KR102020371B1 - Compositions for preventing or treating pain comprising extracts of Lonicera caerulea - Google Patents

Abstract

The present invention relates to a composition for the prevention or treatment of pain, including the extract from the tree, specifically, the pharmaceutical composition, food composition, quasi-drug composition, and method for treating pain, including the extract from the tree It is about.
Taraxacum extract according to the present invention exhibits analgesic effects such as inhibiting weight loss, cold allodynia and mechanical allodynia, menstrual pain, etc., can be usefully used for the prevention, improvement or treatment of analgesic.

Description

Composition for the prevention or treatment of pain comprising the extracts of the wormwood {Compositions for preventing or treating pain comprising extracts of Lonicera caerulea}

The present invention relates to a composition for the prevention or treatment of pain, including the extract from the tree, specifically, the pharmaceutical composition, food composition, quasi-drug composition, and method for treating pain, including the extract from the tree It is about.

Pain can be caused by a variety of causes, and if the pain persists for a long time or its irritation is too severe, it can interfere with daily life and cause anxiety and fear. Because of this, people with chronic pain often have depression. In particular, 7-8% of the population is known to suffer from neuropathic pain caused by injury or disease, and the prevalence of primary dysmenorrhea, or menstrual cramps, is 45- As it is known to approach 95%, the development of materials and methods for treating them is urgent.

At present, pain treatments of acetylsalicylic acid, ibuprofen, acetaminophen and indomethacin are widely used in the treatment of pain. However, the analgesics are effective when administered in high doses, and even if initially effective, the resistance to long-term use is often lost. In addition, side effects such as gastrointestinal bleeding, gastrointestinal disorders, liver damage, and the like may be caused.

In addition to the analgesics described above, amitriptyline has been widely used as an analgesic and antidepressant in chronic pain patients, and is known to exhibit relatively strong anti-inflammatory and antioxidant effects. However, it has been reported that it may cause serious cardiotoxicity (Goodnick PJ, Expert Opin Pharmacother. 2002, 3: 479-98 .; Thanacoody HK, Toxicol Rev. 2005, 24: 205-14.), Safety without side effects In addition, there is an urgent need for the development of a new analgesic with excellent analgesic effect even at low doses.

Accordingly, in order to minimize side effects, therapeutic agents using natural materials have been developed, and for example, painkillers including gold and silver coins have been developed (Korean Patent Publication No. 10-0554079). Lonicera japonica Thunb. Is excellent in body heat regulation, antipyretic, detoxification and anti-inflammatory effects, in particular, it is well known that it has an analgesic and analgesic effect. Buds of gold or silver flowers or flowers that have just started to bloom are widely used for the prescription of traditional Chinese medicine.

On the other hand, Lonicera caerulea var. edulis L.) is native to Korea, China, and Japan, and its fruit has been used as a traditional herb. The fruit of the tree is rich in ascorbic acid and phenolic compounds such as anthocyanins and flavonoids, which are excellent in antioxidant effects, and have excellent effects on improving lipid and sugar metabolism, protecting liver, anti-inflammatory effect, and promoting wound healing. Known. However, its analgesic effect is unknown.

Under these backgrounds, the present inventors have diligently researched to develop natural substances that can alleviate or improve pain, and as a result, they have confirmed that the olecus extract exhibits excellent analgesic effects, thereby completing the present invention.

One object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of pain, including the Daengyi extract or fractions thereof.

Another object of the present invention is to provide a method for treating pain, comprising administering the pharmaceutical composition to a subject causing or suspected of causing the pain.

Still another object of the present invention is to provide a food composition for preventing or ameliorating pain, including a powdered bark extract or a fraction thereof.

Another object of the present invention is to provide a quasi-drug composition for the prevention or improvement of pain, including the Daengyi extract or fractions thereof.

In order to achieve the above object, one embodiment of the present invention provides a pharmaceutical composition for the prevention or treatment of pain, including the oleander extract or fractions thereof.

The present inventors have confirmed that the Dainberry fruit extract reduces weight loss, cold / mechanical allodynia and abdominal pain by alleviating the pain of the rats induced pain, the pain relief effect is inhibition of peroxidation, microglia / glial cell activation As a result of inhibiting the expression of the factor, inhibiting the expression of proinflammatory cytokines, promoting antioxidant activity, and inhibiting inflammation, it was confirmed that the powder of the wood was useful for the prevention, improvement or treatment of pain.

As used herein, the term "cattle" refers to Lonicera. caerulea var. means a deciduous broad-leaved shrub and edulis, honeysuckle having a scientific name of L. and more Blueberry (var. emphyllocalyx), broad leaf daengdaengyi (var. longibracteata), round leaves daengdaengyi include various sub-species, called the like (var. venulosa) However, it is not limited thereto. The fruit of the tree is an oval berry and ripens in autumn and is eaten raw. Although it is known that the fruit of the dagger is effective in dementia, wrinkle improvement, whitening, etc., the therapeutic effect on pain has not been found and was first identified by the present inventors.

In the present invention, the roots, stems, leaves, berries, flowers, etc. of the dagger may be used for the prevention or treatment of pain, more specifically, the fruit may be used, as long as it has the effect of preventing or treating pain, in particular It is not limited.

The wood is purchased commercially, or may be used collected or cultivated in nature.

The term "extract" of the present invention refers to an extract obtained by extracting and processing the oleander tree, a diluent or concentrate of the extract, a dried product obtained by drying the extract, a crude or purified product of the extract, or a mixture thereof. Extracts of all formulations that can be formed using itself and extracts.

The method of extracting the wood is not particularly limited and may be extracted according to a method commonly used in the art. Non-limiting examples of the extraction method, hot water extraction method, ultrasonic extraction method, filtration method, reflux extraction method, and the like, these may be performed alone or in combination of two or more methods.

In the present invention, the kind of the extraction solvent used to extract the wood is not particularly limited, and any solvent known in the art may be used. Non-limiting examples of the extraction solvent may include water, alcohols having 1 to 4 carbon atoms or mixed solvents thereof, and these may be used alone or in combination of one or more thereof.

As used herein, the term "fraction" refers to the result obtained by performing fractionation to separate a specific component or a specific group of components from a mixture comprising several various components.

In the present invention, the fractionation method for obtaining the fraction is not particularly limited, and may be performed according to a method commonly used in the art. Non-limiting examples of the fractionation method include a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed through an ultrafiltration membrane having a constant molecular weight cut-off value, and various chromatography (size, charge, hydrophobicity). Or chromatographed fractions), and combinations thereof, which are prepared for separation according to affinity. Specifically, a method of obtaining a fraction from the extract by treating a predetermined solvent with an extract obtained by extracting the wood of the present invention.

The kind of the fractionation solvent used to obtain the fraction in the present invention is not particularly limited, and any solvent known in the art may be used. Non-limiting examples of the fractionation solvents include polar solvents such as water and alcohols having 1 to 4 carbon atoms; Nonpolar solvents such as hexane and ethyl acetate; Or a mixed solvent thereof. These may be used alone or in combination of one or more, but are not limited thereto.

In addition, the extract or fraction may be prepared and used in the form of a dry powder after extraction, but is not limited thereto.

As used herein, the term "pain" refers to an unpleasant sensation caused by stimulation of a particular nerve with a pain receptor, and all symptoms in which the sensation is alleviated, prevented or treated by the extract of the present invention Include. In general, depending on the pain area, such as headache, chest pain, abdominal pain, low back pain, etc., depending on the occurrence of somatic pain (somatic pain), visceral pain (visceral pain), neuropathic pain (neuropathic pain) is divided into.

Specifically, the pain may include anatomically distinct pain, specifically, neck pain, back pain, back pain, chest pain, head pain, and the like.

In addition, the pain may include nociceptive pain caused by cellular damage, psychogenic pain caused by psychological conditions, inflammatory pain associated with tissue damage and infiltration of immune cells, damage to the nervous system. Or neuropathic pain caused by its abnormal function. At this time, the pain-induced pain may include somatic pain and visceral pain.

More specifically, the pain may be one or more selected from the group consisting of nociceptive pain, psychogenic pain, inflammatory pain, and neuropathic pain, and most specifically, cancer pain in which complex nociceptive pain, inflammatory pain, etc. act in combination. cancer pain and postoperative pain; Trigeminal neuralgia pain, idiopathic pain and diabetic neuropathic pain corresponding to neuropathic pain; And it may be one or more selected from the group consisting of migraine and menstrual pain corresponding to visceral pain, but is not limited thereto.

As used herein, the term "prevention" refers to any act of inhibiting or delaying pain by administration of a composition comprising the above-mentioned Rocha extract or its fractions.

As used herein, the term "treatment" refers to any action in which pain is alleviated or ameliorated or beneficially altered by administration of a composition comprising the above-mentioned Rotin extract.

Such a composition of the present invention can also treat or prevent secondary symptoms such as appetite suppression and weight gain caused by pain.

In a specific embodiment of the present invention, the Taraxacum fruit extract has an analgesic effect such as suppressing weight loss, suppressing cold allodynia and mechanical allodynia to rats induced by pain by a CCI (Chronic constriction injury) operation ( 4, and Tables 3 to 5), the analgesic effect is due to the reduction of spinal cord lipid peroxidation, increase the antioxidant activity of the spinal cord, decrease the expression of microglia / astroglia activating factor in spinal cord tissue and decrease the expression of proinflammatory cytokines Was achieved (Tables 6, 7, 9 and 11). In addition, rats induced with menstrual cramps by estradiol benzoate and oxytocin show weight loss inhibition and abdominal analgesic effects (Table 12 and FIG. 5), and the analgesic effect is uterine hyperemia and edema inhibition, lipid peroxidation in uterine tissues. It was confirmed that the reduction was achieved by increasing the antioxidative activity of the uterus, decreasing the expression of inflammatory / pro-inflammatory factors in the uterine tissue and reducing the inflammation (Figs. 6 to 9, Tables 13 and 14, and Tables 16 to 18).

This suggests that the Taraxacum extract or a fraction thereof exhibits a therapeutic effect of pain caused by various causes, and exhibits effects such as suppressing / reducing / relaxing / improving pain, and thus, the pharmaceutical composition of the present invention comprising them. It is suggested that the composition can be usefully used for the prevention or treatment of pain. Moreover, this effect is higher or similar to the existing drugs amitriphthyline, indomethacin or goldfin extract, offering the potential as a safe natural therapeutic agent.

The pharmaceutical composition of the present invention may comprise 0.001 to 80, specifically 0.001 to 70, more specifically 0.001 to 60% by weight based on the total weight of the composition of the Daengyi extract or fractions thereof, but is not limited thereto.

In addition, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, excipient or diluent commonly used in the manufacture of the pharmaceutical composition, the carrier may comprise a non-naturally occuring carrier (carrier) have.

Specific examples of the carrier, excipient, and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used, but is not limited thereto.

In addition, the pharmaceutical composition may be a tablet, a pill, a powder, a granule, a capsule, a suspension, a solution, an emulsion, a syrup, a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilizer and a suppository, respectively, according to a conventional method. It may have any one formulation selected from the group consisting of, and the formulation may be in various forms, oral or parenteral. When formulated, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used, but is not limited thereto.

As a specific example, a solid preparation for oral administration may be used in tablets, pills, powders, granules, capsules, etc., the solid preparation may be at least one excipient, for example, starch, calcium carbonate, sucrose (lactose) or lactose ( lactose), gelatin and the like can be used. In addition, a lubricant such as magnesium stearate, talc, and the like may be used in addition to the simple excipient, but is not limited thereto.

In addition, as a liquid preparation for oral administration, suspending agents, liquid solutions, emulsions, syrups, etc. may be used. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, and preservatives, may be used. And the like can be used. For parenteral administration, sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations or suppositories may be used. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, etc. may be used, but is not limited thereto.

In addition, as a base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, etc. may be used, but is not limited thereto.

Another aspect provides a method of treating pain, comprising administering the pharmaceutical composition to a subject causing or suspected of causing the pain.

At this time, the definition of "pain" and "treatment" is as described above.

As used herein, the term "administration" means introducing a composition comprising the said Daengyi extract or fractions thereof into a subject in a suitable manner.

As used herein, the term "individual" means all animals, including rats, mice, domestic animals, etc., including humans, which may or may not cause pain. Specific examples may be mammals or individuals other than humans.

The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount.

The term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level refers to the type and severity of the subject, severity, age, sex, activity of the drug, Sensitivity to drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of drugs, and other factors well known in the medical arts.

The pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. In addition, single or multiple administrations can be made. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, which can be easily determined by those skilled in the art.

In addition, the pharmaceutical composition may be administered orally or parenterally (eg, applied intravenously, subcutaneously, intraperitoneally, or topically) according to a desired method, and the dosage is based on the condition and weight of the patient, and the degree of disease. Depending on the drug form, route of administration, and time, it may be appropriately selected by those skilled in the art.

As a specific example, the pharmaceutical composition may generally be administered in an amount of 0.001 to 1000 mg / kg, more specifically 0.05 to 200 mg / kg, most specifically 0.1 to 100 mg / kg once a day or several times. Preferred dosages may be appropriately selected by those skilled in the art depending on the condition and weight of the individual, the severity of the disease, the form of the drug, the route of administration and the duration.

Another aspect provides a food composition for the prevention or amelioration of pain, including a thorn extract or a fraction thereof.

In this case, the definitions of the "sad wood", "extract", "fraction", "pain" and "prevention" are as described above.

Food composition of the present invention can be expected to improve the pain because it can be ingested on a daily basis, and unlike the general medicine because it has the advantage that there is no side effect that can occur when taking long-term use of the drug as a natural product, It can be very useful for the purpose of preventing or improving pain.

As used herein, the term " improvement " means any action that reduces a parameter, such as the extent of symptoms, associated with the condition treated with the administration of the food composition.

The term "food" of the present invention, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, drinks, tea, drinks, alcoholic beverages , Vitamin complexes, nutraceuticals and health foods, and includes all foods in the usual sense.

The health functional food (health functional food) is the same term as food for special health use (FOSHU), in addition to the nutritional supply, the processed food, medical effect is high so that the bioregulatory function appears efficiently Means food. Here, 'function (sex)' means to obtain a useful effect for health purposes such as nutrient control or physiological action on the structure and function of the human body. The health food (health food) means a food having an active health maintenance or promotion effect compared to the general food, the health supplement food (health supplement food) means a food for health supplement purposes. In some cases, the terms nutraceutical, health food, health supplement food may be used.

Specifically, the health functional food is a food produced by adding the powder of the present invention or the fraction thereof to food materials, such as beverages, teas, spices, chewing gum, confectionery, or the like encapsulated, powdered, suspensions, intake thereof If you mean to bring a specific effect on health, but unlike the general medicine has the advantage that there is no side effect that can occur when taking long-term use of the drug as a raw material.

The food of the present invention may be prepared by a method commonly used in the art, and may be prepared by adding raw materials and ingredients commonly added in the art. In addition, the food composition may be prepared in various forms of formulation as long as the formulation is recognized as a food.

In addition, the food composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited and may be used as long as the carrier is commonly used in the art.

In addition, the food composition may include additional ingredients that are commonly used in food compositions to improve the smell, taste, time and the like. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, panthotenic acid, and the like. In addition, minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu) and chromium (Cr); And amino acids such as lysine, tryptophan, cysteine, valine and the like.

In addition, the food composition is a preservative (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetic acid, etc.), fungicides (bleaching powder and highly bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisol (BHA), butylhydride) Oxytoluene (BHT), etc.), colorant (such as tar pigment), colorant (sodium nitrite, sodium nitrite, etc.), bleach (sodium sulfite), seasoning (MSG glutamate, etc.), sweetener (ducin, cyclate, saccharin Foods such as sodium, etc.), fragrances (vanillin, lactones, etc.), swelling agents (alum, potassium D-tartrate, etc.), reinforcing agents, emulsifiers, thickeners (foils), coatings, gum herbicides, foam inhibitors, solvents, modifiers, etc. It may include food additives. The additive may be selected according to the type of food and used in an appropriate amount.

In a specific embodiment of the present invention, the Taraxacum fruit extract has an analgesic effect such as suppressing weight loss, suppressing cold allodynia and mechanical allodynia to rats induced by pain by a CCI (Chronic constriction injury) operation ( 4, and Tables 3 to 5), the analgesic effect is due to the reduction of spinal cord lipid peroxidation, increase the antioxidant activity of the spinal cord, decrease the expression of microglia / astroglia activating factor in spinal cord tissue and decrease the expression of proinflammatory cytokines Was achieved (Tables 6, 7, 9 and 11). In addition, rats induced with menstrual cramps by estradiol benzoate and oxytocin show weight loss inhibition and abdominal analgesic effects (Table 12 and FIG. 5), and the analgesic effect is uterine hyperemia and edema inhibition, lipid peroxidation in uterine tissues. It was confirmed that the reduction was achieved by increasing the antioxidative activity of the uterus, decreasing the expression of inflammatory / pro-inflammatory factors in the uterine tissue and reducing the inflammation (Figs. 6 to 9, Tables 13 and 14, and Tables 16 to 18).

This suggests that the Taraxacum extract or a fraction thereof exhibits the effect of treating or improving pain caused by various causes, and exhibits effects such as suppressing / reducing / relaxing / improving pain, and thus, the present invention includes these. It is suggested that the food composition of the can be usefully used for the prevention or improvement of pain.

Another embodiment provides a quasi-drug composition for the prevention or amelioration of pain, including the Daengyi extract or fractions thereof.

In this case, the definitions of the "sad tree", "extract", "fragment", "pain", "prevention" and "improvement" are as described above.

As used herein, the term "quasi drug" refers to articles used for the purpose of diagnosing, treating, ameliorating, alleviating, treating, or preventing a disease of a human or animal, which have a lesser effect than a pharmaceutical, for example, according to the pharmacological law. Quasi-drugs exclude products used for the purpose of medicines, and include products used for the treatment or prevention of diseases of humans / animals, and products with slight or no direct action on the human body.

The quasi-drug composition of the present invention may be prepared with one or more selected from the group consisting of body cleanser, foam, soap, mask, ointment, cream, lotion, essence and spray, but is not limited thereto. In addition, the composition may be prepared in the form of a band, sanitary napkin, and the like, but is not limited thereto.

When using the poison extract or fractions thereof according to the present invention as an quasi-drug additive, the composition can be added as it is, or used with other quasi-drug or quasi-drug components, and can be suitably used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the intended use.

In a specific embodiment of the present invention, the Taraxacum fruit extract has an analgesic effect such as suppressing weight loss, suppressing cold allodynia and mechanical allodynia to rats induced by pain by a CCI (Chronic constriction injury) operation ( 4, and Tables 3 to 5), the analgesic effect is due to the reduction of spinal cord lipid peroxidation, increase the antioxidant activity of the spinal cord, decrease the expression of microglia / astroglia activating factor in spinal cord tissue and decrease the expression of proinflammatory cytokines Was achieved (Tables 6, 7, 9 and 11). In addition, rats induced with menstrual cramps by estradiol benzoate and oxytocin show weight loss inhibition and abdominal analgesic effects (Table 12 and FIG. 5), and the analgesic effect is uterine hyperemia and edema inhibition, lipid peroxidation in uterine tissues. It was confirmed that the reduction was achieved by increasing the antioxidative activity of the uterus, decreasing the expression of inflammatory / pro-inflammatory factors in the uterine tissue and reducing the inflammation (Figs. 6 to 9, Tables 13 and 14, and Tables 16 to 18).

This suggests that the Taraxacum extract or a fraction thereof exhibits the effect of treating or improving pain caused by various causes, and exhibits effects such as suppressing / reducing / relaxing / improving pain, and thus, the present invention includes these. It is suggested that the quasi-drug composition can be usefully used for the prevention or improvement of pain.

Taraxacum extract according to the present invention exhibits analgesic effects such as inhibiting weight loss, cold allodynia and mechanical allodynia, menstrual pain, etc., can be usefully used for the prevention, improvement or treatment of analgesic.

1 is an image showing a step-by-step process of the surgical constriction injury (CCI) according to an embodiment of the present invention.
Figure 2 is a schematic diagram of the experiment for confirming the analgesic effect on neuropathic pain of the Daenggi extract (hereinafter referred to as 'BH') according to an embodiment of the present invention.
Figure 3 is a schematic diagram of the experiment for confirming the analgesic effect on menstrual pain of BH according to an embodiment of the present invention.
Figure 4 is a graph confirming the weight gain effect of the BH in the neuropathic pain rat model.
Figure 5 is a graph confirming the effect of abdominal writhing, that is, abdominal pain in the menstrual pain rat model. Intact is a normal control group, PD is a control group, IND is an indomethacin 5 mg / kg group, LF is a gold and silver extract (hereinafter referred to as 'LF') 500 mg / kg group, 500 is BH 500 mg / kg group, 250 is BH 250 mg / kg administration group, and 125 means BH 125 mg / kg administration group. In this case, a indicates that p <0.01 compared to the normal control as a result of the LSD assay, b indicates p <0.01 compared to the menstrual pain control as a result of the LSD assay.
6 is an image confirming the effect of reducing the uterine hyperemia and swelling (enlargement) of the BH in menstrual pain rat model. Scale bars represent 11 mm, A is normal control group, B is menstrual pain control group, C is indomethacin 5 mg / kg group, D is LF 500 mg / kg group, E is BH 500 mg / kg group , F means a BH 250 mg / kg administration group, and G means a BH 125 mg / kg administration group.
7 is a graph confirming the effect of reducing the uterus weights (uterus weights) of the BH in menstrual pain rat model. Intact is a normal control group, PD is a menstrual pain control group, IND is an indomethacin 5 mg / kg group, LF is a LF 500 mg / kg group, 500 is a BH 500 mg / kg group, 250 is a BH 250 mg / kg group, and 125 Means BH 125 mg / kg administration group. In this case, a and b indicate p <0.01 and p <0.05, respectively, as compared to the normal control group as a result of the LSD assay, c indicates p <0.01 as compared to the normal control group as a result of the LSD assay, and d is compared to the normal control group as a result of the MW assay. p <0.01, and e indicates that p <0.01 as a result of MW assay compared to menstrual pain control group.
8 is an image confirming the effect of reducing the inflammation in the uterine corneal tissue of the menstrual pain rat model, showing the thickness of the entire uterus. Scale bar shows 120 μm, A is normal control group, B is menstrual pain control group, C is indomethacin 5 mg / kg group, D is LF 500 mg / kg group, E is BH 500 mg / kg group, F is BH 250 mg / kg administration group, and G means BH 125 mg / kg administration group. In this case, a and b indicate p <0.01 and p <0.05, respectively, as compared to the normal control group as a result of the LSD assay, c indicates p <0.01 as compared to the normal control group as a result of the LSD assay, and d is compared to the normal control group as a result of the MW assay. p <0.01, and e indicates that p <0.01 as a result of MW assay compared to menstrual pain control group.
9 is an image confirming the effect of reducing the inflammation in the uterine keratoplasty tissue of the menstrual pain rat model, showing immune response cells to TNF-α and iNOS-2. Scale bar shows 120 μm, A is normal control group, B is menstrual pain control group, C is indomethacin 5 mg / kg group, D is LF 500 mg / kg group, E is BH 500 mg / kg group, F is BH 250 mg / kg administration group, and G means BH 125 mg / kg administration group.

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Production Example  One. Wood  Preparation method of extract

Production Example  1-1. Water solvent Hydrothermal extraction

Lonicera caerulea var. edulis In order to prepare the extract of L.), specifically, the extract of the blue honeysuckle (hereinafter referred to as 'BH'), the following method was performed.

Specifically, 100 g of ground pulverized tree fruit was added to 1 liter of distilled water and stirred well, followed by extraction under reflux for 3 hours at an extraction temperature maintaining 90 to 95 ° C., and the filtrate was separated, and the herbal extract at 55 to 65 ° C. The mixture was concentrated under reduced pressure, and freeze-dried to obtain 21.2 g of the herbal composition powder extract.

Thereafter, 200 g of BH concentrated to 63 brix was diluted 25 times with distilled water and used by lyophilization.

Meanwhile, the BH includes 4.54 ± 0.09% of betaine, total phenols 210.63 ± 23.65 mg GAE / g, total flavonoids 159.30 ± 12.51 mg CE / g, total antocyanins 133.57 It was confirmed that ± 4.06 mg M3GE / g is included.

Production Example  1-2. water- Alcohol  Using mixed solvent Hydrothermal extraction

In addition, to prepare BH, the following method was performed.

1 g of 25% ethyl alcohol was added to 100 g of the pulverized sapling fruit as in Example 1-1, followed by stirring, followed by heating to reflux for 3 hours at an extraction temperature maintaining 80 to 90 ° C., followed by filtrate. After separation, the herbal extracts were concentrated under reduced pressure at 55 to 65 ° C, and freeze-dried to obtain 19.5 g of the herbal extract powder extract.

Thereafter, 200 g of BH concentrated to 63 brix was diluted 25 times with distilled water and used by lyophilization.

Meanwhile, it was confirmed that the BH contained 4.54 ± 0.09% of betaine, total phenol 210.63 ± 23.65 mg GAE / g, total flavonoid 159.30 ± 12.51 mg CE / g, and total anthocyanin 133.57 ± 4.06 mg M3GE / g.

Production Example  2. Manufacturing Method of Gold Coin Extract

In order to prepare an extract of Lonicera japonica Thunberg, a homogeneous plant of the genus Taegung tree, specifically, the extract of Lonicerae Flos (hereinafter referred to as 'LF'), the following method was performed.

Specifically, 10 times distilled water was added to 1 kg of dried flowers of the gold and silver coins, and heated to 100 ° C. for 2.5 hours. Thereafter, the resultant was lyophilized after evaporation using a round flask evaporator (N-1110, Eyela, Tokyo, Japan).

Experimental Example  1. How to use experimental animals

Experimental Example  1-1. Neuropathic  ache( neuropathic  pain-induced experimental animals

A total of 70 SD (SPF / VAF Outbred Crl: CD) male rats were obtained (OrientBio, Seungnam, Korea) and purified for 7 days. constriction injury was performed. Twenty four hours after surgery, eight experimental animals of similar body weight were selected for each group. At this time, each control group and the experimental group are as shown in Table 1 below, it was divided according to the type of surgery and the drug administered.

division Surgery type Dosing medication Control Gastric Surgery Control
(Sham control) Sham-Surgery Distilled water oral administration CCI control CCI Distilled water oral administration Comparison Amitriptyline
(Amitriptyline hydrochloride) CCI Amitriptyline 10 mg / kg intraperitoneally LF
Lonicerae Flos CCI LF 500 mg / kg oral dose Experimental group BH500 (high capacity) CCI BH 500 mg / kg oral administration BH250 (medium capacity) CCI BH 250 mg / kg oral administration BH125 (low capacity) CCI BH 125 mg / kg oral administration

Animal testing according to the present invention was carried out under the prior approval of the Daegu Haany University animal experiment ethics committee (approval number: DHU2017-046, 2017.05.10).

Experimental Example  1-2. Menstrual pain( dysmenorrhea ) Induced experimental animals

A total of 73 SD (SPF / VAF Outbred Crl: CD) female rats were obtained (OrientBio, Seungnam, Korea) and purified for 28 days, followed by administration of a dysmenorrhea by the method according to Experimental Example 3 to induce menstrual pain. Thereafter, 10 experimental animals of similar weight were selected for each group. At this time, each control group and the experimental group are as shown in Table 2 below, it was divided according to the type of surgery and the drug administered.

division Types of menstrual cramps Dosing medication Control Normal control
(Intact vehicle) Saline Distilled water oral administration Menstrual pain control Estradiol benzoate and oxytocin, E / O Distilled water oral administration Comparison Indomethacin
(Indomethacin, IND) E / O Indomethacin 5 mg / kg orally LF
Lonicerae Flos E / O LF 500 mg / kg oral dose Experimental group BH500 (high capacity) E / O BH 500 mg / kg oral administration BH250 (medium capacity) E / O BH 250 mg / kg oral administration BH125 (low capacity) E / O BH 125 mg / kg oral administration

Animal testing according to the present invention was carried out under the prior approval of the Daegu Haany University animal experiment ethics committee (approval number: DHU2017-047, 2017.05.10).

Experimental Example  2. CCI (Chronic constriction injury) surgical method

In order to produce neuropathic pain-induced experimental animals, rats underwent CCI (Chronic constriction injury) surgery. The surgical procedure is shown in FIG.

On the other hand, the chronic model of neurological constriction injury (CCI) rats caused by sciatic nerve ligation produces molecular, biochemical and cellular structural changes that are very similar to those observed in human neuropathic pain in primary sensory neurons. It has the same clinical symptoms as neuropathic pain in humans such as allodynia and hyperalgesia, and is used as the most common experimental model for studying neuropathic pain in humans. The analgesic effect of various antidepressants, anti-inflammatory agents and antioxidants on allodynia Have been evaluated using these CCI rat models (De Vry J, Eur J Pharmacol. 2004, 491: 137-48; Berrocoso E, Eur J Pharmacol. 2011, 655: 46-51).

Specifically, rodent inhalation anesthesia (Surgivet, Waukesha, WI, USA), ventilation device (Model 687, Harvard Apparatus, Cambridge, UK), 2-3% isoflurane (isoflurane, Hana Pharm. Co., Hwasung, Korea ), The rats were anesthetized with general inhalation using 70% N ₂ O and 28.5% O ₂ mixed gas, and anesthetized with 1-1.5% isoflurane. The left femoral lateral section was then incised to expose the sciatic nerve, followed by 4 ligation using 4-0 absorbent sutures (Catgut 4/0; F1154035, B. Braun Melsungen AG, Hessen, Germany) at intervals of 1 to 2 mm. By causing chronic neuropathic pain. The muscles around the wound were closed using 4/0 catgut sutures, and the skin was closed using a 3/0 blue nylon thread (NB324, Ailee, Busan, Korea) in the usual way. Postoperative wounds were protected by application of povidone-iodine (Povidone Iodine, Betadine ^™ , Korea Pharma, Hwasung, Korea) and Allusspray (Aluspray ^™ , Vetoquinol, Cedex, France).

In addition, the Sham control confirmed the left sciatic nerve in the same manner and then sutured the muscle and skin in the same manner without ligation.

Experimental Example  3. How to cause menstrual pain

In order to prepare a laboratory animal induced with dysmenorrhea, rats were administered estradiol benzoate and oxytocin.

On the other hand, after repeated administration of estradiol benzoate and oxytocin to a test animal, a single administration of oxytocin readily causes menstrual pain similar to humans (Liu et al, Methods Find Exp Clin Pharmacol., 2003, 25: 447 -452.).

Specifically, estradiol benzoate is administered once daily for 10 days subcutaneously (2.5 mg / kg at the start and final administration, 1 mg / kg at 2 to 9 doses), and then estradiol at the last 10 administrations. One hour after benzoate, 1 U / kg of oxytocin was intraperitoneally administered.

At this time, estradiol benzoate and oxytocin were suspended or dissolved in physiological saline and administered subcutaneously or intraperitoneally with a 26 G needle attached to a 5 ml syringe. Instead of diol benzoate and oxytocin, physiological saline was injected subcutaneously or intraperitoneally at the same dose and frequency.

Experimental Example  4. Drug Administration

Drug administration methods for the control group, comparative group and experimental group according to the present invention are shown in detail in FIGS.

First, the test drug, BH, was prepared according to Preparation Example 1-1, and dissolved in sterile distilled water at concentrations of 100, 50, and 25 mg / ml, and doses of 5 ml / kg (500, 250, and 125). mg / kg) orally via zonde attached to a 5 ml syringe once daily for 14 days. At this time, the highest dose of BH (500 mg / kg) was set based on the results of previous studies according to the evaluation of efficacy and mouse toxicity in the rat hypothyroid rat model (Kim HS, Toxicol Res. 2015, 31 : 61-8.). In addition, the medium dose (250 mg / kg) and the low dose (125 mg / kg) were set at half the dose for it.

In addition, LF, a comparative drug, was dissolved in sterile distilled water at a concentration of 100 mg / ml, and orally administered at the same time and method as the BH administration at a dose of 5 ml / kg (500 mg / kg).

In addition, another comparative drug, amitriptyline, was dissolved in saline at a concentration of 2 mg / ml, and 5 ml syringe once daily for 14 days, starting 24 hours after CCI surgery at a dose of 5 ml / kg (10 mg / kg). It was administered intraperitoneally using a 26 G needle attached to it. At this time, the dosage and method of administration of the amitrifthilin was set according to what is known in the art (Berrocoso E, Eur J Pharmacol. 2011, 655: 46-51).

In addition, another comparative drug, Indomethacin, was suspended in sterile distilled water at a concentration of 1 mg / ml, and administration of estradiol benzoate once daily for 10 days at a dose of 5 ml / kg (5 mg / kg) 30 Minutes later, oral administration was performed using sonde attached to the syringe. At this time, the dosage and method of administration of indomethacin were established as known in the art (Kim et al., J Periodontal Res. 2012, 47: 800-10.).

Meanwhile, the normal control group was orally administered distilled water in the same period and method as the BH administration in order to apply the same correction and stress according to the administration.

Experimental Example  5. Statistical Analysis

Statistical analysis was performed using SPSS (Release 14.0K, IBM SPSS Inc., Armonk, NY, USA) and all result values are expressed as 'mean ± standard deviation (S.D.)' of 8 rats.

If the homogeneity of variance was investigated using the Levin's test, and there was no significant variation in variance homogeneity in the Levin test results, then one-way ANOVA (two-analysis of variance) test was performed on the result. After performing the LSD (least-significant difference multi-comparison) test to determine which group showed a significant deviation. When the dispersion homogeneity was significantly out of the Levin test results, the Kruskal-Wallis H test, which is a nonparametric comparison test, was performed. When significant differences were found in the Kruskal-Wallis test, MW (Mann-Whitney U) The test was performed to determine which group showed a significant deviation.

In addition, to observe the extent of neuropathic pain caused by unilateral sciatic CCI surgery, the percentage change between gastric and control groups; And percentage change between the CCI control group and the experimental / comparative group administered the test / comparative drug.

In addition, in order to observe the degree of dysmenorrhea induced by estradiol benzoate and oxytocin, the percentage change between normal and menstrual cramps administered with saline as a menstrual pain trigger; And percentage change between the menstrual pain control group and the experimental / comparative group administered the test / comparative drug.

Example  One. Wood  Analyzing Analgesic Effects of Fruit Extract (BH) on Neuropathic Pain

Example  1-1. Body weight and Weight gain  Confirm change

In order to confirm the analgesic effect of BH on rats induced by CCI surgery, changes in body weight and weight gain were confirmed.

On the other hand, chronic and severe neuropathic pain caused by CCI leads directly to anorexia, resulting in significant weight loss. Thus, inhibition of such weight loss is used as an important indicator of the analgesic effect on neuropathic pain (Farghaly HS, Pain Physician. 2014, 17: 187-95.).

Specifically, body weights were measured 24 hours after CCI surgery, one day before administration (day 0) and one, three, seven, ten and fourteen days after administration. In order to reduce individual differences, the weight gain after 14 days of administration was calculated as in Equation 1 below. Then, the results are shown in Figure 4 and Table 3 below.

[Equation 1]

Body weight gain (g) for 14 days after drug administration

= Body weight at sacrifice (weight on day 14)-body weight 24 hours after CCI surgery-body weight before drug administration (weight on day 0)

division Body weight (g) Body weight gains
[B-A] [A] at the beginning of drug administration Sacrifice
[B] Control Gastric Surgery Control 269.50 ± 11.07 318.00 ± 14.00 48.50 ± 9.12 CCI control 259.75 ± 11.37 261.25 ± 14.09 ^a 1.50 ± 3.82 ^a Comparison Amitriptyline
10 mg / kg 260.25 ± 12.37 294.75 ± 10.15 ^ab 34.50 ± 10.27 ^ab LF 500 mg / kg 258.88 ± 11.56 279.75 ± 12.67 ^ab 20.88 ± 5.25 ^ab Test group BH 500 mg / kg
259.75 ± 15.55 292.00 ± 12.24 ^ab 32.25 ± 11.63 ^ab BH 250 mg / kg 259.38 ± 11.36 289.13 ± 13.50 ^ab 29.75 ± 6.61 ^ab BH 125 mg / kg 259.88 ± 10.53 280.25 ± 10.50 ^ab 20.38 ± 5.40 ^ab

At this time, ^a shown in Table 3 is LSD test indicates p <0.01 compared to gastric surgery control, ^b is LSD test indicates p <0.01 compared to CCI control

 As a result, as can be seen in Figure 4 and Table 3, in the case of the CCI control group, significant weight loss begins after 1 day of administration compared to the gastric surgery control group, and significant weight loss appears during the entire 14-day administration period. Confirmed. In addition, 14 days after drug administration, the weight gain of body weight was confirmed to be -96.91% decrease compared to gastric surgery control.

However, it was confirmed that the amitrifthilin 10 mg / kg administration group and LF 500 mg / kg administration group, the body weight increased from 3 days after the start of administration, respectively, compared to the CCI control group. In addition, on the 14th day of drug administration, the weight gain of the body weight was increased by 2200.00 and 1291.67%, respectively, compared to the CCI control group.

In particular, in the case of BH 500, 250 and 125 mg / kg administration group, it was confirmed that significant weight gain starts from 7 and 10 days after the start of administration compared to the CCI control group. In addition, it was confirmed that the dose-dependent weight gain appeared in the three BH-administered group, and on the 14th day of drug administration, the weight gain of the body weight was increased by 2050.00, 1883.33 and 1258.33%, respectively, compared to the CCI control group.

Furthermore, it was confirmed that the BH 500 mg / kg administration group showed similar or better weight gain and weight loss reduction inhibitory effects than the amitrifthilin 10 mg / kg administration group and the LF 500 mg / kg administration group.

Through the above results, the Taraxacum fruit extract increases the weight of the pain-induced rats, and in particular, exhibits a similar or better weight gain effect than amitriptyline or gold silver extract, which is well known as an analgesic agent, and thus causes neuropathic pain. It can be seen that it can be usefully used as a prophylactic or therapeutic substance of.

Example  1-2. cold In allodynia  Analgesic effect check

In order to confirm the analgesic effect of BH on rats induced by CCI surgery, the analgesic effect on cold-induced allodynia was confirmed by cold plate test.

CCI, on the other hand, causes a variety of allodynia, including cold allodynia, very similar to the clinical symptoms of neuropathic pain in humans (Jasmin L, KPain. 1998, 75: 367-82.).

Specifically, the rat was placed on a low temperature (4 ± 1 ° C.) metal plate and transparent plastic box (280 × 250 ×) using a hot / cold plate test system (Model 35150, Ugo Basile SRL). 210 mm ³ , Varese, Italy). Then, the number of times the rat lifted the left hind paw for 2 minutes was calculated as a nociceptive response. At this time, the experiment was performed 24 hours after CCI surgery, before the drug administration (day 0) and 1, 3, 7, 10 and 14 days after administration, the results are shown in Table 4 below.

division Period after drug administration (days) 0 3 7 10 14 Control Gastric Surgery Control   3.38 ± 1.06   3.25 ± 1.04   3.00 ± 0.76   2.63 ± 0.74   2.50 ± 0.53 CCI control 25.88 ± 2.42 ^a 26.13 ± 1.73 ^a 24.25 ± 2.31 ^c 23.63 ± 2.50 ^c 22.13 ± 1.73 ^c Comparison Amitriptyline
10 mg / kg 25.75 ± 1.83 ^a 16.50 ± 2.45 ^ab 12.63 ± 2.33 ^cd 9.63 ± 1.60 ^cd 9.13 ± 1.46 ^cd LF
500 mg / kg 26.00 ± 1.31 ^a 22.38 ± 2.62 ^ab 20.88 ± 2.23 ^ce 16.63 ± 2.72 ^cd 15.63 ± 2.33 ^cd Test group BH
500 mg / kg
25.75 ± 1.91 ^a 17.50 ± 3.34 ^ab 13.25 ± 2.60 ^cd 10.38 ± 1.69 ^cd 9.75 ± 1.28 ^cd BH
250 mg / kg 25.75 ± 1.67 ^a 18.38 ± 3.74 ^ab 16.50 ± 2.88 ^cd 12.88 ± 2.30 ^cd 12.88 ± 2.53 ^cd BH
125 mg / kg 26.13 ± 1.64 ^a 22.13 ± 1.81 ^ab 19.75 ± 1.39 ^cd 16.25 ± 2.82 ^cd 15.25 ± 3.11 ^cd

In this case, ^a shown in Table 4 is LSD test indicates p <0.01 compared to gastric surgery control, ^b is The LSD assay showed p <0.01 compared to the CCI control group, ^c indicates p <0.01 compared to the gastric surgery control group as a result of the MW assay, and ^d and ^e were p <0.01 and p <0.05.

As a result, as shown in Table 4, in the case of the CCI control group, compared to the gastric surgery control group, the number of left hind paws lifted, that is, cold allodynia increased after CCI surgery and continued until 14 days of drug administration. In addition, 14 days after drug administration, it was confirmed that this cold allodynia was increased by 785.00% compared to gastric surgery control.

However, it was confirmed that in the case of amitriptyline 10 mg / kg administration group and LF 500 mg / kg administration group, cold allodynia was reduced from 3 days after the start of administration, respectively, compared to the CCI control group. In addition, 14 days after drug administration, these cold allodynia was confirmed to be -58.76 and -29.38% decrease compared to the CCI control, respectively.

In particular, in the case of BH 500, 250 and 125 mg / kg administration group, compared to the CCI control group, it was confirmed that cold allodynia decreases after 3 days after the start of administration, respectively. In addition, it was confirmed that the three BH-administered groups showed a dose-dependent cold allodynia reducing effect, and on day 14, the cold allodynia was reduced by -55.93, -41.81 and -31.07% compared to the CCI control group, respectively. .

Furthermore, the BH 500 mg / kg group showed cold allodynia reduction similar to that of the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group compared to the LF 500 mg / kg group. It was confirmed to exhibit an excellent cold allodynia reducing effect.

Through the above results, the Taraxacum fruit extract reduces the cold allodynia in rats, and in particular, exhibits a pain reduction effect similar to or better than that of amitriptyline or gold and silver extract, which are well known as analgesics, thus preventing or preventing neuropathic pain. It can be seen that it can be usefully used as a therapeutic substance.

Example  1-3. Mechanical In allodynia  Analgesic effect check

In order to confirm the analgesic effect of BH on rats induced by CCI surgery, the analgesic effect on mechanical allodynia was confirmed through the Von Frey hair filament test.

On the other hand, CCI causes various allodynias, including mechanical allodynia, very similar to the clinical symptoms of neuropathic pain in humans (Jasmin L, KPain. 1998, 75: 367-82.).

Specifically, the rats in which the low temperature plate test according to Example 1-2 was completed were placed on a wire mesh in the air, and locked in a box (Perspex boxes, 185 × 210 × 135 mm ³ ). Thereafter, mechanical allodynia was given by applying pressure to the left hind foot, the pain being a dynamic plantar aesthesiometer system (Model 37450, Ugo Basile SRL, Varese, Italy) and Von Frey filament (Bio-VF). -M, Bioseb, Chaville, France) and measured in grams (g). With 50 g as the cutoff limit, the force that induces the withdrawal response was set to the threshold. At this time, the experiment was performed 24 hours after CCI surgery, before (0 day) and 1, 3, 7, 10 and 14 days after the administration of the drug, the results are shown in Table 5 below.

division Period after drug administration (days) 0 3 7 10 14 Control Gastric Surgery Control  42.20 ± 5.42  41.88 ± 5.51  42.63 ± 4.60  41.75 ± 5.50  42.63 ± 5.26 CCI control 12.88 ± 2.03 ^a 11.50 ± 1.20 ^a 12.13 ± 1.81 ^a 12.88 ± 1.55 ^a 13.88 ± 1.36 ^a Comparison Amitriptyline
10 mg / kg 12.75 ± 2.12 ^a 24.00 ± 3.78 ^ab 28.25 ± 4.06 ^ab 29.50 ± 4.99 ^ab 31.38 ± 5.58 ^ab LF
500 mg / kg 13.00 ± 2.27 ^a 16.50 ± 1.20 ^ab 18.50 ± 1.77 ^ab 19.00 ± 1.51 ^ab 19.88 ± 1.55 ^ab Test group BH
500 mg / kg
12.75 ± 2.25 ^a 23.63 ± 2.62 ^ab 28.63 ± 2.67 ^ab 29.13 ± 2.90 ^ab 30.75 ± 3.37 ^ab BH
250 mg / kg 12.75 ± 2.25 ^a 20.00 ± 1.31 ^ab 23.88 ± 2.30 ^ab 24.88 ± 2.47 ^ab 25.13 ± 2.95 ^ab BH
125 mg / kg 12.75 ± 2.12 ^a 16.88 ± 2.10 ^ab 18.63 ± 1.92 ^ab 19.88 ± 1.73 ^ab 20.63 ± 2.26 ^ab

At this time, ^a shown in Table 5 is MW test indicates that p <0.01 compared to gastric surgery control, ^b is The MW assay indicates that p <0.01 compared to the CCI control.

As a result, as shown in Table 5, in the case of the CCI control group, the magnitude of the force for withdrawing the left hind paw after CCI surgery was significantly reduced, compared to the gastric surgery control group, and the threshold value was decreased during the entire administration period of 14 days. It was confirmed that the decrease significantly. In addition, 14 days after drug administration, the threshold was confirmed to be -67.45% less than the gastric surgery control group.

However, it was confirmed that the amitrifthilin 10 mg / kg administration group and LF 500 mg / kg administration group, the threshold increased from 3 days after the start of administration, respectively, compared to the CCI control group. In addition, on the 14th day of drug administration, the threshold was increased by 126.13 and 43.24%, respectively, compared to the CCI control group.

In particular, in the BH 500, 250 and 125 mg / kg administration group, it was confirmed that the threshold increased significantly from 3 days after the start of administration compared to the CCI control group. In particular, it was confirmed that the dose-dependent threshold increases in the three BH-administered group, and on the 14th day of drug administration, the threshold was increased by 121.62, 81.08 and 48.65%, respectively, compared to the CCI control group.

Furthermore, it was confirmed that the BH 500 mg / kg administration group showed a similar or better threshold increase effect than the amitrifthilin 10 mg / kg administration group and the LF 500 mg / kg administration group.

Through the above results, the Taraxacum fruit extract reduces the mechanical allodynia in rats and, in particular, exhibits a pain reduction effect similar to or better than that of amitriptyline or gold coin extract, which is well known as an analgesic agent, thereby preventing or preventing neuropathic pain. It can be seen that it can be usefully used as a therapeutic substance.

Example  2. Wood  Identification of the analgesic effect mechanism of fruit extract (BH) on neuropathic pain

Example  2-1. Identifying the Reducing Effect of Spinal Cord Lipid Peroxidation

In order to confirm the analgesic effect of BH on rats induced by CCI surgery, the reduction effect of spinal cord lipid peroxidation was confirmed by measuring MDA (malondialdehyde) content.

On the other hand, oxidative stress is one of the causes of chronic neuropathic pain, and MDA is a final product of lipid peroxidation and is usefully used as an indicator of lipid peroxidation (Messarah M, Exp Toxicol Pathol. 2010, 62: 301-10). .).

Specifically, the weight of the abdomen (lumbosacral spinal cord) of the L4-L6 part was separated from the rats in which the pon fry hair filament test according to Examples 1-3 was completed. Then, bead beater (Model TacoTMPre, GeneResearch Biotechnology Corp., Taichung, Taiwan) and ultrasonic cell grinder in buffer solution consisting of 10 mM sucrose, 10 mM Tris-HCl and 0.1 M MEDTA (pH 7.4) (Model KS-750, Madell Technology Corp., Ontario, CA) was homogenized and centrifuged at 12,000 g for 15 minutes. The homogenate of the obtained spinal cord tissue was stored at -150 ° C until use using an ultra low temperature cooler (MDF-1156, Sanyo, Tokyo, Japan).

The degree of peroxidation of spinal cord lipids was determined by measuring absorbance at 525 nm using a thiobarbituric acid test and a UV / Vis spectrophotometer (OPTIZEN POP, Mecasys, Daejeon, Korea). Expressed as concentration (nM). Total protein content was calculated using bovine serum albumin as internal standard. Then, the results are shown in Table 6 below.

division Lumbar spinal cord tissue
Lumbosacral spinal cord tissues MDA content (nM / g protein) Control Gastric Surgery Control 2.97 ± 1.01 CCI control 10.83 ± 1.79 ^d Comparison Amitriptyline
10 mg / kg 4.94 ± 0.99 ^de LF
500 mg / kg 6.31 ± 0.72 ^de Test group

BH
500 mg / kg
4.84 ± 0.67 ^de BH
250 mg / kg 5.28 ± 0.90 ^de BH
125 mg / kg 6.28 ± 1.32 ^de

At this time, ^d shown in Table 6 indicates that p <0.01 compared to the control group MW assay results, ^e indicates that p <0.01 compared to the CCI control group MW assay results.

As a result, as shown in Table 6, in the case of the CCI control group, the MDA content, that is, the peroxidation of spinal cord lipids was significantly increased, compared to the gastric surgery control group, and this peroxidation was confirmed to increase by 264.60%.

However, in the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, the peroxidation of spinal cord lipids was significantly reduced compared to the CCI control group, which was -54.40 and -41.73% less than the CCI control group, respectively. It was confirmed.

In particular, the BH 500, 250 and 125 mg / kg administration group, it was confirmed that the peroxidation of spinal cord lipids, respectively, compared to the CCI control group, the degree of peroxidation was -55.27, -51.26 and -41.99%, respectively, compared to the CCI control It was confirmed that the decrease.

Furthermore, the BH 500 mg / kg group showed similar peroxidation reduction effects as those of the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group was superior to the LF 500 mg / kg group. It was confirmed that the effect of reducing the degree of peroxidation.

Through the above results, the Taraxacum fruit extract reduced the MDA content of rats, that is, the peroxidation of spinal cord lipids, and showed a similar or better reducing spinal cord lipid peroxidation effect than amitriptyline or gold silver extract, which are well known as analgesics. Therefore, it was found that it can be usefully used as a substance for preventing or treating neuropathic pain.

Example  2-2. Identifying the Functional Enhancement Effects of the Spinal Cord Antioxidant Defense System

To determine the analgesic effect of BH on rats induced by CCI surgery, the effects of spinal cord antioxidant defense systems on GSH (glutathione) content, superoxide dismutase (SOD) and CAT ( Catalase) was confirmed by measuring the change in activity.

On the other hand, GSH is a representative endogenous antioxidant that controls tissue injury by removing ROS at a relatively low concentration in cells (Odabasoglu F, J Ethnopharmacol. 2006, 103: 59-65.). In addition, SOD and CAT are also endogenous antioxidant enzymes, acting as part of the cell's enzyme defense system (Cheeseman KH, Br Med Bull. 1993, 49: 481-93.).

First, in order to measure the GSH content, the prepared homogenate was mixed with 0.1 ml of 25% trichloroacetic acid (trichloroacetic acid, Merck, San Francisco, CA, USA), and then centrifuged at 4,200 rpm for 40 minutes at 4,200 rpm. GSH content was measured using a spectrophotometer at absorbance 412 nm using 2-nitro benzoic acid (Sigma-Aldrich, St. Louise, MO, USA) and expressed in concentrations per gram of protein (nM).

In addition, the activity of CAT was measured through the degree of decomposition of H ₂ O ₂ . CAT activity is defined as the amount of enzyme required to degrade 1 nM H ₂ O ₂ per minute at 25 ° C. and pH 7.8. The amount of H ₂ O ₂ remaining is measured using a spectrophotometer at absorbance 240 nm and per mg protein. Expressed as concentration (U).

In addition, SOD activity can be confirmed by the degree of production of superoxide radicals. When SOD reacts with nitroblue tetrazolium (NBT), xanthine is produced and the xanthine is xanthine oxidase. Reacts with superoxide radicals. The superoxide radicals were measured using a spectrophotometer at absorbance 560 nm and expressed as concentration per mg protein. In this case, 1U refers to the amount of enzyme that reduces the initial absorbance of NBT by 50% for 1 minute. Then, the results are shown in Table 7 below.

division Lumbar spinal cord tissue GSH content
(nM / protein g) SOD activity
(U / protein mg) CAT active
(U / protein mg) Control Gastric Surgery Control 65.31 ± 11.26 0.74 ± 0.12 186.25 ± 27.15 CCI control 26.37 ± 11.33 ^a 0.27 ± 0.07 ^a 25.13 ± 10.51 ^d Comparison Amitriptyline
10 mg / kg 46.53 ± 10.58 ^ab 0.53 ± 0.08 ^ab 122.75 ± 29.31 ^de LF
500 mg / kg 41.15 ± 4.83 ^ab 0.40 ± 0.10 ^ac 65.50 ± 20.58 ^de Test group

BH
500 mg / kg
51.49 ± 11.77 ^ab 0.54 ± 0.12 ^ab 126.25 ± 32.30 ^de BH
250 mg / kg 44.87 ± 10.02 ^ab 0.51 ± 0.13 ^ab 104.88 ± 27.35 ^de BH
125 mg / kg 41.61 ± 7.18 ^ab 0.40 ± 0.08 ^ac 64.63 ± 18.37 ^de

In this case, ^a shown in Table 7 is LSD test indicates p <0.01 compared to gastric surgery control, ^b and ^c are The LSD test results indicate p <0.01 and p <0.05, respectively, compared to the CCI control group, ^c indicates p <0.01 compared to the gastric surgery control group according to the MW assay, and ^d is p <0.01 compared to the gastric surgery control group as a result of the MW assay. ^E indicates that p <0.01 compared to the CCI control as a result of the MW assay.

As a result, as shown in Table 7, the CCI control group significantly reduced GSH content, SOD activity, and CAT activity, that is, antioxidant activity, compared to the gastric surgery control group, and the decrease was -59.62% and -63.41, respectively. % And -86.51%.

However, it was confirmed that the amitrifthilin 10 mg / kg administration group and LF 500 mg / kg administration group, the antioxidant activity of the spinal cord increased compared to the CCI control group. Specifically, it was confirmed that the GSH content, SOD activity, and CAT activity increased 76.43, 95.39, and 388.56% for the amitrifthilin-administered group, respectively. In addition, the GSH content, SOD activity and CAT activity was increased by 56.02, 48.39 and 160.70% for the LF administration group, respectively.

In particular, in the case of BH 500, 250 and 125 mg / kg administration group, it was confirmed that the antioxidant activity of the spinal cord is increased, and dose-dependent antioxidant activity is increased compared to the CCI control group. Specifically, GSH content, SOD activity and CAT activity were 95.23, 100.46 and 402.49% for the BH 500 mg / kg administration group, respectively; 70.14, 87.10 and 317.41% for the BH 250 mg / kg dose group, respectively; BH 125 mg / kg administration group was found to increase 57.79, 48.39 and 157.21%, respectively.

Furthermore, it was confirmed that the BH 500 mg / kg administration group showed better antioxidant activity than the amitrifthilin 10 mg / kg administration group and the LF 500 mg / kg administration group.

Through the above results, Taraxacum berry extract increases rats' GSH content, SOD activity and CAT activity, that is, antioxidant activity of the spinal cord, and in particular, the antioxidant activity is better than that of amitriptyline or gold silver extract, which are well known as analgesics. Since it is effective, it can be seen that it can be usefully used as a substance for preventing or treating neuropathic pain.

Example  2-3. Decreased expression of microglia and astroglia activating factors in spinal cord tissue

To identify the analgesic effects of BH on rats induced by CCI surgery, microglia and astroglia activating factors in the spinal cord tissue, namely ionized calcium-binding adapte rmolecule-1 (Iba-1) and GFAP (Glial) Fibrillary acidic protein) expression was confirmed by RT-PCR analysis.

On the other hand, microglia and astroglia are activated in response to nerve damage and are known to cause various neuropathies and chronic neuropathic pain such as neurotoxicity, chronic inflammation and hyperpolarization (Milligan ED, Nat Rev Neurosci. 2009). , 10: 23-36.).

First, RNA was extracted from spinal cord tissue using Trizol reagent (Invitrogen, Carlsbad, CA, USA), and the concentration and quality of RNA were confirmed by CFX96TM Real-Time System (Bio-Rad, Hercules, CA, USA). . Samples were treated with recombinant DNase I (DNA-free; Ambion, Austin, TX, USA) to remove contaminated DNA and RNA was obtained using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Reverse transcription. The degree of expression of each factor was confirmed using the primers described in Table 8 below and the ABI Step One Plus sequence detection system (Applied Biosystems, Foster City, CA, USA). Then, GAPDH (glyceraldehydes 3-phosphate dehydrogenase) was normalized to the expression level, the results are shown in Table 9 below.

Target factor 5 '-3' order NCBI accession No. Iba-1 Forward direction CAGACTGCCAGCCTAAGACA
(SEQ ID NO 1) NM_017196 Reverse AGGAATTGCTTGTTGATCCC
(SEQ ID NO: 2) GFAP Forward direction AGAAAACCGCATCACCATTCC
(SEQ ID NO: 3) NM_017009 Reverse CAGGGCTCCATTTTCAATCTG
(SEQ ID NO: 4) GAPDH Forward direction GCTAGGACTGGATAAGCAGGG
(SEQ ID NO: 5) NM_017008 Reverse GCCAAATCCGTTCACACCG
(SEQ ID NO: 6)

division Lumbar spinal cord tissue Iba-1 GFAP Control
Gastric Surgery Control   1.01 ± 0.05   0.99 ± 0.12 CCI control 2.87 ± 0.65 ^c 1.76 ± 0.18 ^a Comparison
Amitriptyline
10 mg / kg 1.64 ± 0.24 ^cd 1.23 ± 0.09 ^ab LF
500 mg / kg 2.00 ± 0.25 ^cd 1.45 ± 0.23 ^ab Test group


BH
500 mg / kg
1.69 ± 0.30 ^cd 1.29 ± 0.11 ^ab BH
250 mg / kg 1.80 ± 0.21 ^cd 1.35 ± 0.11 ^ab BH
125 mg / kg 1.97 ± 0.23 ^cd 1.46 ± 0.19 ^ab

In this case, ^a shown in Table 9 is LSD test indicates p <0.01 compared to gastric surgery control, ^b is As a result of the LSD assay, p <0.01 indicates that the CCI control group, ^c indicates that p <0.01 compared to the gastric surgery control group, and ^d indicates that p <0.01 compared to the CCI control group.

As a result, as shown in Table 9, in the CCI control group, the mRNA expression levels of Iba-1 and GFAP, ie, microglia and astrocyte activating factors, were significantly increased compared to the gastric surgery control group. The increase was 184.49 and 77.90%, respectively.

However, it was confirmed that the expression of the activating factor was reduced in the amitrifthilin 10 mg / kg administration group and LF 500 mg / kg administration group, compared to the CCI control group. Specifically, it was confirmed that the mRNA expression levels of Iba-1 and GFAP decreased -42.87 and -30.31% in the amitriptyline-administered group, respectively. In addition, in the LF-administered group, the mRNA expression levels of Iba-1 and GFAP were -30.18 and -17.53%, respectively.

In particular, in the case of BH 500, 250 and 125 mg / kg administration group, it was confirmed that the expression of the activating factor of the spinal cord is reduced, and the dose-dependent expression amount compared to the CCI control group. Specifically, mRNA expression levels of Iba-1 and GFAP were -40.91 and -26.90% for the BH 500 mg / kg administration group, respectively; -37.07 and -23.56% for the BH 250 mg / kg dose group, respectively; BH 125 mg / kg administration group was confirmed to decrease -31.44 and -17.18%, respectively.

Furthermore, the BH 500 mg / kg group showed a similar or better effect of reducing the expression of microglial and astroglia activating factors than the amitriptyline 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg. It was confirmed that the / kg administration group also showed a better expression reduction effect than the LF 500 mg / kg administration group.

Through the above results, Taraxacum fruit extract reduces the amount of mRNA expression of Iba-1 and GFAP in the rat spinal cord, that is, the expression of microglia and astroglia activating factors, and especially amitrityline or a well known effect as an analgesic agent. Since it exhibits a similar or better expression reduction effect than the sterling silver extract, it can be seen that it can be usefully used as a material for preventing or treating neuropathic pain.

Example  2-4. Spinal cord tissue Pro-inflammatory  Confirmation of cytokine expression reduction effect

To investigate the analgesic effect of BH on rats induced by CCI surgery, pro-inflammatory cytokine (Tumor necrosis factor) -α and inducible nitric oxide synthase (iNOS) in the spinal cord tissue ) MRNA expression reduction effect was confirmed by RT-PCR analysis.

On the other hand, pro-inflammatory cytokines are also involved in neuropathic pain, and the expression of pro-inflammatory cytokines such as TNF-α and iNOS after nerve injury triggers an inflammatory response (Liang F, Saudi Pharm J. 2017). , 25: 649-54.

Specifically, by the method according to Example 2-3, RT-PCR was performed using a primer as shown in Table 10 below, and the results are shown in Table 11 below.

Target factor 5 '-3' order NCBI accession No. TNF-α Forward direction CTACTGAACTTCGGGGTGAT
(SEQ ID NO: 7) NM_012675 Reverse CTTGGTGGTTTGTGAGTGTG
(SEQ ID NO: 8) iNOS Forward direction AGCCTAGTCAACTGCAAGAG
(SEQ ID NO: 9) NM_012611 Reverse TCTTGTATTGTTGGGCTGAGA
(SEQ ID NO: 10)

division Lumbar spinal cord tissue TNF-α iNOS Control Gastric Surgery Control   1.00 ± 0.10   0.99 ± 0.05 CCI control 3.92 ± 0.69 ^c 6.30 ± 0.79 ^c Comparison Amitriptyline
10 mg / kg 1.88 ± 0.24 ^cd 2.38 ± 0.62 ^cd LF
500 mg / kg 2.71 ± 0.30 ^cd 3.68 ± 0.80 ^cd Test group

BH
500 mg / kg
1.82 ± 0.24 ^cd 2.39 ± 0.39 ^cd BH
250 mg / kg 2.12 ± 0.29 ^cd 3.12 ± 0.47 ^cd BH
125 mg / kg 2.69 ± 0.24 ^cd 3.70 ± 0.42 ^cd

In this case, ^c shown in Table 11 indicates that p <0.01 compared to the control group gastric surgery results, ^d indicates that p <0.01 compared to the CCI control results.

As a result, as shown in Table 11, in the CCI control group, the amount of mRNA expression of TNF-α and iNOS, that is, pro-inflammatory cytokines, was significantly increased compared to the gastric surgery control group, respectively, increasing by 291.01 and 538.28%. Confirmed.

However, it was confirmed that the expression of the cytokine was reduced in the amitrifthilin 10 mg / kg administration group and LF 500 mg / kg administration group, compared to the CCI control group. Specifically, it was confirmed that the amount of mRNA expression of TNF-α and iNOS decreased -52.11 and -62.13% in the amitriptyline-administered group, respectively. In addition, it was confirmed that the mRNA expression of TNF-α and iNOS in the LF-administered group decreased -30.87 and -41.48%, respectively.

In particular, even in the BH 500, 250 and 125 mg / kg administration group, it was confirmed that the expression of the cytokine in the spinal cord is reduced compared to the CCI control group. Specifically, mRNA expression levels of TNF-α and iNOS were -53.58 and -62.11% for the BH 500 mg / kg administration group, respectively; -45.75 and -50.44% for the BH 250 mg / kg dose group, respectively; BH 125 mg / kg administration group was confirmed to decrease -31.35 and -41.30%, respectively.

Furthermore, the BH 500 mg / kg group showed a similar or better expression reduction effect of the activator than the amitrifthilin 10 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group also received LF. It was confirmed to exhibit a similar or better expression reduction effect than the 500 mg / kg administration group.

Through the above results, the Taraxacum fruit extract reduces the amount of TNF-α and iNOS mRNA expression in the rat spinal cord, that is, the expression of proinflammatory cytokines, and is particularly similar to amitriptyline or gold silver extract, which are well known as analgesics. Or better because it shows an effect of reducing the expression of pro-inflammatory cytokines, it can be seen that it can be usefully used as a substance for the prevention or treatment of neuropathic pain.

Example  3. Confirm the analgesic effect of BH on menstrual pain

Example  3-1. Body weight and Weight gain  Confirm change

In order to confirm the analgesic effect of BH on rats induced by estradiol benzoate and oxytocin, changes in body weight and weight gain were confirmed.

On the other hand, estradiol benzoate promotes the secretion of endogenous and exogenous cholecystokinin hormones to make you feel full, so physiological pain caused by estradiol benzoate is directly linked to anorexia, resulting in significant weight loss. Therefore, this suppression of weight loss is used as an important indicator of the analgesic effect on menstrual pain (Asarian L et al., Endocrinology. 2007, 148: 5656-66.).

Specifically, body weights were measured once a day for 10 days before estradiol benzoate treatment (day 0) and until the last dose (day 9). In order to reduce individual differences, weight gain after 10 days of administration was calculated as in Equation 2 below. Then, the results are shown in Table 12 below.

[Equation 2]

Weight gain (g) for 10 days after drug administration

= Weight at sacrifice (weight on day 9)-weight before estradiol benzoate treatment (weight on day 0)

division Body weight (g) Body weight gains
[B-A] [A] at the beginning of drug administration At Sacrifice [B] Control Normal control 223.30 ± 10.03 232.50 ± 10.72 9.20 ± 4.18 Menstrual pain control 224.80 ± 14.16 218.70 ± 13.34 ^b -6.10 ± 4.20 ^a Comparison Indomethacin
5 mg / kg 223.20 ± 10.58 221.60 ± 9.85 -1.60 ± 3.17 ^ad LF 500 mg / kg 224.90 ± 9.53 223.90 ± 11.26 -1.00 ± 4.90 ^ad Test group BH 500 mg / kg
221.60 ± 17.43 224.10 ± 18.62 2.50 ± 3.87 ^ac BH 250 mg / kg 225.50 ± 8.72 225.70 ± 10.59 0.20 ± 6.96 ^ac BH 125 mg / kg 224.80 ± 14.67 223.70 ± 15.94 -1.10 ± 3.41 ^ad

In this case, ^a shown in Table 12 is LSD test indicates that p <0.01 compared to the normal control, ^b is The LSD assay indicated that p <0.05 compared to the normal control. ^C is also LSD test indicates that p <0.01 compared to menstrual pain control, ^d is The LSD assay indicated that p <0.05 compared to menstrual pain control.

 As a result, as shown in Table 12, in the case of menstrual pain control group, it was confirmed that a significant weight loss during the entire administration period 10 days. In addition, on the 10th day of drug administration, it was confirmed that the weight gain of the body weight was -166.30% lower than that of the normal control group.

Meanwhile, in the indomethacin 5 mg / kg and LF 500 mg / kg groups, there was no significant change in body weight compared to the menstrual pain control group, but on the 10th day of drug administration, the weight gain of the body weight was 74.77 and 84.61% increase

In particular, it was confirmed that the BH 500, 250 and 125 mg / kg administration group showed a significant weight gain compared to the menstrual pain control group. In addition, it was confirmed that the dose-dependent weight gain was shown in the three BH-administered group, and on the 10th day of drug administration, the weight gain of the body weight was increased by 141.98, 104.26 and 82.97%, respectively, compared to the menstrual pain control group.

Furthermore, it was confirmed that the low dose BH 125 mg / kg administration group showed similar or better weight gain and weight loss inhibition effects than the indomethacin 5 mg / kg administration group and the LF 500 mg / kg administration group.

Through the above results, the dagger fruit extract increases the weight of rats inducing menstrual pain, and in particular, exhibits a similar or better weight gain effect than the indomethacin or gold and silver extract, which are well known as menstrual pain analgesics, thus preventing the occurrence of menstrual pain. Or it can be seen that it can be usefully used as a therapeutic substance.

Example  3-2. Identify pain relief for abdominal pain

In order to confirm the analgesic effect of BH on rats induced menstrual pain, the analgesic effect on abdominal pain was confirmed through abdominal writhing reduction effect.

On the other hand, the degree of dysmenorrhea is measured through abdominal writhing, and generally, an increase in abdominal writhing response means an increase in abdominal pain (Yang et al., J Agr Food Chem. 2004, 52: 6787-93.).

Specifically, 3 minutes after oxytocin injection, rats were placed in a separate polycarbonate box (280 x 420 x 180 mm) and abdominal writhing was recorded for 30 minutes. For the accuracy of the results, two experimenters were recorded in a double-blind manner.

As a result, as shown in Figure 5, the dysmenorrhea control group, compared to the normal control group after the oxytocin administration, the writhing symptoms increased, it was confirmed that this increase was increased by 3815.00% compared to the normal control group.

On the other hand, indomethacin 5 mg / kg administration group and LF 500 mg / kg administration group, it was confirmed that the degree of struggle is reduced compared to the menstrual pain control group. Specifically, it was confirmed that the degree of writhing decreased -44.57 and -23.37%, respectively, compared to the menstrual pain control group.

In particular, even in the BH 500, 250 and 125 mg / kg administration group, it was confirmed that the degree of struggle is reduced compared to the menstrual pain control group. In addition, it was confirmed that the dose-dependent writhing reduction effect in the three BH-administered group, the degree of writhing decreased -42.78, -33.08 and -23.88%, respectively, compared to the menstrual pain control group.

Furthermore, it was confirmed that the BH 500 mg / kg administration group showed similar or better abdominal stiffness reduction effect than the indomethacin 5 mg / kg administration group and the LF 500 mg / kg administration group.

Based on the above results, the dagger fruit extract reduces abdominal pain in menstrual cramps induced rats, and in particular, exhibits a similar or better abdominal pain reduction effect than indomethacin or sterling silver extract, which is well known as a menstrual painkiller. It can be seen that it can be usefully used as a prophylactic or therapeutic substance of.

Example  4. Identify the analgesic effect mechanism of BH on menstrual pain

Example  4-1. Identify the effect of inhibiting uterine hyperemia and enlargement

In order to confirm the mechanism of analgesic effect of BH on rats induced by menstrual pain by estradiol benzoate and oxytocin, the effect of inhibiting uterine hyperemia and edema was confirmed.

Oxidative stress or inflammation, on the other hand, is one of the important etiologies of the development of menstrual cramps, which leads to uterine hyperemia and swelling, resulting in an increase in uterine weight (Chen L et al., J Sci Food Agric., 2014, 94: 180- 8.).

Specifically, 1 hour after oxytocin injection, rats were sacrificed and uterine weights were measured at g levels (absolute wet weight). In order to reduce individual differences, relative weight of the uterus (% of body weight) was calculated using the weight at the time of sacrifice as shown in Equation 3 below.

[Equation 3]

Relative weight of the uterus (% of body weight)

= ((Absolute wet weight of uterus / body weight at sacrifice (date of the last 10 test substances) × 100)

As a result, as shown in Figures 6 and 7, in the menstrual pain control group, it was confirmed that the symptoms of uterine hyperemia and edema were shown as compared with the normal control group, and the relative uterine weight was increased by 93.94% compared to the normal control group. It was.

On the other hand, indomethacin 5 mg / kg administration group and LF 500 mg / kg administration group, it was confirmed that the symptoms of uterine hyperemia and edema compared to the menstrual pain control group, the relative uterine weight of -37.44 and-respectively A 24.35% decrease was confirmed.

In particular, in the case of BH 500, 250 and 125 mg / kg administration group, it was confirmed that the symptoms of uterine hyperemia and edema compared to the menstrual pain control group. In addition, it was confirmed that the three BH-administered groups showed a dose-dependent decrease in uterine hyperemia and edema symptoms, and the relative uterine weights were -38.58, -34.55, and -25.01% lower than those of the menstrual pain control group, respectively.

Furthermore, it was confirmed that the BH 500 mg / kg administration group showed a similar or better uterine weight reduction effect than the indomethacin 5 mg / kg administration group and the LF 500 mg / kg administration group.

Based on the above results, Taraxacum alba extract reduces uterine weight by reducing uterine hyperemia and swelling in rats with dysmenorrhea, and especially uterus similar or better than indomethacin or sterling silver extract, which is well known as a menstrual painkiller. Since it shows a weight reduction effect, it can be seen that it can be usefully used as a preventive or therapeutic substance for menstrual pain.

Example  4-2. Confirmation of Reduction Effect of Lipid Peroxidation in Uterine Tissue

In order to confirm the mechanism of analgesic effect of BH on rats induced by menstrual pain by estradiol benzoate and oxytocin, the effect of reducing uterine lipid peroxidation was confirmed by measuring the malondialdehyde (MDA) content.

Oxidative stress is one of the causes of menstrual cramps, and MDA is the final product of lipid peroxidation and is usefully used as an indicator of lipid peroxidation (Chen L et al., J Sci Food Agric., 2014, 94: 180). -8.).

Specifically, the right uterine horn tissues were separated from the rats whose uterine weight was measured according to Example 4-1, and their weight was measured. Thereafter, a homogenate of uterine keratoplasty tissues was obtained in the same manner as in Example 2-1, and MDA was measured therefrom, and the results are shown in Table 13 below.

division Right cervical tissue
(Left uterine horn tissues) MDA content (nM / g protein) Control Normal control   2.62 ± 1.14 Menstrual pain control 22.53 ± 10.34 ^a Comparison Indomethacin
5 mg / kg 7.15 ± 1.87 ^ac LF
500 mg / kg 12.25 ± 2.02 ^ac Test group

BH
500 mg / kg
6.74 ± 1.34 ^ac BH
250 mg / kg 9.71 ± 1.39 ^ac BH
125 mg / kg 12.06 ± 1.23 ^ac

In this case, ^a shown in Table 13 is MW test indicates that p <0.01 compared to the normal control, ^c is The MW assay indicates that p <0.01 compared to menstrual pain control.

 As a result, as shown in Table 13, in the case of the menstrual pain control group, the MDA content, that is, the peroxidation of the uterine lipids was significantly increased compared to the normal control group, and this peroxidation was confirmed to increase by 760.15%.

However, in the indomethacin 5 mg / kg and LF 500 mg / kg groups, the peroxidation of uterine lipids was significantly reduced compared to the menstrual pain control group, and this peroxidation decreased -68.25 and -45.64%, respectively, compared to the menstrual pain control group. It was confirmed.

In particular, even in the BH 500, 250 and 125 mg / kg administration group, it was confirmed that the peroxidation of uterine lipids, respectively, compared to the menstrual pain control group, and the degree of peroxidation was -70.07, -56.90 and -46.46%, respectively, compared to the menstrual pain control group. It was confirmed that the decrease.

Furthermore, the BH 500 mg / kg group showed better peroxidation reduction effect than the amitrifthilin 10 mg / kg group and the LF 500 mg / kg group, and the lower dose of BH 125 mg / kg group than the LF 500 mg / kg group It was confirmed that it shows an excellent effect of reducing the degree of peroxidation.

Through the above results, the Taraxacum fruit extract reduces the MDA content of rats, that is, the peroxidation of uterine lipids, and in particular, exhibits a similar or better reducing effect of uterine lipid peroxidation than indomethacin or sterling gold extract, which is well known as an analgesic agent. In addition, it can be seen that it can be usefully used as a preventive or therapeutic substance for menstrual pain.

Example  4-3. Confirmation of functional enhancement effect of antioxidant defense system in uterine tissue

In order to confirm the mechanism of analgesic effect of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, the functional improvement effect of the uterine antioxidant defense system was confirmed by measuring the change in the activity of GSH content, SOD and CAT.

Specifically, for the homogenate of the uterine tissue prepared in Example 4-2, the change of GSH content, SOD and CAT activity was confirmed by the method according to Example 2-2. Then, the results are shown in Table 14 below.

division Right cervical tissue GSH content
(nM / protein g) SOD activity
(U / protein mg) CAT active
(U / protein mg) Control
Normal control 12.46 ± 4.06 358.30 ± 78.45 114.26 ± 26.55 Menstrual pain control 4.05 ± 1.00 ^a 173.30 ± 23.81 ^a 38.22 ± 11.84 ^a Comparison
Indomethacin
5 mg / kg 8.17 ± 1.69 ^ac 278.20 ± 39.22 ^ac 75.86 ± 12.37 ^ac LF
500 mg / kg 6.27 ± 1.37 ^ac 220.70 ± 30.32 ^ac 54.77 ± 10.61 ^ad Test group


BH
500 mg / kg
8.34 ± 1.50 ^ac 284.30 ± 30.22 ^bc 77.08 ± 12.67 ^ac BH
250 mg / kg 7.43 ± 1.71 ^ac 245.10 ± 36.75 ^ac 65.82 ± 10.47 ^ac BH
125 mg / kg 6.36 ± 1.06 ^ac 224.30 ± 32.56 ^ac 57.09 ± 11.53 ^ac

In this case, ^a shown in Table 14 is MW test indicates that p <0.01 compared to the normal control, ^b is The MW assay indicates p <0.05 compared to the normal control group, ^c indicates p <0.01 compared to the menstrual pain control group as a result of the MW assay, and ^d indicates p <0.05 compared to the menstrual pain control group as a result of the MW assay.

As a result, as shown in Table 14, in the case of menstrual pain control group, GSH content, SOD activity and CAT activity, that is, antioxidant activity is significantly reduced compared to the normal control group, -67.47%, -51.63% and -66.55%, respectively. It was confirmed that the decrease.

However, the indomethacin 5 mg / kg administration group and LF 500 mg / kg administration group, it was confirmed that the antioxidant activity of the uterus compared to the menstrual pain control group. Specifically, in the indomethacin-administered group, the GSH content, the SOD activity, and the CAT activity change amount was increased by 101.68, 60.53 and 98.49%, respectively. In addition, in the LF-administered group, it was confirmed that the GSH content, the SOD activity and the CAT activity change amount increased by 54.84, 27.35 and 43.31%, respectively.

In particular, in the case of BH 500, 250 and 125 mg / kg administration group, it was confirmed that the antioxidant activity of the spinal cord is increased, and dose-dependent antioxidant activity is increased compared to the menstrual pain control group. Specifically, GSH content, SOD activity and CAT activity were 105.82, 64.05 and 101.67% for the BH 500 mg / kg administration group, respectively; 83.32, 41.43 and 72.21% for the BH 250 mg / kg dose group, respectively; BH 125 mg / kg administration group was found to increase 57.03, 29.43 and 49.36% respectively.

Furthermore, the BH 500 mg / kg group showed better antioxidative activity than the indomethacin 5 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group was superior to the LF 500 mg / kg group. It was confirmed that the antioxidant activity increases.

Through the above results, the Taraxacum berry extract increases the rat's GSH content, SOD activity, and CAT activity, that is, antioxidant activity of the uterus, and is particularly effective in increasing antioxidant activity than indomethacin or gold silver extract, which are well known as analgesics. Since it can be seen that it can be usefully used as a material for preventing or treating menstrual pain.

Example  4-4. Inflammatory and intrauterine tissue Proinflammatory  Confirmation of the effect of reducing the expression

In order to confirm the mechanism of analgesic effect of BH on rats induced by menstrual cramps by estradiol benzoate and oxytocin, RT-reducing effects of inflammatory and proinflammatory factors, ie NF-κB and COX-2, in uterine tissue It was confirmed by PCR analysis.

On the other hand, the expression of inflammatory and proinflammatory factors such as NF-κB and COX-2 triggers an inflammatory response and causes pain (Liang F et al., Saudi Pharm J. 2017, 25: 649-54.).

Specifically, the homogenate of cervical tissue prepared in Example 4-2, RT-PCR was performed by the method according to Example 2-3, and primers as shown in Table 15 were used. RT-PCR results are shown in Table 16 below.

Target factor 5 '-3' order NCBI accession No. NF-κB Forward direction GCGCATCCAGACCAACAATAA
(SEQ ID NO: 11) NM_001276711 Reverse GCCGAAGCTGCATGGACACT
(SEQ ID NO: 12) COX-2 Forward direction CTGCATGTGGCTGATGTCATC
(SEQ ID NO: 13) S67722 Reverse AGGACCCGTCATCTCCAGGGTAATC
(SEQ ID NO: 14)

division
Right cervical tissue NF-κB COX-2 Control
Normal control  1.01 ± 0.8 0.98 ± 0.12 Menstrual pain control 4.80 ± 1.14 ^a 2.62 ± 0.46 ^a Comparison
Indomethacin
5 mg / kg 2.23 ± 0.59 ^ab 1.44 ± 0.32 ^ab LF
500 mg / kg 3.29 ± 0.46 ^ab 1.97 ± 0.13 ^ab Test group


BH
500 mg / kg
2.32 ± 0.47 ^ab 1.40 ± 0.15 ^ab BH
250 mg / kg 2.95 ± 0.58 ^ab 1.70 ± 0.35 ^ab BH
125 mg / kg 3.28 ± 0.41 ^ab 1.95 ± 0.21 ^ab

In this case, ^a shown in Table 16 is MW test indicates that p <0.01 compared to the normal control, ^b is MW assay results indicate that p <0.01, respectively, compared to menstrual pain control group.

As a result, as shown in Table 16, in the case of menstrual pain control group, the mRNA expression levels of NF-κB and COX-2, that is, the expression of inflammatory and proinflammatory factors, are significantly increased compared to the normal control group. It was confirmed that they were 376.64 and 166.02%, respectively.

However, in the indomethacin 5 mg / kg administration group and LF 500 mg / kg administration group, it was confirmed that the expression of the factor is reduced compared to the menstrual pain control group. Specifically, it was confirmed that the mRNA expression levels of NF-κB and COX-2 in the indomethacin-administered group decreased by -53.49 and -44.93%, respectively. In addition, in the LF-administered group, it was confirmed that the mRNA expression levels of NF-κB and COX-2 decreased -31.37 and -24.55%, respectively.

In particular, even in the BH 500, 250 and 125 mg / kg administration group, it was confirmed that the expression of the factor in the uterus compared to the menstrual pain control group. Specifically, mRNA expression levels of NF-κB and COX-2 were -51.57 and -46.35% for the BH 500 mg / kg administration group, respectively; -38.58 and -34.91% for the BH 250 mg / kg dose group, respectively; BH 125 mg / kg administration group was confirmed to decrease -31.51 and -25.62%, respectively.

Furthermore, the BH 500 mg / kg group showed a similar or better expression reduction effect of the activating factor than the indomethacin 5 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group also received the LF 500 group. It was confirmed to show a similar or better expression reduction effect than the mg / kg administration group.

Based on the above results, the Taraxacum fruit extract reduces the amount of mRNA expression of NF-κB and COX-2 in the rat uterus, ie, the expression of inflammatory and proinflammatory factors, and particularly the indomethacin or gold silver extract, which are well known as analgesics. Since it shows a similar or better effect of reducing the expression of inflammatory and proinflammatory factors, it can be seen that it can be usefully used as a material for preventing or treating pain.

Example  4-5. Identify the effect of reducing inflammation in the uterine tissue

Example  4-5-1. Confirmation of histopathological changes

In order to confirm the mechanism of analgesic effect of BH on rats induced by menstrual pain by estradiol benzoate and oxytocin, the effect of reducing inflammation in uterine tissue was confirmed through histopathological methods.

Specifically, the right uterine angle was cut out and fixed with 10% formalin, and then inserted into paraffin to make 3-4 μm sections, followed by HE staining with hematoxylin and eosin. Then, histopathological morphology of each sample was observed with an optical microscope (Model 80i, Nikon, Tokyo, Japan). The total thickness of the uterus (㎛) and mucosal thickness (㎛), the number of inflammatory cell infiltration in the mucosa (cells / mucosal mm ^2), including automatic image analyzer computer-based (i Solution FL ver 9.1, IMT i -solution Inc , Vancouver, Quebec, Canada), and the results are shown in Table 17 below.

division Right cervical tissue Full thickness
(Μm) Mucosa thickness
(Μm) Inflammatory cells
(Cell / mucosa mm ² ) Control
Normal control 1886.71 ± 161.55 725.96 ± 87.72  106.60 ± 32.95 Menstrual pain control 3431.51 ± 361.77 ^d 1282.09 ± 232.17 ^a 809.80 ± 146.76 ^d Comparison
Indomethacin
5 mg / kg 2520.51 ± 157.31 ^de 838.81 ± 76.38 ^bc 188.00 ± 26.80 ^de LF
500 mg / kg 2998.11 ± 113.41 ^de 1043.52 ± 102.81 ^ac 466.60 ± 136.51 ^de Test group


BH
500 mg / kg
2576.26 ± 225.41 ^de 837.89 ± 74.33 ^bc 189.10 ± 42.62 ^de BH
250 mg / kg 2846.03 ± 152.91 ^de 985.32 ± 104.57 ^ac 259.10 ± 66.57 ^de BH
125 mg / kg 2942.25 ± 122.80 ^de 1029.56 ± 105.21 ^ac 448.20 ± 93.30 ^de

In this case, ^a and ^b shown in Table 17 indicates that p <0.01 and p <0.05, respectively, compared to the normal control as a result of the LSD assay, ^c is As a result of the LSD assay, p <0.01 indicates that the menstrual pain control group, ^d indicates that p <0.01 compared to the normal control group, and ^e indicates that p <0.01 compared to the menstrual pain control group.

As a result, as shown in Table 17 and FIG. 8, in the case of the menstrual pain control group, it was confirmed that the infiltration of inflammatory cells in the uterine mucosa and the related inflammatory edema were significantly increased compared to the normal control group. Specifically, in the case of the menstrual pain control group, the change in the total thickness of the uterine horn, the thickness of the uterine horn mucosa and the number of inflammatory cells infiltrated into the uterine horn mucosa were increased by 81.88, 76.61 and 659.66%, respectively.

However, indomethacin 5 mg / kg administration group and LF 500 mg / kg administration group, it was confirmed that the degree of inflammation is reduced compared to the menstrual pain control group. Specifically, in the indomethacin-administered group, the change in the total thickness of the uterine horn, the thickness of the uterine horn and the number of inflammatory cells infiltrated into the mucosa were -26.55, -34.57 and -76.78%, respectively. In addition, the LF-administered group was found to decrease -12.63, -18.61 and -42.38%, respectively.

In particular, in the case of BH 500, 250 and 125 mg / kg administration group, it was confirmed that the degree of inflammation decreases compared to the menstrual pain control, and the degree of inflammation decreases in a dose-dependent manner. Specifically, the change in the total thickness of the uterine horn, the thickness of the uterine horn and the number of inflammatory cells infiltrated into the mucosa were -24.92, -34.65 and -76.65% for the BH 500 mg / kg administration group, respectively; -17.06, -23.15 and -68.00% for the BH 250 mg / kg dose group, respectively; In the case of BH 125 mg / kg administration group it was confirmed that the -14.26, -19.70 and -44.65% decrease respectively.

Furthermore, BH 500 mg / kg group showed better inflammation reduction effect than indomethacin 5 mg / kg group and LF 500 mg / kg group, and low dose BH 125 mg / kg group had better inflammation than LF 500 mg / kg group. It was confirmed that the reduction effect.

Based on the above results, the Taraxacum berry extract reduces the degree of inflammation in the rat uterus, and is particularly useful as a prophylactic or therapeutic substance for menstrual pain since it exhibits a better inflammation reduction effect than the well known indomethacin or sterling silver extract. It could be used to make.

Example  4-5-2. Identify immunohistochemical changes

In order to confirm the mechanism of analgesic effect of BH on rats induced by estradiol benzoate and oxytocin, the effect of reducing inflammation in uterine tissue was confirmed by immunohistochemical method.

Specifically, reactive inflammatory cells for the proinflammatory cytokines TNF-α and iNOS present in the right uterine keratomucosa were purified with ABC and peroxidase substrate kits (Vector Labs, Burlingame, CA, USA). Confirmation was made using the primary antibody. The number of TNF-α and iNOS labeled cells (cells / mucosa mm ² ) was calculated using a computer-based automated image analyzer and the results are shown in Table 18 below. At this time, the cells that occupy 20% or more of the reactivity to TNF-α and iNOS, respectively, were considered as reactive (positive) cells.

division
Right cervical tissue TNF-α positive cells
(Cell / mucosa mm ² ) iNOS positive cells
(Cell / mucosa mm ² ) Control
Normal control 22.40 ± 12.29 20.00 ± 10.37 Menstrual pain control 446.80 ± 101.78 ^d 520.60 ± 142.31 ^d Comparison
Indomethacin
5 mg / kg 80.40 ± 21.88 ^de 109.00 ± 26.34 ^de LF
500 mg / kg 287.30 ± 74.25 ^de 306.00 ± 90.71 ^de Test group


BH
500 mg / kg
91.10 ± 14.30 ^de 120.50 ± 44.52 ^de BH
250 mg / kg 145.10 ± 49.68 ^de 185.60 ± 76.37 ^de BH
125 mg / kg 274.20 ± 51.70 ^de 296.20 ± 71.11 ^de

In this case, ^a and ^b shown in Table 18 indicates that p <0.01 and p <0.05, respectively, as compared to the normal control as a result of the LSD assay, ^c is As a result of the LSD assay, p <0.01 indicates that the menstrual pain control group, ^d indicates that p <0.01 compared to the normal control group, and ^e indicates that p <0.01 compared to the menstrual pain control group.

As a result, as can be seen in Table 18 and Figure 9, in the case of menstrual pain control, it was confirmed that the number of TNF-α and iNOS immune response cells significantly increased compared to the normal control. Specifically, in the case of the menstrual pain control group, the change in the number of TNF-α and iNOS immune-responsive cells infiltrating the uterine mucosa was 1894.64 and 2503.00%, respectively, compared to the normal control group.

However, in the indomethacin 5 mg / kg administration group and LF 500 mg / kg administration group, it was confirmed that the number of TNF-α and iNOS immune response cells compared to the menstrual pain control group. Specifically, in the indomethacin-administered group, changes in the number of TNF-α and iNOS immune-responsive cells decreased by -82.01 and -79.06%, respectively. In addition, the LF-administered group was found to decrease -35.70 and -41.22%, respectively.

In particular, even in the BH 500, 250 and 125 mg / kg administration group, it was confirmed that the number of TNF-α and iNOS immune response cells, and the number of immune response cells in a dose-dependent manner compared to the menstrual pain control group. Specifically, the degree of change in the number of TNF-α and iNOS immune-responsive cells was -79.61 and -76.85% for the BH 500 mg / kg administration group, respectively; -67.52 and -64.35% for the BH 250 mg / kg dose group, respectively; BH 125 mg / kg administration group was confirmed that the -38.63 and -43.10% decrease respectively.

Furthermore, the BH 500 mg / kg group showed a similar or superior effect of reducing the number of immune response cells as the indomethacin 5 mg / kg group and the LF 500 mg / kg group, and the low dose BH 125 mg / kg group also received LF 500 mg. It was confirmed that the effect of reducing the number of immune response cells superior to the / kg administration group.

Through the above results, the dagger fruit extract reduces the number of immune response cells in the rat uterine mucosa, that is, the degree of inflammation, and in particular, exhibits a better inflammation reduction effect than the indomethacin or gold silver extract, which are well known as analgesics. Therefore, it can be seen that it can be usefully used as a material for preventing or treating menstrual pain.

From the above description, those skilled in the art will appreciate that the present application can be implemented in other specific forms without changing the technical spirit or essential features. In this regard, it should be understood that the embodiments described above are exemplary in all respects and not limiting. The scope of the present application should be construed that all changes or modifications derived from the meaning and scope of the following claims and equivalent concepts rather than the detailed description are included in the scope of the present application.

<110> H & K Bioscience Co., Ltd. <120> Compositions for preventing or treating pain comprising extracts          of Lonicera caerulea <130> KPA170393-KR <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Iba-1 F-primer <400> 1 cagactgcca gcctaagaca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Iba-1 R-primer <400> 2 aggaattgct tgttgatccc 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFAP F-primer <400> 3 agaaaaccgc atcaccattc c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GFAP R-primer <400> 4 cagggctcca ttttcaatct g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F-primer <400> 5 gctaggactg gataagcagg g 21 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R-primer <400> 6 gccaaatccg ttcacaccg 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha F-primer <400> 7 ctactgaact tcggggtgat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha R-primer <400> 8 cttggtggtt tgtgagtgtg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOS F-primer <400> 9 agcctagtca actgcaagag 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> iNOS R-primer <400> 10 tcttgtattg ttgggctgag a 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NF-kappaB F-primer <400> 11 gcgcatccag accaacaata a 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NF-kappaB R-primer <400> 12 gccgaagctg catggacact 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> COX-2 F-primer <400> 13 ctgcatgtgg ctgatgtcat c 21 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COX-2 R-primer <400> 14 aggacccgtc atctccaggg taatc 25

Claims (10)

Pharmaceutical composition for the prevention or treatment of pain, including the extract of Lonicera caerulea or fractions thereof.
The composition of claim 1, wherein the dagger is a fruit of a dagger.
The composition of claim 1, wherein the extract is prepared by extracting the wood from water, at least one solvent selected from the group consisting of alcohols having 1 to 4 carbon atoms and mixed solvents thereof.
The method of claim 1, wherein the fraction is prepared by dividing the powder of the dagger with a solvent selected from the group consisting of water, alcohol having 1 to 4 carbon atoms, hexane (Hexane), ethyl acetate and mixed solvents thereof. That is, the composition.
The composition of claim 1, wherein the pain is one or more selected from the group consisting of nociceptive pain, psychogenic pain, inflammatory pain, and neuropathic pain. .
The method of claim 5, wherein the pain is cancer pain, postoperative pain, trigeminal neuralgia pain, idiopathic pain, diabetic neuropathic pain, At least one selected from the group consisting of migraine and menstrual pain, composition.
The composition of claim 1, wherein the composition comprises the Daugung extract or fractions thereof in an amount of 0.001 to 80% by weight based on the total weight of the composition.
A method of treating pain, comprising administering the composition of any one of claims 1 to 7 to a subject having or suspected of having a pain other than a human.
A food composition for the prevention or amelioration of pain, comprising the extract of Lonicera caerulea or fractions thereof.
A quasi-drug composition for the prevention or amelioration of pain, which includes an extract of Lonicera caerulea or fractions thereof.

Images