WO2018170753A1 - Tud rna for knocking down mirna-29a, mirna-152, and mirna-185, and application thereof - Google Patents

Abstract

Provided is a Tud RNA for knocking down miRNA-29a, miRNA-152, and miRNA-424. A coding nucleotide sequence of the Tud RNA is represented by SEQ ID NO. 1. Also provided is a method for preparing an interference vector containing the coding nucleotide sequence of the Tud RNA.

Description

 Title: A Tud that knocks down miRNA-29a, miRNA-152 and miRNA-185

RNA and its application

 Technical field

 [0001] The present invention relates to a Tud RNA which knocks down miRNA-29a, miRNA-152 and miRNA-185 and an application thereof, and belongs to the field of genetic engineering technology.

 Background technique

 [0002] MicroRNAs (miRNAs) are a class of endogenous, non-coding RNAs found in eukaryotes, typically between 22 and 25 nt in size. miRNAs are widely distributed in plants, animals, and multicellular organisms, and can Play an important regulatory role, and in the study of human miRNAs, it is found that the expression of miRNA in normal tissues and tumor tissues is significantly different, some miRNAs are lowly expressed in tumor tissues, and some are highly expressed in tumor tissues. This suggests that miRNAs play a crucial role in tumorigenesis.

 [0003] miR-29a is a small RNA closely related to cell proliferation. It is involved in many diseases and can act as a tumor suppressor gene in a variety of tumors. It has the ability to grow and invade cells such as human gastric cancer and bladder cancer. Correlation, its expression level is an important reference for evaluating the benign and malignant glioma, and it is also associated with diseases such as atherosclerotic liver fibrosis, and has important potential application value for the treatment of various tumors; miR-152 is a kind of Multi-functional miRNA, the study found that miR-152 is related to methylation, such as the methyltransferase DNMT1 content and enzyme activity, miR-152 can be methylated by endometrial cancer DNA into a silent gene, and its It is involved in the development of various cancers. It is a tumor suppressor microRNA, which is associated with many diseases such as preeclampsia, trophoblastic tumor, bladder cancer, gastrointestinal cancer, ovarian cancer, etc. miR-185 is a 22 nt miRNA. , located in human chromosome 22ql l.21, plays an important role as a tumor suppressor gene in the occurrence and invasion of colon cancer, gastric cancer, esophageal cancer, lung cancer, liver cancer and other tumors. Further it is one methylation-related inhibition of miRNA, may affect the level of the whole genome methylation by direct targeted expression of DNMT1, further regulation of the methylation status of certain modification genes, gene expression. By controlling the expression of miR-2 9a, miR-152 and miR-185, the synergy with other drugs can provide new epigenetic ideas for the treatment of cancer.

technical problem [0004] MiRNA functional studies often require miRNA silencing techniques, including anti-miR, antago miR, miRNA

 Sponge et al., these technologies are all transient transfection techniques, unable to maintain long-term stable silencing of the target miRNA, and the silencing effect is far from optimal.

[0005] Tough Decoy RNA (Tud RNA) is a novel miRNA-inhibiting miRNA that inhibits miRNA by introducing double-stranded RNA to target miRNAs. Because the inserted RNA is double-stranded and has a secondary structure of stem loops, it is resistant to intracellular nuclease degradation and can inhibit miRNAs in a long-term, stable and efficient manner.

 Problem solution

 Technical solution

 The present invention provides a knockdown of miRNA-29a, miRNA-152 and miRNA-185 of Tud RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1, mainly in inhibiting human miR-29a, miR-152 And miR-185 expression products are used.

 The present invention also provides a method for preparing a shRNA interference carrier, and the steps are as follows:

 [0008] (1) a BamHI and Hindlll cleavage site is added to both ends of the nucleotide sequence shown in SEQ ID NO: 0.1 to obtain a Tud RNA fragment;

(2) The interference fragment obtained in the step (1) was ligated to a plasmid vector linearized by BamHI and Hindlll to obtain a Tud RNA vector.

[0010] The specific steps are as follows:

 [0011] (1) a BamHI and Hindlll cleavage site is added to both ends of the nucleotide sequence shown in SEQ ID NO: 1 to obtain a Tud RNA fragment;

(2) The interference fragment obtained in the step (1) was ligated to the p-Ge nesil 1.0 plasmid vector linearized by BamHI and Hindlll to obtain the Tud RNA vector p-Genesil-Tud-29a-152-185.

[0013] Tud provided by the present invention

 Application of RNA vector preparation in inhibiting human miR-29a, miR-152 and miR-185 expression products

Specifically, the Tud RNA sequences were designed by comparative analysis of human miR-29a, miR-152 and miR-185 sequences. [0015] According to human miR-29a, 1^11-152 and 1^11-185 sequences, single-stranded Tud RNA fragments with BamHI and Hindlll cleavage sites were synthesized, renatured into double strands, ligated to The p-Genesill.O vector linearized by BamHI and Hindlll. The effective interference fragment constructed and screened is Tud-29a-152-185.

 Advantageous effects of the invention

 Beneficial effect

 [0016] The same design of the present invention interferes with miR-29a, ! The ^11-152 and 1^11-185 TuD RNA sequences have a stem-loop structure and are not easily degraded. The double-stranded Tud RNA has higher binding efficiency than the currently used single-stranded miRNA sponge, and its Target, can better achieve the interference of three miRNAs, improve the efficiency of mi RNA function research.

 Brief description of the drawing

 DRAWINGS

 [0017] Figure 1. miRNA expression levels of each group of cells, wherein, a. miR-29a expression, b.

 Expression of miR-152, c. expression of miR-185.

 BEST MODE FOR CARRYING OUT THE INVENTION

 BEST MODE FOR CARRYING OUT THE INVENTION

[0018] The present invention will be further described in detail below with reference to the embodiments and the accompanying drawings, but the embodiments of the invention are not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from the market unless otherwise stated.

[0019] pGenesill.O vector was purchased from Biovector Plasmid Vector Culture Cell Genetic Collection Center; Reverse Transcription Kit

SYBR fluorescence real-time quantitative PCR kits were purchased from Takara Reagent Co., Ltd.; endotoxin plasmid extraction kits were purchased from Tiangen Biochemical.

SEQ ID NO 1: 5'-

AGCCAATCAAGATGATCCTAGCGCCACCTTTTT -3' = [0021] Example 1:

 Design and Synthesis of Tud RNA Targeting miR-29a, miR-152 and miR-185

[0023] Based on the sequence information of miR-29a, miR-152 and miR-185 provided in the TuD RNA design sequence and miRBase, TuD designed for miR-29a, miR-152 and miR-185 was designed.

 The RNA oligonucleotide sequence 歹lJTud-29a-152-185, whose sequence 歹 ij is shown in SEQ ID NO 1, was commissioned by Shanghai Biotech to synthesize by gene synthesis.

[0024] Example 2:

 [0025] Construction of p-Genesil-Tud-29a-152-185 vector

 [0026] The Tud-29a-152-185 sequence and p-Genesill.0 were separately treated with BamHI and Hindlll enzymes, respectively, and electrophoresed and recovered, and then ligated with T4 DNA ligase at 4 ° C overnight, and then transformed into competent E. coli ToplO, Single colonies were cultured and sent to Shanghai Biotech for sequencing. The correctly sequenced p-Genesil-Tud-29a-152-185 vector was constructed. The p-Genesil-Tud-29a-152-185 vector was extracted using an endotoxin plasmid extraction kit.

 [0027] Example 3:

 [0028] -06^8 Ding 11 (1-29&-152-185 vector transduced butyl 24 cells

 [0029] T24 cells were seeded in 6-well plates at 1000000 cells per well, and the cell density was about 60% after 18 h. The p-Genesil-Tud-29a-152-185 vector was transduced into T24 cells using jetPrime transfection reagent. After 4 h of reaction, the medium was changed to fresh DMEM complete medium and culture was continued for 24 h.

 [0030] Example 4:

 [0031] Detection of miR-29a, miR-152 and miR-185 expression levels

 [0032] T24 cells and T24 cells transduced with p-Genesil-Tud-29a-152-185 vector, using miRcute

 The miRNA extraction and isolation kit extracts the miRNAs of these cells, and then uses S-Poly(T) hsa-miR-29a qPCR-assay primer set, S-Poly(T) hsa-miR-152 qPCR-assay primer set and S-Poly (T) hsa-miR-185 qPCR-assay primer set kit (both purchased from Shenzhen Anran Bio) Reverse transcription and tailing of miRNA to obtain the corresponding cDNA. Take 2 kinds of cells of cDNA 2

As a template, the expression levels of miR-29a, miR-152 and miR-185 were detected by real-time PCR, and the experiment was repeated 3 times, and 3 parallel samples were set per well, and snord 44 was used as an internal reference. The results are shown in Figure 1. It can be seen that the expression level of miR-29a in TuD-29a-152-185 cells is 53<3⁄4 lower than that in T24 cells, and the expression level of miR-152 is 69% lower than that in T24 cells, miR-185 The expression level is 62% lower than that of T24 cells. The difference is statistical Significance (ρ<0.01), indicating that the TuD-29a-152-185 cell line was successfully constructed.

Industrial applicability

 The present invention is designed to interfere with the miR-29a, 1^&-152 and 1^!-185 TuD RNA sequences with a stem-loop structure, which is not easily degraded, and the double-stranded Tud RNA is relatively common with the currently used single-stranded miRNA sponge. The binding efficiency is higher, and at the same time, the interference of the three miRNAs can be well achieved for the three targets, and the efficiency of the miRNA function research is improved.

Claims

Claims [Claim 1] A Tud RNA that knocks down miRNA-29a, miRNA-152 and miRNA-185, which is capable of knocking down human miR-29a, 1^1 -152 and 1^1 - The expression of 185, nucleotide sequence 歹IJ is shown as SEQ ID NO 1. [Claim 2] A method for producing a Tud RNA interference vector according to claim 1, wherein the steps are as follows:

 (1) adding a BamHI and Hindlll restriction site to the nucleotide sequence shown in SEQ ID NO: 1 to obtain a Tud RNA fragment;

 (2) The interference fragment obtained in the step (1) was ligated to a plasmid vector linearized by BamHI and Hindlll to obtain an interference vector.

 [Claim 3] The method according to claim 2, wherein the specific steps are as follows:

 (1) adding a BamHI and Hindlll restriction site to the nucleotide sequence shown in SEQ ID NO: 1 to obtain a Tud RNA fragment;

 (2) The Tud RNA fragment obtained in the step (1) was ligated to the p-Genesill.O plasmid vector linearized by BamHI and Hindlll to obtain an interference vector p-Genesil-Tud-29a-152-18.

5.