WO2019032999A1 - PHOTORECEPTOR GENE MODULATOR PHOTOREGULIN 3 FOR THE TREATMENT OF RETINAL DISEASE - Google Patents
PHOTORECEPTOR GENE MODULATOR PHOTOREGULIN 3 FOR THE TREATMENT OF RETINAL DISEASE Download PDFInfo
- Publication number
- WO2019032999A1 WO2019032999A1 PCT/US2018/046272 US2018046272W WO2019032999A1 WO 2019032999 A1 WO2019032999 A1 WO 2019032999A1 US 2018046272 W US2018046272 W US 2018046272W WO 2019032999 A1 WO2019032999 A1 WO 2019032999A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- retina
- retinal
- compound
- subject
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0048—Eye, e.g. artificial tears
Definitions
- sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification.
- the name of the text file containing the sequence listing is 67005_ST25.txt.
- the text file is 2 KB; was created on August 10, 2018; and is being submitted via EFS-Web with the filing of the specification.
- Retinitis pigmentosa is an inherited retinal degenerative disease with a prevalence of 1 to 3,000-5,000 births. More than 3,000 mutations in about 60 genes have been identified to be associated with RP. Most of these mutations are in genes essential for rod photoreceptor development and function. There is currently no effective medical therapy that slows or prevents rod degeneration in these individuals.
- Nrl rod-specific transcription factors
- Nr2e3 loss of function mutations in the rod-specific transcription factors Nr2e3 cause rods to acquire a more cone-like identity.
- Conditional knockout has shown that Nrl, is necessary even in mature rods to maintain their normal levels of gene expression.
- the invention provides a method for decreasing rod gene expression in a retina.
- the rod gene is Nrl, Nr2e3, Rho, or Gnatl.
- the invention provides a method for decreasing rhodopsin expression in a retina.
- contacting the retina comprises systemic administration or intravitreal injection.
- the retina is a retina of a human subject.
- the invention provides a method for treating a disease or condition treatable by decreasing rod gene expression in a retina.
- the invention provides a method of treating a retinal disease in a subject.
- the disease or condition or retinal disease is retinitis pigmentosa, retinal degeneration, macular degeneration, age-related macular degeneration, Stargardt's macular dystrophy, retinal dystrophy, Sorsby's fundus dystrophy, diabetic retinopathy, diabetic maculopathy, retinopathy of prematurity, and ischemia reperfusion related retinal injury.
- the disease or condition or retinal disease is retinitis pigmentosa.
- administering the compound comprises systemic administration or intravitreal injection.
- the subject is a human.
- FIGURE 1A illustrates the chemical structure of Photoregulin3 (PR3).
- FIGURE IB compares dose-response relationship of PR1 and PR3 on Rhodopsin mRNA expression in dissociated retinal cell cultures.
- FIGURE 1C compares dose-response relationship of PR1 and PR3 on Rhodopsin protein expression in dissociated retinal cell cultures.
- FIGURE ID shows intact retinas from Pl l mice were explanted in media containing DMSO or 0.3 uM PR3 for 3 DIV and then stained for S Opsin (green) and DAPI in a whole-mount preparation. Scale bar represents 50 ⁇ .
- FIGURE IE is a graph quantifying the effects of PR3 on S-opsin expression; treatment conditions were the same as those in FIGURE ID.
- S-opsin+ cones are predominantly present in the ventral retina of mice.
- FIGURE IF illustrates an isothermal titration calorimetric (ITC) study of PR3 binding to Nr2e3.
- Nr2e3 protein was expressed as a fusion protein from the expression vector pVP16. The fusion protein was incubated with TEV overnight at 4°C and then the His8-MBP tags were separated from Nr2e3 by ion exchange chromatography.
- ITC isothermal titration calorimetry
- 100 mM PR3 was injected into 20 mM Nr2e3 in a MicroCal ITC-200 (Malvern). ITC qualitatively showed a direct interaction between PR3 and Nr2e3, with an estimated K d of 67 ⁇ using a one site model.
- FIGURE 2B shows gene ontology analysis (http://geneontology.org/page/go- enrichment-analysis) results for largest changes (top 100) in gene expression assessed by RNA sequencing.
- FIGURE 2C compares electron microscope micrographs of retinal sections of wild type mice treated with 10 mg/kg PR3 or DMSO vehicle. Compared to controls, PR3 retinas have arrested inner and outer segment development and less compact heterochromatin in the ONL. Scale bars represent 10 ⁇ (top) and 2 ⁇ (bottom).
- FIGURE 3A illustrates the timeline of photoreceptor degeneration in the Rhodopsin P23H mouse and experimental design.
- FIGURE 3B compares immunofluorescence staining for Rhodopsin, S Opsin, Otx2, and Cone Arrestin on retinal sections from Rhodopsin P23H mice and demonstrates preservation of photoreceptors with PR3 treatment. Scale bar represents 50 ⁇ .
- FIGURE 3C compares counts for rows of DAPI+ cells in the central and peripheral ONL and show greater survival of photoreceptors with PR3 treatment (n > 7, *p ⁇ 0.05, Student's t-test).
- FIGURE 3D compares qPCR on whole retinas from Rhodopsin P23H mice treated with DMSO or PR3 and shows greater expression of photoreceptor genes Recoverin, Rhodopsin, and S Opsin with PR3 treatment (n > 6, *p ⁇ 0.05, Student's t-test).
- FIGURE 4B compares representative scotopic ERG waveforms from a single DMSO vehicle mouse.
- FIGURE 4C compares representative scotopic ERG waveforms from a single PR3 -treated mouse.
- FIGURE 4E compares representative photopic ERG waveforms from a single control (DMSO) mouse.
- FIGURE 4F compares representative photopic ERG waveforms from a single PR3 -treated mouse.
- the present invention provides methods for decreasing rod gene expression in a retina, methods for decreasing the protein products (e.g., rhodopsin) expressed by rod genes in a retina, methods for treating a disease or condition treatable by decreasing rod gene expression or their protein products in a retina, and methods for treating a retinal disease in a subject.
- the retina or subject are treated with Photoregulin3 (PR3) to achieve the advantageous result of decreasing rod gene expression, thereby decreasing the expression of their protein products, and consequently treating a disease or condition treatable by decreasing rod gene expression or their protein products.
- PR3 is effective for treating retinal diseases such as retinitis pigmentosa (RP).
- the invention provides a method for decreasing rod gene expression in a retina.
- the method includes contacting a retina with PR3, a compound of formul
- Rod genes whose expression are effectively reduced in the practice of the methods of the invention include Nrl, Nr2e3, Rho, Gnatl, and Pde6b.
- contacting the retina comprises systemic administration of the compound to the subject or intravitreal injection of the compound.
- the invention provides a method for reducing the expression of protein products derived from rod genes.
- the invention provides a method for decreasing rhodopsin expression in a retina.
- a retina is treated with a compound of formula (I) or a pharmaceutically acceptable salt thereof, as described above.
- treating the retina comprises systemic administration of the compound to the subject or intravitreal injection of the compound.
- methods are provided for treating a disease or condition treatable by decreasing rod gene expression, or their protein products, in a retina.
- the methods include administering to a subject in need thereof a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof, as described above.
- Representative diseases or conditions treatable by decreasing rod gene expression, or their protein products, in a retina include retinitis pigmentosa, retinal degeneration, macular degeneration, age-related macular degeneration, Stargardt's macular dystrophy, retinal dystrophy, Sorsby's fundus dystrophy, diabetic retinopathy, diabetic maculopathy, retinopathy of prematurity, and ischemia reperfusion related retinal injury.
- the treatable disease or condition is retinitis pigmentosa.
- administering the compound comprises systemic administration of the compound to the subject or intravitreal injection of the compound.
- the invention provides methods for treating a retinal disease in a subject.
- the methods include administering to a subject in need thereof a therapeutically effective amount of a compound having formula (I) or a pharmaceutically acceptable salt thereof, as described above.
- Representative retinal diseases treatable by the methods of the invention include retinitis pigmentosa, retinal degeneration, macular degeneration, age-related macular degeneration, Stargardt's macular dystrophy, retinal dystrophy, Sorsby's fundus dystrophy, diabetic retinopathy, diabetic maculopathy, retinopathy of prematurity, and ischemia reperfusion related retinal injury.
- the treatable disease or condition is retinitis pigmentosa.
- administering the compound comprises systemic administration of the compound to the subject or intravitreal injection of the compound.
- the term "therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as reduced levels of rod gene expression or their protein products.
- a therapeutically effective amount of a compound may vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the compound to elicit a desired response in the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response.
- a therapeutically effective amount is also one in which any toxic or detrimental effects of the administered compound are outweighed by the therapeutically beneficial effects.
- dosage values can vary with the severity of the condition to be alleviated.
- specific dosage regimens can be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.
- Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that can be selected by a medical practitioner.
- the amount of active compound in the composition can vary according to factors such as the disease state, age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, a single bolus can be administered, several divided doses can be administered over time or the dose can be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
- the administration of the compound can be a local administration (e.g., administration to the eye), or systemic administration to the subject.
- the term "subject” is intended to include mammalian organisms. Examples of subjects include humans and non-human mammals. In specific embodiments of the invention, the subject is a human.
- the terms "administering,” “contacting,” or “treating” include any method of delivery of a compounds or a pharmaceutical composition comprising the compound into a subject's system or to a particular region of the subject (e.g., eye).
- the invention provides methods for increasing cone gene expression, or their protein products, in a retina.
- a retina is treated or contacted with a compound having formula (I) or a pharmaceutically acceptable salt thereof, as described above.
- treating or contacting the retina comprises systemic administration of the compound to the subject or intravitreal injection of the compound.
- treating or contacting the retina comprises systemic administration of the compound to the subject or intravitreal injection of the compound.
- the invention provides a pharmaceutical composition that includes a pharmaceutically acceptable carrier and a compound of formula (I) or a pharmaceutically acceptable salt thereof.
- Suitable carriers include those suitable for administration to an animal (e.g., a human subject).
- Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (e.g., saline, dextrose) and dispersions.
- compositions of the invention can be orally administered, for example, with an inert diluent or carrier, enclosed in hard or soft shell gelatin capsule, or compressed into tablets.
- an inert diluent or carrier enclosed in hard or soft shell gelatin capsule, or compressed into tablets.
- the compounds and compositions can be combined with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
- the amount of active compounds in such therapeutically useful compositions is such that a suitable dosage is obtained.
- compositions of the invention can be administered parenterally.
- Solutions of the compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with additives, such as surfactants.
- Dispersions can also be prepared in in oils.
- Photoregulin3 or PR3 (a small molecule antagonist of Nr2e3a) useful in the methods of the invention.
- Nr2e3 is a retina-specific nuclear receptor and a key regulator of photoreceptor gene expression. Regulation of rod gene expression has emerged as a potential therapeutic strategy to treat retinal degenerative diseases like Retinitis Pigmentosa (RP).
- Photoregulinl (PR1) is a small molecule modulator of Nr2e3 that regulates the expression of photoreceptor-specific genes. Manipulation of photoreceptor gene expression with PR1 slows the progression of retinal degeneration in vitro in the Rho P23H and Pde6b Rdl models of RP. However, in vivo analyses with this series were limited by the compounds' potency, solubility, and stability in vivo.
- PR3 Photoregulin3
- rod photoreceptor gene expression e.g. Nrl, Rhodopsin, Gnatl
- RNA sequencing analysis To determine the effectiveness of PR3 as a potential therapy for RP, Rho P23H mice were treated with PR3 or vehicle from postnatal day 12-14 (PI 2- 14) until P20 and assessed retinal structure and function at P21.
- PR3 -treated Rho P23H mice had larger scotopic and photopic ERG responses than littermate controls, in addition to significantly decreased degeneration of photoreceptors.
- the PR3 treatment described herein demonstrates anatomical and functional preservation of the retina in Rho P23H mice, providing proof-of-concept of this therapeutic strategy for the treatment of RP.
- Nr2e3 In order to identify compounds that may target Nr2e3 a fructinant Nr2e3 in transfected CHO-S cells in a luciferase-based assay (PubChem Assay IDs: 602229, 624378, 624394, and 651849).
- a secondary screen for initial hits dissociated primary retinal cell cultures were used and assayed Rhodopsin, because it is a well- defined target of Nr2e3 signaling and is expressed at high levels exclusively in rod photoreceptors.
- Retina were dissociated from postnatal day 5 (P5) mice and cultured them in media containing the small molecules.
- Nr2e3 Mutations in Nr2e3 result in an increased number of S Opsin+ photoreceptors as well as a reduction in rod gene expression.
- PR3 treatment also affects cone gene expression, intact retinas were explanted from Pl l wild type mice in media containing DMSO or PR3 for 3 days. Intact retinas were used for this experiment to assess changes in dorsal and ventral retina independently. After fixation and whole mount immunostaining, S Opsin+ cells were counted in the ventral retina. Similar to Nr2e3 mutations, treatment with PR3 resulted in an increase in the number S Opsin+ cells in the ventral retina (FIGURES ID- IE).
- PR3 was initially identified as a chemical modulator of Nr2e3 in a luciferase- based assay that identified ligands by disruption of the Nr2e3-NCOR dimer complex (PubChem Assay IDs: 602229, 624378, 624394, and 651849).
- isothermal titration calorimetry ITC was used. Consistent with other assays, ITC qualitatively showed a direct interaction between PR3 and Nr2e3 (estimated K d of 67 ⁇ using one site model; FIGURE IF).
- Nr2e3 signaling is important for rod photoreceptor cell fate, development and maturation, and maintenance of expression.
- wild type mice were systemically treated (intraperitoneal injection) with PR3 or vehicle at P12.
- PR3 or vehicle At P13, 24h after the injection, the retinas were collected for global transcriptome analysis by RNA sequencing. A decrease in most rod photoreceptor-specific transcripts was observed (FIGURES 2A and 2B). Similar to conditional knockout of Nrl and knockdown of Nrl by CRISPR/Cas9 in postmitotic photoreceptors, large and global increases in cone gene expression were not observed.
- genes expressed in both rod and cone photoreceptors like Crx and Otx2, that are upstream of Nr2e3 showed no difference in expression between control and PR3 treatment.
- changes in genes expressed in other retinal cell types were not observed, indicating specificity of the PR3 for photoreceptors, and increases in cell death genes or cell stress genes were not observed, indicating that the compound is not toxic to retinal cells.
- Electron microscopy was used to perform an ultrastructural analysis of photoreceptor morphology after PR3 treatment. Wild type mice were intraperitoneally injected with vehicle or PR3 for 3 consecutive days starting at PI 1. At PI 4, 24h after the third injection, the mice were euthanized and processed their retinas for EM. Photoreceptor outer segments begin to form during the second and third postnatal week; genetic loss-of-function mutations in Nr2e3 lead to an impairment in rod outer segment formation. PR3 treatment prevented outer segment development; outer segments of PR3- treated photoreceptors were strikingly truncated compared to controls (FIGURE 2C).
- Rho P23H Rho P23H mice
- Rho P23H mice most rod photoreceptors undergo apoptosis by the end of the third postnatal week.
- Rho P23H mice were treated with PR3 or vehicle from P12-P14 until P21, during the period of rod photoreceptor death (FIGURE 3 A).
- visual function was assessed with ERGs and euthanized the mice for histological and qPCR analyses.
- control Rho P23H mice had only 2-3 rows of photoreceptors remaining in their ONL (FIGURES 3B and 3C). Rods were sparse and there were few remaining cones (S Opsin+ and Cone Arrestin+ photoreceptors).
- mice C57B1/6 (Jackson Stock No: 000664) and Rho P23H (Jackson Stock No: 017628) were used at the indicated ages. All mice were housed by the Department of Comparative Medicine at the University of Washington and protocols were approved by the University of Washington Institutional Animal Care and Use Committee. The research was carried out in accordance with the ARVO statement for the Use of Animals in Ophthalmic and Vision Research.
- Photoregulin3 was identified by searching previous small molecule screens with SciFinder and PubChem for Nr2e3 interacting molecules. It was initially obtained from ChemDiv and then synthesized and purified in large quantities in the lab after initial screening. For in vivo experiments, mice were injected intraperitoneally with PR3 dissolved in DMSO at 10 mg/kg.
- Retinas were dissected from postnatal day 5 (P5) mice and dissociated by treatment with 0.5% Trypsin diluted in calcium- and magnesium-free HBSS from 10 minutes at 37°C. Trypsin was inactivated by adding an equal volume of FBS and cells were pelleted by centrifugation at 4°C and resuspended in media (Neurobasal-A containing 1% FBS, 1% N 2 , 1% B27, 1% Pen/Strep, and 0.5% L-glutamine). For qPCR, cells were plated into 24-well tissue culture plates at a density of 1 retina/well (see qPCR section below).
- RNA from retinas was isolated using TRIzol (Invitrogen) and cDNA was synthesized using the iScript cDNA synthesis kit (Bio-Rad). SSO Fast (Bio-Rad) was used for quantitative real-time PCR. For analysis, values were normalized to Gapdh (ACt) and AACt between DMSO and compound-treated samples was expressed as percent of DMSO treated controls (100*2 A AACt). Student's t-tests were performed on ACt values.
- Gapdh F: GGCATTGCTCTCAATGACAA (SEQ ID NO: 1)
- R CTTGCTCAGTGTCCTTGCTG (SEQ ID NO: 2)
- Rhodopsin F: CCCTTCTCCAACGTCACAGG (SEQ ID NO: 3)
- Intact retinas without RPE from Pl l C57B1/6 mice were explanted on 0.4 ⁇ pore tissue culture inserts in media (Neurobasal-A containing 1% FBS, 1% N 2 , 1% B27, 1% Pen/Strep, and 0.5% L-Glutamine) containing DMSO or 0.3 ⁇ Photoregulin3. Full media changes were performed every other day. Explants were fixed with 4% PFA for 20 minutes at room temperature, blocked with blocking solution (10% Normal Horse Serum and 0.5% Triton X-100 diluted in IX PBS) for 1 hour at room temperature, and incubated overnight at 4°C with primary antibodies generated against S Opsin (1 :400, SCBT, sc-14363).
- the explants were washed with IX PBS, and then incubated with a species appropriate, fluorescently-labeled secondary antibody diluted in blocking solution overnight, followed by washing with IX PBS and DAPI staining.
- the explants were transferred to slides and coverslipped with Fluoromount-G (SouthernBiotech).
- Fluoromount-G SouthernBiotech
- An Olympus FluoView F VI 000 was used for confocal microscopy. Cells were counted from single plane confocal images taken at fixed settings.
- Eyecups were fixed in 4% PFA in IX PBS for 20 minutes at room temperature and then cryoprotected in 30% sucrose in IX PBS overnight at 4°C. Samples were embedded in OCT (Sakura Finetek), frozen on dry ice, and then sectioned at 16-18 ⁇ on a cryostat (Leica).
- Nr2e3 protein (aa 90-410) was expressed as a His8-MBP-TEV fusion protein from the expression vector pVP16 (DNASU Plasmid ID: HsCD00084154).
- E. coli BL21 (DE3) cells were grown to an OD600 of 1, and then induced with 0.2 mM IPTG at 16°C overnight. Cells were harvested, resuspended in extract buffer (20 mM Tris pH 8, 200 mM NaCl, 10% glycerol, 5 mM 2-mercaptoethanol, and saturated PMSF diluted 1 : 1,000), and then lysed by sonication on ice.
- Lysates were centrifuged at 4°C and the supernatant was loaded onto an equilibrated column containing 5 mL of Ni-NTA agarose (Qiagen).
- the column was washed with 20 mM Tris pH 8, 1M NaCl, 5 mM 2-mercaptoethanol, and 40 mM imidazole, and then the protein was eluted with 20 mM Tris pH 8, 200 mM NaCl, 5 mM 2-mercaptoethanol, and 100 mM imidazole.
- the fusion protein was incubated with TEV overnight at 4°C and then the His8-MBP tags were separated from NR2E3 by ion exchange chromatography.
- RNA from retinas was isolated using TRIzol (Invitrogen) and total RNA integrity was checking using an Agilent 4200 TapeStation and quantified using a Trinean DropSense96 spectrophotometer.
- RNA-seq libraries were prepared from total RNA using the TruSeq RNA Sample Prep kit (Illumina) and a Sciclone NGSx Workstation (PerkinElmer). Library size distributions were validated using an Agilent 4200 TapeStation. Additional Library quality control, blending of pooled indexed libraries, and cluster optimization were performed using Life Technologies' Invitrogen Qubit Fluorometer.
- RNA-seq libraries were pooled (4-plex) and clustered onto a flow cell lane. Sequencing was performed using an Illumina HiSeq 2500 in rapid mode employing a paired-end, 50 base read length (PE50) sequencing strategy.
- mice were euthanized by C0 2 , and then perfused with 0.9% saline followed by 4% glutaraldehyde in 0.1 M sodium cacodylate buffer. Eye cups were fixed in 4% glutaraldehyde in 0.1 M sodium cacodylate buffer, washed with 0.1 M sodium cacodylate buffer, and then post-fixed in 2% osmium tetroxide. After fixation, eye cups were washed with water, dehydrated through a graded series of ethanol, incubated in propylene oxide and then epon araidite, polymerized overnight at 60 °C, and then sectioned at a thickness of 70 nm. Images were obtained using a JEOL JEM- 1230 electron microscope.
- mice were dark adapted overnight (12-18 hours). All subsequent steps were carried out under dim red light. Mice were placed in an anesthesia chamber and anesthetized with 1.5-3% isoflurane gas. Mice were transferred from the anesthesia chamber to a heated platform maintained at 37°C and positioned in a nose cone to maintain a constant flow of isoflurane. Drops of 1% tropicamide and 2.5% phenylephrine hydrochloride were applied to each eye. A reference needle electrode was placed subdermally on the top of the head and a ground needle electrode was placed subdermally in the tail. Drops of 1.5% methyl cellulose were applied to each eye and contact lens electrodes were placed over each eye.
Landscapes
- Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Ophthalmology & Optometry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201880051862.3A CN111093657A (zh) | 2017-08-10 | 2018-08-10 | 用于治疗视网膜疾病的光感受器基因调节剂光调节素3 |
| CA3072175A CA3072175A1 (en) | 2017-08-10 | 2018-08-10 | Photoreceptor gene modulator photoregulin 3 for treatment of retinal disease |
| JP2020506984A JP2020530459A (ja) | 2017-08-10 | 2018-08-10 | 網膜の疾患を処置するための光受容体遺伝子のモジュレーターであるフォトレギュリン3 |
| MX2020001274A MX2020001274A (es) | 2017-08-10 | 2018-08-10 | Fotoregulina3, moduladora de los genes de los fotorreceptores para el tratamiento de enfermedades de la retina. |
| EP18844100.0A EP3664801A4 (en) | 2017-08-10 | 2018-08-10 | PHOTORECEPTOR MODULATOR-PHOTOREGULIN 3 FOR TREATMENT OF RETINAL DISEASES |
| AU2018313990A AU2018313990A1 (en) | 2017-08-10 | 2018-08-10 | Photoreceptor gene modulator photoregulin 3 for treatment of retinal disease |
| US16/637,174 US20200368234A1 (en) | 2017-08-10 | 2018-08-10 | Photoreceptor gene modulator photoregulin 3 for treatment of retinal disease |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762543782P | 2017-08-10 | 2017-08-10 | |
| US62/543,782 | 2017-08-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019032999A1 true WO2019032999A1 (en) | 2019-02-14 |
Family
ID=65272549
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/046272 Ceased WO2019032999A1 (en) | 2017-08-10 | 2018-08-10 | PHOTORECEPTOR GENE MODULATOR PHOTOREGULIN 3 FOR THE TREATMENT OF RETINAL DISEASE |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20200368234A1 (https=) |
| EP (1) | EP3664801A4 (https=) |
| JP (1) | JP2020530459A (https=) |
| CN (1) | CN111093657A (https=) |
| AU (1) | AU2018313990A1 (https=) |
| CA (1) | CA3072175A1 (https=) |
| MX (1) | MX2020001274A (https=) |
| WO (1) | WO2019032999A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11241460B2 (en) | 2013-03-15 | 2022-02-08 | Astellas Institute For Regenerative Medicine | Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells |
| US12558380B2 (en) | 2013-03-15 | 2026-02-24 | Astellas Institute For Regenerative Medicine | Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9855314B2 (en) * | 2013-03-01 | 2018-01-02 | The Schepens Eye Research Insititute, Inc. | Methods for modulating development and function of photoreceptor cells |
| US10363256B2 (en) * | 2015-03-27 | 2019-07-30 | University Of Washington | Methods for treatment of retinal disease by photoreceptor gene expression modulation |
| CN105343107A (zh) * | 2015-12-03 | 2016-02-24 | 上海中医药大学附属岳阳中西医结合医院 | 雷公藤红素在制备防治视网膜退行性改变相关疾病药物中的应用 |
-
2018
- 2018-08-10 US US16/637,174 patent/US20200368234A1/en not_active Abandoned
- 2018-08-10 CN CN201880051862.3A patent/CN111093657A/zh active Pending
- 2018-08-10 WO PCT/US2018/046272 patent/WO2019032999A1/en not_active Ceased
- 2018-08-10 MX MX2020001274A patent/MX2020001274A/es unknown
- 2018-08-10 CA CA3072175A patent/CA3072175A1/en not_active Abandoned
- 2018-08-10 JP JP2020506984A patent/JP2020530459A/ja active Pending
- 2018-08-10 EP EP18844100.0A patent/EP3664801A4/en not_active Withdrawn
- 2018-08-10 AU AU2018313990A patent/AU2018313990A1/en not_active Abandoned
Non-Patent Citations (5)
| Title |
|---|
| DATABASE PubChem COMPOUND 13 February 2015 (2015-02-13), "COMPOUND SUMMARY CID-89460316 |C19H28N4S", XP055574683, retrieved from NCBI Database accession no. CID-89460316 * |
| DATABASE PubChem COMPOUND 7 February 2015 (2015-02-07), "COMPOUND SUMMARY CID-86845279 | C22H25N3O", XP055574678, retrieved from NCBI Database accession no. CID-86845279 * |
| NAKAMURA ET AL.: "Potential of Small Molecule-Mediated Reprogramming of Rod Photoreceptors to Treat Retinitis Pigmentosa", IOVS, vol. 57, no. 14, 2016, pages 6407 - 6415, XP055574673 * |
| See also references of EP3664801A4 * |
| SHERIDAN: "Interest rekindles in drug cocktails that reprogram cells", NATURE BIOTECHNOLOGY, vol. 35, no. 6, June 2017 (2017-06-01), pages 489 - 490, XP055574675 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11241460B2 (en) | 2013-03-15 | 2022-02-08 | Astellas Institute For Regenerative Medicine | Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells |
| US12508284B2 (en) | 2013-03-15 | 2025-12-30 | Astellas Institute For Regenerative Medicine | Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells |
| US12558380B2 (en) | 2013-03-15 | 2026-02-24 | Astellas Institute For Regenerative Medicine | Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells |
Also Published As
| Publication number | Publication date |
|---|---|
| US20200368234A1 (en) | 2020-11-26 |
| MX2020001274A (es) | 2020-09-22 |
| EP3664801A1 (en) | 2020-06-17 |
| EP3664801A4 (en) | 2021-06-23 |
| CA3072175A1 (en) | 2019-02-14 |
| AU2018313990A1 (en) | 2020-02-27 |
| CN111093657A (zh) | 2020-05-01 |
| JP2020530459A (ja) | 2020-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10849904B2 (en) | Methods for treatment of retinal disease by photoreceptor gene expression modulation | |
| Roberti et al. | Nerve growth factor modulation of retinal ganglion cell physiology | |
| Liu et al. | Prolyl-4-hydroxylases inhibitor stabilizes HIF-1α and increases mitophagy to reduce cell death after experimental retinal detachment | |
| US20250057868A1 (en) | Compositions and methods of modulating hif-2a to improve muscle generation and repair | |
| US20250082688A1 (en) | Compositions and methods for williams syndrome (ws) therapy | |
| Orban et al. | A combination of G protein–coupled receptor modulators protects photoreceptors from degeneration | |
| Feng et al. | Trilobatin attenuates cerebral ischaemia/reperfusion‐induced blood–brain barrier dysfunction by targeting matrix metalloproteinase 9: The legend of a food additive | |
| Szarka et al. | The role of gap junctions in cell death and neuromodulation in the retina | |
| US20230372311A1 (en) | Compositions and methods of treating age-related retinal dysfunction | |
| US20200368234A1 (en) | Photoreceptor gene modulator photoregulin 3 for treatment of retinal disease | |
| Bessero et al. | Role of the c‐Jun N‐terminal kinase pathway in retinal excitotoxicity, and neuroprotection by its inhibition | |
| US20100204192A1 (en) | Agents, compositions and methods for enhancing neurological function | |
| US20210196716A1 (en) | Compositions and methods for treating eye disorders | |
| JP2007529555A (ja) | シヌクレイノパチーを治療する方法 | |
| US20240382416A1 (en) | Method of treating inflammation and photoreceptor cell degeneration in retinal degeneration patients | |
| US11147807B2 (en) | Pharmaceutical composition containing DUSP1 inhibitor | |
| Lara-López et al. | Topical administration of novel FKBP12 ligand MP-004 improves retinal function and structure in retinitis pigmentosa models | |
| WO2012117334A1 (en) | Mglur5 positive allosteric modulators for use in the treatment phelan-mcdermid syndrome | |
| US9987242B2 (en) | Treatment of Levodopa-induced Dyskinesias | |
| Zhao et al. | Neuron‐glial cell communication in the traumatic stress‐induced immunomodulation | |
| CA2888984A1 (en) | Methods for treating eye disorders | |
| JP7138934B2 (ja) | 網膜神経保護作用を有するアペリン受容体アゴニストを含有する医薬組成物 | |
| Mucke | Drug Repurposing Patent Applications April–June 2025 | |
| Ke et al. | Autophagy-Induced Microglial Death Contributes to Neuroinflammation in Acute Optic Nerve Injury | |
| WO2024059335A1 (en) | Methods of treating age-related and inherited retinal dysfunctions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18844100 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3072175 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2020506984 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018313990 Country of ref document: AU Date of ref document: 20180810 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018844100 Country of ref document: EP Effective date: 20200310 |