WO2018170750A1 - Tud rna for suppressing expressions of mirna-29a, mirna-148a, and mirna-152, and application thereof - Google Patents

Abstract

Provided is a Tough Decoy RNA (Tud RNA) for suppressing expressions of miRNA-29a, miRNA-148a, and miRNA-152. A nucleotide sequence of the Tud RNA is represented by SEQ ID NO. 1. The present invention also provides a Tud RNA interference vector for suppressing expressions of miRNA-29a, miRNA-148a, and miRNA-152. A preparation method for the Tud RNA interference vector comprises: synthesizing, according to compared and analyzed human miR-29a, miR-148a, and miR-152 sequences, a fragment with BamHI and HindIII restriction enzyme cutting sites, connecting the fragment onto a plasmid vector subjected to BamHI and HindIII linearization, and filtering to obtain an effective interference vector.

Description

 Title of Invention: Tud RNA with Inhibition of Expression of Small RNA-29a, 148a and 152 and Their Applications

 Technical field

 [0001] The present invention relates to a Tud RNA for inhibiting expression of small RNA-29a, 148a and 152 and its use, and belongs to the field of genetic engineering technology.

 Background technique

 [0002] MicroRNAs (miRNAs) are a class of endogenous, non-coding RNAs found in eukaryotes, typically between 22 and 25 nt in size. miRNAs are widely distributed in plants, animals, and multicellular organisms, and can Play an important regulatory role, and in the study of human miRNAs, it is found that the expression of miRNA in normal tissues and tumor tissues is significantly different, some miRNAs are lowly expressed in tumor tissues, and some are highly expressed in tumor tissues. This suggests that miRNAs play a crucial role in tumorigenesis.

[0003] miR-29a is a small RNA closely related to cell proliferation. It is involved in many diseases and can act as a tumor suppressor gene in a variety of tumors. It has the ability to grow and invade cells such as human gastric cancer and bladder cancer. Correlation, its expression level is an important reference for evaluating the benign and malignant glioma, and it is also associated with diseases such as atherosclerosis liver fibrosis, and has important potential application value for the treatment of various tumors; miR-148a is in recent years A more studied micr ₀ RNA. It is reported that miR-148a is closely related to exogenous substance metabolism, apoptosis, occurrence, development and epigenetics of various cancers; miR-152 is a multifunctional miRNA, and the study found that miR-152 Related to methylation, such as methyltransferase DNMT1 content and enzyme activity, miR-152 can be methylated by endometrial cancer DNA into a silent gene, and it is associated with the development of various cancers, it is A tumor suppressing microRNA associated with many diseases such as pre-eclampsia, trophoblastic tumor, bladder cancer, gastrointestinal cancer, and ovarian cancer. By controlling the expression of miR-29a, miR-148a and miR-152, peers can work synergistically with other drugs to provide new epigenetic ideas for the treatment of cancer.

 technical problem

[0004] MiRNA functional studies often require miRNA silencing techniques, including anti-miR, antago miR, miRNA Sponge et al., these technologies are all transient transfection techniques, unable to maintain long-term stable silencing of the target miRNA, and the silencing effect is far from optimal.

[0005] Tough Decoy RNA (Tud RNA) is a novel miRNA-inhibiting miRNA that inhibits miRNA by introducing double-stranded RNA to target miRNAs. Because the inserted RNA is double-stranded and has a secondary structure of stem-loops, it is resistant to intracellular nuclease degradation and inhibits miRNAs in a long-term, stable, and efficient manner.

 Problem solution

 Technical solution

 The present invention provides a Tud RNA which inhibits the expression of small RNA-29a, 148a and 152, and has a nucleotide sequence 歹IJ as shown in SEQ ID NO: 1, mainly inhibiting human miR-29a, miR-148a. And application in miR-152 expression preparations.

 The present invention also provides a method for preparing a shRNA interference carrier, and the steps are as follows:

 [0008] (1) a BamHI and Hindlll cleavage site is added to both ends of the nucleotide sequence shown in SEQ ID NO: 0.1 to obtain a Tud RNA fragment;

(2) The interference fragment obtained in the step (1) was ligated to a plasmid vector linearized by BamHI and Hindlll to obtain a Tud RNA vector.

[0010] The specific steps are as follows:

 [0011] (1) a BamHI and Hindlll cleavage site is added to both ends of the nucleotide sequence shown in SEQ ID NO: 1 to obtain a Tud RNA fragment;

(2) The interference fragment obtained in the step (1) was ligated to the p-Ge nesil 1.0 plasmid vector linearized by BamHI and Hindlll to obtain the Tud RNA vector p-Genesil-Tud-29a-148a-152.

[0013] Tud provided by the present invention

 A method of preparing an RNA vector for use in inhibiting expression of human miR-29a, miR-148a and miR-152 expression preparations.

 Specifically, Tud RNA sequences were designed by comparative analysis of human miR-29a, miR-148a and miR-152 sequences.

[0015] According to the human miR-29a, miR-148a and miR-152 sequences, single-stranded Tud RNA fragments with BamHI and Hindlll cleavage sites were synthesized, renatured into double strands, ligated to BamHI and Hindlll Linearization p-Genesill.O vector. The effective interference fragment constructed and screened is Tud-29a-148a-152.

 Advantageous effects of the invention

 Beneficial effect

 [0016] The homologous interference miR-29a, miR-148a and miR-152 TuD RNA sequences designed by the present invention have a stem-loop structure and are not easily degraded, and the double-stranded Tud RNA is relatively common with the currently used single-stranded miRNA sponge. The binding efficiency is higher, and the same target for three targets can better achieve the interference of three miRNAs and improve the efficiency of miRNA function research.

 Brief description of the drawing

 DRAWINGS

 [0017] Figure 1. miRNA expression levels of each group of cells, wherein, a. miR-29a expression, b.

 Expression of miR-148a, c. expression of miR-152.

 BEST MODE FOR CARRYING OUT THE INVENTION

 BEST MODE FOR CARRYING OUT THE INVENTION

[0018] The present invention will be further described in detail below with reference to the embodiments and the accompanying drawings, but the embodiments of the invention are not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from the market unless otherwise stated.

[0019] pGenesill.O vector was purchased from Biovector Plasmid Vector Culture Cell Genetic Collection Center; Reverse Transcription Kit

SYBR fluorescence real-time quantitative PCR kits were purchased from Takara Reagent Co., Ltd.; endotoxin plasmid extraction kits were purchased from Tiangen Biochemical.

SEQ ID NO 1: 5'-

CCAATCAAGATGATCCTAGCGCCACCTTTT -3,.

[0021] Example 1 :

Design and Synthesis of Tud RNA Targeting miR-29a, miR-148a and miR-152 [0023] TuD RNA oligonucleosides targeting miR-29a, miR-148a and miR-152 were designed based on the sequence information of miR-29a, miR-148a and miR-152 provided in the TuD RNA design sequence and miRBase. The acid sequence 歹ijTud-29a-148a-152, whose sequence 歹ij is shown as SEQ ID NO 1, was commissioned by Shanghai Shenggong to synthesize by gene synthesis.

 [0024] Example 2:

 [0025] Construction of p-Genesil-Tud-29a-148a-152 vector

[0026] The Tud-29a-148a-152 sequence and p-Genesill.0 were separately treated with BamHI and Hindlll enzymes, respectively, and electrophoresed and recovered, and then ligated with T4 DNA ligase at 4 ° C overnight, and then transformed into competent E. coli ToplO, Single colonies were cultured and sent to Shanghai Biotech for sequencing. The correctly sequenced pG _eneS il-T _U d-29a-14 8a-152 vector was constructed. The p-Genesil-Tud-29a-148a-152 vector was extracted using an endotoxin plasmid extraction kit.

 [0027] Example 3:

 [0028] p-Genesil-Tud-29a-148a-152 vector transduction 16HBE cells

 [0029] 16HBE cells were seeded in 6-well plates at 1000000 cells per well, and the cell density was approximately 60% after 18 h. The p-Genesil-Tud-29a-148a-152 vector was transduced with 16HBE cells using jetPrime transfection reagent. After 4 h of reaction, the medium was changed to fresh DMEM complete medium and culture was continued for 24 h.

 [0030] Example 4:

 Detection of expression levels of miR-29a, miR-148a and miR-152

 16HBE cells and 16HBE cells transduced with p-Genesil-Tud-29a-148a-152 vector were used to extract miRNAs from these cells using the miRcute miRNA extraction and isolation kit, followed by S-Poly(T) hsa-miR- 29a qPCR-assay primer set, S-Poly(T) hsa-miR-148a qPCR-assay primer set and S-Poly(T) hsa-miR-152 qPCR-assay primer set kit (both purchased from Shenzhen Anran Bio) The miRNA is reverse transcribed and tailed to obtain the corresponding cDNA. Take 2 kinds of cells of cDNA 2

As a template, real-time PCR was used to detect changes in the expression levels of miR-29a, miR-148a and miR-152. The experiment was repeated 3 times, and 3 parallel samples were set per well, with snord 44 as an internal reference. The results are shown in Figure 1. It can be seen that the expression level of miR-29a in TuD-29a-148a-152 cells is 49% lower than that in 16HBE cells, and the expression level of miR-1 48a is 61<3⁄4 lower than that in 16HBE cells, 1^ The expression level of 11-152 is 68 ^< 3⁄4 lower than the 1613⁄4 £ cells. The difference was statistically significant (/?<0.01), indicating that the TuD-29a-148a-152 cell line was successfully constructed.

Industrial applicability The homologous interference miR-29a, miR-148a and miR-152 TuD RNA sequences designed by the present invention have a stem-loop structure and are not easily degraded, and the double-stranded Tud RNA is more efficient than the currently used single-stranded miRNA sponge. High, and the same target for three targets, can better achieve the interference of three miRNAs, improve the efficiency of miRNA function research.

Claims

Claims [Claim 1] Tud RNA inhibiting expression of small RNA-29a, 148a and 152, which is capable of knocking down expression of human miR-29a, miR-148a and miR-152, nucleotide sequence As shown in SEQ ID NO 1. [Claim 2] A method for producing a Tud RNA interference vector according to claim 1, wherein the steps are as follows:

 (1) adding a BamHI and Hindlll restriction site to the nucleotide sequence shown in SEQ ID NO: 1 to obtain a Tud RNA fragment;

 (2) The interference fragment obtained in the step (1) was ligated to a plasmid vector linearized by BamHI and Hindlll to obtain an interference vector.

 [Claim 3] The method according to claim 2, wherein the specific steps are as follows:

 (1) adding a BamHI and Hindlll restriction site to the nucleotide sequence shown in SEQ ID NO: 1 to obtain a Tud RNA fragment;

 (2) The Tud RNA fragment obtained in the step (1) was ligated to the p-Genesill.O plasmid vector linearized by BamHI and Hindlll to obtain an interference vector p-Genesil-Tud-29a-148a-1

52.