mg / kg administration group, respectively; , And 57.79, 48.39 and 157.21%, respectively, for the 125 mg / kg BH group.
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군보다도 우수한 항산화 활성 증가 효과를 나타냄을 확인하였다.Furthermore, it was confirmed that BH 500 mg / kg administration group showed better antioxidant activity than amitriptyline 10 mg / kg and LF 500 mg / kg administration group.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트의 GSH 함량, SOD 활성 및 CAT 활성, 즉 척수의 항산화 활성을 증가시키고, 특히 진통제로서의 효과가 잘 알려진 아미트리프틸린 또는 금은화 추출물보다 더 우수한 항산화 활성 증가 효과를 나타내므로, 신경병증 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Thymus nuts increases the GSH content, SOD activity and CAT activity of the rat, that is, the antioxidant activity of the spinal cord, and particularly the antioxidant activity of the amitriptyline or gallium arsenide extract As a result, it could be used as a preventive or therapeutic agent for neuropathic pain.
실시예 2-3. 척수 조직 내 미세아교세포 및 별아교세포 활성화 인자의 발현 감소 효과 확인Examples 2-3. Decreased expression of microglial cells and astrocytic cell activation factor in spinal cord tissues
CCI 수술에 의해 통증이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 척수 조직 내 미세아교세포 및 별아교세포 활성화 인자, 즉 Iba-1(Ionized calcium-binding adapter molecule-1) 및 GFAP(Glial fibrillary acidic protein)의 발현 감소 효과를 RT-PCR 분석을 통해 확인하였다.In order to confirm the analgesic effect of BH on pain-induced rats by CCI surgery, microglia and astrocytic activation factors in the spinal cord, namely Iba-1 (Ionized calcium-binding adapter molecule-1) and GFAP fibrillary acidic protein expression was confirmed by RT-PCR analysis.
한편, 미세아교세포 및 별아교세포는 신경 손상에 반응하여 활성화되며, 신경독성, 만성 염증 및 과분극과 같은 다양한 신경병증 및 만성적인 신경병증 통증을 유발하는 것으로 알려져 있다(Milligan ED, Nat Rev Neurosci. 2009, 10:23-36.).On the other hand, microglial cells and astrocytes are activated in response to nerve injury and are known to cause various neuropathies such as neurotoxicity, chronic inflammation and hyperpolarization, and chronic neuropathic pain (Milligan ED, Nat Rev Neurosci. 2009 , 10: 23-36).
먼저, Trizol 시약(Invitrogen, Carlsbad, CA, USA)을 사용하여 척수 조직으로부터 RNA를 추출하였고, RNA의 농도와 품질은 CFX96TM Real-Time System(Bio-Rad, Hercules, CA, USA)을 통해 확인하였다. 오염된 DNA를 제거하기 위해 샘플을 재조합 DNase I(DNA-free; Ambion, Austin, TX, USA)으로 처리하였고, High-Capacity cDNA 역전사 키트(Applied Biosystems, Foster City, CA, USA)를 사용하여 RNA를 역전사하였다. 하기 표 8에 기재한 프라이머 및 ABI Step One Plus 서열 검출 시스템(Applied Biosystems, Foster City, CA, USA)을 사용하여 각 인자의 발현 정도를 확인하였다. 이후, GAPDH(glyceraldehydes 3-phosphate dehydrogenase)의 발현양으로 표준화하였고, 그 결과를 하기 표 9에 나타내었다.RNA was extracted from spinal cord tissues using Trizol reagent (Invitrogen, Carlsbad, Calif., USA), and the concentration and quality of RNA were determined using the CFX96 ™ Real-Time System (Bio-Rad, Hercules, CA, USA) . Samples were treated with recombinant DNase I (DNA-free; Ambion, Austin, TX, USA) and high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) Lt; / RTI &gt; The expression level of each factor was confirmed using primers and ABI Step One Plus sequence detection system (Applied Biosystems, Foster City, Calif., USA) shown in Table 8 below. Thereafter, the expression level of GAPDH (glyceraldehydes 3-phosphate dehydrogenase) was standardized. The results are shown in Table 9 below.
표적 인자Target factor 5' - 3'5 'to 3' 서열order NCBI accession No.NCBI accession No.
Iba-1Iba-1 정방향Forward CAGACTGCCAGCCTAAGACA(서열번호 1)CAGACTGCCAGCCTAAGACA (SEQ ID NO: 1) NM_017196NM_017196
역방향Reverse AGGAATTGCTTGTTGATCCC(서열번호 2)AGGAATTGCTTGTTGATCCC (SEQ ID NO: 2)
GFAPGFAP 정방향Forward AGAAAACCGCATCACCATTCC(서열번호 3)AGAAAACCGCATCACCATTCC (SEQ ID NO: 3) NM_017009NM_017009
역방향Reverse CAGGGCTCCATTTTCAATCTG(서열번호 4)CAGGGCTCCATTTTCAATCTG (SEQ ID NO: 4)
GAPDHGAPDH 정방향Forward GCTAGGACTGGATAAGCAGGG (서열번호 5)GCTAGGACTGGATAAGCAGGG (SEQ ID NO: 5) NM_017008NM_017008
역방향Reverse GCCAAATCCGTTCACACCG(서열번호 6)GCCAAATCCGTTCACACCG (SEQ ID NO: 6)
구분division 요추 척수 조직Lumbar spinal cord tissue
Iba-1Iba-1 GFAPGFAP
대조군Control group 위수술 대조군Gastric surgery 1.01±0.05  1.01 ± 0.05 0.99±0.12  0.99 ± 0.12
CCI 대조군CCI control group 2.87±0.65c 2.87 ± 0.65 c 1.76±0.18a 1.76 + 0.18 a
비교군 Comparative group 아미트리프틸린10 mg/kgAmitriptyline 10 mg / kg 1.64±0.24cd 1.64 ± 0.24 cd 1.23±0.09ab 1.23 ± 0.09 ab
LF500 mg/kg LF 500 mg / kg 2.00±0.25cd 2.00 ± 0.25 cd 1.45±0.23ab 1.45 ± 0.23 ab
시험군 Test group BH500 mg/kgBH 500 mg / kg 1.69±0.30cd 1.69 ± 0.30 cd 1.29±0.11ab 1.29 ± 0.11 ab
BH250 mg/kgBH250 mg / kg 1.80±0.21cd 1.80 ± 0.21 cd 1.35±0.11ab 1.35 ± 0.11 ab
BH125 mg/kgBH125 mg / kg 1.97±0.23cd 1.97 ± 0.23 cd 1.46±0.19ab 1.46 ± 0.19 ab
이때, 상기 표 9에 나타낸 a는 LSD 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 LSD 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이고, c는 MW 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time, a shown in Table 9 LSD test showed that p <0.01 compared to the control group, and b As a result of LSD test, p <0.01 compared to CCI control group. C indicates that p <0.01 compared to the control group, and d indicates p <0.01 as compared with CCI control group.
그 결과, 상기 표 9에서 볼 수 있듯이, CCI 대조군의 경우, 위수술 대조군에 비하여 Iba-1 및 GFAP의 mRNA 발현양, 즉 미세아교세포 및 별아교세포 활성화 인자가 현저하게 증가하며, 이러한 증가 정도는 각각 184.49 및 77.90% 증가함을 확인하였다.As a result, as shown in Table 9, in the CCI control group, the amount of mRNA expression of Iba-1 and GFAP, that is, microglial cell and astrocytic cell activation factor, was markedly increased as compared with the gastric surgery control group. 184.49 and 77.90%, respectively.
그러나, 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, CCI 대조군에 비하여 상기 활성화 인자의 발현이 감소함을 확인하였다. 구체적으로, 아미트리프틸린 투여군의 경우 Iba-1 및 GFAP의 mRNA 발현양은 각각 -42.87 및 -30.31% 감소함을 확인하였다. 또한, LF 투여군의 경우 Iba-1 및 GFAP의 mRNA 발현양은 각각 -30.18 및 -17.53% 감소함을 확인하였다.However, the expression of the activating factor was decreased in the 10 mg / kg group of amitriptyline and the 500 mg / kg of LF group compared to the CCI control group. Specifically, the amount of mRNA expression of Iba-1 and GFAP was decreased by -42.87 and -30.31%, respectively, in the group treated with amitriptyline. In addition, in the LF-treated group, mRNA expression levels of Iba-1 and GFAP were decreased by -30.18 and -17.53%, respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, CCI 대조군에 비하여 척수의 상기 활성화 인자의 발현이 감소하며, 용량 의존적으로 발현양이 감소함을 확인하였다. 구체적으로, Iba-1 및 GFAP의 mRNA 발현양은 BH 500 mg/kg 투여군의 경우 각각 -40.91 및 -26.90%; BH 250 mg/kg 투여군의 경우 각각 -37.07 및 -23.56%; BH 125 mg/kg 투여군의 경우 각각 -31.44 및 -17.18% 감소함을 확인하였다. In particular, it was confirmed that the expression of the activating factor in the spinal cord was decreased and the expression level was decreased dose-dependently in the BH 500, 250 and 125 mg / kg administration group, as compared with the CCI control group. Specifically, the mRNA expression levels of Iba-1 and GFAP were -40.91 and -26.90%, respectively, in the group administered with BH 500 mg / kg; -37.07 and -23.56% for BH 250 mg / kg treated group, respectively; And decreased by -31.44 and -17.18%, respectively, in the 125 mg / kg BH group.
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 미세아교세포 및 별아교세포 활성화 인자의 발현 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군보다도 우수한 발현 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg group showed a decrease in the expression of microglial cells and astrocytic cell activation factors similar or superior to those of the amitriptyline 10 mg / kg group and LF 500 mg / kg group, and the low dose BH 125 mg / kg was also superior to the LF 500 mg / kg group.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트 척수 내의 Iba-1 및 GFAP의 mRNA 발현양, 즉 미세아교세포 및 별아교세포 활성화 인자의 발현을 감소시키고, 특히 진통제로서의 효과가 잘 알려진 아미트리프틸린 또는 금은화 추출물과 유사하거나 더 우수한 발현 감소 효과를 나타내므로, 신경병증 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Thymus nuts decreases the expression level of mRNA of Iba-1 and GFAP in the rat spinal cord, that is, the expression of microglial cells and astrocytic cell activating factor, and particularly amitriptyline And exhibit similar or better expression reduction effects as the Euglena extract, it can be used as a preventive or therapeutic agent for neuropathic pain.
실시예 2-4. 척수 조직 내 전염증성 사이토카인의 발현 감소 효과 확인Examples 2-4. Decreased expression of proinflammatory cytokines in spinal cord tissues
CCI 수술에 의해 통증이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 척수 조직 내 전염증성 사이토카인(Pro-inflammatory cytokine), 즉 TNF(Tumor necrosis factor)-α 및 iNOS(Inducible nitric oxide synthase)의 mRNA 발현 감소 효과를 RT-PCR 분석을 통해 확인하였다.To confirm the analgesic effect of BH on pain-induced rats by CCI surgery, proinflammatory cytokines in the spinal cord, namely TNF (Tumor Necrosis Factor) -α and iNOS (Inducible Nitric Oxide Synthase ) MRNA expression was confirmed by RT-PCR analysis.
한편, 전염증성 사이토카인 역시 신경병증의 통증에 관여하며, 신경 손상 후 TNF-α 및 iNOS와 같은 전염증성 사이토카인이 발현되면 염증반응이 촉발되어 통증이 야기된다(Liang F, Saudi Pharm J. 2017, 25:649-54.).On the other hand, proinflammatory cytokines are also involved in neuropathic pain, and the expression of proinflammatory cytokines such as TNF-α and iNOS following neuronal injury triggers an inflammatory reaction, resulting in pain (Liang F, Saudi Pharm J. 2017 , 25: 649-54.).
구체적으로, 상기 실시예 2-3에 따른 방법으로, 하기 표 10에 나타낸 바와 같은 프라이머를 사용하여 RT-PCR을 수행하였고, 그 결과를 하기 표 11에 나타내었다.Specifically, RT-PCR was carried out using primers as shown in Table 10 by the method according to Example 2-3, and the results are shown in Table 11 below.
표적 인자Target factor 5' - 3'5 'to 3' 서열order NCBI accession No.NCBI accession No.
TNF-αTNF-a 정방향Forward CTACTGAACTTCGGGGTGAT(서열번호 7)CTACTGAACTTCGGGGTGAT (SEQ ID NO: 7) NM_012675NM_012675
역방향Reverse CTTGGTGGTTTGTGAGTGTG(서열번호 8)CTTGGTGGTTTGTGAGTGTG (SEQ ID NO: 8)
iNOSiNOS 정방향Forward AGCCTAGTCAACTGCAAGAG(서열번호 9)AGCCTAGTCAACTGCAAGAG (SEQ ID NO: 9) NM_012611NM_012611
역방향Reverse TCTTGTATTGTTGGGCTGAGA(서열번호 10)TCTTGTATTGTTGGGCTGAGA (SEQ ID NO: 10)
구분division 요추 척수 조직Lumbar spinal cord tissue
TNF-αTNF-a iNOSiNOS
대조군Control group 위수술 대조군Gastric surgery 1.00±0.10  1.00 + - 0.10 0.99±0.05  0.99 ± 0.05
CCI 대조군CCI control group 3.92±0.69c 3.92 ± 0.69 c 6.30±0.79c 6.30 ± 0.79 c
비교군 Comparative group 아미트리프틸린10 mg/kgAmitriptyline 10 mg / kg 1.88±0.24cd 1.88 ± 0.24 cd 2.38±0.62cd 2.38 ± 0.62 cd
LF500 mg/kg LF 500 mg / kg 2.71±0.30cd 2.71 ± 0.30 cd 3.68±0.80cd 3.68 ± 0.80 cd
시험군 Test group BH500 mg/kgBH 500 mg / kg 1.82±0.24cd 1.82 ± 0.24 cd 2.39±0.39cd 2.39 ± 0.39 cd
BH250 mg/kgBH250 mg / kg 2.12±0.29cd 2.12 ± 0.29 cd 3.12±0.47cd 3.12 ± 0.47 cd
BH125 mg/kgBH125 mg / kg 2.69±0.24cd 2.69 ± 0.24 cd 3.70±0.42cd 3.70 ± 0.42 cd
이때, 상기 표 11에 나타낸 c는 MW 검정 결과 위수술 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 검정 결과 CCI 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time, c shown in Table 11 shows that p <0.01 compared to the surgical control group as a result of MW test, and d indicates that p <0.01 as compared with CCI control.
그 결과, 상기 표 11에서 볼 수 있듯이, CCI 대조군의 경우, 위수술 대조군에 비하여 TNF-α 및 iNOS의 mRNA 발현양, 즉 전염증성 사이토카인이 현저하게 증가하며, 각각 291.01 및 538.28% 증가함을 확인하였다.As a result, as shown in Table 11, the expression level of TNF-α and iNOS mRNA, that is, proinflammatory cytokine, was significantly increased in the CCI control group compared to the gastric surgery control group and increased by 291.01 and 538.28% Respectively.
그러나, 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, CCI 대조군에 비하여 상기 사이토카인의 발현이 감소함을 확인하였다. 구체적으로, 아미트리프틸린 투여군의 경우 TNF-α 및 iNOS의 mRNA 발현양은 각각 -52.11 및 -62.13% 감소함을 확인하였다. 또한, LF 투여군의 경우 TNF-α 및 iNOS의 mRNA 발현양은 각각 -30.87 및 -41.48% 감소함을 확인하였다.However, it was confirmed that the expression of the cytokine was decreased in the case of 10 mg / kg of amitriptyline and 500 mg / kg of LF compared to the CCI control. Specifically, the amount of mRNA expression of TNF-α and iNOS in the group treated with amitriptyline was -52.11 and -62.13%, respectively. In addition, the amount of TNF-α and iNOS mRNA expression was decreased by -30.87 and -41.48%, respectively, in the LF-treated group.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, CCI 대조군에 비하여 척수 내 상기 사이토카인의 발현이 감소함을 확인하였다. 구체적으로, TNF-α 및 iNOS의 mRNA 발현양은 BH 500 mg/kg 투여군의 경우 각각 -53.58 및 -62.11%; BH 250 mg/kg 투여군의 경우 각각 -45.75 및 -50.44%; BH 125 mg/kg 투여군의 경우 각각 -31.35 및 -41.30% 감소함을 확인하였다. In particular, it was confirmed that the expression of the cytokine in the spinal cord was decreased in the BH 500, 250 and 125 mg / kg administration group as compared to the CCI control group. Specifically, the expression levels of TNF-α and iNOS mRNA were -53.58 and -62.11%, respectively, in the group administered with BH 500 mg / kg; -45.75 and -50.44% for the BH 250 mg / kg administration group, respectively; And -31.35 and -41.30%, respectively, for the 125 mg / kg BH group.
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 상기 활성화 인자의 발현 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군과 유사하거나 더 우수한 발현 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg group showed a similar or better effect to the activation factor than the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group also showed LF And 500 mg / kg, respectively.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트 척수 내의 TNF-α 및 iNOS의 mRNA 발현양, 즉 전염증성 사이토카인의 발현을 감소시키고, 특히 진통제로서의 효과가 잘 알려진 아미트리프틸린 또는 금은화 추출물과 유사하거나 더 우수한 전염증성 사이토카인의 발현 감소 효과를 나타내므로, 신경병증 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Staphylococcus aureus decreases the expression level of TNF-α and iNOS mRNA in rat spinal cord, that is, the expression of proinflammatory cytokine, and is similar to that of amitriptyline or gingkoff extract Or exhibit a more excellent proinflammatory cytokine expression reduction effect, it can be used as a preventive or therapeutic agent for neuropathic pain.
실시예 3. BH의 생리통에 대한 진통효과 확인Example 3. Confirmation of analgesic effect on menstrual pain of BH
실시예 3-1. 체중 및 증체량의 변화 확인Example 3-1. Check changes in weight and weight gain
에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 체중 및 증체량의 변화를 확인하였다. In order to confirm the analgesic effect of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, changes in body weight and body weight gain were observed.
한편, 에스트라디올 벤조에이트는 내인성 및 외인성 콜레시스토키닌(cholecystokinin) 호르몬의 분비를 촉진하여 포만감을 느끼게 하므로, 에스트라디올 벤조에이트에 의한 생리통은 식욕부진으로 직결되고, 결과적으로 현저한 체중 감소가 초래된다. 이에, 이러한 체중 감소의 억제는 생리통에 대한 진통 효과를 나타내는 중요한 지표로 사용된다(Asarian L et al., Endocrinology. 2007, 148:5656-66.).On the other hand, estradiol benzoate promotes the secretion of endogenous and exogenous cholecystokinin hormones, and thus feels fullness. Therefore, the menstrual cramps caused by estradiol benzoate are directly linked to poor appetite, resulting in significant weight loss. Thus, inhibition of weight loss is an important indicator of analgesic effects on menstrual cramps (Asarian L et al., Endocrinology 2007, 148: 5656-66.).
구체적으로, 에스트라디올 벤조에이트 처리 전(0일)과 마지막 투여 시(9일)까지, 10일 동안 매일 하루에 한 번씩 체중을 측정하였다. 개체 차이를 줄이기 위하여, 10일간의 투여 후 체중 증가량을 하기 수학식 2와 같이 계산하였다. 이후, 그 결과를 하기 표 12에 나타내었다.Specifically, body weight was measured once a day for 10 days before the treatment with estradiol benzoate (0 day) and last administration (9 days). In order to reduce individual differences, the weight gain after 10 days of administration was calculated as shown in Equation 2 below. The results are shown in Table 12 below.
[수학식 2]&Quot; (2) &quot;
약물 투여 후 10일간의 체중 증가량(g)Weight gain (g) for 10 days after drug administration
= 희생 시의 체중(9일째의 체중) - 에스트라디올 벤조에이트 처리 전 체중(0일째의 체중)= Body weight at sacrifice (body weight at 9th day) - body weight before oestradiol benzoate treatment (body weight at day 0)
구분division 체중 (g)Weight (g) 증체량(Body weight gains)[B - A]Body weight gains [B - A]
약물 투여 시작 시 [A]At the start of drug administration [A] 희생 시[B]At sacrifice [B]
대조군Control group 정상 대조군Normal control group 223.30±10.03223.30 + - 10.03 232.50±10.72232.50 ± 10.72 9.20±4.189.20 ± 4.18
생리통 대조군Menstrual pain control 224.80±14.16224.80 ± 14.16 218.70±13.34b 218.70 ± 13.34 b - 6.10±4.20a - 6.10 + - 4.20 a
비교군 Comparative group 인도메타신 5 mg/kg Indomethacin 5 mg / kg 223.20±10.58223.20 ± 10.58 221.60±9.85221.60 ± 9.85 - 1.60±3.17ad - 1.60 + 3.17 ad
LF 500 mg/kg LF 500 mg / kg 224.90±9.53224.90 + - 9.53 223.90±11.26223.90 ± 11.26 - 1.00±4.90ad - 1.00 ± 4.90 ad
시험군 Test group BH 500 mg/kgBH 500 mg / kg 221.60±17.43221.60 ± 17.43 224.10±18.62224.10 + - 18.62 2.50±3.87ac 2.50 ± 3.87 ac
BH 250 mg/kgBH 250 mg / kg 225.50±8.72225.50 + - 8.72 225.70±10.59225.70 + - 10.59 0.20±6.96ac 0.20 ± 6.96 ac
BH 125 mg/kgBH 125 mg / kg 224.80±14.67224.80 ± 14.67 223.70±15.94223.70 ± 15.94 - 1.10±3.41ad - 1.10 ± 3.41 ad
이때, 상기 표 12에 나타낸 a는 LSD 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 LSD 검정 결과 정상 대조군에 비하여 p<0.05임을 나타내는 것이다. 또한, c는 LSD 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 LSD 검정 결과 생리통 대조군에 비하여 p<0.05임을 나타내는 것이다. At this time, a shown in Table 12 LSD test showed that p <0.01 compared to the normal control, and b LSD test showed that p <0.05 compared to the normal control group. Also, c is The LSD test showed that p <0.01 compared to the control group, and d The LSD test showed that p <0.05 compared to the control group.
그 결과, 표 12에서 볼 수 있듯이, 생리통 대조군의 경우, 전체 투여기간인 10일 동안 현저한 체중 감소가 나타남을 확인하였다. 또한, 약물 투여 10일째, 체중의 증체량은 정상 대조군에 비하여 -166.30% 감소한 것임을 확인하였다. As a result, as shown in Table 12, in the case of the menstrual control group, it was confirmed that the weight loss was remarkable during the entire administration period of 10 days. On the 10th day after the administration of the drug, the body weight gain was found to be -166.30% lower than that of the normal control group.
한편, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 유의성 있는 체중의 변화가 나타나지는 않았으나, 약물 투여 10일째, 체중의 증체량은 생리통 대조군에 비하여 각각 74.77 및 84.61% 증가함을 확인하였다On the other hand, in the case of 5 mg / kg of indomethacin and 500 mg / kg of LF, there was no significant change in body weight compared to the control group, but the body weight gain on the 10th day of drug administration was 74.77 84.61%
특히, BH 500, 250 및 125 mg/kg 투여군의 경우, 생리통 대조군에 비하여 유의성 있는 체중 증가를 나타냄을 확인하였다. 또한, 상기 세 개의 BH 투여군에서는 용량 의존적인 체중 증가가 나타남을 확인하였고, 약물 투여 10일째, 체중의 증체량은 생리통 대조군에 비하여 각각 141.98, 104.26 및 82.97% 증가함을 확인하였다. In particular, the BH 500, 250, and 125 mg / kg administration groups showed significant weight gain compared to the menstrual control group. In addition, dose-dependent weight gain was observed in the three BH-treated groups, and the body weight gain was increased by 141.98, 104.26, and 82.97% on the 10th day of drug administration, respectively.
나아가, 저용량인 BH 125 mg/kg 투여군은 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 체중 증가 및 증체량 감소 억제 효과를 나타냄을 확인하였다.Furthermore, the low dose of 125 mg / kg of BH showed similar or better inhibitory effects on body weight gain and body weight gain than the 5 mg / kg of indomethacin and 500 mg / kg of LF.
상기 결과를 통해, 댕댕이나무 열매 추출물은 생리통이 유발된 랫트의 무게를 증가시키고, 특히 생리통 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물과 유사하거나 더 우수한 무게 증가 효과를 나타내므로, 생리통의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Staphylococcus aureus increases the weight of rats induced with menstrual cramps, and exhibits a weight increasing effect similar to or better than that of indomethacin or gingkofamily extract, Or as a therapeutic substance.
실시예 3-2. 복부 통증에 대한 진통효과 확인Example 3-2. Confirmation of analgesic effect on abdominal pain
생리통이 유발된 랫트에 대한 BH의 진통효과를 확인하기 위하여, 복부 몸부림(abdominal writhing) 감소 효과를 통해 복부 통증에 대한 진통효과를 확인하였다. To confirm the analgesic effect of BH on rats induced by menstrual cramps, analgesic effects on abdominal pain were confirmed by the effect of abdominal writhing reduction.
한편, 생리통의 정도는 복부 몸부림을 통해 측정되며, 일반적으로 복부 몸부림 반응의 증가는 복부 통증의 증가를 의미한다(Yang et al., J Agr Food Chem. 2004, 52:6787-93.).On the other hand, the degree of menstrual pain is measured through abdominal stiffness, and an increase in abdominal stiffness response generally means an increase in abdominal pain (Yang et al., J Agr Food Chem. 2004, 52: 6787-93).
구체적으로, 옥시토신 주사 3분 후, 랫트를 분리된 폴리 카보네이트 박스(280 × 420 × 180 mm)에 놓고, 복부의 몸부림을 30분 동안 기록하였다. 결과의 정확성을 위해 두 명의 실험자가 이중 맹검 방식(double-blind manner)으로 기록하였다.Specifically, after 3 minutes of oxytocin injection, the rats were placed in a separate polycarbonate box (280 x 420 x 180 mm) and the stump of the abdomen was recorded for 30 minutes. Two authors were recorded in a double-blind manner for the accuracy of the results.
그 결과, 도 5에서 볼 수 있듯이, 생리통 대조군의 경우, 정상 대조군에 비하여 옥시토신 투여 후 몸부림 증상이 증가되며, 이러한 증가 정도는 정상 대조군에 비하여 3815.00% 증가한 것임을 확인하였다.As a result, as shown in FIG. 5, in the case of the menstrual control group, the symptom of strangulation was increased after administration of oxytocin compared with the normal control group, and the degree of increase was 3815.00% higher than that of the normal control group.
한편, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 몸부림의 정도가 감소함을 확인하였다. 구체적으로, 몸부림의 정도는 생리통 대조군에 비하여 각각 -44.57 및 -23.37% 감소함을 확인하였다.On the other hand, in the case of 5 mg / kg of indomethacin and 500 mg / kg of LF, it was confirmed that the degree of struggle was decreased as compared with the menstrual control group. Specifically, the degree of writhing was reduced by -44.57 and -23.37%, respectively, compared to the control group.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, 생리통 대조군에 비하여 몸부림의 정도가 감소함을 확인하였다. 또한, 상기 세 개의 BH 투여군에서는 용량 의존적인 몸부림 감소 효과가 나타남을 확인하였고, 몸부림의 정도는 생리통 대조군에 비하여 각각 -42.78, -33.08 및 -23.88% 감소함을 확인하였다.In particular, it was confirmed that the degree of strangulation was decreased in the BH 500, 250, and 125 mg / kg administration groups as compared with the menstrual control group. In addition, the three BH-treated groups showed dose-dependent wrinkle reduction, and the degree of writhing was -42.78, -33.08, and -23.88%, respectively, as compared to the control group.
나아가, BH 500 mg/kg 투여군은 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 복부의 몸부림 감소 효과를 나타냄을 확인하였다.Furthermore, it was confirmed that the 500 mg / kg BH group exhibited a similar or better abdominal weight reduction effect to the indomethacin 5 mg / kg group and the LF 500 mg / kg group.
상기 결과를 통해, 댕댕이나무 열매 추출물은 생리통이 유발된 랫트의 복부 통증을 감소시키고, 특히 생리통 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물과 유사하거나 더 우수한 복부 통증 감소 효과를 나타내므로, 생리통의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been found that the extract of Staphylococcus aureus reduces the abdominal pain of rats caused by menstrual pain, and exhibits a similar or better abdominal pain reducing effect than that of indomethacin or gingival oocyte extract, Can be usefully used as a preventive or remedy substance.
실시예 4. BH의 생리통에 대한 진통효과 메커니즘 확인Example 4. Confirmation of analgesic effect mechanism of menstrual pain of BH
실시예 4-1. 자궁 충혈 및 부종(enlargement) 억제 효과 확인Example 4-1. Confirming the effect of suppressing uterine congestion and enlargement
에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대한 BH의 진통효과 메커니즘을 확인하기 위하여, 자궁 충혈 및 부종 억제 효과를 확인하였다.In order to confirm the analgesic effect mechanism of BH on estradiol benzoate and oxytocin induced rats in the menstrual cramps, the effect of suppressing uterine bleeding and edema was confirmed.
한편, 산화 스트레스 또는 염증은 생리통 발병의 중요한 병인 중 하나이며, 이는 자궁 충혈 및 부종을 야기하여 결과적으로 자궁의 무게를 증가시킨다(Chen L et al., J Sci Food Agric., 2014, 94:180-8.).Oxidative stress or inflammation is one of the major pathogenesis of menstrual cramps, causing uterine congestion and edema resulting in increased uterine weight (Chen L et al., J Sci Food Agric., 2014, 94: 180- 8.).
구체적으로, 옥시토신 주사 1시간 후, 랫트를 희생시키고 g 수준(절대 습윤 중량)으로 자궁 무게를 측정하였다. 개체 차이를 줄이기 위하여, 희생시 체중을 사용하여 상대적인 자궁의 무게(체중의 %)를 하기 수학식 3과 같이 계산하였다. Specifically, after 1 hour of oxytocin injection, the rats were sacrificed and uterine weights were measured at g level (absolute wet weight). To reduce individual differences, the weight of the relative uterus (% of body weight) was calculated using Equation 3 using the weight at sacrifice.
[수학식 3]&Quot; (3) &quot;
상대적인 자궁의 무게(체중의 %)Relative weight of uterus (% of body weight)
= [(자궁의 절대 습윤 중량 / 희생시의 체중(마지막 10번째 시험 물질 투여 일) × 100)= [(Absolute wet weight of uterus / body weight at sacrifice (last tenth test substance administration day) x 100)
그 결과, 도 6 및 7에서 볼 수 있듯이, 생리통 대조군의 경우, 정상 대조군에 비하여 현저한 자궁 충혈 및 부종 증상이 나타남을 확인하였고, 상대적인 자궁의 무게는 정도는 정상 대조군에 비하여 93.94% 증가함을 확인하였다.As a result, as shown in FIGS. 6 and 7, in the case of the menstrual control group, it was confirmed that the uterine congestion and edema symptoms were remarkable as compared with the normal control group, and the relative weight of the uterus was increased by 93.94% Respectively.
한편, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 자궁 충혈 및 부종 증상이 감소함을 확인하며, 상대적인 자궁의 무게는 생리통 대조군에 비하여 각각 -37.44 및 -24.35% 감소함을 확인하였다.On the other hand, in the case of 5 mg / kg of indomethacin and 500 mg / kg of LF, the uterine congestion and edema symptoms were reduced compared to the control group, and the relative weight of the uterus was -37.44 and - 24.35%, respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, 생리통 대조군에 비하여 자궁 충혈 및 부종 증상이 감소함을 확인하였다. 또한, 상기 세 개의 BH 투여군에서는 용량 의존적인 자궁 충혈 및 부종 증상의 감소 효과가 나타남을 확인하였고, 상대적인 자궁의 무게는 생리통 대조군에 비하여 각각 -38.58, -34.55 및 -25.01% 감소함을 확인하였다.In particular, the BH 500, 250 and 125 mg / kg administration group also showed a decrease in uterine congestion and edema symptoms compared to the control group. In addition, the three BH-treated groups showed a dose-dependent reduction in uterine conization and edema symptoms, and the relative weight of the uterus was decreased by -38.58, -34.55 and -25.01%, respectively, as compared with the control group.
나아가, BH 500 mg/kg 투여군은 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 자궁 무게 감소 효과를 나타냄을 확인하였다.Furthermore, it was confirmed that the 500 mg / kg BH group had similar or better uterine weight reduction effects than the 5 mg / kg indomethacin group and 500 mg / kg LF group.
상기 결과를 통해, 댕댕이나무 열매 추출물은 생리통이 유발된 랫트의 자궁 충혈 및 부종 증상을 감소시켜 자궁 무게를 감소키고, 특히 생리통 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물과 유사하거나 더 우수한 자궁 무게 감소 효과를 나타내므로, 생리통의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Staphylococcus aureus decreases the uterine weight by reducing the symptoms of uterine congestion and edema in rats induced by menstrual cramps, and in particular, a uterus similar or superior to the indomethacin or gingival extracts Weight reduction effect, it can be used as a preventive or therapeutic substance for menstrual cramps.
실시예 4-2. 자궁 조직 내 지질 과산화의 감소 효과 확인Example 4-2. Identification of the effect of lipid peroxidation in uterine tissues
에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대한 BH의 진통효과 메커니즘을 확인하기 위하여, 자궁 지질 과산화의 감소 효과를 MDA(malondialdehyde) 함량을 측정함으로써 확인하였다. In order to confirm the analgesic effect mechanism of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, the reduction effect of uterine lipid peroxidation was confirmed by measuring the MDA (malondialdehyde) content.
한편, 산화 스트레스는 생리통의 원인 중 하나이며, MDA는 지질 과산화의 최종 산물로서, 지질 과산화의 측정 지표로 유용하게 이용되고 있다(Chen L et al., J Sci Food Agric., 2014, 94:180-8.).Oxidative stress is one of the causes of menstrual cramps, and MDA is the final product of lipid peroxidation, which is useful as a measure of lipid peroxidation (Chen L et al., J Sci Food Agric., 2014, 94: 180 -8.).
구체적으로, 상기 실시예 4-1에 따라 자궁 무게 측정이 완료된 랫트에서 우측 자궁각 조직(Left uterine horn tissues)을 분리하여 이의 무게를 측정하였다. 이후, 상기 실시예 2-1에 따른 방법으로 자궁각 조직의 균질액을 수득하였고, 이로부터 MDA를 측정하여 그 결과를 하기 표 13에 나타내었다.Specifically, the left uterine horn tissues were separated from the uterus weight-measured rats according to Example 4-1, and their weights were measured. Thereafter, a homogeneous liquid of the uterine tissue was obtained by the method according to Example 2-1, and MDA was measured therefrom. The results are shown in Table 13 below.
구분division 우측 자궁각 조직(Left uterine horn tissues)Left uterine horn tissues
MDA 함량 (nM/단백질 g)MDA content (nM / protein g)
대조군Control group 정상 대조군Normal control group 2.62±1.14  2.62 ± 1.14
생리통 대조군Menstrual pain control 22.53±10.34a 22.53 + - 10.34 a
비교군 Comparative group 인도메타신 5 mg/kgIndomethacin 5 mg / kg 7.15±1.87ac 7.15 ± 1.87 ac
LF500 mg/kg LF 500 mg / kg 12.25±2.02ac 12.25 + 2.02 ac
시험군 Test group BH500 mg/kgBH 500 mg / kg 6.74±1.34ac 6.74 ± 1.34 ac
BH250 mg/kgBH250 mg / kg 9.71±1.39ac 9.71 ± 1.39 ac
BH125 mg/kgBH125 mg / kg 12.06±1.23ac 12.06 + 1.23 ac
이때, 상기 표 13에 나타낸 a는 MW 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, c는 MW 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time, a shown in Table 13 MW test showed that p <0.01 compared to the normal control, and c The results of MW test indicate that p <0.01 compared to the control group.
그 결과, 표 13에서 볼 수 있듯이, 생리통 대조군의 경우, 정상 대조군에 비하여 MDA 함량, 즉 자궁 지질의 과산화가 현저하게 증가하며, 이러한 과산화는 760.15% 증가한 것임을 확인하였다. As a result, as shown in Table 13, it was confirmed that the MDA content, that is, the peroxidation of the uterine lipids was significantly increased in the menstrual control group, and that the peroxidation was increased by 760.15% as compared with the normal control group.
그러나, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 자궁 지질의 과산화가 현저하게 감소하며, 이러한 과산화는 생리통 대조군에 비하여 각각 -68.25 및 -45.64% 감소함을 확인하였다.However, in the 5 mg / kg indomethacin group and the 500 mg / kg LF group, the peroxidation of the uterine lipids was markedly decreased as compared with the control group, and this peroxidation was decreased by -68.25 and -45.64% Respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, 생리통 대조군에 비하여 각각 자궁 지질의 과산화가 감소함을 확인하였고, 이러한 과산화 정도는 생리통 대조군에 비하여 각각 -70.07, -56.90 및 -46.46% 감소함을 확인하였다. In particular, in the BH 500, 250 and 125 mg / kg administration group, the peritoneal lipid peroxidation was decreased in comparison with the control group, and the degree of peroxidation was -70.07, -56.90 and -46.46% Respectively.
나아가, BH 500 mg/kg 투여군은 아미트리프틸린 10 mg/kg 투여군 및 LF 500 mg/kg 투여군과 더 우수한 과산화 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군보다도 우수한 과산화 정도 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg group showed a better reduction of peroxidation compared with the 10 mg / kg group of amitriptyline and the 500 mg / kg group of LF, and the LH 500 mg / kg group It was confirmed that it exhibited a superior degree of peroxidation reduction.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트의 MDA 함량, 즉 자궁 지질의 과산화를 감소시키고, 특히 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물과 유사하거나 더 우수한 자궁 지질 과산화 감소 효과를 나타내므로, 생리통의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Thymus nuts decreases the MDA content of rats, i.e., the lipid peroxidation of uterine lipids, and exhibits a similar or better cervical lipid peroxidation effect than the indomethacin or gingkofumhara extracts, , And as a preventive or therapeutic agent for menstrual cramps.
실시예 4-3. 자궁 조직 내 항산화 방어 시스템의 기능 향상 효과 확인Example 4-3. Improvement of function of antioxidant defense system in uterine tissues
에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대한 BH의 진통효과 메커니즘을 확인하기 위하여, 자궁 항산화 방어 시스템의 기능 향상 효과를 GSH 함량, SOD 및 CAT의 활성 변화를 측정함으로써 확인하였다. In order to confirm the analgesic effect mechanism of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, the functional improvement effect of the uterine antioxidant defense system was confirmed by measuring changes in GSH content, SOD and CAT activity.
구체적으로, 상기 실시예 4-2에서 준비한 자궁각 조직의 균질액에 대하여, 상기 실시예 2-2에 따른 방법으로 GSH 함량, SOD 및 CAT의 활성 변화를 확인하였다. 이후, 그 결과를 하기 표 14에 나타내었다.Specifically, the activity of GSH content, SOD, and CAT was determined by the method according to Example 2-2 with respect to the homogeneous liquid of uterine tissue prepared in Example 4-2. The results are shown in Table 14 below.
구분division 우측 자궁각 조직Right uterine tissue
GSH 함량(nM/단백질 g)GSH content (nM / protein g) SOD 활성(U/단백질 mg)SOD activity (U / protein mg) CAT 활성(U/단백질 mg)CAT activity (U / protein mg)
대조군Control group 정상 대조군Normal control group 12.46±4.0612.46 + - 4.06 358.30±78.45358.30 ± 78.45 114.26±26.55114.26 ± 26.55
생리통 대조군Menstrual pain control 4.05±1.00a 4.05 ± 1.00 a 173.30±23.81a 173.30 ± 23.81 a 38.22±11.84a 38.22 + - 11.84 a
비교군 Comparative group 인도메타신5 mg/kgIndomethacin 5 mg / kg 8.17±1.69ac 8.17 ± 1.69 ac 278.20±39.22ac 278.20 ± 39.22 ac 75.86±12.37ac 75.86 ± 12.37 ac
LF500 mg/kg LF 500 mg / kg 6.27±1.37ac 6.27 ± 1.37 ac 220.70±30.32ac 220.70 ± 30.32 ac 54.77±10.61ad 54.77 ± 10.61 ad
시험군 Test group BH500 mg/kgBH 500 mg / kg 8.34±1.50ac 8.34 + 1.50 ac 284.30±30.22bc 284.30 ± 30.22 bc 77.08±12.67ac 77.08 ± 12.67 ac
BH250 mg/kgBH250 mg / kg 7.43±1.71ac 7.43 ± 1.71 ac 245.10±36.75ac 245.10 ± 36.75 ac 65.82±10.47ac 65.82 ± 10.47 ac
BH125 mg/kgBH125 mg / kg 6.36±1.06ac 6.36 ± 1.06 ac 224.30±32.56ac 224.30 ± 32.56 ac 57.09±11.53ac 57.09 + - 11.53 ac
이때, 상기 표 14에 나타낸 a는 MW 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 MW 검정 결과 정상 대조군에 비하여 p<0.05임을 나타내는 것이고, c는 MW 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 MW 검정 결과 생리통 대조군에 비하여 각각 p<0.05임을 나타내는 것이다.At this time, a shown in Table 14 MW test results showed that p <0.01 compared to the normal control, and b The results of the MW test show that p <0.05 compared to the normal control group, and c shows that the MW test shows p <0.01 as compared with the control group, and d shows the MW test as p <0.05 compared with the control group.
그 결과, 상기 표 14에서 볼 수 있듯이, 생리통 대조군의 경우, 정상 대조군에 비하여 GSH 함량, SOD 활성 및 CAT 활성, 즉 항산화 활성이 현저하게 감소하며, 각각 -67.47%, -51.63% 및 -66.55% 감소함을 확인하였다.As shown in Table 14, GSH content, SOD activity, and CAT activity, i.e., antioxidative activity, were significantly decreased in the case of the menstrual pain control group compared to the normal control group, which was -67.47%, -51.63%, and -66.55% Respectively.
그러나, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 자궁의 항산화 활성이 증가함을 확인하였다. 구체적으로, 인도메타신 투여군의 경우 GSH 함량, SOD 활성 및 CAT 활성 변화량은 각각 101.68, 60.53 및 98.49% 증가함을 확인하였다. 또한, LF 투여군의 경우 GSH 함량, SOD 활성 및 CAT 활성 변화량은 각각 54.84, 27.35 및 43.31% 증가함을 확인하였다.However, in the case of 5 mg / kg of indomethacin and 500 mg / kg of LF, it was confirmed that the antioxidant activity of the uterus was increased compared to the control group. Specifically, in the indomethacin-treated group, the amounts of GSH content, SOD activity, and CAT activity were increased by 101.68, 60.53, and 98.49%, respectively. In the LF administration group, the amounts of GSH, SOD and CAT activity were increased by 54.84, 27.35 and 43.31%, respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, 생리통 대조군에 비하여 척수의 항산화 활성이 증가하며, 용량 의존적으로 항산화 활성이 증가함을 확인하였다. 구체적으로, GSH 함량, SOD 활성 및 CAT 활성은 BH 500 mg/kg 투여군의 경우 각각 105.82, 64.05 및 101.67%; BH 250 mg/kg 투여군의 경우 각각 83.32, 41.43 및 72.21%; BH 125 mg/kg 투여군의 경우 각각 57.03, 29.43 및 49.36% 증가함을 확인하였다. Especially, the antioxidant activity of spinal cord was increased and the dose - dependent antioxidative activity was also increased in the BH 500, 250 and 125 mg / kg group, compared to the control group. Specifically, GSH content, SOD activity, and CAT activity were 105.82, 64.05, and 101.67% for the 500 mg / kg BH group, respectively; 83.32, 41.43 and 72.21% for the BH 250 mg / kg administration group, respectively; And BH 125 mg / kg, respectively, which were increased by 57.03, 29.43 and 49.36%, respectively.
나아가, BH 500 mg/kg 투여군은 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군보다도 우수한 항산화 활성 증가 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군보다 우수한 항산화 활성 증가 효과를 나타냄을 확인하였다.Furthermore, the BH 500 mg / kg group showed a better antioxidant activity than the 5 mg / kg indomethacin group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group was also superior to the LF 500 mg / kg group Antioxidant activity was increased.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트의 GSH 함량, SOD 활성 및 CAT 활성, 즉 자궁의 항산화 활성을 증가시키고, 특히 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물보다 더 우수한 항산화 활성 증가 효과를 나타내므로, 생리통의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Staphylococcus aureus increases the GSH content, SOD activity and CAT activity of the rat, that is, the antioxidant activity of the uterus, and particularly the antioxidative activity increasing effect It can be used as a preventive or therapeutic agent for menstrual cramps.
실시예 4-4. 자궁 조직 내 염증성 및 전염증성 인자의 발현 감소 효과 확인Example 4-4. Decreased expression of inflammatory and proinflammatory factors in uterine tissues
에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대한 BH의 진통효과 메커니즘을 확인하기 위하여, 자궁 조직 내 염증성 및 전염증성 인자, 즉 NF-κB 및 COX-2의 mRNA 발현 감소 효과를 RT-PCR 분석을 통해 확인하였다.In order to confirm the analgesic effect mechanism of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, the effect of reducing mRNA expression of inflammatory and proinflammatory factors such as NF-κB and COX- PCR analysis.
한편, NF-κB 및 COX-2와 같은 염증성 및 전염증성 인자가 발현되면 염증반응이 촉발되어 통증이 야기된다(Liang F et al., Saudi Pharm J. 2017, 25:649-54.).On the other hand, the expression of inflammatory and proinflammatory factors such as NF-κB and COX-2 triggers an inflammatory reaction, resulting in pain (Liang F et al., Saudi Pharm J. 2017, 25: 649-54).
구체적으로, 상기 실시예 4-2에서 준비한 자궁 경부 조직의 균질액에 대하여, 상기 실시예 2-3에 따른 방법으로 RT-PCR을 수행하였고, 하기 표 15에 나타낸 바와 같은 프라이머를 사용하였다. RT-PCR 결과는 하기 표 16에 나타내었다.Specifically, the homogenate of the cervical tissues prepared in Example 4-2 was subjected to RT-PCR in the same manner as in Example 2-3, and primers as shown in Table 15 were used. RT-PCR results are shown in Table 16 below.
표적 인자Target factor 5' - 3'5 'to 3' 서열order NCBI accession No.NCBI accession No.
NF-κBNF-κB 정방향Forward GCGCATCCAGACCAACAATAA(서열번호 11)GCGCATCCAGACCAACAATAA (SEQ ID NO: 11) NM_001276711NM_001276711
역방향Reverse GCCGAAGCTGCATGGAC ACT(서열번호 12)GCCGAAGCTGCATGGAC ACT (SEQ ID NO: 12)
COX-2COX-2 정방향Forward CTGCATGTGGCTGATGTCATC(서열번호 13)CTGCATGTGGCTGATGTCATC (SEQ ID NO: 13) S67722S67722
역방향Reverse AGGACCCGTCATCTCCAG GGTAATC(서열번호 14)AGGACCCGTCATCTCCAG GGTAATC (SEQ ID NO: 14)
구분division 우측 자궁각 조직Right uterine tissue
NF-κBNF-κB COX-2COX-2
대조군Control group 정상 대조군Normal control group 1.01±0.8 1.01 ± 0.8 0.98±0.120.98 ± 0.12
생리통 대조군Menstrual pain control 4.80±1.14a 4.80 ± 1.14 a 2.62±0.46a 2.62 ± 0.46 a
비교군 Comparative group 인도메타신5 mg/kgIndomethacin 5 mg / kg 2.23±0.59ab 2.23 ± 0.59 ab 1.44±0.32ab 1.44 ± 0.32 ab
LF500 mg/kg LF 500 mg / kg 3.29±0.46ab 3.29 ± 0.46 ab 1.97±0.13ab 1.97 ± 0.13 ab
시험군 Test group BH500 mg/kgBH 500 mg / kg 2.32±0.47ab 2.32 ± 0.47 ab 1.40±0.15ab 1.40 ± 0.15 ab
BH250 mg/kgBH250 mg / kg 2.95±0.58ab 2.95 ± 0.58 ab 1.70±0.35ab 1.70 ± 0.35 ab
BH125 mg/kgBH125 mg / kg 3.28±0.41ab 3.28 ± 0.41 ab 1.95±0.21ab 1.95 ± 0.21 ab
이때, 상기 표 16에 나타낸 a는 MW 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, b는 MW 검정 결과 생리통 대조군에 비하여 각각 p<0.01임을 나타내는 것이다.At this time, a shown in Table 16 MW test results showed that p <0.01 compared to the normal control, and b The results of MW test indicate that p <0.01, respectively, compared to the control group.
그 결과, 상기 표 16에서 볼 수 있듯이, 생리통 대조군의 경우, 정상 대조군에 비하여 NF-κB 및 COX-2의 mRNA 발현양, 즉 염증성 및 전염증성 인자의 발현이 현저하게 증가하며, 이러한 증가 정도는 각각 376.64 및 166.02%임을 확인하였다.As a result, as shown in Table 16, the expression level of mRNA of NF-κB and COX-2, that is, inflammatory and proinflammatory factors, was markedly increased in the case of the periodontal control group compared to the normal control group. Were 376.64 and 166.02%, respectively.
그러나, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 상기 인자의 발현이 감소함을 확인하였다. 구체적으로, 인도메타신 투여군의 경우 NF-κB 및 COX-2의 mRNA 발현양은 각각 -53.49 및 -44.93% 감소함을 확인하였다. 또한, LF 투여군의 경우 NF-κB 및 COX-2의 mRNA 발현양은 각각 -31.37 및 -24.55% 감소함을 확인하였다.However, in the case of the indomethacin 5 mg / kg administration group and the LF 500 mg / kg administration group, the expression of the factor was decreased as compared with the control group. Specifically, in the indomethacin-treated group, the amounts of mRNA expression of NF-κB and COX-2 were decreased by -53.49 and -44.93%, respectively. In addition, the amount of mRNA expression of NF-κB and COX-2 in the LF-treated group was decreased by -31.37 and -24.55%, respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, 생리통 대조군에 비하여 자궁 내 상기 인자의 발현이 감소함을 확인하였다. 구체적으로, NF-κB 및 COX-2의 mRNA 발현양은 BH 500 mg/kg 투여군의 경우 각각 -51.57 및 -46.35%; BH 250 mg/kg 투여군의 경우 각각 -38.58 및 -34.91%; BH 125 mg/kg 투여군의 경우 각각 -31.51 및 -25.62% 감소함을 확인하였다. In particular, it was confirmed that the expression of the above-mentioned factors in the uterus was decreased in the BH 500, 250 and 125 mg / kg administration group as compared to the control group. Specifically, the expression levels of NF-κB and COX-2 mRNA were -51.57 and -46.35%, respectively, in the 500 mg / kg BH group; -38.58 and -34.91% for BH 250 mg / kg treated group, respectively; And -31.51 and -25.62%, respectively, for the 125 mg / kg BH group.
나아가, BH 500 mg/kg 투여군은 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 더 우수한 상기 활성화 인자의 발현 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군과 유사하거나 더 우수한 발현 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg administration group exhibited a similar or better effect of the activation factor than the 5 mg / kg indomethacin group and the LF 500 mg / kg administration group, and the low dose BH 125 mg / mg / kg administration group, respectively.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트 자궁 내의 NF-κB 및 COX-2의 mRNA 발현양, 즉 염증성 및 전염증성 인자의 발현을 감소시키고, 특히 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물과 유사하거나 더 우수한 염증성 및 전염증성 인자의 발현 감소 효과를 나타내므로, 통증의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Isabella japonica reduces the expression levels of mRNA of NF-κB and COX-2 in the rat uterus, that is, the expression of inflammatory and proinflammatory factors, And exhibit the effect of reducing the expression of inflammatory and proinflammatory factors similar or superior to those of the prophylactic and therapeutic agents of the present invention.
실시예 4-5. 자궁 조직 내 염증 감소 효과 확인Example 4-5. Identification of inflammation reduction in uterine tissues
실시예 4-5-1. 조직병리학적 변화 확인Example 4-5-1. Identify histopathological changes
에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대한 BH의 진통효과 메커니즘을 확인하기 위하여, 자궁 조직 내 염증 감소 효과를 조직병리학적인 방법을 통해 확인하였다.To confirm the mechanism of analgesic effect of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, the effect of reducing inflammation in uterine tissues was confirmed by histopathological methods.
구체적으로, 우측 자궁각을 잘라내어 10% 포르말린으로 고정하였고, 파라핀에 끼운 후 3 내지 4 μm의 절편을 만든 뒤 헤마톡실린(Hematoxylin)과 에오신(eosin)으로 HE 염색하였다. 이후, 광학 현미경(Model 80i, Nikon, Tokyo, Japan)으로 각 샘플의 조직 병리학적 형태를 관찰하였다. 자궁각의 전체 두께(㎛) 및 점막 두께(㎛), 점막에 침투한 염증 세포의 수(세포 / 점막 mm2) 등은 컴퓨터 기반의 자동 이미지 분석기(iSolution FL ver 9.1, IMT i-solution Inc., Vancouver, Quebec, Canada)를 사용하여 계산하였고, 그 결과를 하기 표 17에 나타내었다.Specifically, the right uterine corpuscle was cut and fixed with 10% formalin, inserted into paraffin, cut into 3-4 μm sections, and HE stained with hematoxylin and eosin. Histopathological morphology of each sample was then observed with an optical microscope (Model 80i, Nikon, Tokyo, Japan). The total thickness (㎛) and mucosal thickness (㎛) of uterine cornea and the number of inflammatory cells (cell / mucous membrane 2 ) penetrating into the mucosa were measured using a computer-based automatic image analyzer ( i Solution FL ver 9.1, IMT i -solution Inc ., Vancouver, Quebec, Canada), and the results are shown in Table 17 below.
구분division 우측 자궁각 조직Right uterine tissue
전체 두께(㎛)Total thickness (탆) 점막 두께(㎛)Mucosal thickness (㎛) 염증성 세포(세포 / 점막 mm2)Inflammatory cells (cells / mucosa mm 2 )
대조군Control group 정상 대조군Normal control group 1886.71±161.551886.71 + - 161.55 725.96±87.72725.96 + - 87.72 106.60±32.95 106.60 ± 32.95
생리통 대조군Menstrual pain control 3431.51±361.77d 3431.51 ± 361.77 d 1282.09±232.17a 1282.09 ± 232.17 a 809.80±146.76d 809.80 ± 146.76 d
비교군 Comparative group 인도메타신5 mg/kgIndomethacin 5 mg / kg 2520.51±157.31de 2520.51 ± 157.31 de 838.81±76.38bc 838.81 + - 76.38 bc 188.00±26.80de 188.00 ± 26.80 de
LF500 mg/kg LF 500 mg / kg 2998.11±113.41de 2998.11 ± 113.41 de 1043.52±102.81ac 1043.52 ± 102.81 ac 466.60±136.51de 466.60 ± 136.51 de
시험군 Test group BH500 mg/kgBH 500 mg / kg 2576.26±225.41de 2576.26 ± 225.41 de 837.89±74.33bc 837.89 ± 74.33 bc 189.10±42.62de 189.10 ± 42.62 de
BH250 mg/kgBH250 mg / kg 2846.03±152.91de 2846.03 ± 152.91 de 985.32±104.57ac 985.32 ± 104.57 ac 259.10±66.57de 259.10 ± 66.57 de
BH125 mg/kgBH125 mg / kg 2942.25±122.80de 2942.25 ± 122.80 de 1029.56±105.21ac 1029.56 ± 105.21 ac 448.20±93.30de 448.20 ± 93.30 de
이때, 상기 표 17에 나타낸 a 및 b는 LSD 검정 결과 정상 대조군에 비하여 각각 p<0.01 및 p<0.05임을 나타내는 것이고, c는 LSD 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 MW 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, e는 MW 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time, a and b shown in Table 17 indicate that p <0.01 and p <0.05, respectively, as compared with the normal control group, and c indicates Will result indicating that the LSD test p <0.01 compared with the control group cramps, d will result indicating that the MW black p <0.01 compared with the control group, e is indicating that the test result MW p <0.01 compared with the control group cramps.
그 결과, 상기 표 17 및 도 8에서 볼 수 있듯이, 생리통 대조군의 경우, 정상 대조군에 비하여 자궁각 점막 내 염증세포의 침윤 및 이와 관련된 염증성 부종이 현저하게 증가함을 확인하였다. 구체적으로, 생리통 대조군의 경우, 정상 대조군에 비하여 자궁각 전체 두께, 자궁각 점막 두께 및 상기 자궁각 점막에 침윤한 염증세포의 수의 변화 정도는 각각 81.88, 76.61 및 659.66% 증가함을 확인하였다.As a result, as shown in Table 17 and FIG. 8, it was confirmed that infiltration of inflammatory cells in the uterine mucosa and inflammatory edema associated with the uterine mucosa were significantly increased in the case of the control group, compared with the normal control group. Specifically, in the case of the periodontal control group, it was confirmed that the total thickness of the uterus, the thickness of uterine mucosa, and the number of inflammatory cells infiltrated into the uterine mucosa were increased by 81.88, 76.61 and 659.66%, respectively, as compared with the normal control group.
그러나, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 염증의 정도가 감소함을 확인하였다. 구체적으로, 인도메타신 투여군의 경우 자궁각 전체 두께, 자궁각 점막 두께 및 상기 점막에 침윤한 염증세포의 수의 변화 정도는 각각 -26.55, -34.57 및 -76.78% 감소함을 확인하였다. 또한, LF 투여군의 경우 각각 -12.63, -18.61 및 -42.38% 감소함을 확인하였다.However, in the 5 mg / kg group of indomethacin and 500 mg / kg of LF group, the degree of inflammation was decreased compared to the control group. Specifically, in the case of the indomethacin-treated group, it was confirmed that the total thickness of the uterus, the thickness of uterine mucosa, and the number of inflammatory cells infiltrating into the mucosa were decreased by -26.55, -34.57 and -76.78%, respectively. In the LF administration group, it was also found to decrease by -12.63, -18.61 and -42.38%, respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, 생리통 대조군에 비하여 염증의 정도가 감소하며, 용량 의존적으로 염증 정도가 감소함을 확인하였다. 구체적으로, 자궁각 전체 두께, 자궁각 점막 두께 및 상기 점막에 침윤한 염증세포의 수의 변화 정도는 BH 500 mg/kg 투여군의 경우 각각 -24.92, -34.65 및 -76.65%; BH 250 mg/kg 투여군의 경우 각각 -17.06, -23.15 및 -68.00%; BH 125 mg/kg 투여군의 경우 각각 -14.26, -19.70 및 -44.65% 감소함을 확인하였다. In particular, even in the BH 500, 250 and 125 mg / kg administration groups, the degree of inflammation was decreased and the dose of inflammation was decreased dose-dependently compared to the control group. Specifically, the changes in uterine total thickness, uterine mucosal thickness, and number of inflammatory cells infiltrated into the mucosa were -24.92, -34.65, and -76.65%, respectively, in the BH 500 mg / kg group; -17.06, -23.15 and -68.00%, respectively, for the BH 250 mg / kg administration group; And -14.26, -19.70 and -44.65%, respectively, for the 125 mg / kg BH group.
나아가, BH 500 mg/kg 투여군은 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군보다도 우수한 염증 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군보다 우수한 염증 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg group showed a better inflammation reduction effect than the 5 mg / kg indomethacin group and the LF 500 mg / kg group, and the low dose BH 125 mg / And it is confirmed that it shows a reduction effect.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트 자궁의 염증 정도를 감소시키고, 특히 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물보다 더 우수한 염증 감소 효과를 나타내므로, 생리통의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been found that the extract of Staphylococcus aureus decreases the degree of inflammation of the rat uterus and exhibits a more excellent inflammation-reducing effect than the indomethacin or gingkofumara extract, which is particularly well known as an analgesic agent. It can be seen that
실시예 4-5-2. 면역조직화학적 변화 확인Example 4-5-2. Identification of immunohistochemical changes
에스트라디올 벤조에이트 및 옥시토신에 의해 생리통이 유발된 랫트에 대한 BH의 진통효과 메커니즘을 확인하기 위하여, 자궁 조직 내 염증 감소 효과를 면역조직화학적인 방법을 통해 확인하였다.In order to confirm the analgesic effect mechanism of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, the effect of reducing inflammation in uterine tissues was confirmed by immunohistochemistry.
구체적으로, 우측 자궁각 점막 내에 존재하는, 전염증성 사이토카인인 TNF-α 및 iNOS에 대한 반응성 염증세포는 ABC 및 퍼옥시다제(peroxidase) 기질 키트(Vector Labs, Burlingame, CA, USA)로 정제된 1차 항체를 사용하여 확인하였다. TNF-α 및 iNOS가 표지된 세포의 수(세포 / 점막 mm2)는 컴퓨터 기반의 자동 이미지 분석기를 사용하여 계산하였고, 그 결과를 하기 표 18에 나타내었다. 이때, TNF-α 및 iNOS 각각에 대한 반응성, 즉 밀도를 20% 이상 차지하는 세포를 반응성(양성) 세포로 간주하였다.Specifically, reactive inflammatory cells for proinflammatory cytokines TNF-a and iNOS present in the right uterine mucosa were purified with ABC and peroxidase substrate kit (Vector Labs, Burlingame, Calif., USA) Primary antibodies were used to confirm. The number of cells labeled with TNF-α and iNOS (cell / mucosal mm 2 ) was calculated using a computer-based automatic image analyzer and the results are shown in Table 18 below. At this time, the cells that occupied more than 20% of the reactivity, that is, the density, of TNF-α and iNOS were regarded as reactive (positive) cells.
구분division 우측 자궁각 조직Right uterine tissue
TNF-α 양성 세포(세포 / 점막 mm2)TNF-α positive cells (cell / mucosal mm 2 ) iNOS 양성 세포(세포 / 점막 mm2)iNOS-positive cells (cells / mucosa mm 2 )
대조군Control group 정상 대조군Normal control group 22.40±12.2922.40 ± 12.29 20.00±10.3720.00 ± 10.37
생리통 대조군Menstrual pain control 446.80±101.78d 446.80 ± 101.78 d 520.60±142.31d 520.60 ± 142.31 d
비교군 Comparative group 인도메타신5 mg/kgIndomethacin 5 mg / kg 80.40±21.88de 80.40 ± 21.88 de 109.00±26.34de 109.00 ± 26.34 de
LF500 mg/kg LF 500 mg / kg 287.30±74.25de 287.30 ± 74.25 de 306.00±90.71de 306.00 ± 90.71 de
시험군 Test group BH500 mg/kgBH 500 mg / kg 91.10±14.30de 91.10 ± 14.30 de 120.50±44.52de 120.50 ± 44.52 de
BH250 mg/kgBH250 mg / kg 145.10±49.68de 145.10 ± 49.68 de 185.60±76.37de 185.60 ± 76.37 de
BH125 mg/kgBH125 mg / kg 274.20±51.70de 274.20 ± 51.70 de 296.20±71.11de 296.20 ± 71.11 de
이때, 상기 표 18에 나타낸 a 및 b는 LSD 검정 결과 정상 대조군에 비하여 각각 p<0.01 및 p<0.05임을 나타내는 것이고, c는 LSD 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이고, d는 MW 검정 결과 정상 대조군에 비하여 p<0.01임을 나타내는 것이고, e는 MW 검정 결과 생리통 대조군에 비하여 p<0.01임을 나타내는 것이다.At this time, a and b shown in Table 18 indicate that p <0.01 and p <0.05, respectively, as compared with the normal control group, and c indicates Will result indicating that the LSD test p <0.01 compared with the control group cramps, d will result indicating that the MW black p <0.01 compared with the control group, e is indicating that the test result MW p <0.01 compared with the control group cramps.
그 결과, 상기 표 18 및 도 9에서 볼 수 있듯이, 생리통 대조군의 경우, 정상 대조군에 비하여 TNF-α 및 iNOS 면역반응세포의 수가 현저하게 증가함을 확인하였다. 구체적으로, 생리통 대조군의 경우, 정상 대조군에 비하여 자궁각 점막에 침윤한 TNF-α 및 iNOS 면역반응세포의 수의 변화 정도는 각각 1894.64 및 2503.00%증가함을 확인하였다.As a result, as shown in Table 18 and FIG. 9, it was confirmed that the numbers of TNF-α and iNOS immunoreactive cells were significantly increased in the periodontal control group compared to the normal control group. Specifically, the number of TNF-α and iNOS-immunoreactive cells infiltrated into uterine mucosa increased 1894.64 and 2503.00%, respectively, in the case of the control group, compared with the control group.
그러나, 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군의 경우, 생리통 대조군에 비하여 TNF-α 및 iNOS 면역반응세포의 수가 감소함을 확인하였다. 구체적으로, 인도메타신 투여군의 경우 TNF-α 및 iNOS 면역반응세포의 수의 변화 정도는 각각 -82.01 및 -79.06% 감소함을 확인하였다. 또한, LF 투여군의 경우 각각 -35.70 및 -41.22% 감소함을 확인하였다.However, the numbers of TNF-α and iNOS-immunoreactive cells were decreased in the 5 mg / kg indomethacin group and the 500 mg / kg LF group compared to the control group. Specifically, in the indomethacin-treated group, the changes in the numbers of TNF-α and iNOS-immunoreactive cells were -82.01 and -79.06%, respectively. In the LF-treated group, it was found that the decrease was -35.70 and -41.22%, respectively.
특히, BH 500, 250 및 125 mg/kg 투여군의 경우에도, 생리통 대조군에 비하여 TNF-α 및 iNOS 면역반응세포의 수가 감소하며, 용량 의존적으로 면역반응세포의 수가 감소함을 확인하였다. 구체적으로, TNF-α 및 iNOS 면역반응세포의 수의 변화 정도는 BH 500 mg/kg 투여군의 경우 각각 -79.61 및 -76.85%; BH 250 mg/kg 투여군의 경우 각각 -67.52 및 -64.35%; BH 125 mg/kg 투여군의 경우 각각 -38.63 및 -43.10% 감소함을 확인하였다. In particular, the numbers of TNF-α and iNOS-immunoreactive cells were decreased in the BH 500, 250, and 125 mg / kg groups compared to the control group, and the number of immune response cells was decreased in a dose-dependent manner. Specifically, the degree of changes in the number of TNF-α and iNOS-immunoreactive cells was -79.61 and -76.85%, respectively, in the group administered with BH 500 mg / kg; -67.52 and -64.35% for the BH 250 mg / kg administration group, respectively; And -38.63 and -43.10%, respectively, for the 125 mg / kg BH group.
나아가, BH 500 mg/kg 투여군은 인도메타신 5 mg/kg 투여군 및 LF 500 mg/kg 투여군과 유사하거나 우수한 면역반응세포의 수 감소 효과를 나타내며, 저용량인 BH 125 mg/kg 투여군도 LF 500 mg/kg 투여군보다 우수한 면역반응세포의 수 감소 효과를 나타냄을 확인하였다.In addition, the BH 500 mg / kg group showed a similar effect to that of the indomethacin 5 mg / kg group and the LF 500 mg / kg group. In the low dose BH 125 mg / kg group, LF 500 mg / kg of the control group.
상기 결과를 통해, 댕댕이나무 열매 추출물은 랫트 자궁 점막 내 존재하는 면역반응세포의 수, 즉 염증 정도를 감소시키고, 특히 진통제로서의 효과가 잘 알려진 인도메타신 또는 금은화 추출물보다 더 우수한 염증 감소 효과를 나타내므로, 생리통의 예방 또는 치료 물질로서 유용하게 사용될 수 있음을 알 수 있었다.From the above results, it has been shown that the extract of Staphylococcus aureus decreases the number of immunoreactive cells present in the rat uterine mucosa, that is, the degree of inflammation, and exhibits a more excellent inflammation-reducing effect than the indomethacin or gingkofumara extract, Therefore, it can be used as a preventive or therapeutic agent for menstrual cramps.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present application is to be interpreted as being within the scope of the present application, all changes or modifications derived from the meaning and scope of the appended claims and from their equivalents rather than the detailed description.

Claims (10)

  1. 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 치료용 약학 조성물.A pharmaceutical composition for the prevention or treatment of pain, comprising a farina tree extract or a fraction thereof.
  2. 제1항에 있어서, 상기 댕댕이나무는 댕댕이나무의 열매인 것인, 조성물.2. The composition of claim 1, wherein the buttock tree is a fruit of the jungle tree.
  3. 제1항 또는 제2항에 있어서, 상기 추출물은 댕댕이나무를 물, 탄소수 1 내지 4의 알코올 및 이들의 혼합 용매로 이루어진 군에서 선택된 1종 이상의 용매로 추출하여 제조되는 것인, 조성물.3. The composition according to claim 1 or 2, wherein the extract is prepared by extracting the buttock tree with at least one solvent selected from the group consisting of water, an alcohol having 1 to 4 carbon atoms, and a mixed solvent thereof.
  4. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 분획물은 댕댕이나무 추출물을 물, 탄소수 1 내지 4의 알코올, 헥산(Hexane), 에틸 아세테이트(Ethyl acetate) 및 이들의 혼합용매로 구성되는 군으로부터 선택되는 용매로 분획하여 제조되는 것인, 조성물.4. The method according to any one of claims 1 to 3, wherein the fraction is selected from the group consisting of water, an alcohol having 1 to 4 carbon atoms, hexane, ethyl acetate and a mixed solvent thereof , &Lt; / RTI &gt; and mixtures thereof.
  5. 제1항 내지 제4항 중 어느 한 항에 있어서, 상기 통증은 상기 통증은 통각수용성 통증(nociceptive pain), 심인성 통증(psychogenic pain), 염증성 통증(inflammatory pain) 및 신경병성 통증(neuropathic pain)으로 이루어진 군에서 선택되는 하나 이상인 것인, 조성물.The method of any one of claims 1 to 4, wherein the pain is selected from the group consisting of nociceptive pain, psychogenic pain, inflammatory pain, and neuropathic pain. Lt; RTI ID = 0.0 &gt; of: &lt; / RTI &gt;
  6. 제5항에 있어서, 상기 통증은 암성 통증(cancer pain), 수술 후 통증(postoperative pain), 삼차 신경통(trigeminal neuralgia pain), 특발성 통증(idiopathic pain), 당뇨성 신경병성 통증(diabetic neuropathic pain) 편두통 및 생리통으로 이루어진 군에서 선택되는 하나 이상인 것인, 조성물6. The method of claim 5, wherein the pain is selected from the group consisting of cancer pain, postoperative pain, trigeminal neuralgia pain, idiopathic pain, diabetic neuropathic pain, And menstrual pain, wherein the composition is at least one selected from the group consisting of
  7. 제1항 내지 제6항 중 어느 한 항에 있어서, 상기 조성물은 상기 댕댕이나무 추출물 또는 이의 분획물을 총 조성물의 중량 대비 0.001 내지 80 중량%로 포함하는 것인, 조성물.7. The composition according to any one of claims 1 to 6, wherein the composition comprises 0.001 to 80% by weight of the royal jellyfish extract or fraction thereof, relative to the weight of the total composition.
  8. 제1항 내지 제7항 중 어느 한 항의 조성물을 통증이 유발되거나 유발이 의심되는 개체에 투여하는 단계를 포함하는, 통증의 치료 방법.8. A method of treating pain, comprising the step of administering the composition of any one of claims 1 to 7 to a subject suspected of having or causing pain.
  9. 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 개선용 식품 조성물.A food composition for preventing or ameliorating pain comprising a farina tree extract or a fraction thereof.
  10. 댕댕이나무 추출물 또는 이의 분획물을 포함하는 통증의 예방 또는 개선용 의약외품 조성물.A quasi-drug composition for prevention or improvement of pain, comprising a farina tree extract or a fraction thereof.
PCT/KR2018/009517 2017-08-21 2018-08-20 Composition comprising extract of lonicera coerulea for prevention or treatment of pain WO2019039810A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170105478A KR102020371B1 (en) 2017-08-21 2017-08-21 Compositions for preventing or treating pain comprising extracts of Lonicera caerulea
KR10-2017-0105478 2017-08-21

Publications (1)

Publication Number Publication Date
WO2019039810A1 true WO2019039810A1 (en) 2019-02-28

Family

ID=65440114

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/009517 WO2019039810A1 (en) 2017-08-21 2018-08-20 Composition comprising extract of lonicera coerulea for prevention or treatment of pain

Country Status (2)

Country Link
KR (1) KR102020371B1 (en)
WO (1) WO2019039810A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220039197A (en) 2020-09-22 2022-03-29 강원대학교산학협력단 Composition for preventing or treating sepsis and pain comprising extracts of Dracocephalum moldavica

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013116889A (en) * 2011-10-31 2013-06-13 Kowa Co Boi containing composition
KR20150032511A (en) * 2014-11-19 2015-03-26 (주)제주사랑농수산 Antioxidant Composition Anti-inflammatory Composition Using an Extract of Cocculus trilobus
KR20150033504A (en) * 2013-09-24 2015-04-01 주식회사 에이치앤케이바이오사이언스 Pharmaceutical composition for preventing or treating thyroid diseases comprising extract from Lonicera caerulea L. car. edulis fruits

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013116889A (en) * 2011-10-31 2013-06-13 Kowa Co Boi containing composition
KR20150033504A (en) * 2013-09-24 2015-04-01 주식회사 에이치앤케이바이오사이언스 Pharmaceutical composition for preventing or treating thyroid diseases comprising extract from Lonicera caerulea L. car. edulis fruits
KR20150032511A (en) * 2014-11-19 2015-03-26 (주)제주사랑농수산 Antioxidant Composition Anti-inflammatory Composition Using an Extract of Cocculus trilobus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KIM, JEONG HWA ET AL.: "Anti-inflammatory Activity of the Fruits of Blue Honeysuckle", YAKHAK HOEJI, vol. 60, no. 5, 2016, pages 235 - 242 *
RYU, K. H. ET AL.: "Anti-Inflammatory and Analgesic Activities of SKLJI, a Highly Purified and Injectable Herbal Extract of Lonicera Japonica", BIOSCIENCE, BIOTECHNOLOGY, AND BIOCHEMISTRY, vol. 74, no. 10, 2010, pages 2022 - 2028, XP055224458 *

Also Published As

Publication number Publication date
KR20190020469A (en) 2019-03-04
KR102020371B1 (en) 2019-09-11

Similar Documents

Publication Publication Date Title
WO2017095138A1 (en) Curcumin-containing lipid nanoparticle complex comprising ginsenosides
WO2012124888A2 (en) Composition comprising the extract of herbal combination for preventing or treating diabetic peripheral neuropathy
WO2010087577A2 (en) Use of thymus capitatus extract, satureja hortensis extract, or carvacrol for treating metabolic diseases
WO2015111832A1 (en) Composition for preventing or treating prostate-related diseases, containing poncirus trifoliate extract
WO2018070707A1 (en) Composition for preventing or treating muscle disease comprising decanal or pharmaceutically acceptable salt thereof as active ingredient
WO2019039810A1 (en) Composition comprising extract of lonicera coerulea for prevention or treatment of pain
WO2015160226A1 (en) Female menopause alleviation use of composition containing composite extract of red clover and pomegranate as active ingredient
WO2020085826A1 (en) Composition for alleviation of skin irritation induced by environmental pollution factors or for skin protection, containing nutmeg extract or macelignan as active ingredient
WO2017183924A1 (en) Composition for preventing or treating dry eye syndrome comprising maple leaf extract
WO2019059634A1 (en) Skin whitening composition comprising d-tyrosine or peptide comprising same
WO2017146486A1 (en) Composition for preventing or treating benign prostatic hyperplasia, containing morus alba linne extract
WO2012081831A2 (en) Composition comprising the extract of loranthus yadoriki sieb having monoamine oxidase-inhibiting activity
WO2010041908A2 (en) Novel use of panduratin derivative or boesenbergia pandurata extract
WO2020145619A1 (en) Composition for allergy prevention, atopic dermatitis alleviation or skin regeneration, containing, as active ingredient, undecane or undecanal
WO2019017677A9 (en) Composition comprising citral as effective ingredient for exhibiting effect of muscle strengthening, muscle enhancement, muscle differentiation, muscle regeneration, or sarcopenia suppression
WO2015046743A1 (en) Pharmaceutical composition for preventing or treating thyroid diseases, containing lonicera caerulea l. var. edulis fruit extract as active ingredient
WO2021002642A1 (en) Composition for preventing or treating rheumatoid arthritis, comprising snake venom
WO2020130478A1 (en) Anti-allergy, atopic dermatitis alleviation or skin regeneration composition containing jasmone as active ingredient
WO2019139365A1 (en) Novel phenylsulfonyl oxazole derivative and use thereof
WO2022092461A1 (en) Pharmaceutical composition for preventing or treating obesity or diabetes, and preparation method therefor
WO2019172566A1 (en) Anti-stress agent, anti-depressant or anti-anxiety agent composition containing ionone as active ingredient
WO2014126269A1 (en) Pharmaceutical composition for improving male sexual function and for treating infertility
WO2021029659A1 (en) Composition for preventing or treating allergic diseases or atopic dermatitis comprising ethyl vanillin, suberic acid, thiazole or salt thereof as effective component
WO2015199516A1 (en) Composition for improving muscular function or enhancing exercise performance, containing kirenol or hui chum extract
WO2021034082A1 (en) Composition for preventing or treating allergic diseases or atopic dermatitis, comprising ocimene, camphor, or salt thereof as active ingredient

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18847650

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18847650

Country of ref document: EP

Kind code of ref document: A1