WO2019000147A1

WO2019000147A1 - Tud rna effectively inhibiting expression of human mir-148a, mir-152 and mir-185 and use thereof

Info

Publication number: WO2019000147A1
Application number: PCT/CN2017/089927
Authority: WO
Inventors: 毛吉炎
Original assignee: 深圳市博奥康生物科技有限公司
Priority date: 2017-06-26
Filing date: 2017-06-26
Publication date: 2019-01-03

Abstract

Provided are a TuD RNA and the use thereof. The TuD RNA can effectively inhibit the expression of human miR-148a, miR-152 and miR-185. The DNA sequence encoding the TuD RNA is as shown below: 5'-ggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagatgatcctagcgccaccttttt-3'. The use of the TuD RNA comprises constructing the TuD RNA on a lentiviral vector to obtain a recombinant vector; and applying the recombinant vector to the human cells to inhibit the expression of human miR-148a, miR-152 and miR-185.

Description

Instruction manual

Title of the invention: an effective inhibition of the expression of human miR-148a, miR-152 and miR-185

Tud RNA and its application

Technical field

The present invention relates to a Tud

RNA, in particular, relates to a Tud RNA effective for inhibiting the expression of human miR-148a, miR-152 and miR-185 and its use.

Background technique

[0002] MicroRNAs (miRNAs) are a class of endogenous, non-coding RNAs found in eukaryotes, typically between 22 and 25 nt in size. miRNAs are widely distributed in plants, animals, and multicellular organisms, and can Play an important regulatory role, and in the study of human miRNAs, it is found that the expression of miRNA in normal tissues and tumor tissues is significantly different, some miRNAs are lowly expressed in tumor tissues, and some are highly expressed in tumor tissues. This suggests that miRNAs play a crucial role in tumorigenesis.

[0003] miR-148a is a microRNA that has been studied more in recent years. It is reported that miR-148a is closely related to exogenous substance metabolism, apoptosis, occurrence, development and epigenetics of various cancers; miR-1 52 is a multifunctional miRNA, and the study found that miR- 152 is associated with methylation, such as methyltransferase DNMT1 content and enzyme activity, miR-152 can be methylated by endometrial cancer DNA into a silent gene, and it is associated with the development of various cancers, it It is a tumor suppressor microRNA, which is associated with many diseases such as preeclampsia, trophoblastic tumor, bladder cancer, gastrointestinal cancer, ovarian cancer, etc. miR-185 is a 22 nt miRNA located at human chromosome 22ql l.21, It plays an important role as a tumor suppressor gene in the development and invasion of tumors such as colon cancer, gastric cancer, esophageal cancer, lung cancer, and liver cancer. In addition, it is a methylation-related tumor suppressor miRNA that can directly target DNMT1. Expression affects the level of methylation in the whole genome, which in turn regulates the methylation status of certain genes and affects gene expression. By controlling the expression of miR-148a, miR-152 and miR-185, the synergy with other drugs can provide new epigenetic ideas for the treatment of cancer.

technical problem

[0004] Functional studies of MiRNAs are primarily accomplished through miRNA interference and overexpression techniques. Existing miRNA interference In technology, anti-miR and antagomiR are transient transfection techniques, and the interference effect cannot be stably maintained, while the miRNA sponge effect is far from optimal. The prior art lacks a technique that has good interference effect and can achieve long-term stable interference. .

[0005] Tough Decoy RNA (Tud RNA) is a novel miRNA-inhibiting miRNA that inhibits miRNA by introducing double-stranded RNA to target miRNAs. Because the inserted RNA is double-stranded and has a secondary structure of stem-loops, it is resistant to intracellular nuclease degradation and inhibits miRNAs in a long-term, stable, and efficient manner.

Problem solution

Technical solution

[0006] The primary object of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide an effective suppression of human miR-

Tud RNA expressed by 148a, miR-152 and miR-185.

Another object of the present invention is to provide the above-described use of Tud RNA which effectively inhibits the expression of human miR-148a, miR-152 and miR-185.

A further object of the present invention is to provide a recombinant vector comprising the above Tud RNA.

The object of the invention is achieved by the following technical solutions:

[0010] A Tud RNA which effectively inhibits the expression of human miR-148a, miR-152 and miR-185, and the DNA sequence encoding the Tud RNA which inhibits the expression of human miR-148a, miR-152 and miR-185 is as follows Show:

[0011] 5'- ggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacg tgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatctaggagaccagcaaagtcacgta ctatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagatgatcctagcgccaccttttt -3'°

The use of the Tud RNA which is effective for inhibiting the expression of human miR-148a, miR-152 and miR-185, the application comprising constructing the Tud RNA on a lentiviral vector to obtain the Tud RNA containing the Tud RNA Recombinant vector; will contain the Tud

The recombinant vector of RNA acts on 16HBE cells to inhibit the expression of miR-148a, miR-152 and miR-185;

[0013] the lentiviral vector is a pGLV3/Hl/GFP+Puro (pGLV3) lentiviral shuttle vector;

[0014] The preparation method of the recombinant vector containing the Tud RNA comprises the following steps: (1) Designing a DNA sequence 歹|J containing Tud RNA that inhibits the expression of human miR-148a, miR-152 and miR-185, as follows:

[0016] 5,- ggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacg tgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatctaggagaccagcaaagtcacgta ctatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagatgatcctagcgccaccttttt -3';

[0017] To clone it into the pGLV3 lentiviral shuttle vector, the following sense strand (F) and antisense strand (R) DNA sequence 歹 'J were synthesized:

[0018] Tud-148a-152-185 justice chain:

[0019] 5'-

GATCCggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaaccca aagtcacgtgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatctaggagaccagcaaa gtcacgtactatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagatgatcctagcgccacctttttG -3,;

[0020] Tud-148a-152-185 antisense strand:

[0021] 5'-

AATTCaaaaaggtggcgctaggatcatcttgtgtttcaagaagatcatcacgtgactttgggttcaagacagatagtacgt gactttgctggtctcctagatttcggtcggggagttgtattctgtgaccagaatacttgtgtttcaagaagatcatcacgtgacttt gggttcaagacagatagtacgtgactttgctggtctcctagatttcggtgggggagttgatgatcctagcgccG -3'°

[0022] The 5' end of the sense strand template is added with GATCC, which is complementary to the sticky end formed by BamHI digestion; the AATTC is added to the 5' end of the antisense strand template, which is complementary to the sticky end formed by EcoRI digestion;

[0023] (2) mixing equal amounts of the sense strand and the antisense strand DNA, annealing to form a DNA duplex, to obtain a Tud RNA template;

[0024] (3) The pGLV3 vector was digested with BamHI and EcoRI to obtain a linearized pGLV3 vector;

[0025] (4) ligating the Tud RNA template in step (2) with the linearized pGLV3 vector in step (3) to obtain a recombinant vector pGLV3-Tud-148a-152-185;

(5) Recombinant vector pGLV3-Tud-148a-152-185 and packaging vector pGag/Pol, pRev, pVSV-

G is co-transfected into 293T cells, and the culture supernatant is collected to obtain virus particles containing the desired Tud RNA, which can be used for transfection of the target cells. Advantageous effects of the invention

Beneficial effect

The Tud RNA of the present invention which inhibits the expression of human miR-148a, miR-152 and miR-185 is effective for inhibiting the expression of human miR-148a, miR-152 and miR-185. The Tud RNA, which inhibits the expression of human miR-148a, miR-152 and mi R-185, is constructed on a lentiviral vector, and is effective not only for dividing and non-dividing cells, but also for in vivo and in vitro studies.

Brief description of the drawing

DRAWINGS

1 is a structural diagram of a pGLV3 vector; FIG. 2 is a miRNA expression level of each group of cells, wherein, a.

Expression of miR-148a, b. expression of miR-152, c. expression of miR-185.

BEST MODE FOR CARRYING OUT THE INVENTION

The present invention will be further described in detail below with reference to the embodiments and drawings, but the embodiments of the invention are not limited thereto.

Example 1 Design and Synthesis of Tud RNA Effectively Inhibiting Expression of Human miR-148a, miR-152 and miR-185

[0031] TuD RNA oligonucleosides targeting miR-148a, miR-152 and miR-185 were designed based on the sequence information of miR-148a, miR-152 and miR-185 provided in the TuD RNA design sequence and miRBase. acid sequence bad | J, having the sequence 5 '- ggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacg tgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatctaggagaccagcaaagtcacgta ctatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagatgatcctagcgccaccttttt -3' ° Principal synthesis Shanghai Sangon.

To clone it into the pGLV3 lentiviral shuttle vector, the following sense strand (F) and antisense strand were designed (R)

) DNA sequence 歹 'J :

[0033] Tud-148a-152-185 justice chain:

[0034] 5'- GATCCggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaaccca aagtcacgtgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatctaggagaccagcaaa gtcacgtactatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagatgatcctagcgccacctttttG -3,;

[0035] Tud-148a-152-185 antisense strand:

[0036] 5'-

[0037] The 5' end of the sense strand template is added with GATCC, which is complementary to the sticky end formed by BamHI digestion; the AATTC is added to the 5' end of the antisense strand template, which is complementary to the sticky end formed by EcoRI digestion.

[0038] (2) Mix equal amounts of sense strands (10 μΜ, 5 μΐ) and antisense strands (10 μΜ, 5 μΐ) DNA, add 90 μl (1 (1Η2Ο, annealed on a PCR machine according to the following procedure) Treatment: 95 ° C for 5 min, then annealed at a rate of O.rC per second down to 25 ° C for annealing, and finally stored at 4 ° C for later use. The Tud RNA template solution obtained after annealing was diluted 5 times to a final concentration of 200 nM for the ligation reaction.

(3) The pGLV3 vector (Gimma Gene Co., Ltd.) was digested with BamH I and EcoR I, and the vector was linearized. The conditions of the digestion were as follows: pGLV3 vector (10μ, BamH I) Dicer (5 L, Fermentas), EcoR I endonuclease (5 L, Fermentas), FastDigest buffer (8 (VL, TOYOBO) were mixed, placed at 37 ° C for 1 hour, using a gel back kit ( Axygen) recovered the linear vector fragment and diluted its concentration to 50 ng^L.

[0040] (4) linearized pGLV3 vector 1 μ1, annealed Tud RNA template 1μ1, Τ4 DNA ligase (NEB), 1μ1, 10xT4 ligation buffer (NEB) 2μ1, deionized water 15 μΓ mixed , connected overnight at 4 °C. The ligation product 5 μl was transformed into E. coli ToplO competent cells and cultured overnight on LB plates containing 10 (Vg/ml ampicillin at 30 ° C. The grown monoclonal was selected in LB containing 100 μ _§ /ηι1 ampicillin Incubate overnight at 30 ° C in liquid medium, using plasmid extraction kit (Omega)

Bio-tek) The plasmid was purified and verified by sequencing to prepare a recombinant plasmid pGLV3-Tud-148a-152-185.

(5) The recombinant vector pGLV3-Tud-148a-152-185 was co-transfected into packaging cells pGag/Pol, pRev, pVSV-G to 293T cells, and the culture supernatant was collected to obtain virus particles containing the desired Tud RNA. can be use on Transfect the target cells.

Example 2 Lentiviral transduction 16HBE cells

[0043] 16HBE cells were seeded in 6-well plates, 1000000 cells per well, and the cell density was about 50% after 12 hours. The virus solution was taken separately, and the virus was diluted 10 times with DMEM complete medium, and then polyglycolamine was added.

(polybrene) to a final concentration of 8 g/mL. The medium in the 6-well plate was removed, and the virus-containing DMEM complete medium (containing 10% fetal bovine serum) was added. After 24 hours, the virus-containing DMEM complete medium was discarded, and the fresh DMEM complete medium was replaced. After 24 hours, 0.5 was used. The cells were screened at a g/ml concentration of puromycin. After 10 days of screening, the medium was changed once every 3 days, and the concentration of puromycin was continuously increased to 1.0 g/ml. The cell line obtained by screening was named TuD-148a-152-185 cell line.

Example 3 Fluorescence Quantitative PCR Detection of Changes in Expression Levels of miRNAs

[0045] Normal 16HBE cells, TuD-148a-152-185 cells were inoculated into 6-well plates (about 300,000 per well), and the cells were cultured for about 24 hours to a degree of fusion of 80%. The miRNAs of these cells were extracted using the miRcute miRNA extraction and isolation kit, followed by S-Poly(T) hsa-miR-148a qPCR-assay primer

Set, S-Poly(T) hsa-miR-152 qPCR-assay primer set and S-Poly(T) hsa-miR-185 qPCR-assay primer

The set kit reverse-transcribes and tails the miRNA to obtain the corresponding cDNA. The cDNA of each of the two cells was used as a template, and the expression levels of miR-148a, miR-152 and miR-185 were detected by real-time PCR. The experiment was repeated 3 times, and 3 parallel samples were set per well, with snord 44 as the internal reference. . As a result, as shown in Fig. 2, it was found that the expression level of miR-148a with TuD-148a-152-185 cells was 60% lower than that of 16HBE cells, and the expression level of mi R-152 was 62% lower than that of 16HBE cells, miR-185 The expression level is 59% lower than that of 16HBE cells. The difference was statistically significant (/?<0.01), indicating that the TuD-148a-152-185 cell line was successfully constructed.

Industrial applicability

Claims

It claims a potent inhibitor of human miR-148a, miR-152, and the expression of miR-185 Tud RNA, wherein: said encoding RNA sequence Tud DNA as follows: 5'- ggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaac ccaaagtcacgtgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatct aggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaaga tgatcctagcgccaccttttt -3, . The use of the Tud RNA of claim 1 for the preparation of miR-148a, miR-152 and miR-185 functional studies and for the preparation of targeted therapeutics for miR-148a, miR-152 and miR-185 related diseases. The product of the preparation of miR-148a, miR-152 and miR-185 functional studies according to claim 2 and the use of the therapeutic agent for the preparation of miR-148a, miR-152 and miR-185 related diseases Characterized in that the application comprises constructing the DNA sequence of claim 1 on a lentiviral vector to obtain a recombinant vector comprising the DNA sequence of claim 1. The product of the preparation of miR-148a, miR-152 and miR-185 functional studies according to claim 3 and the use of the therapeutic agent for the preparation of miR-148a, miR-152 and miR-185 related diseases And characterized in that: the lentiviral vector is a PGLV3 lentiviral shuttle vector. The product of the preparation of miR-148a, miR-152 and miR-185 functional studies according to claim 4 and the use of the therapeutic agent for the preparation of miR-148a, miR-152 and miR-185 related diseases And the method for preparing the recombinant vector comprising the DNA sequence of claim 1, comprising the steps of:

(1) Design a DNA sequence ij ij containing Tud RNA that inhibits the expression of human miR-148a, miR-152 and miR-185, as follows:

5,- Ggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatctgtcttgaac ccaaagtcacgtgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgaccgaaatct aggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacgtgatgatcttcttgaaacacaaga tgatcctagcgccaccttttt -3,;

To clone it into the pGLV3 lentiviral shuttle vector, the following sense and antisense strand DNA sequences were synthesized:

Tud-148a-152-185 justice chain:

5'-

GATCCggcgctaggatcatcaactccccgaccgaaatctaggagaccagcaaagtcacgtactatct gtcttgaacccaaagtcacgtgatgatcttcttgaaacacaagtattctggtcacagaatacaactccccgac cgaaatctaggagaccagcaaagtcacgtactatctgtcttgaacccaaagtcacgtgatgatcttcttgaa acacaagatgatcctagcgccacctttttG -3';

Tud-148a-152-185 antisense strand:

5'-

AATTCaaaaaggtggcgctaggatcatcttgtgtttcaagaagatcatcacgtgactttgggttcaaga cagatagtacgtgactttgctggtctcctagatttcggtcggggagttgtattctgtgaccagaatacttgtgtt tcaagaagatcatcacgtgactttgggttcaagacagatagtacgtgactttgctggtctcctagatttcggtg ggggagttgatgatcctagcgccG -3,.

The 5' end of the above sense strand template was added with GATCC, which was complementary to the sticky end formed by BamHI digestion; the AATTC was added to the 5' end of the antisense strand template, which was complementary to the sticky end formed by EcoRI digestion;

(2) mixing equal amounts of the sense strand and the antisense strand DNA, and annealing to form a DNA double strand to obtain a Tud RNA template;

(3) The pGLV3 vector was digested with BamHI and EcoRI to obtain a linearized pGLV3 vector;

(4) The Tud RNA template in the step (2) and the linearized pGLV3 vector in the step (3) were ligated to obtain a recombinant vector pGLV3-Tud-148a-152-185.