WO2018236232A4 - Nucleic acids for silencing an expression of a gene encoding a prodh/pox protein and uses thereof - Google Patents

Nucleic acids for silencing an expression of a gene encoding a prodh/pox protein and uses thereof Download PDF

Info

Publication number
WO2018236232A4
WO2018236232A4 PCT/PL2018/000061 PL2018000061W WO2018236232A4 WO 2018236232 A4 WO2018236232 A4 WO 2018236232A4 PL 2018000061 W PL2018000061 W PL 2018000061W WO 2018236232 A4 WO2018236232 A4 WO 2018236232A4
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
nucleic acid
prodh
stranded nucleic
double
Prior art date
Application number
PCT/PL2018/000061
Other languages
French (fr)
Other versions
WO2018236232A1 (en
Inventor
Jerzy PAŁKA
Ilona ΖΑRĘΒΑ
Nafis RAHMAN
Arkadius SURAŻYŃSKI
Wojciech Miltyk
Original Assignee
Uniwersytet Medyczny W Białymstoku
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Uniwersytet Medyczny W Białymstoku filed Critical Uniwersytet Medyczny W Białymstoku
Publication of WO2018236232A1 publication Critical patent/WO2018236232A1/en
Publication of WO2018236232A4 publication Critical patent/WO2018236232A4/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The subject matter of this invention relates to a double-stranded nucleic acid for silencing expression of a gene encoding PRODH/POX protein in a cell, an expression vector for silencing expression of a gene encoding PRODH/POX protein comprising such double- stranded nucleic acid, a host cell comprising such double-stranded nucleic acid or vector, a cell clone with silenced expression of a gene encoding PRODH/POX protein comprising such double-stranded nucleic acid or vector, a pharmaceutical composition for silencing expression of a gene encoding PRODH/POX protein in an organism comprising such double-stranded nucleic acid or vector, and a pharmaceutically acceptable carrier or diluent. the subject matter of the invention further relates to an in vitro method of silencing expression of a gene encoding PRODH/POX protein in a cell, wherein a double-stranded nucleic acid or vector is introduced, keeping the cell with the introduced double-stranded nucleic acid or vector in conditions and for a period of time sufficient for silencing expression of a gene encoding PRODH/POX protein in a cell. The subject matter of the invention also relates to the double- stranded nucleic acid for use in the therapy, treatment and/or prevention of a disorder or disease characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta; for inhibiting a growth and/or proliferation of a neoplastic cell; for inducing apoptosis and/or autophagy; for use in diagnostics, especially diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta; for use in the manufacture of a cell line with silenced expression of a gene encoding PRODH/POX protein; for use in the manufacture of a non-human transgenic organism with silenced expression of a gene encoding PRODH/POX protein; for use in the manufacture of a cell clone with silenced expression of a gene encoding PRODH/POX protein, preferably a clone of MCF-7 cells with silenced expression of a gene encoding PRODH/POX protein. The subject matter of the invention also relates to a single-stranded nucleic acid for determining an expression of a gene encoding PRODH/POX protein in a cell comprising at least one sequence having at least 15 nucleotides in length, which is substantially complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein. The subject matter of the invention also relates to a single-stranded nucleic acid for use in the manufacture of a microarray for identification of PRODH/POX protein encoding gene transcript expression, for use for obtaining a sequence having at least partially the length of the cDNA or mRNA of the gene encoding PRODH/POX protein in a cell.

Claims

49 AMENDED CLAIMS received by the International Bureau on 14 February 2019 (14.02.2019)
1. A double-stranded nucleic acid for silencing expression of a gene encoding PRODH/POX protein in a cell, wherein the double-stranded nucleic acid is a double-stranded deoxynucleic acid (dsDNA) or a double- stranded ribonucleic acid (dsRNA), and comprises at least a sense strand and an antisense strand, each having at least 19 nucleotides in length, which are in at least 70 % complementary to each other, wherein the sense strand comprises a first sequence, and the antisense strand comprises a second sequence complementary, over the length of at least 15 to 17 nucleotides, to the mRNA encoding PRODH/POX protein, and wherein the double- stranded nucleic acid, upon introducing it into a cell expressing the gene encoding PRODH/POX protein, silences the expression of the gene.
2. The double- stranded nucleic acid according to claim 1, characterized in that it is a double-stranded deoxynucleic acid, wherein the sense strand comprises the first sequence selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), and the antisense strand comprises the second sequence selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).
3. The double- stranded nucleic acid according to claim 2, characterized in that it comprises a sequence of id. no. 1 as the first sequence and a sequence id. no. 4 as the second sequence, or a sequence of id. no. 2 as the first sequence and a 50
sequence of id. no. 5 as the second sequence, or a sequence of id. no. 3 as the first sequence and a sequence of id. no. 6 as the second sequence.
4. The double- stranded nucleic acid according to claim 1, characterized in that it is a double- stranded ribonucleic acid, wherein the sense strand comprises the first sequence selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), and the antisense strand comprises the second sequence selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).
5. The double- stranded nucleic acid according to claim 4, characterized in that it comprises a sequence of id. no. 7 as the first sequence and a sequence of id. no. 10 as the second sequence, or a sequence of id. no. 8 as the first sequence and a sequence of id. no. 11 as the second sequence, or a sequence of id. no. 9 as the first sequence and a sequence of id. no. 12 as the second sequence.
6. An expression vector for silencing expression of a gene encoding PRODH/POX protein, characterized in that it comprises a double-stranded nucleic acid as specified in any one of the claims 1 to 3.
7. The expression vector according to claim 6, characterized in that this vector is a plasmid, a transposon, or a virus.
8. A host cell, characterized in that it comprises a double-stranded nucleic acid as specified in any one of the claims 1 to 5, or an expression vector as specified in claim 6 or 7, preferably selected from a prokaryotic cell, such as a bacterial cell, and a eukaryotic cell, such as a plant cell and an animal cell, especially a mammalian cell, in particular a human cell.
9. A cell clone with silenced expression of a gene encoding PRODH/POX protein, characterized in that it comprises a double- stranded nucleic acid as specified in any one of the claims 1 to 5, or an expression vector as specified in claim 6 or 7.
10. The cell clone according to claim 9, characterized in that the clone is a clone of MCF-7 cells, preferably comprising dsDNA as the double-stranded nucleic acid, which dsDNA comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).
11. A pharmaceutical composition for silencing expression of a gene encoding PRODH/POX protein in an organism, characterized in that it comprises a double- stranded nucleic acid as specified in any one of the claims 1 to 5, or an expression vector as specified in claim 6 or 7, and a pharmaceutically acceptable carrier or diluent.
12. The pharmaceutical composition according to claim 11, characterized in that it comprises dsDNA, which comprises the first sequence selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), and the second sequence selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).
13. The pharmaceutical composition according to claim 11 or 12, characterized in that it comprises dsDNA as a double-stranded nucleic acid, which dsDNA comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).
14. The pharmaceutical composition according to claim 11, characterized in that it comprises dsRNA, which comprises the first sequence selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), and the second sequence selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).
15. The pharmaceutical composition according to claim 11 or 14, characterized in that it comprises dsRNA as a double-stranded nucleic acid, which dsRNA comprises a CUAGGACAGAGGCUAUUCAAC sequence (sequence id. no. 7) and a GUUGAAUAGCCUCUGUCCUAG sequence (sequence id. no. 10).
16. An in vitro method of silencing expression of a gene encoding PRODH/POX protein in a cell, characterized in that it comprises the steps of:
(a) introducing a double- stranded nucleic acid as specified in any one of the claims 1 to 5 or an expression vector as specified in any one of the claims 6 to 7 into the cell; and 53
(b) keeping the cell with the introduced double-stranded nucleic acid or vector from step (a) in conditions and for a period of time sufficient to for silencing expression of the gene encoding PRODH/POX protein in the cell.
17. The in vitro method of silencing expression according to claim 16, characterized in that in step a) dsDNA is introduced, which preferably comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).
18. The in vitro method of silencing expression according to claim 17, characterized in that in step a) dsRNA is introduced, preferably comprising a CUAGGACAGAGGCUAUUCAAC sequence (sequence id. no. 7) and a GUUGAAUAGCCUCUGUCCUAG sequence (sequence id. no. 10).
19. The method according to any one of the claims 16 to 18, characterized in that silencing expression of the gene encoding PRODH/POX protein is achieved by using the RNAi method, preferably based on shRNA, miRNA, or siRNA.
20. The method according to claim 19, characterized in that the RNAi method based on shRNA is used for silencing expression of the gene, wherein shRNA preferably comprises a pair of sequences selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1) and GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4) connected to each other in 5 '-3' orientation by a nucleotide linker having 5 to 15 nucleotides in length; and CTAGGACAGAGGCTATTCAAC (sequence id. no. 1) and GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4) connected to each other in 3 '-5' orientation by a nucleotide linker having 5 to 15 nucleotides in length. 54
21. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use in therapy.
22. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use in the treatment and/or prevention of a disorder or disease characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta.
23. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use for inhibiting a growth and/or proliferation of a neoplastic cell.
24. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use for inducing an apoptosis and/or autophagy in a cell, preferably in a neoplastic cell.
25. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use for regulating proline metabolism in an organism.
26. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use in diagnostics.
27. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use in diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfect.
28. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use in the manufacture of a cell line with silenced expression of a gene encoding PRODH/POX protein. 55
29. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use in the manufacture of a non-human transgenic organism with silenced expression of a gene encoding PRODH/POX protein.
30. A double- stranded nucleic acid as specified in any one of the claims 1 to 5 for use in the manufacture of a cell clone with silenced expression of a gene encoding PRODH/POX protein, preferably a clone of MCF-7 cells with silenced expression of a gene encoding PRODH/POX protein.
31. A single-stranded nucleic acid for determining an expression of a gene encoding PRODH/POX protein in a cell, wherein the single- stranded nucleic acid comprises at least one sequence having at least 19 nucleotides in length, which is in at least 70 % complementary, over the length of at least 15 to 17 nucleotides, to the mRNA encoding PRODH/POX protein.
32. The single- stranded nucleic acid according to claim 31, characterized in that it is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are in at least 70 % complementary, over the length of at least 15 to 17 nucleotides, to the mRNA encoding the PRODH/POX protein.
33. The single- stranded nucleic acid according to claim 31, characterized in that it is a single- stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are in at least 70% complementary, over the length of at least 15 to 17 nucleotides, to the mRNA part encoding PRODH/POX protein. 56
34. The single-stranded nucleic acid according to one of the claims 31 to 32, characterized in that it is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), or a sequence comprising an antisense strand selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).
35. The single- stranded nucleic acid according to claim 31 or 33, characterized in that it is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), or a sequence comprising an antisense strand selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).
36. The single- stranded nucleic acid as specified in one of the claims 31 to 35 for use in the manufacture of a microarray for identification of PRODH/POX protein encoding gene transcript expression.
37. The single- stranded nucleic acid as specified in one of the claims 31 to 35 for use in obtaining a sequence having at least partially the length of the cDNA 57
or mRNA of the gene encoding PRODH/POX protein in a cell, wherein the single- stranded nucleic acid comprises at least one sequence having at least 19 nucleotides in length, which is in at least 70 % complementary, over the length of at least 15 to 17 nucleotides, to the mRNA encoding PRODH/POX protein.
38. The single-stranded nucleic acid for use according to claim 37, characterized in that it is a single- stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand which are in at least 70 % complementary, over the length of at least 15 to 17 nucleotides, to the mRNA part encoding PRODH/POX protein.
39. The single-stranded nucleic acid for use according to any one of the claims 37 to 38, characterized in that it is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), or a sequence comprising an antisense strand selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).
40. The single-stranded nucleic acid for use according to claim 37, characterized in that it is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are in at least 70 % complementary, over the length of at least 15 to 17 nucleotides, to the mRNA part encoding PRODH/POX protein. 58
41. The single-stranded nucleic acid for use according to claim 40, characterized in that it is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), or a sequence comprising an antisense strand selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).
42. The single- stranded nucleic acid as specified in any one of the claims 31 to 35 for use in diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta.

59

Statement under Article 19(1) PCT

Original Claims 1, 33, 35, 36, 41, 43 and 45 were amended to address objections raised by ISA. In amended claims the expression "substantially complementary" was replaced with the expression "in at least 70 % complementary" (based on explicit definition in the application - page 20, lines 3 - 6) and the expression "on at least part of its length" was replaced with the expression "over the length of at least 15 to 17 nucleotides" (based on explicit definition in the application - page 20, lines 3 - 11). It is clear that the substantially complementary means at least 70% complementarity, while the complementarity on at least part of its length means complementarity over the length of at least 15 to 17 nucleotides.

Additionally in Claim 1 the expression "is a double-stranded deoxynucleic acid (dsDNA) or a double-stranded ribonucleic acid (dsRNA)" was introduced (based on original claims 2 and 3). It is worth explaining that depending on which DNA template strand, either sense or antisense, mRNA is formed, this mRNA has either sense or antisense sequence. It is unambiguously clear that expressions sense and antisense in this context indicate the strand orientation, i.e. either 5'- 3' orientation or 3'-5' respectively (page 19, lines 25-31).

In original Claim 33 the expression "15 nucleotides" was replaced by "19 nucleotides" (based on original claim 34).

The above amendments make it clear that the application relates to inventions connected by a single inventive concept being nucleic acid molecules, single- or double- stranded, having a length of at least 19 nucleotides, and complementary in at least 70 %, over the mentioned above length, to the mRNA encoding PRODH/POX protein.

Claimed subject-matter is new and inventive in view of the cited publications, because Dl to D9 neither disclose nor suggest claimed solutions.

Dl discloses post-translational inhibition of PRODH/POX expression and general possibility of combining it with antisense nucleic acid or siRNA. D2 discloses PRODH/POX vector for cancer cell transfection to achieve PRODH over-expression, i.e. opposite effect than in the subject application. D3 and D4 disclose use of siRNA PRODH/POX but provide only information about kits used without disclosing any sequence. D5 discloses use of PRODH/POX vector to achieve PRODH over-expression, i.e. opposite effect as in the subject application. D7 and D8 are internet publications concerning PRODH. It was not however established what precisely and when exactly was published therein (specifically before the relevant priority date). 60

It seems based on the dates shown on the webpages that the relevant information was published in 2018, i.e. after the priority date. D9 provides only general information about PRODH shRNA without any sequence information.

Thus in applicant's opinion the claimed subject-matter does not extend beyond original disclosure, therefore it meets requirements of Article 19(2) PCT. It is also deemed clear in the meaning of Articles 5 and 6 PCT and forming single inventive pursuant Article 3 and Rule 13 PCT, as well as new and inventive pursuant to Article 33 PCT.

PCT/PL2018/000061 2017-06-20 2018-06-19 Nucleic acids for silencing an expression of a gene encoding a prodh/pox protein and uses thereof WO2018236232A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PLP.421954 2017-06-20
PL421954A PL239994B1 (en) 2017-06-20 2017-06-20 Bifilar nucleic acid for calming expression of PRODH/POX protein coding gene and its applications, expressive vector, host cell, cell clone, pharmaceutical composition, in vitro method for calming expression of PRODH/POX protein coding gene, monofilar nucleic acid for calming expression of PRODH/POX protein coding gene and its applications

Publications (2)

Publication Number Publication Date
WO2018236232A1 WO2018236232A1 (en) 2018-12-27
WO2018236232A4 true WO2018236232A4 (en) 2019-03-07

Family

ID=63244932

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/PL2018/000061 WO2018236232A1 (en) 2017-06-20 2018-06-19 Nucleic acids for silencing an expression of a gene encoding a prodh/pox protein and uses thereof

Country Status (2)

Country Link
PL (1) PL239994B1 (en)
WO (1) WO2018236232A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7385106B2 (en) * 2000-01-24 2008-06-10 Ramot At Tel Aviv University Ltd. Plants tolerant of environmental stress conditions, methods of generating same and novel polynucleotide sequence utilized thereby
US10517844B2 (en) * 2014-11-13 2019-12-31 Buck Institute For Research On Aging Inhibition of proline catabolism for the treatment of cancer and other therapeutic applications

Also Published As

Publication number Publication date
PL421954A1 (en) 2019-01-02
WO2018236232A1 (en) 2018-12-27
PL239994B1 (en) 2022-02-07

Similar Documents

Publication Publication Date Title
Hannus et al. siPools: highly complex but accurately defined siRNA pools eliminate off-target effects
Toscano-Garibay et al. Transcriptional regulation mechanism mediated by miRNA–DNA• DNA triplex structure stabilized by Argonaute
JP5145557B2 (en) Tumor growth inhibitor containing microRNA as active ingredient, and pharmaceutical composition for cancer treatment
WO2017062754A1 (en) Compositions and methods for enhancing crispr activity by polq inhibition
Roberts et al. Not so pseudo anymore: pseudogenes as therapeutic targets
Régnier et al. The interplay of Hfq, poly (A) polymerase I and exoribonucleases at the 3′ ends of RNAs resulting from Rho-independent termination: a tentative model
WO2019196887A1 (en) Novel small activating rna
JP2015211680A (en) Short hairpin rnas for inhibition of gene expression
JP6137484B2 (en) Double-stranded nucleic acid molecule for gene expression suppression
Chen et al. Preferential production of RNA rings by T4 RNA ligase 2 without any splint through rational design of precursor strand
Olejniczak et al. Sequence-non-specific effects generated by various types of RNA interference triggers
WO2019196883A1 (en) Method for activating p21 gene expression
Baryshev et al. DNA methylation of the Oct4A enhancers in embryonal carcinoma cells after etoposide treatment is associated with alternative splicing and altered pluripotency in reversibly senescent cells
Stiefel et al. Noncoding RNAs, post-transcriptional RNA operons and Chinese hamster ovary cells
Lee et al. Characterization of the long terminal repeat of the endogenous retrovirus-derived microRNAs in the olive flounder
WO2018236232A4 (en) Nucleic acids for silencing an expression of a gene encoding a prodh/pox protein and uses thereof
Bellantuono et al. Hydra as a tractable, long-lived model system for senescence
US20210180055A1 (en) Systems and methods for gene modification
WO2016145608A1 (en) Small activating rna, manufacturing method and application thereof
WO2006130976A1 (en) Interfering rnas, methods for their production, and use
CN114144202A (en) Multiple shRNA for vectors
CN110643607B (en) microRNA related to reproductive function of Liaoyu white cattle and obtaining method thereof
US20220411848A1 (en) Novel Replicase Cycling Reaction (RCR)
WO2022103817A3 (en) Rna molecules for use in inhibiting sars-cov-2 protein production
Patel Antisense Technology

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18755931

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18755931

Country of ref document: EP

Kind code of ref document: A1