WO2016145608A1

WO2016145608A1 - Small activating rna, manufacturing method and application thereof

Info

Publication number: WO2016145608A1
Application number: PCT/CN2015/074358
Authority: WO
Inventors: 李龙承; 龙波; 郭丹
Original assignee: 中国医学科学院北京协和医院
Priority date: 2015-03-17
Filing date: 2015-03-17
Publication date: 2016-09-22

Abstract

Provided is a small activating RNA (saRNA). The saRNA consists of a sense sequence comprising 25-30 nucleotides and an antisense sequence comprising 25-30 nucleotides, wherein at least 80% of the antisense sequence complements the sense sequence. The sense sequence or antisense sequence comprises matching segments having 19-25 nucleotides, the sequence of at least 80% of the matching segment complements a segment in a target gene regulatory sequence.

Description

Small activated RNA and preparation method and application thereof

Technical field

The invention relates to the field of molecular biology, in particular to the application of double-stranded small RNA in the field of RNA activation technology.

Background technique

In 1998, Fire and Mello were found to be a double-stranded small RNA molecule (dsRNA) that triggers an evolutionarily conserved gene expression silencing mechanism called RNA interference (RNAi), a small RNA molecule called small Interfering RNA (siRNA). Since siRNA is capable of specifically silencing the expression of a target gene, it is considered to be very promising to develop a new gene-targeted drug for treating diseases. RNA interference is triggered by endogenous dsRNA molecules or by exogenous introduction of siRNA. Endogenous dsRNA is processed by a longer single-stranded RNA that is processed by a protein called Dicer in the cell after it forms a hairpin structure. Introduction of mature siRNA into cells from outside the cell can also trigger RNA interference. These mature dsRNAs are loaded intracellularly with a protein called Argonaute (AGO), which then directs AGO to bind to mRNA sequences complementary to the intracellular sequence, which in turn cleaves and degrades mRNA, resulting in silencing of gene expression. In 2006, Li et al. found that dsRNA targeting gene regulatory sequences such as promoters can trigger the exact opposite of RNA interference, ie increasing gene expression at the transcriptional and epigenetic levels of the gene, and naming the phenomenon as RNA activation (RNAa), This small RNA against a gene promoter is called a small activating RNA (saRNA). The saRNA is a small double-stranded RNA having a length of 21 nucleosides (nt) and a 2 nucleotide deoxyribonucleic acid (DNA) overhang at the 3' end. After the SARNA is introduced into the cell, the AGO protein is also required to participate in its action, and a saRNA-AGO complex is formed with AGO. After the complex enters the nucleus, it binds to a target site on the chromosome, for example, binds to the promoter region of the gene, and then the AGO protein. The recruitment of other proteins such as RNA polymerase II, histone modification factors and the like to form an RNA-mediated transcriptional activation (RITA) ultimately triggers the increase of gene transcription and epigenetic activation. In addition to being introduced from outside the cell, saRNA is also present in the cell. A typical example is a microRNA (miRNA) of 20-26 nucleotides in length. miRNAs are transcribed from the genome to produce primary miRNAs ranging in length from 80 to several thousand nucleotides. After treatment with the Drosha/DGCR8 complex, the original miRNA becomes a miRNA precursor (precursor miRNA) of approximately 80 nucleotides in length. The precursor miRNA is transported to the cytosol via Exportin5 and processed by an enzyme called Dicer to produce a mature miRNA. These ones miRNAs can also participate in the regulation of gene expression through RNA activation mechanisms. Since RNA activation can purposely activate gene expression, RNA activation can be used as a molecular tool to study gene function, treat various diseases such as cancer, and reprogram cells.

In U.S. Patent Application Serial No. U.S. Patent Application Serial No. U.S. Patent Application Serial No. No. No. No. No. No. No. No. No. No. No. No. No. No. No. No. No. Methods. The saRNA molecule comprises a ribonucleotide molecule that is complementary to a non-coding region of the gene. The region where the saRNA binds is selected to activate the expression of the gene. There are typically two overhanging bases at the 3' end of the ribonucleotide and are not complementary to the non-coding region of the gene of interest, such as two deoxyribonucleotides dTdT. The complementary region of the nucleotide molecule is greater than 14 bases and less than 21 bases. A saRNA molecule is a double-stranded molecule whose second strand is complementary to the first strand to form a double strand with at least two overhanging bases at the 3' end of the two strands. The saRNA molecule can also exist as a single-stranded molecule which can form a double-stranded structure. The first partial region of the single-stranded nucleic acid molecule consists of ribonucleotides and is complementary to the non-coding region of the gene of interest, and the second partial region is complementary to the first partial region to form a double-stranded structure. There are at least two overhanging bases at the 3' end of such a single-stranded nucleic acid molecule. However, the saRNA molecules designed according to the above patent application have the following problems: 1) the design efficiency is not high, the success rate of designing the saRNA according to the above saRNA design rule is only 10% to 20%; 2) the saRNA pair designed according to the above saRNA design rule Target gene activation is ineffective.

Despite the enormous potential use of RNA activation, there is currently a problem of inefficient RNA activation for many genes. On the one hand, it may be because saRNA needs to enter the nucleus; on the other hand, it may be that the saRNA of the prior art design is still quite different from the sequence composition and chemical structure of the endogenous naturally occurring saRNA.

Summary of the invention

In view of the low success rate of saRNA design and the low efficiency of RNA activation in the design and application of saRNA, the present application provides a design method of dsaRNA to improve the efficiency of RNA activation and expand the use of RNA activation. The saRNA according to the present invention is substantially a saRNA (dese substrate saRNA, dsaRNA) as a Dicer substrate, and the inventors of the present invention named it Dicer substrate saRNA in order to distinguish it from the prior art saRNA, unless otherwise specified. The saRNA as a Dicer substrate in the present invention is represented by dsaRNA.

A small activating RNA consisting of a sense sequence comprising 25 to 30 nucleotides and an antisense sequence comprising 25 to 30 nucleotides, at least 80% of the sequence of the antisense sequence being associated with the sense The sequence is complementary; the sense sequence or the antisense sequence comprises a matching fragment having 19 to 25 nucleotides, At least 80% of the sequences in the matched fragments match the target sites of the target gene regulatory sequences. It should be understood that the target gene regulatory sequence of the present invention refers to a DNA sequence located on DNA in the nucleus, which enhances transcription initiation or elongation, or can positively regulate gene transcription through epigenetic mechanisms.

Preferably, the sense sequence and/or the antisense sequence further comprises 1-5 deoxyribonucleotides; preferably, the 2 nucleotides located at the 3' end of the sense sequence and/or the antisense sequence are Deoxyribonucleotides. The inventors found in the study that the addition of deoxyribonucleotides to the sense sequence and/or antisense sequence can increase the resistance of dsaRNA to intracellular RNase degradation and enhance its stability.

Preferably, the target gene regulatory sequence fragment is a target gene promoter sequence fragment; preferably, the target gene promoter sequence fragment is selected from the first 5000 bases upstream from the transcription start point of the target gene to be transcribed from the target gene. The promoter region formed by the previous base from the beginning. Applicants have found in the study that because this region contains specific sequences required for gene transcription, including RNA polymerase or transcription factor binding sites, dsaRNA designed for this region has a higher activation efficiency.

According to an embodiment of the present invention, the target gene of the dsaRNA is the human gene p21; preferably, the target sequence of the target gene is selected from the group consisting of SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66 SEQ ID NO: 67, SEQ ID NO: 68 or SEQ ID NO: 69.

In one embodiment according to the invention, the sense and antisense sequences of the dsaRNA are selected from one of the following combinations:

The sense sequence is SEQ ID NO: 2, and the antisense sequence is SEQ ID NO: 3;

The sense sequence is SEQ ID NO: 4, and the antisense sequence is SEQ ID NO: 5;

The sense sequence is SEQ ID NO: 6, and the antisense sequence is SEQ ID NO: 7;

The sense sequence is SEQ ID NO: 8, and the antisense sequence is SEQ ID NO: 9;

The sense sequence is SEQ ID NO: 10 and the antisense sequence is SEQ ID NO: 11;

The sense sequence is SEQ ID NO: 12 and the antisense sequence is SEQ ID NO: 13.

In one embodiment according to the invention, the target gene is the human pancreatic-duodenal homeobox gene PDX1; preferably, the dsaRNA is directed against the human pancreatic-duodenal homeobox gene PDX1 The sequence and antisense sequences are selected from one of the following combinations:

The sense sequence is SEQ ID NO: 54, and the antisense sequence is SEQ ID NO: 55;

The sense sequence is SEQ ID NO: 56 and the antisense sequence is SEQ ID NO: 57;

The sense sequence is SEQ ID NO: 58, and the antisense sequence is SEQ ID NO: 59;

The sense sequence is SEQ ID NO: 60 and the antisense sequence is SEQ ID NO: 61;

The sense sequence is SEQ ID NO: 62 and the antisense sequence is SEQ ID NO: 63.

In one embodiment according to the invention, the target gene is the human gene NKX3.1; preferably, the sense sequence and the antisense sequence for the small activating RNA of the gene NKX3.1 are selected from one of the following combinations:

The sense sequence is SEQ ID NO: 70 and the antisense sequence is SEQ ID NO: 71;

The sense sequence is SEQ ID NO: 72 and the antisense sequence is SEQ ID NO: 73;

The sense sequence is SEQ ID NO: 74 and the antisense sequence is SEQ ID NO: 75;

The sense sequence is SEQ ID NO: 76 and the antisense sequence is SEQ ID NO: 77;

The sense sequence is SEQ ID NO:78 and the antisense sequence is SEQ ID NO:79.

The invention further provides a method for preparing the small activated RNA described above, the method comprising the steps of:

1) selecting a sequence of 19-25 nt in length from a promoter fragment of the target gene as a target site;

2) synthesizing the nucleotide sequence corresponding to the target site described in the step 1) as a base sequence, adding nucleotides to the length of 25 to 30 nt on both sides of the base sequence to obtain a sense sequence;

3) synthesizing an antisense sequence of 25 to 30 nt in length, and making at least 80% of the sequences in the antisense sequence complementary to the sense sequence obtained in step 2);

4) Combine the sense sequence obtained in step 2) with the antisense sequence obtained in step 3) in the same molar number in RNA annealing buffer, heat to 97 ° C, and then naturally cool to room temperature to obtain double-stranded small activation. RNA.

In an embodiment according to the invention, in step 2), 1 to 5 deoxyribonucleotides are added when synthesizing the sense sequence and/or the antisense sequence; preferably, the sense sequence and/or the The two nucleotides located at the 3' end of the sense sequence are deoxyribonucleotides.

On the other hand, the small activating RNA according to the present invention can be applied to the preparation of a drug for increasing the expression of a target gene, preferably for the preparation of an antitumor drug.

In a further aspect, the invention also provides a method of increasing the expression of a target gene, the method comprising introducing a small activating RNA as a Dicer substrate according to the invention into a cell of a subject.

In still another aspect, the present invention provides a method of preventing and/or treating a tumor comprising introducing a small activating RNA as a Dicer substrate according to the present invention into a subject having a tumor risk and/or having a tumor Preferably, the tumor is selected from the group consisting of bladder cancer, prostate cancer, and liver cancer.

The inventors of the present invention found in the study that the cells store endogenous double-stranded small RNAs which are produced by processing a longer single-stranded RNA through multiple steps. These processes require the participation of multiple RNases. The last step is that the RNA containing the hairpin structure of about 27-70 nucleotides is treated with a protein called Dicer. A mature double-stranded small RNA comprising 21-22 nucleotides is generated. Therefore, the present inventors have found in the study that by designing and synthesizing a dsaRNA longer than the 21 nucleotide saRNA in the prior art, when the dsaRNA is introduced into the cell, the applicant finds that they are treated by the Dicer enzyme to generate a more Natural saRNA can thus more effectively mimic the natural maturation process of endogenous double-stranded small RNA and effectively increase the efficiency of RNA activation.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1a-b are the position and sequence information of dsaP21 prepared according to the present invention on the p21 gene promoter. Among them, Figure 1a shows the distribution of dsaP21 in the human p21 promoter region. Figure 1b shows the designed double-stranded sequence information of the dsaP21 nucleic acid (black bold bases represent deoxyribonucleotides).

Figure 2 is a bar graph showing the effect of dsaRNA-activated p21 mRNA expression prepared according to the present invention.

Figure 3 is a bar graph showing the effect of dsaRNA-activated p21 mRNA expression prepared according to the present invention.

Figure 4 is a bar graph showing the effect of applying dsaP21 prepared according to the present invention to inhibit tumor cell growth, indicating that dsaRNA can effectively inhibit tumor cell growth.

Figure 5 is a cell morphology diagram of inhibiting tumor cell growth after transfection of dsaP21 prepared by the present invention into PC-3 cells, indicating that dsaRNA can effectively inhibit tumor cell proliferation.

Figure 6 is a bar graph showing the effect of activation of p21 mRNA by a nucleic acid molecule of 23 nucleotides in length prepared by the present invention.

Figure 7 is a bar graph showing the effect of activation of p21 mRNA by a nucleic acid molecule of 35 nucleotides in length prepared by the present invention.

Figure 8 is a bar graph showing the effect of dsaPDX1 produced by the present invention on the expression of a non-tumor related gene PDX1 mRNA.

Figure 9 is a bar graph showing the effect of dsaNKX3.1 prepared by the present invention on activation of prostate cancer cell line PC-3 mRNA.

Figure 10 is a cell morphology diagram of inhibiting tumor cell growth after transfection of dsaNKX3.1 prepared by the present invention into PC-3 cells, indicating that dsaRNA can effectively inhibit tumor cell proliferation.

The best way to implement the invention

In order to better explain the present invention, it is convenient to understand the technical solution of the present invention, and now the drawings and the actual The invention is further described in the following examples, and it is to be understood that the invention is not intended to be

Example 1

Materials and Method

1.Dicer substrate saRNA (dsaRNA) design:

The selection of the target site of the dsaRNA of the present invention is based on the following principles: 1. The selected target sequence is the sense sequence of the gene; 2. The 5' end of the guide RNA strand is bound to the 3' end of the target sequence; 3. The target sequence has a GC content of 40-65%; 4. avoids the target sequence comprising 4 or more consecutive repeat base sequences; 5. The target sequence has a lower thermodynamic stability than the 5' end. 6. The selected target site should avoid CpG islands and high GC regions.

In the promoter region of the gene, the designed target site has a sequence length of 19 to 25 bases. The promoter region of the gene is selected from 5000 bases upstream of the transcription start site to one base before the transcription start site of the gene.

Taking the p21 gene as an example, a human p21 (CDKN1A) promoter fragment (SEQ ID NO: 1) was downloaded from the ENSEMBL genomic database, and a total of 1000 base pairs (bp) from the -1000 site to the transcription start site. Using the sequence fragment as a template, six saRNA target sites were designed (as shown in Figure 1a). Each target site has a sequence length of 25 bases. The specific names are as follows:

dsaP21-1 target sequence: SEQ ID NO: 645'-GCTCCAGGTGCTTCTGGGAGAGGTG-3'

dsaP21-2 target sequence: SEQ ID NO: 655'-GTATTAATGTCATCCTCCTGATCTT-3'

dsaP21-3 target sequence: SEQ ID NO: 665'-CCTGGAGAGTGCCAACTCATTCTCC-3'

dsaP21-4 target sequence: SEQ ID NO: 675'-GGATCAGTGGGAATAGAGGTGATAT-3'

dsaP21-5 target sequence: SEQ ID NO: 685'-CCAGATTTGTGGCTCACTTCGTGGG-3'

dsaP21-6 target sequence: SEQ ID NO: 695'-TGCCAACTCATTCTCCAAGTAAAAA-3'.

According to the above target sites, the dsaRNA sense sequence and the antisense sequence were synthesized. The first 23 sequences of the sense sequence were ribonucleotides, the last two were deoxyribonucleotides, and the antisense sequence was 27 nucleotides in length, all of which were ribonucleosides. Glycosylate. Location of the target site and synthetic dsaRNA sense and antisense sequences As shown in Figure 1a - Figure 1b. The six dsaRNAs designed are specifically as follows: dsaP21-1 (sense sequence: SEQ ID NO: 2GCUCCAGGUG CUUCUGGGAG AGGtg; antisense sequence: SEQ ID NO: 3CACGAGGUCC ACGAAGACCC UCUCCAC), dsaP21-2 (sense sequence: SEQ ID NO: 4GUAUUAAUGU CAUCCUCCUG AUCtt; Antisense sequence: SEQ ID NO: 5UACAUAAUUA CAGUAGGAGG ACUAGAA), dsaP21-3 (sense sequence: SEQ ID NO: 6CCUGGAGAGU GCCAACUCAU UCUcc; antisense sequence: SEQ ID NO: 7GAGGACCUCUCACGGUUGAG UAAGAGG), dsaP21-4 (sense sequence: SEQ ID NO: 8 GGAUCAGUGG GAAUAGAGGU GAUat; antisense sequence: SEQ ID NO: 9UCCCUAGUCA CCCUUAUCUC CACUAUA), dsaP21-5 (sense sequence: SEQ ID NO: 10CCAGAUUUGU GGCUCACUUCGUGgg; antisense sequence: SEQ ID NO: 11UCGGUCUAAA CACCGAGUGA AGCACCC), dsaP21-6 (sense sequence: SEQ ID NO: 12UGCCAACUCA UUCUCCAAGUAAAaa; antisense sequence: SEQ ID NO: 13 UCCAGGUUGA GUAAGAGGUU CAUUUUU); dsaControl: (sense sequence: SEQ ID NO: 14 AGTCACUACU GAGUGACAGUAGAat; antisense sequence: SEQ ID NO: 15 AUCUCUACUGU CACUCAGUAG UGACUGC).

2. Comparison of RNA activation efficiency between dsaRNA according to the invention and conventionally designed saRNA

The inventors of the present application also designed six standard saRNAs of 21 nucleotides in length corresponding to the above dsaRNA, wherein the two ends of the sense sequence and the antisense sequence are deoxyribonucleotides, and the specific sequence is:

saP21-1 (sense sequence: SEQ ID NO: 16 GCUCCAGGUGCUUCUGGGAGAdTdT; antisense sequence: SEQ ID NO: 17UCUCCCAGAAGCACCUGGAGCdTdT). saP21-2 (sense sequence: SEQ ID NO: 18 GUAUUAAUGUCAUCCUCCUGAdTdT; antisense sequence: SEQ ID NO: 19UCAGGAGGAUGACAUUAAUACdTdT). saP21-3 (sense sequence: SEQ ID NO: 20CCUGGAGAGUGCCAACUCAUUdTdT; antisense sequence: SEQ ID NO: 21 AAUGAGUUGGCACUCUCCAGGdTdT). saP21-4 (sense sequence: SEQ ID NO: 22 GGAUCAGUGGGAAUAGAGGUGdTdT; antisense sequence: SEQ ID NO: 23 CACCUCUAUUCCCACUGAUCCdTdT). saP21-5 (sense sequence: SEQ ID NO: 24 CCAGAUUUGUGGCUCACUUCGdTdT; antisense sequence: SEQ ID NO: 25 CGAAGUGAGCCACAAAUCUGGdTdT). saP21-6 (sense sequence: SEQ ID NO: 26 UGCCAACUCAUUCUCCAAGUAdTdT; antisense sequence: SEQ ID NO: 27 UACUUGGAGAAUGAGUUGGCAdTdT).

3.dsaRNA and saRNA synthesis:

Chemically synthesize the single strand of the above dsaRNA, perform desalting purification, and then separately The two single strands containing the complementary region (ie, the sense sequence and the antisense sequence) were added to the same RNA annealing buffer, heated to 97 ° C, and then the solution was naturally cooled to room temperature to obtain a double-stranded dsaRNA.

4. Cell culture and transfection:

The exponential growth phase human prostate cancer cell line PC-3 was taken and trypsinized, then suspended in RPMI-1640 medium containing 10% fetal bovine serum, and seeded into 6-well cell culture at a density of 4×10 ⁵ cells/well. Plate, where the medium was 2 ml. 6.25 μl of dsaRNA at a concentration of 20 μM was mixed with 243.5 μl of Opti-MEM medium (purchased from Lifetech), and 5 μl of Lipofectamine RNAiMax (purchased from Lifetech) was diluted with 245 μl of Opti-MEM to dilute dsaRNA with RNAiMax. Mix and leave at room temperature for 20 minutes. The transfection mixture (500 μl) was then added to the cells of the 6-well plate. After mixing well, the cells were placed in a CO ₂ incubator and incubated at 37 ° C for 5% CO ₂ for 72-96 hours.

5. Total RNA extraction from cells:

Total cellular mRNA extraction was performed using the Qiagen RNeasy kit. After 72-96 hours of cell transfection, the medium was removed, the cells were washed with 1 ml of PBS buffer, then 350 μl of RTL buffer was added, the cell lysate was collected, an equal amount of 70% ethanol was added, and finally 50 μl of DEPC-treated water was added, and the mixture was collected by centrifugation. RNA. The resulting RNA solution was measured for its concentration using a Nanodrop instrument.

6. cDNA synthesis:

Take 1 μg of RNA, add DEPC to treat water to 10 μl, add 1 μl (0.5 μg) of Oligo-dT primer, incubate at 70 ° C for 10 minutes, transfer to ice, then add 2.5 μl of RT reaction buffer, 1.0 μl of 25 mM dNTP, 0.5 μl of RNA. Enzyme inhibitor, add water to 25 μl. The reaction was carried out at 45 degrees Celsius for 1 hour and then at 70 degrees Celsius for 10 minutes. Finally, the resulting cDNA was dissolved and diluted to 100 μl with deRNase water.

7. mRNA expression analysis:

mRNA expression analysis was performed using a Power Sybrgreen qPCR mixture (purchased from Lifetech) and an ABI 7500 rapid real-time quantitative PCR instrument. 1 μl of the cDNA product was taken, and 1 μl of 0.67 μM primer, 3 μl of water, and 5 μl of Sybrgreen reagent were added. The reaction was carried out in a PCR instrument using standard procedures. The GAPDH gene was simultaneously amplified as an internal control. The sense primer is: SEQ ID NO: 285'-ATCACCATCTTCCAGGAGCGA-3', and the antisense primer is: SEQ ID NO: 295'-TTCTCCATGGTGGTGAAGACG-3'.

8. Cell proliferation analysis:

Cell transfection was performed in 96-well plates. Cell proliferation is measured using Promega

The AQ _ueous One Solution Cell Proliferation Assay kit is completed. Cell proliferation assays were performed daily for 0-6 days after cell transfection for a total of 6 time points. 20 μl of the solution one reagent was added to the culture medium before the analysis, and then the cells were further cultured at 37 ° C for 30 minutes, and the absorbance was measured with a microplate reader at a wavelength of 490 nm.

9. Cell morphology analysis:

PC-3 tumor cells were uniformly inoculated into 6-well plates, and cells were transfected the next day, and observed under a phase contrast microscope at 72 hours after transfection and photographed.

result

1.dsaRNA triggers RNAa

To evaluate the RNAa activity of dsaRNA, PC-3 cells were transfected with dsaRNA, Mock and dsaControl were used as controls, and dsaControl was used as a control for non-specific dsaRNA, a molecule that was not complementary to any gene sequence in the cell. . The cells were harvested 72 hours after transfection, and total RNA was extracted, and cDNA was obtained by reverse transcription reaction. Using cDNA as a template, p21 mRNA was amplified by real-time quantitative PCR using human p21 gene primer, and GAPDH was amplified as an internal control. As shown in Figure 2, among the 6 dsaRNAs designed, 3 (dsaP21-4, dsaP21-5, dsaP21-6) activated p21 mRNA expression more than 3 fold.

To compare the RNA activation efficacy of dsaRNA with conventionally designed saRNA, PC-3 cells were transfected with saRNA, Mock and dsaControl as controls. Cells were harvested 72 hours after transfection and p21 mRNA expression was analyzed as described above. As shown in Figure 3, only two of the six saRNAs designed (saP21-4) activated p21 mRNA expression with an activation factor of 1.5 to 2.2 fold.

2.dsaRNA inhibits tumor cell proliferation

The p21 gene is an important cell cycle negative regulatory gene and therefore has a tumor suppressing effect. To evaluate the effect of p21dsaRNA on tumor cell growth, PC-3 cells were transfected with p21 dsaRNA and Promega CellTiter was used 72 hours after transfection.

Cell viability was analyzed using the AQ _ueous One Solution Cell Proliferation Assay kit. As shown in Figure 4, dsaP21-4, dsaP21-5, and dsaP21-6 significantly reduced the survival rate of PC-3 cells. Moreover, this effect is associated with the ability of dsaRNA to promote expression of the p21 gene.

3.dsaRNA inhibits tumor cell growth

PC-3 cells were uniformly cultured in 6-well plates, and dsaRNAs designed to target different sites of p21 promoter were transfected into PC-3 cells, respectively, and blank Mock control group and dsaControl control group were set, and the difference was used after 72 hours. The cells were observed under a microscope. As shown in Fig. 5, the growth rate of PC-3 in the experimental group transfected with dsaP21-4, dsaP21-5, and dsaP21-6 was slowed down, and the number was significantly lower than that of the control group. The number of cells transfected with dsaP21-4 was higher than that of the experimental group transfected with dsaP21-5, and the number of cells in the experimental group transfected with dsaP21-6 was smaller. This indicates that the effect of dsaP21 on cell growth inhibition is closely related to the ability of dsaP21 to promote p21 gene expression. The stronger the ability of dsaP21 to promote p21 gene expression, the stronger its ability to inhibit cell growth. These indicate that this dsaP21 is an effective inhibitor of tumor cell growth inhibition.

Compared with the prior art, the present invention demonstrates the activity from the shear of the Dicer enzyme. The substrate saRNA molecule (dsaRNA) of the Dicer enzyme obtained by saRNA can significantly increase the activation efficiency of the target gene. The existing method of the saRNA method is to mimic the product of the dicer enzyme, thereby bypassing its interaction with the Dicer enzyme. The dsaRNAs designed in this patent can improve the efficiency of RNA activation, making the target DNA molecule easier to interact with dsaRNA, thereby facilitating the activation of the target gene more easily and efficiently.

Example 2

(a) Activation efficiency of saRNAs shorter than 25 nucleotides

A dsRNA of 23 nucleotides in length was designed for 6 sites of the p21 gene promoter. They are named: dsP21-1a, dsP21-2a, dsP21-3a, dsP21-4a, dsP21-5a, dsP21-6a. Its sequence is: dsP21-1a (sense sequence: SEQ ID NO: 30GCUCCAGGUGCUUCUGGGAGAGG, antisense sequence: SEQ ID NO: 31UCUCCCAGAAGCACCUGGAGCAC); dsP21-2a (sense sequence: SEQ ID NO: 32GUAUUAAUGUCAUCCUCCUGATC, antisense sequence: SEQ ID NO :33UCAGGAGGAUGACAUUAAUACAU); dsP21-3a (sense sequence: SEQ ID NO: 34CCUGGAGAGUGCCAACUCAUUCU, antisense sequence: SEQ ID NO: 35AAUGAGUUGGCACUCUCCAGGAG); dsP21-4a (sense sequence: SEQ ID NO: 36 GGAUCAGUGGGAAUAGAGGUGAT, antisense sequence: SEQ ID NO: 37CACCUCUAUUCCCACUGAUCCCT); dsP21-5a (sense sequence: SEQ ID NO: 38CCAGAUUUGUGGCUCACUUCGTG, antisense sequence: SEQ ID NO: 39 CGAAGUGAGCCACAAAUCUGGCT); dsP21-6a (sense sequence: SEQ ID NO: 40UGCCAACUCAUUCUCCAAGUAAA, antisense sequence: SEQ ID NO: 41 UACUUGGAGAAUGAGUUGGCACT), wherein the last two bases of the sense sequence are deoxyribonucleotides. The results showed that, as shown in Figure 6, dsP21-3a, dsP21-5a, and dsP21-6a could activate the expression of p21 gene, but the activation efficiency was significantly lower.

(2) Effect of activation efficiency longer than 30 nucleotides

A 35-nucleotide dsRNA was designed for 6 sites of the p21 gene promoter, and was named as dsP21-1b, dsP21-2b, dsP21-3b, dsP21-4b, dsP21-5b, dsP21-6b. The sequence is: dsaP21-1b (sense sequence: SEQ ID NO: 42GUCUAGGUGCUCCAGGUGCUUCUGGGAGAGGUGAC, antisense sequence: SEQ ID NO: 43CACCUCUCCCAGAAGCACCUGGAGCACCUAGACAC); dsaP21-2b (sense sequence: SEQ ID NO: 44AUUUUUAUGUAUUAAUGUCAUCCUCCUGAUCUUTT, antisense sequence: SEQ ID NO: 45AAGAUCAGGAGGAUGACAUU AAUACAUA AAAAUTC); dsaP21-3b (sense sequence is: SEQ ID NO: 46UGUGUCCUCCUGG AGAGUGCCAACUCAUUCUCCAA, antisense sequence: SEQ ID NO: 47GGAGAAUGAGUUGGCACUCUCCAGGAGGACACAGC); dsaP21-4b (sense sequence: SEQ ID NO: 48CUAGUGAGGGAUCAGUGGGAAUAGAGGUGAUAUTG, antisense sequence: SEQ ID NO: 49AUAUCACCUCUAUUCCCACUGAUCCCUCACUAGGT); dsaP21-5b (sense sequence: SEQ ID NO: 50AAAAAAAGCCAGAUUUGUGGCUCACUUCGUGGGGA, antisense sequence: SEQ ID NO: 51CCCACGAAGUGAGCCACAAAUCUGGCUUUUUUUAC); dsaP21-6b (sense sequence: SEQ ID NO: 52CUGGAGAGUGCCAACUCAUUCUCCAAGUAAAAAAA, antisense sequence: SEQ ID NO: 53UUUUUACUUGGAGAAUGAGUUGGCACUCUCCAGGA), wherein the last two sequences of justice are deoxygenated Ribonucleotides.

The results showed that, as shown in Figure 7, dsP21-3b, dsP21-5b, and dsP21-6b could activate the expression of p21 gene, but the activation efficiency was significantly lower.

Example 3

The dsaRNA designed according to the present invention has a highly efficient expression of the pancreatic-duodenal homeobox gene (PDX1). PDX1 gene is an important gene regulating islet function, and PDX1 can also promote insulin gene expression in non-β cells such as hepatocytes, which has important application value in the treatment of diabetes. We designed dsaRNAs for different sites in the promoter region of the PDX1 gene. The deoxyribonucleotides in the dsaRNA sequence are represented by lower case bold in the sequence shown below. dsaPDX1-1 (sense sequence: SEQ ID NO: 54 CACACUAUGUCCAUUAUCAAAUA ta, antisense sequence: SEQ ID NO: 55 UAUAUUUGAUAAUGGACAUAGUGUGUU); dsaPDX1-2 (sense sequence: SEQ ID NO: 56CCGACAUCUUUGUGGCUGUGAACaa, antisense sequence: SEQ ID NO: 57UUGUUCACAGCCACAAAGAUGUCGGUU); dsaPDX1-3 (sense sequence: SEQ ID NO: 58GACCUAGAGAGCUGGGUCUGCAAac, antisense sequence: SEQ ID NO: 59GUUUGCAGACCCAGCUCUCUAGGUCAG); dsaPDX1-4 (sense sequence: SEQ ID NO: 60ACAACGAAUGCCAGAGUUUCGUGtg, antisense sequence: SEQ ID NO :61CACACGAAACUCUGGCAUUCGUUGUGU); dsaPDX1-5 (sense sequence: SEQ ID NO: 62GUACUUGCAGCACAUCCACAAGUaa, antisense sequence: SEQ ID NO: 63UUACUUGUGGAUGUGCUGCAAGUACUU), wherein the last two bases of the sense sequence are deoxyribonucleotides. The designed dsaPDX1 was transfected into HepG2 cells respectively, and the concentration of dsaPDX1 RNA was 50 nM. After 96 hours of transfection, the cells were collected, total RNA was extracted, and the expression of PDX1 gene was detected. The results showed that dsaPDX1-1, dsaPDX1-3 and dsaPDX1-4 can efficiently activate the expression of PDX1 gene in HepG2 cells. (Figure 8).

Example 4

The dsaRNA designed according to the present invention has a highly efficient expression of the NKX3.1 gene. NKX3.1 is a prostate specific and androgen regulating gene. Highly expressed in human prostate tissue, it is a prostate-specific tumor suppressor and plays an important role in the treatment of prostate cancer. The present invention designs dsaRNAs for different sites in the NKX3.1 promoter. The deoxyribonucleotides in the dsaRNA sequence are represented by lower case bold in the sequence shown below. Wherein dsaNKX-1 (sense sequence: SEQ ID NO: 70GAGGAGAGCUGGAGAAGGAGAGGaa, antisense sequence: SEQ ID NO: 71UUCCUCUCCUUCUCCAGCUCUCCUCCC); dsaPDX1-2 (sense sequence: SEQ ID NO: 72AGAGCUAACUGGACUGUUUGUCUtg, antisense sequence: SEQ ID NO: 73CAAGACAAACAGUCCAGUUAGCUCUUC); dsaPDX1-3 (sense sequence: SEQ ID NO: 74CUGUAAUUGGCUCUGACGGUCCUGA, antisense sequence: SEQ ID NO: 75UCAGGACCGUCAGAGCCAAUUACAGGG); dsaPDX1-4 (sense sequence: SEQ ID NO: 76AGAGCACCCAGAACUCUCACGGUac, antisense sequence: SEQ ID NO: 77GUACCGUGAGAGUUCUGGGUGCUCUCU); dsaPDX1-5 (sense sequence: SEQ ID NO: 78AGAUAUUGCAGAUCUGAGUUUGCac, antisense sequence: SEQ ID NO: 79 GUGCAAACUCAGAUCUGCAAUAUCUAC), wherein the last two bases of the sense sequence are deoxyribonucleotides. The designed dsaNKX was transfected into prostate cancer PC-3 cells respectively, and the concentration of dsaNKX RNA was 50 nM. After 96 hours of transfection, the cells were collected, total RNA was extracted, and the expression of NKX3.1 gene was detected. The results showed that dsaNKX-1, dsaNKX-2, dsaNKX-3, dsaNKX-4 and dsaNKX-5 can efficiently activate the expression of NKX3.1 gene in PC-3 cells, of which dsaNKX-1 and dsaNKX-5 are activated. The effect is more pronounced (Figure 9), which is effective in inhibiting the proliferation of PC-3 cells (Figure 10).

While the invention has been described and illustrated in detail, it is understood that the invention Various modifications, changes and variations of the present invention are possible without departing from the spirit and scope of the invention.

Claims

A small activating RNA, characterized in that the small activating RNA consists of a sense sequence comprising 25-30 nucleotides and an antisense sequence comprising 25-30 nucleotides, at least one of the antisense sequences 80% of the sequence is complementary to the sense sequence; the sense sequence or the antisense sequence comprises a target gene regulatory sequence-matching fragment having 19-25 nucleotides, the matching fragment having at least 80% sequence and target Target site matching of gene regulatory sequences.
The small activating RNA according to claim 1, wherein said sense sequence and/or antisense sequence further comprises 1-5 deoxyribonucleotides; preferably, said sense sequence and/or antisense The two nucleotides located at the 3' end of the sequence are deoxyribonucleotides.
The small activating RNA according to claim 1 or 2, wherein the target gene regulatory sequence fragment is a target gene promoter sequence fragment; preferably, the target gene promoter sequence fragment is upstream of a target gene transcription initiation point A promoter region formed by one base of 5000 bases to the start of transcription of the target gene.
The small activating RNA according to any one of claims 1 to 3, wherein the target gene is a human gene p21; preferably, the target site sequence of the target gene regulatory sequence is selected from the group consisting of SEQ ID NO: 64. One of SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68 or SEQ ID NO: 69.
The small activating RNA according to claim 4, wherein the sense sequence and the antisense sequence of the small activating RNA are selected from one of the following combinations:

The sense sequence is SEQ ID NO: 2, and the antisense sequence is SEQ ID NO: 3;

The sense sequence is SEQ ID NO: 4, and the antisense sequence is SEQ ID NO: 5;

The sense sequence is SEQ ID NO: 6, and the antisense sequence is SEQ ID NO: 7;

The sense sequence is SEQ ID NO: 8, and the antisense sequence is SEQ ID NO: 9;

The sense sequence is SEQ ID NO: 10 and the antisense sequence is SEQ ID NO: 11;

The sense sequence is SEQ ID NO: 12 and the antisense sequence is SEQ ID NO: 13.
The small activating RNA according to any one of claims 1 to 3, wherein the target The gene is the human pancreas-duodenum homeobox gene PDX1; preferably, the sense sequence and the antisense sequence against the small activation RNA of the human pancreatic-duodenal homeobox gene PDX1 are selected from one of the following combinations :

The sense sequence is SEQ ID NO: 54, and the antisense sequence is SEQ ID NO: 55;

The sense sequence is SEQ ID NO: 56 and the antisense sequence is SEQ ID NO: 57;

The sense sequence is SEQ ID NO: 58, and the antisense sequence is SEQ ID NO: 59;

The sense sequence is SEQ ID NO: 60 and the antisense sequence is SEQ ID NO: 61;

The sense sequence is SEQ ID NO: 62 and the antisense sequence is SEQ ID NO: 63.
The small activating RNA according to any one of claims 1 to 3, wherein the target gene is the human gene NKX3.1; preferably, the sense sequence of the small activating RNA against the gene NKX3.1 And the antisense sequence is selected from one of the following combinations:

The sense sequence is SEQ ID NO: 70 and the antisense sequence is SEQ ID NO: 71;

The sense sequence is SEQ ID NO: 72 and the antisense sequence is SEQ ID NO: 73;

The sense sequence is SEQ ID NO: 74 and the antisense sequence is SEQ ID NO: 75;

The sense sequence is SEQ ID NO: 76 and the antisense sequence is SEQ ID NO: 77;

The sense sequence is SEQ ID NO:78 and the antisense sequence is SEQ ID NO:79.
A method of producing a small activating RNA according to any one of claims 1 to 7, wherein the method comprises the steps of:

1) selecting a sequence comprising 19 to 25 bases as a target site in a promoter sequence fragment of the target gene;

2) synthesizing the RNA sequence corresponding to the target site described in the step 1) as a base sequence, adding nucleotides to one or both sides of the base sequence to a length of 25 to 30 nucleotides to obtain a sense sequence ;

3) synthesizing an antisense sequence of 25 to 30 nt in length, and making at least 80% of the sequence of the antisense sequence complementary to the sense sequence obtained in step 2);

4) Combine the sense sequence obtained in step 2) with the antisense sequence obtained in step 3) in the same molar number in RNA annealing buffer, heat to 97 ° C, and then naturally cool to room temperature to obtain double-stranded small activation. RNA.
The method according to claim 8, wherein in step 2), at least one deoxyribonucleotide is added when synthesizing said sense sequence and/or antisense sequence, preferably synthesizing said positive The two nucleotides at the 3' end of the sense sequence and/or the antisense sequence are deoxyribonucleotides.
The use of the small activating RNA according to any one of claims 1 to 7 for the preparation of a medicament for increasing expression of a target gene, preferably for use in the preparation of an antitumor drug;

Preferably, the tumor is selected from the group consisting of bladder cancer, prostate cancer, and liver cancer.
A method of increasing the expression of a target gene, the method comprising introducing the small activating RNA of any one of claims 1 to 7 into a cell of a subject.
A method of preventing and/or treating a tumor, the method comprising introducing the small activating RNA of any one of claims 1 to 7 into a subject having a risk of having a tumor and/or having a tumor Preferably, the tumor is selected from the group consisting of bladder cancer, prostate cancer, and liver cancer.