WO2018236232A1

WO2018236232A1 - Nucleic acids for silencing an expression of a gene encoding a prodh/pox protein and uses thereof

Info

Publication number: WO2018236232A1
Application number: PCT/PL2018/000061
Authority: WO
Inventors: Jerzy PAŁKA; Ilona ΖΑRĘΒΑ; Nafis RAHMAN; Arkadius SURAŻYŃSKI; Wojciech Miltyk
Original assignee: Uniwersytet Medyczny W Białymstoku
Priority date: 2017-06-20
Filing date: 2018-06-19
Publication date: 2018-12-27
Also published as: PL421954A1; WO2018236232A4; PL239994B1

Abstract

The subject matter of this invention relates to a double-stranded nucleic acid for silencing expression of a gene encoding PRODH/POX protein in a cell, an expression vector for silencing expression of a gene encoding PRODH/POX protein comprising such double- stranded nucleic acid, a host cell comprising such double-stranded nucleic acid or vector, a cell clone with silenced expression of a gene encoding PRODH/POX protein comprising such double-stranded nucleic acid or vector, a pharmaceutical composition for silencing expression of a gene encoding PRODH/POX protein in an organism comprising such double-stranded nucleic acid or vector, and a pharmaceutically acceptable carrier or diluent. the subject matter of the invention further relates to an in vitro method of silencing expression of a gene encoding PRODH/POX protein in a cell, wherein a double-stranded nucleic acid or vector is introduced, keeping the cell with the introduced double-stranded nucleic acid or vector in conditions and for a period of time sufficient for silencing expression of a gene encoding PRODH/POX protein in a cell. The subject matter of the invention also relates to the double- stranded nucleic acid for use in the therapy, treatment and/or prevention of a disorder or disease characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta; for inhibiting a growth and/or proliferation of a neoplastic cell; for inducing apoptosis and/or autophagy; for use in diagnostics, especially diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta; for use in the manufacture of a cell line with silenced expression of a gene encoding PRODH/POX protein; for use in the manufacture of a non-human transgenic organism with silenced expression of a gene encoding PRODH/POX protein; for use in the manufacture of a cell clone with silenced expression of a gene encoding PRODH/POX protein, preferably a clone of MCF-7 cells with silenced expression of a gene encoding PRODH/POX protein. The subject matter of the invention also relates to a single-stranded nucleic acid for determining an expression of a gene encoding PRODH/POX protein in a cell comprising at least one sequence having at least 15 nucleotides in length, which is substantially complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein. The subject matter of the invention also relates to a single-stranded nucleic acid for use in the manufacture of a microarray for identification of PRODH/POX protein encoding gene transcript expression, for use for obtaining a sequence having at least partially the length of the cDNA or mRNA of the gene encoding PRODH/POX protein in a cell.

Description

Nucleic acids for silencing an expression of a gene encoding a PRODH/POX protein and uses thereof

Field of the invention

The invention relates to the field of silencing gene expression, in particular to a designed specific double strand of nucleic acid, especially a double-stranded deoxyribonucleic acid (dsDNA) and a double-stranded ribonucleic acid (dsRNA), for use for silencing expression of a gene encoding PRODH/POX protein, i.e. proline dehydrogenase (PRODH)/ proline oxidase (POX). More specifically, the subject matter of this invention concerns a double-stranded nucleic acid for silencing expression of a gene encoding PRODH/POX protein, an expression vector comprising such nucleic acid, a host cell comprising such expression vector or nucleic acid, a cell clone comprising such nucleic acid or expression vector, a pharmaceutical composition comprising such nucleic acid or expression vector, an in vitro method of silencing expression of a gene encoding PRODH/POX protein and uses of a double-stranded nucleic acid. The subject matter of the invention is also a single-stranded nucleic acid for silencing expression of a gene encoding PRODH/POX protein and its uses. The invention also relates to the above-mentioned nucleic acid molecules of for use in therapy, as a medicament, in diagnostics, in the treatment and/or prevention of disorders characterized by an impaired proline metabolism through silencing expression of a gene encoding PRODH/POX protein, for the manufacture of a microarray for identification of PRODH/POX protein encoding gene transcript expression.

Background art

Proline oxidase (POX), also known as proline dehydrogenase (PRODH), is a mitochondrial enzyme dependent on flavin nucleotides (Donald SP, Sun XY, Hu CA, Yu J, Mei JM, Valle D, et al. Proline oxidase, encoded by p53-induced gene-6, catalyzes the generation of proline-dependent reactive oxygen species. Cancer Res. 2001 ;61 (5): 1810-5 ; Phang JM, Donald SP, Pandhare J, Liu Y. The metabolism of proline, a stress substrate, modulates carcinogenic pathways. Amino Acids. 2008;35(4):681-90)). The sequence of this enzyme is known and available in the NCBI (National Center of Biotechnology Information) database. For example, the human sequence is available in the database, i.e., the complete human PRODH 1 sequence (GenBank: AF120278.1; date of accession: 5/15/2014), transcription variant 1 (tvl) (NCBI Reference Sequence: NM_016335.4; date of accession: 5/15/2014) and transcription variant 2 (tv2) (NCBI Reference Sequence: NM_001195226.1; date of accession: 5/15/2014). Sequences of PRODH/POX proteins of other organisms are also known and publicly available in databases; the same applies to the nucleic acid sequences of that encode them. The sequences are highly conserved across different organisms, such as viruses, bacteria, plants, and animals, including mammals and humans. This enzyme catalyzes a conversion of proline to Al-pyrroline-5-carboxylic acid (P5C). During the process, electrons are transported to the respiratory chain, thus contributing to the production of ATP, or directly reduce oxygen, thus producing reactive oxygen species (ROS). A diagram of the proline cycle in a cell is presented in Fig. 1. (Fig. 1). It is known that, depending on the cellular environment and metabolic situation in the proline cycle either 1) PRODH/POX is activated, resulting in the production of an ATP molecule, which replenishes energy deficits , and promotes cell survival (see, for example: Phang JM, Donald SP, Pandhare J, Liu Y. The metabolism of proline, a stress substrate, modulates carcinogenic pathways. Amino Acids. 2008;35(4):681-90; Hu CA, Donald SP, Yu J, Lin WW, Liu Z, Steel G, et al. Overexpression of proline oxidase induces proline-dependent and mitochondria-mediated apoptosis. Mol Cell Biochem. 2007;295(l-2):85-92; Liu Y, Borchert GL, Surazynski A, Hu CA, Phang JM. Proline oxidase activates both intrinsic and extrinsic pathways for apoptosis: the role of ROS/superoxides, NFAT and MEK/ERK signaling. Oncogene. 2006;25(41):5640-7), or 2) caspase-9 and caspase-3 are activated by ROS, initiating apoptosis (see, for example: Liu W, Phang JM. Proline dehydrogenase (oxidase), a mitochondrial tumor suppressor, and autophagy under the hypoxia microenvironment. Autophagy. 2012;8(9): 1407-9; Martindale JL, Holbrook NJ. Cellular response to oxidative stress: signaling for suicide and survival. J Cell Physiol. 2002;192(1): 1-15; Raha S, Robinson BH. Mitochondria, oxygen free radicals, and apoptosis. Am J Med Genet. 2001;106(l):62-70; Phang JM. The regulatory functions of proline and pyrroline-5- carboxylic acid. Curr Top Cell Regul. 1985;25:91-132; Phang JM, Pandhare J, Liu Y. The metabolism of proline as microenvironmental stress substrate. J Nutr. 2008;138(10):2008S- 15S).

Probably, both processes, i.e. both ATP and ROS production, occur simultaneously. However, the mechanism of directing a cell to the pathway of apoptosis or survival is not known yet.

Thus, an important step of proline utilization is its conversion to P5C in mitochondria, resulting in the generation of ATP or ROS, as shown in Fig. 1 and Fig. 2. The intensity of this process and its influence on apoptosis/autophagy is probably regulated by the energy status of a cell, but this hypothesis is confirmed by just a few studies (see, for example: Liu W, Phang JM. Proline dehydrogenase (oxidase), a mitochondrial tumor suppressor, and autophagy under the hypoxia microenvironment. Autophagy. 2012;8(9): 1407-9; Phang JM, Liu W, Hancock C, Christian KJ. The proline regulatory axis and cancer. Front Oncol. 2012; 2(60): 1-12).

In mitochondria, P5C is converted to glutamic acid under the influence of P5C dehydrogenase, and glutamic acid into a-ketoglutaric acid under the influence of glutamate dehydrogenase. These conversions in a way include α-ketoglutaric acid in the tricarboxylic acid (TCA) cycle. In the case of a defective TCA cycle, glutamic acid may leave the mitochondrion and be converted to P5C in cytoplasm under the influence of P5C synthetase, which is converted to proline under the influence of P5C reductase (Fig. 1). Cytoplasmic proline may be either used in collagen biosynthesis (see, for example: Maxwell SA, Rivera A. Proline oxidase induces apoptosis in tumor cells, and its expression is frequently absent or reduced in renal carcinomas. J Biol Chem. 2003;278(l l):9784-9), or transported again to the mitochondrion, creating the so-called proline cycle, generating ROS, which may induce apoptosis (Fig. 1) (see, for example: Phang JM. The regulatory functions of proline and pyrroline-5-carboxylic acid. Curr Top Cell Regul. 1985;25:91-132; Phang JM, Pandhare J, Liu Y. The metabolism of proline as microenvironmental stress substrate. J Nutr. 2008;138(10):2008S-15S); Liu W, Phang JM. Proline dehydrogenase (oxidase), a mitochondrial tumor suppressor, and autophagy under the hypoxia microenvironment. Autophagy. 2012;8(9): 1407-9)).

Hence, it may be hypothesized that ROS are generated through intensive conversion of proline to P5C, i.e. in the conditions of the enhanced proline cycle. This occurs in the case of increased availability of proline as a substrate for PRODH/POX and increased prolidase activity releasing proline from dipeptide bonds. This may also take place when P5C cannot be converted in the mitochondria to glutamate and α-ketoglutaric acid, a metabolite of the TCA cycle, due to the TCA being overloaded with metabolites or due to mutations of the TCA cycle enzymes (see, for example: Eddy AA, Giachelli CM. Renal expression of genes that promote interstitial inflammation and fibrosis in rats with protein-overload proteinuria. Kidney Int. 1995;47(6): 1546-57).

Impaired proline metabolism results, consequently, in a number of disorders and/or diseases, such as neoplastic diseases, in particular breast cancer, Ehlers-Danlos syndrome (skin elasticity disorder), Marfan syndrome, or osteogenesis imperfecta (brittle bone disease, increased susceptibility to bone fractures). Previous in vitro studies on the role of PRODH/POX expression and the significance of proline availability as the enzyme's substrate in regulating apoptosis/autophagy were carried out in cellular models in a short time frame (up to 24 h). The results of those studies significantly suggest that incresed proline concentration in the cytoplasm combined with high PRODH/POX activity promote apoptosis. In the case of reduced PRODH/POX activity combined with high proline concentration, autophagy occurs (within 24 h) (see, for example: Liu W, Phang JM. Proline dehydrogenase (oxidase), a mitochondrial tumor suppressor, and autophagy under the hypoxia microenvironment. Autophagy. 2012;8(9): 1407-9; Phang JM, Liu W, Hancock C, Christian KJ. The proline regulatory axis and cancer. Front Oncol. 2012;2(60): 1-12)).

There are known methods of reducing expression of proteins and genes encoding them. The expression can be reduced by:

i) full or partial deletion/modification of a fragment of a genome;

ii) use of specific inhibitors reacting directly with the obtained protein or indirectly through an interaction with transcription factors mediating the initiation of a specific protein expression; or

iii) post-transcription silencing of gene expression.

Post-transcription silencing of gene expression consists in silencing expression of a protein encoded by the genes, without affecting the sequence of the whole genome. This can be achieved through the use of RNA interference, also known as RNAi (see, for example: Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science. 2002;296(5567):550-3.). This process consists in specific degradation of target rnRNA using homologous sequences of short RNA fragments. More specifically, the RNAi mechanism consists in inducing degradation of mRNA or blocking its translation by short, non-coding RNA molecules, such as shRNA (short-hairpin RNA), siRNA (small interfering RNA), and miRNA (micro RNA). RNAi mechanisms are presented in Figure 5 (Fig. 5). A common feature of these molecules is their strong interaction with matrix mRNA, leading to degradation of mRNA or inhibition of translation, consequently preventing the protein product production (see, for example, Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science. 2002;296(5567):550-3; Brummelkamp TR, Bernards R, Agami R. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell. 2002:2(3):243-7; Mollaie HR, Monavari SH, Arabzadeh SA, Shamsi-Shahrabadi M, Fazlalipour M, Afshar RM. RNAi and miRNA in viral infections and cancers. Asian Pac J Cancer Prev. 2013;14(12):7045-56; EP OK. siRNAs and shRNAs: Tools for protein knockdown be gene silencing https ://www. labome. com/method/ siRN As- and- shRNAs- Tools-for-Protein-Knockdown-by-Gene-Silencing.html: Mater Methods; 2013; Williams AE. Functional aspects of animal microRNAs. Cell Mol Life Sci. 2008;65(4):545-6213-17).

There are currently commercially available kits for silencing expression of PRODH/POX and/or the gene encoding it ;, for example, from ThermoFisher Scientific or Santa Cruz Biotechnology. However, the manufacturers of such kits do not guarantee obtaining any specific effects, repeatability or effectiveness of silencing a target gene. Moreover, there are no official data on the effectiveness of silencing using such products.

Moreover, there are currently commercially available starter sequences (primers) for quantitative and qualitative analysis of gene expression, for example, using the polymerase chain reaction (PCR) method and its modifications, such as real time PCR (RT-PCR) and real time quantitative PCR (RT-QPCR), but the sequences are not specific enough for the sequence encoding PRODH/POX protein and do not allow efficient and repeatable silencing of PRODH/POX expression or a nucleic acid sequence encoding the protein.

In light of the above, it seems that reduced PRODH/POX activity, depending on the availability of proline, may be the mechanism that activates apoptosis or autophagy in a cell. Thus, providing means for the effective silencing of expression of a gene encoding PRODH/POX protein is of crucial importance for the possibility of regulating the proline cycle, and such means may have many therapeutic, preventive and diagnostic applications, in particular for controlling PRODH/POX expression, especially in disorders and diseases characterized by an impaired proline metabolism.

Therefore, there is a need in the field of this invention for effective and reliable means and methods enabling the silencing of expression of a gene encoding PRODH/POX protein in an efficient, repeatable and effective way, enabling degradation of PRODH/POX mRNA or inhibition of translation, ultimately preventing product production - PRODH/POX protein, and suitable for use in the therapy and prevention of disorders and diseases characterized by an impaired proline metabolism, including neoplasms, in particular breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, or brittle bone disease. There is also a need in the field of this invention for means for identifying and monitoring proline metabolism in a cell and for diagnosing the above-mentioned diseases.

The object of the invention is in particular to provide means for silencing expression of a gene encoding PRODH/POX protein using RNA interference (RNAi), especially shRNA, enabling effective, repeatable and efficient silencing of PRODH/POX expression. Brief description of the invention

The above-mentioned objects have been achieved with the solutions claimed in the attached patent claims.

This invention provides compounds, means, compositions, and methods for silencing expression of a gene encoding PRODH/POX protein in a cell. The cell may be a prokaryotic cell, such as a bacterial cell, or an eukaryotic cell, such as a plant cell, but especially an animal cell, in particular a mammalian cell, such as a human cell. Nucleic acid molecules according to this invention can be synthesized chemically, enzymatically, or through expression. The solutions according to the invention have many industrial applications, in particular therapeutic, preventive, and diagnostic applications, as well as in genomic analyses, genetic engineering, and pharmacogenomics.

The studies carried out by the present inventors in a longer time frame (after several passages) have shown that cells with silenced PRODH/POX expression were subject to apoptosis in the presence of proline. This allows to conclude that PRODH POX silencing through autophagy may lead to apoptosis.

The above observation is supported by the results of the studies presented below, which indicate that reduced PRODH/POX expression and increased proline availability (deriving from the degradation of glycyl-proline (GlyPro) by prolidase) result in a decrease in DNA biosynthesis.

Induction of autophagy in cells with silenced expression of a gene encoding PRODH/POX protein, as proved in the studies performed by the present inventors, takes place in the presence of proline. A deficiency of this amino acid, caused, e.g. by the inhibition of enzymatic prolidase activity or utilization of this amino acid in the process of collagen biosynthesis, leads to apoptosis. The above studies suggest that reduced PRODH/POX activity, depending on the availability of intracellular proline, may be the mechanism that triggers apoptosis or autophagy in a cell.

The above hypothesis is supported by the results of the study indicating that reduced expression of a gene encoding PRODH/POX protein and increased availability of proline (deriving from the degradation of imidopeptides, e.g., glycyl-proline (GlyPro), by prolidase) results in a decrease in DNA biosynthesis and collagen biosynthesis (Fig. 3). At the same time, prolidase activity and intracellular proline concentration are increased.

The functional significance of silencing an expression of a gene encoding PRODH/POX protein can be observed in the analysis of the expression of apoptosis and autophagy markers, as shown schematically in Figure 4 (Fig. 4). In cells with normal PRODH/POX protein expression, GlyPro mostly induces the expression of PRODH/POX, p53, and active caspase-3 and -9. Whereas in cells with silenced PRODH/POX protein expression, occurs mainly an increased expression of beclin-1 protein, Atg7, AMPKa, HEF- la, mTOR, iNOS, and NF-KB.

Induction of autophagy in a cell with silenced expression of a gene encoding PRODH/POX protein takes place in the presence of proline. Whereas in a cell with normal PRODH/POX expression and in the case of increased proline availability caused by increased enzymatic activity of prolidase or by inhibition of proline utilization in the process of collagen biosynthesis, apoptosis takes place.

The subject matter of this invention concerns a double- stranded nucleic acid for silencing expression of a gene encoding PRODH/POX protein in a cell, wherein the double- stranded nucleic acid comprises at least a sense strand and an antisense strand, each having at least 19 nucleotides in length, which are substantially complementary to each other, wherein the sense strand comprises a first sequence, and the antisense strand comprises a second sequence complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein, and wherein the double- stranded nucleic acid, upon introducing it into a cell expressing the gene encoding PRODH/POX protein, silences the expression of the gene.

Preferably, the double-stranded nucleic acid according to the invention is a double- stranded deoxynucleic acid (dsDNA).

Preferably, the double-stranded nucleic acid according to the invention is a double- stranded ribonucleic acid (dsRNA).

Preferably, the double-stranded nucleic acid according to the invention is a double- stranded deoxynucleic acid wherein the sense strand comprises a first sequence selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), and the antisense strand comprises a second sequence selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

More preferably, the double-stranded nucleic acid according to the invention comprises a sequence of id. no. 1 as the first sequence and a sequence of id. no. 4 as the second sequence, or a sequence of id. no. 2 as the first sequence and a sequence of id. no. 5 as the second sequence, or a sequence of id. no. 3 as the first sequence and a sequence of id. no. 6 as the second sequence.

Preferably, the nucleic acid according to the invention is a double-stranded ribonucleic acid wherein the sense strand comprises the first sequence selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7),

GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), and the antisense strand comprises the second sequence selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).

More preferably, the nucleic acid according to the invention comprises a sequence of id. no. 7 as the first sequence and a sequence of id. no. 10 as the second sequence, or a sequence of id. no. 8 as the first sequence and a sequence of id. no. 11 as the second sequence, or a sequence of id. no. 9 as the first sequence and a sequence of id. no. 12 as the second sequence.

The subject matter of the invention also concerns an expression vector for silencing expression of a gene encoding PRODH/POX protein, characterized in that it comprises the double-stranded nucleic acid as specified above.

Preferably, the expression vector according to the invention is a plasmid, a transposon, or a virus.

The subject matter of the invention also concerns a host cell, characterized in that it comprises a double-stranded nucleic acid as specified above, or an expression vector as specified above, more preferably selected from a prokaryotic cell, such as a bacterial cell, and a eukaryotic cell, such as a plant cell and an animal cell, especially a mammalian cell, in particular a human cell.

The subject matter of the invention also concerns a cell clone with silenced expression of a gene encoding PRODH/POX protein, characterized in that it comprises a double- stranded nucleic acid as specified above or an expression vector as specified above.

Preferably, the cell clone according to the invention is a clone of MCF-7 cells, preferably comprising dsDNA as the double-stranded nucleic acid, which dsDNA comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).

The subject matter of the invention also concerns a pharmaceutical composition for silencing expression of a gene encoding PRODH/POX protein in an organism, characterized in that it comprises a double-stranded nucleic acid as specified above or an expression vector as specified above, and a pharmaceutically acceptable carrier or diluent.

Preferably, the pharmaceutical composition according to the invention comprises dsDNA, which comprises the first sequence selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1),

GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), and the second sequence selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

More preferably, the pharmaceutical composition according to the invention comprises dsDNA as a double-stranded nucleic acid, which dsDNA comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).

More preferably, the pharmaceutical composition according to the invention comprises dsRNA, which comprises the first sequence selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7),

GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), and the second sequence selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).

More preferably, the pharmaceutical composition according to the invention comprises dsDNA as a double-stranded nucleic acid, which comprises a CUAGGACAGAGGCUAUUCAAC sequence (sequence id. no. 7) and a GUUGAAUAGCCUCUGUCCUAG sequence (sequence id. no. 10).

The subject matter of the invention also concerns an in vitro method of silencing expression of a gene encoding PRODH/POX protein in a cell, comprising the steps of:

(a) introducing a double-stranded nucleic acid as specified above or an expression vector as specified above into the cell; and

(b) keeping the cell with the introduced double- stranded nucleic acid or the vector from step (a) in conditions and for a period of time sufficient for silencing expression of the gene encoding PRODH/POX protein in the cell. Preferably, in the method according to the invention, in step a) dsDNA is introduced which preferably comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).

More preferably, in step a) of the method according to the invention, dsRNA is introduced which preferably comprises a CUAGGACAGAGGCUAUUCAAC sequence (sequence id. no. 7) and a GUUGAAUAGCCUCUGUCCUAG sequence (sequence id. no. 10).

Preferably, in the method according to the invention, silencing an expression of a gene encoding PRODH/POX protein is achieved using the RNAi method, more preferably the method based on shRNA, miRNA, or siRNA.

Even more preferably, in the method of silencing expression according to the invention , the RNAi method based on shRNA is used, wherein shRNA preferably comprises a pair of sequences selected from: a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4) connected to each other in 5 '-3' orientation by a nucleotide linker having 5 to 15 nucleotides in length, and a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4) connected to each other in 3 '-5' orientation by a nucleotide linker having of 5 to 15 nucleotides in length.

The subject matter of the invention also concerns a double-stranded nucleic acid as specified above for use in therapy.

The subject matter of the invention also concerns a double- stranded nucleic acid as specified above for use in the treatment and/or prevention of a disorder or disease characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta (brittle bone disease).

The subject matter of the invention also concerns a double- stranded nucleic acid as specified above for use for inhibiting a growth and/or proliferation of a neoplastic cell.

The subject matter of the invention also concerns a double-stranded nucleic acid as specified above for use for inducing apoptosis and/or autophagy in a cell, preferably in a neoplastic cell.

The subject matter of the invention also concerns a double-stranded nucleic acid as specified above for use for regulating proline metabolism in an organism.

The subject matter of the invention also concerns a double- stranded nucleic acid as specified above for use in diagnostics. The subject matter of the invention also concerns a double- stranded nucleic acid as specified above for use in diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta (brittle bone disease).

The subject matter of the invention also concerns a double- stranded nucleic acid as specified above for use in the manufacture of a cell line with silenced expression of a gene encoding PRODH/POX protein.

The subject matter of the invention also concerns a double-stranded nucleic acid as specified above for use in the manufacture of a non-human transgenic organism with silenced expression of a gene encoding PRODH/POX protein.

The subject matter of the invention also concerns a double-stranded nucleic acid as specified above for use in the manufacture of a cell clone with silenced expression of a gene encoding PRODH/POX protein, preferably a clone of MCF-7 cells with silenced expression of a gene encoding PRODH/POX protein.

The subject matter of the invention also concerns a single- stranded nucleic acid for determining expression of a gene encoding PRODH/POX protein in a cell, wherein the single- stranded nucleic acid comprises at least one sequence having at least 15 nucleotides in length which is substantially complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein.

Preferably, the single- stranded nucleic acid according to the invention comprises a sequence having at least 19 nucleotides in length.

More preferably, the single- stranded nucleic acid according to the invention is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are substantially complementary, on at least part of their length, to the mRNA part encoding PRODH/POX protein.

More preferably, the single-stranded nucleic acid according to the invention is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand which are substantially complementary, on at least part of their length, to the mRNA part encoding PRODH/POX protein.

Even more preferably, the single-stranded deoxynucleic acid according to the invention can be a sequence comprising a sense strand comprising a sequence selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1),

GCATGTGTGACCAGATCAGCT (sequence id. no. 2) and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), or a sequence comprising an antisense strand comprising a sequence selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5) and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

Even more preferably, the single-stranded ribonucleic acid according to the invention can be a sequence comprising a sense strand comprising a sequence selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7),

GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8) and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), or a sequence comprising an antisense strand comprising a sequence selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11) and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).

The subject matter of the invention further concerns a single- stranded nucleic acid as specified above for use in the manufacture of a microarray for identification of PRODH/POX protein encoding gene transcript expression.

Preferably, the single-stranded nucleic acid for use as specified above comprises a sequence having at least 19 nucleotides in length.

The subject matter of the invention also concerns the single-stranded nucleic acid as specified above for use for obtaining a sequence having at least partially the length of the cDNA or mRNA of the gene encoding PRODH/POX protein in a cell, wherein the single- stranded nucleic acid comprises at least one sequence having at least 15 nucleotides in length which is substantially complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein.

Preferably, the single- stranded nucleic acid for use as specified above comprises a sequence having at least 19 nucleotides in length.

More preferably, the single-stranded nucleic acid according to the invention is a single- stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand which are substantially complementary, on at least part of their length, to the mRNA part encoding PRODH/POX protein.

Even more preferably, the single-stranded nucleic acid according to the invention is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2) and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), or a sequence comprising an antisense strand selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5) and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

More preferably, the single- stranded nucleic acid according to the invention is a single- stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are substantially complementary, on at least part of their length, to the mRNA part encoding PRODH/POX protein.

Even more preferably, the single-stranded nucleic acid according to the invention is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8) and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), or a sequence comprising an antisense strand selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).

The subject matter of the invention also concerns a single-stranded nucleic acid as specified above for use in the diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta (brittle bone disease).

Detailed description of the invention

Silencing expression of a gene encoding PRODH/POX protein and/or an expression of this protein contributes to the induction of functional changes in cells and the induction of pathways promoting cell survival, including, among others, reduced DNA and collagen synthesis and increased prolidase activity.

According to the invention, silencing expression of a gene encoding PRODH/POX protein is achieved through post-transcription silencing of expression of a gene encoding PRODH/POX protein.

The nucleic acid sequences designed by the present inventors may be effectively used for silencing PRODH/POX protein expression, especially by using RNA interference (RNAi), more specifically through inducing mRNA degradation or blocking its translation by short, non-coding RNA molecules, such as shRNA, siRNA, and microRNA. The sequences designed and produced by the present inventors exhibit high specificity to the sequences encoding PRODH/POX protein and, consequently, result in very effective and very efficient silencing of expression of a gene encoding PRODH/POX protein, which is confirmed, among others, by the obtained results of experiments on silencing expression of a gene encoding PRODH/POX protein presented below. These molecules exhibit a strong influence on messenger mRNA, which results in the degradation of mRNA or inhibition of PRODH/POX protein translation, ultimately preventing the production of the protein product and a change in the use of the substrate in the proline cycle, which results in a prolonged state of energy deficiency in a cell, for example, a neoplastic cell, deriving from the conversion of proline to P5C as an alternative source of energy and the accumulation of proline as a molecule with a high oxidation-reduction potential. In the case of neoplastic cells, this leads to their death, which makes it possible to use the solutions according to this invention as drugs, especially in the treatment and/or prevention of such diseases.

The present inventors have made a conjecture that high proline content and high PRODH/POX activity may promote the induction of apoptosis. It cannot be excluded, however, that low PRODH/POX activity, which promotes autophagy, may be an intermediate step in the induction of apoptosis. The accumulation of proline in the cytoplasm (from the products of collagen degradation) and the lack of possibility to utilize it in mitochondria (due to low PRODH/POX activity) disturbs the oxidation-reduction balance, leading to induction of apoptosis. Proline has a reduction potential which requires to be utilized quickly to ensure the oxidation-reduction balance between mitochondria and cytoplasm.

The present inventors have also made a conjecture that the intensity of proline utilization to P5C and the impact of this process on apoptosis depends on the availability of the substrate and on further conversions of P5C. The availability of the substrate (proline) is provided by the cytoplasmic enzyme - prolidase, which recovers proline from imidopeptides deriving from the products of protein degradation, mainly collagen. The main mechanism of proline utilization is collagen biosynthesis. However, proline utilization in the mitochondria has more serious metabolic consequences than utilization of this amino acid in the process of collagen biosynthesis.

The above hypotheses are supported by the results of the studies carried out by the present inventors, which have shown that reduced expression of the gene encoding PRODH/POX protein and increased availability of proline (from the degradation of glycyl- proline (GlyPro) by prolidase) causes a decrease in DNA biosynthesis. Induction of autophagy in cells with silenced expression of PRODH/POX, as demonstrated in the studies, takes place in the presence of proline. A deficiency of this amino acid, caused e.g., by inhibition of enzymatic prolidase activity or utilization of this amino acid in the process of collagen biosynthesis, may lead to apoptosis. Thus, the above studies confirm that reduced PRODH/POX activity, depending on the availability of intracellular proline, may be the mechanism that activates apoptosis or autophagy in a cell.

It results from the studies carried out by the present inventors in a longer time frame (after several passages) that in the presence of proline, cells with silenced expression of PRODH/POX were subject to apoptosis. This allows to conclude that silencing expression of a gene encoding PRODH/POX protein by directing the cell to the autophagy pathway will lead to apoptosis, which makes it possible to use the solutions according to the invention in a number of medical applications, in particular in the therapy, treatment and/or prevention of diseases characterized by an impaired proline metabolism, as well as a number of diagnostic applications.

The double- stranded nucleic acid molecules designed according to this invention can be used for silencing expression of a gene encoding PRODH/POX protein, in particular using RNAi technology. According to the invention, it is possible to achieve the silencing of a gene encoding PRODH/POX protein using dsRNA or dsDNA molecules. As results from the studies presented below, the effectiveness of such silencing reaches even 50%.

Silencing expression of a gene encoding PRODH/POX protein can be achieved using the RNAi method. For example, it is possible to apply the RNAi method using shRNA based on a DNA sequence, which is then introduced into the vector in the standard way, using methods and means known in the art (see, for example: Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science. 2002; 296(5567):550-3; EP OK. siRNAs and shRNAs: Tools for protein knockdown by gene silencing https://www.labome.com/method/siRNAs-and-shRNAs- Tools-for-Protein-Knockdown-by-Gene-Silencing.html: Mater Methods; 2013).

For example, an introduction of a sequence in the form of siRNA leads to "one- time'Vshort-term silencing of an expression of a protein. This is connected with the fact that in the case of siRNA, the sequence is not amplified in the cell. Using this method results in short-term silencing of expression of the target protein, depending on the adaptation mechanisms of the cell.

Introduction of a sequence in the form of miRNA results in a similar effect as in the case of using the sequence in the form of siRNA. The difference consists in that in the case of miRNA, substantial complementarity of the sequence introduced to the target mRNA sequence is sufficient. Introduction of a sequence in the form of shRNA results in a stable, long-term silencing of expression of a target protein. Unlike in the case of using siRNA or miRNA, shRNA molecules introduced by the vector are amplified, whichresults in their constant presence in the host cell without interference in the genomic DNA sequence of the cell or the organism. Due to their constant presence, the degradation of the transcript encoding the target protein occurs continuously, which blocks the process of translation thus preventing the production of the protein.

The expression vector according to the invention may be any plasmid, a transposon sequence or a virus, preferably selected from lentiviruses or retroviruses which are suitable for introduction into a prokaryotic or eukaryotic cell and expression of the sequences introduced this way. The vector with the insert (the designed deoxynucleic acid according to this invention) is introduced into a cell to obtain a host cell, where the nucleic acid sequence is transcribed into RNA, transcription to RNA, wherein mutually complementary chains are then assembled into a characteristic double-strand structure called short hairpin RNA (shRNA). Under the influence of DICER enzyme, this structure is converted to a double-stranded sequence, which is cleaved into single oligonucleotide strands, which subsequently attach to the complementary fragment of the mRNA strand with the RISC enzymatic complex, thus inhibiting the translation of the protein being the subject of interest in a cell. In the case of introducing a sequence using a plasmid, silencing of the expression of the target protein is stable (long-term), resulting from the amplification of the sequence in the form of DNA, which is subsequently transcribed into the RNA sequence that can "attach" to the mRNA sequence encoding the target protein.

Another exemplary way to achieve the silencing of expression of a gene encoding PRODH/POX protein with the use of the RNAi method is an introduction of a sequence according to the invention in the form of siRNA. Introduction of a sequence in the form of siRNA is carried out in the standard way, using methods and means known in the art (see, for example: Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science. 2002; 296(5567):550-3; EP OK. siRNAs and shRNAs: Tools for protein knockdown by gene silencing https://www.labome.com/memod/siRNAs-and-shRNAs-Tools-for-Protein-Knockdown-by- Gene-Silencing.html: Mater Methods; 2013). This leads to "one-time" (short-term) silencing of the expression of the protein. This is connected with the fact, that in the case of siRNA, the sequence is not amplified in a cell. Using this method results in short-term silencing expression of the target protein, depending on the cellular adaptation mechanisms. Using a sequence in the form of siRNA makes it possible to examine the importance of the short- term suppression (silencing) of protein expression and to recognize the cell's adaptation mechanisms against this impairment.

It is also possible to introduce a sequence for silencing expression of a gene encoding PRODH/POX protein in the form of miRNA, which has a similar effect as in the case of using the siRNA method. The difference is that in the case of using miRNA, the substantial complementarity of the sequence introduced to the target mRNA sequence is sufficient, for example the complementarity over a lengths of at least 15 to 17 nucleotides. Introduction of the sequence in the form of miRNA is carried out in the standard way, using methods and means known in the art (see, for example: Bartel DP. MicroRNAs: Genomics, Biogenesis, Mechanism and Function. Cell, 2004; 116:281-297; Khvorova A, Reynolds A, Jayasena SD. Functional siRNA and miRNAs Exhibit Strand Bias. Cell, 2003;115:209-216; Thompson DW, Bracken CP, Goodall GJ. Exprimental strategies for microRNA target identification. Nucleic Acids Res, 2011;16:6845-6853; Zhao J, Liu Y. Virus-based MicroRNA Silencing, htt ://www .bio-protocol . or g/e 1714 ; Li JF, ZhangD, Sheen J. Epitope-tagged protein-based artificial microRNA (ETPamir) screens for optimized gene silencing in plants. Nat Protoc. 2014;4:939-949).

The scientific and technical terms used in this description have the usual meaning used in the field of this invention. The definitions below are provided to help the reader carry out this invention.

The term PRODH/POX used herein relates to a protein, being an enzyme, namely, proline dehydrogenase (PRODH), also known as proline oxidase (POX). It can be a mammalian, especially a human protein, as well as a plant, bacterial or viral protein. The sequences of PRODH/POX proteins in different organisms are very similar. Generally, it is a mitochondrial enzyme dependent on flavin nucleotides. The sequence of this enzyme is known and available under access number GenBankTM NM_016335; hhis is a human sequence. Amino acid sequences of PRODH POX protein from other species, as well as the nucleic acid sequences encoding them, are known and publicly available.

In the context of this invention, the terms "silencing expression of a gene encoding protein" or "silencing expression" for short, used with reference to the gene encoding PRODH POX protein relate to at least partial and/or full suppression of expression of the gene encoding PRODH/POX protein, which is manifested in the reduced amount of transcribed mRNA of the PRODH/POX gene and/or degradation of such transcript below the level observed in the absence of the nucleic acid according to the invention. This leads, in consequence, to at least partial blocking of PRODH/POX protein production and at least partial suppression of PRODH/POX protein activity. Depending on the applied method of introduction and the kind of sequences being introduced into a host cell, different levels of silencing of expression of a gene encoding PRODH/POX protein can be achieved. These levels can be calculated using the following formula:

% silencing= (PRODH/POX expression in control cells) - (PRODH/POX expression in tested cells)/ (PRODH/POX expression in control cells).

Basically, the level of silencing expression of the gene encoding the PRODH/POX protein can be determined in any cell with PRODH/POX expression, with the use of any appropriate method to determine gene expression. Some exemplary, non-limiting, methods that can be used for this purpose are presented in the examples below.

The double-stranded nucleic acid in the context of this invention means a double- stranded ribonucleic acid (dsRNA) or a double-stranded deoxyribonucleic acid (dsDNA).

The term "double-stranded RNA" (dsRNA) as used herein relates to a complex of molecules of ribonucleic acid having a duplex structure comprising two antiparallel and substantially complementary strands of ribonucleic acid, called a sense strand and an antisense strand. The two strands forming a duplex structure can be different parts of one bigger RNA molecule or separate RNA molecules. The separate molecules forming dsRNA are referred to as siRNA ("short interfering RNA") or miRNA ("microRNA"). If the two strands are part of one bigger molecule, i.e. if there is a segment of nucleotides between them, called a nucleotide linker, located between 3' end of one strand and 5' end of the other strand forming the duplex structure, the RNA structure referred to as hairpin loop RNA (or shRNA) is formed. The length of the nucleotide linker can vary; for example, but without limitation thereto, it can have from 5 to 15 nucleotides in length, as it is known in the art. It can also have any sequence, provided that the sequence makes it possible to form a loop structure. The strands of dsRNA can have the same or different number of nucleotides, with the minimum of 19 nucleotides in length. Apart from the duplex structure, dsRNA may comprise one or more nucleotide overhangs, called flanking sequences, which can preferably constitute restriction enzyme recognition sites.

The term "double-stranded deoxynucleic acid" (dsDNA) in the context of this invention relates to a deoxynucleic acid molecule having a duplex structure comprising two antiparallel and substantially complementary strands of a nucleic acid, called a sense strand and an antisense strand. The two strands forming the DNA duplex structure can be different parts of one bigger DNA molecule or can be separate DNA molecules. If the two strands are part of one bigger DNA molecule, there is a segment of nucleotides between them, called a nucleotide linker, located between 3' end of one strand and 5' end of the other strand forming the duplex structure. The length of the nucleotide linker can vary; for example, but without limitation thereto, it can have from 5 to 15 nucleotides in length, as it is known in the art. It can also have any sequence, provided that the sequence makes it possible to form a loop structure. The strands of dsDNA can have the same or different number of nucleotides, with a minimum of 19 nucleotides in length. Apart from the duplex structure, dsDNA may comprise one or more nucleotide overhangs, called flanking sequences, which can preferably constitute sites recognized by restriction enzymes.

The single-stranded nucleic acid in the context of this invention means a single- stranded ribonucleic acid (ssRNA) or a single-stranded deoxyribonucleic acid (ssDNA).

The term "single-stranded RNA" (ssRNA) as used herein relates to single ribonucleic acid molecules having a structure of a single strand fragment (linear structure) comprising one sense strand or one antisense strand which are substantially complementary to the ribonucleic acid matrix strand. Single ssRNA strands may also optionally form a duplex structure, for example, in the case of RNAi with the use of shRNA, or they may be different parts of one bigger RNA molecule, or they may be separate RNA molecules.

The term "single-stranded deoxynucleic acid" (ssDNA) in the context of this invention relates to single molecules of a deoxynucleic acid having the structure of a single strand fragment (linear structure) comprising one sense strand or one antisense strand which are substantially complementary to the deoxyribonucleic acid matrix strand. Single ssDNA strands may also optionally form a duplex structure, e.g., in the case of RNAi with the use of shRNA, or they may be different parts of one bigger DNA molecule, or they may be separate DNA molecules.

The term "sense strand" in the context of this invention means the nucleotide sequence (in 5 '-3' orientation) of a nucleic acid molecule according to this invention having substantial complementarity to the target sequence of a nucleic acid according to the invention.

The term "antisense strand" means the nucleotide sequence (in 3 '-5' orientation) of a nucleic acid according to this invention having substantial complementarity to the target sequence of a nucleic acid according to the invention.

The target sequence of a nucleic acid as used herein relates to at least part of the nucleotide sequence of rriRNA molecule formed during the transcription of PRODH/POX gene of animal origin, especially mammalian, especially human origin and a plant origin PRODH/POX gene, to be silenced. For example, mRNA sequences of transcript variants 1 and 2 of a human PRODH gene are presented in Figures 7 and 8, respectively.

In the context of this invention, the terms "complementarity" and "substantial complementarity" mean that part of the length of the nucleic acid sequence is complementary in at least 70%to the mRNA encoding PRODH/POX protein, preferably in at least 80%, more preferably in at least 90% or even 100%. For example, substantial complementarity necessary to achieve the silencing of expression of a gene encoding the PRQDH/POX protein according to this invention requires a complementarity over the length of at least 15 to 17 nucleotides, preferably 15 to 19 nucleotides. This makes it possible to achieve up to 50% silencing effectiveness. Methods for determining complementarity, including complementarity degree, are known in the art.

The term "expression vector" in the context of this invention means a nucleic acid molecule comprising a sequence encoding at least one nucleic acid according to the invention in a way that enables expression upon introduction into a cell and/or an organism.

The dsDNA and dsRNA sequences comprise in their sequences a fragment of a DNA or RNA strand, respectively, which is complementary to the DNA or RNA sequence encoding PRODH/POX protein.

The host cell as understood in the context of this invention is any eukaryotic cell, such as a plant cell, an animal cell, especially a mammalian cell, in particular a human cell, or a prokaryotic cell, such as a bacterial cell, comprising at least one introduced nucleic acid sequence according to this invention, or at least one expression vector according to the invention. The host cells according to this invention can be obtained using any method known in the art.

A disorder or disease connected with an impaired proline metabolism in the context of this invention means any disease, condition or disorder wherein proline metabolism is impaired or abnormal. Exemplary disorders and diseases characterized by an impaired proline metabolism are: a neoplasm, such as breast cancer, Ehlers-Danlos syndrome (skin elasticity disorder), Marfan syndrome, osteogenesis imperfecta (increased susceptibility to bone fractures), or symptoms of prolidase deficiency, such as impaired wound healing, immunological deficiencies, lower leg ulcers, etc. The proline content in a cell is a resultant of the degradation process of proteins comprising proline (mostly collagen) and the processes of utilizing this amino acid. Proline is released from imidopeptides by a cytoplasmic enzyme, prolidase. Free proline can be used in collagen biosynthesis or converted in mitochondria to pyrroline-5-carboxylic acid. Any impairment of these processes may lead to tissue fibrosis (excessive collagen biosynthesis) or weakened supportive tissues functions, e.g., bones (insufficient collagen biosynthesis). In the case of energy deficiencies, proline can be used as an alternative source of energy through conversion to pyrroline-5-carboxylic acid (P5C) in a mitochondrion, producing ATP or reactive oxygen species (ROS). ATP production promotes cell survival in energy deficiency conditions, whereas ROS generation induces the process of programmed cell death (apoptosis). The utilization of proline in mitochondria, on the one hand, decreases the availability of this amino acid for the process of collagen biosynthesis and mediates connective tissue stroma remodeling, and on the other hand, promotes reorganization of cellular energy metabolism. The impairment of proline metabolism may result in Ehlers- Danlos syndrome (skin elasticity disorder), Marfan syndrome, osteogenesis imperfecta (increased susceptibility to bone fractures), or symptoms of prolidase deficiency, such as: impaired wound healing, immunological deficiencies, lower leg ulcers, etc. The impaired PRODH/POX expression may mediate these phenomena. Thus, reducing PRODH/POX expression may decrease the utilization of proline in mitochondria and increase its availability for the process of collagen biosynthesis. In neoplastic cells, lowering PRODH/POX expression may induce long-term autophagy, what leads to apoptosis, which results in the death of neoplastic cells. Therefore, lowering the expression of the gene encoding PRODH/POX protein makes it possible to treat diseases characterized by an impaired proline metabolism, in particular a neoplasm, especially breast cancer, but also other diseases such as Ehlers-Danlos syndrome, Marfan syndrome, or osteogenesis imperfecta.

The essence of the invention consists in nucleic acid sequences silencing expression of a gene encoding PRODH/POX protein in a cell, especially in a eukaryotic cell, such as a prokaryotic cell, such as a bacterial cell, or a eukaryotic cell, such as an animal cell, especially a mammalian cell, in particular a human cell. The cell can also be a plant cell. Depending on the method of introducing into the cell, the sequences attach to the mRNA encoding PRODH/POX protein thus blocking the translation process, and consequently leading to the degradation of the mRNA encoding PRODH/POX protein. This process results in a lack of or reduced expression of PRODH/POX protein.

Silencing the expression of PRODH/POX leads to proline metabolism impairment by blocking proline degradation in a cell mitochondrion, thus causing an impairment of the cell functioning. These impairments, resulting from impairment in the cellular oxidation- reduction potential, cause the cell to enter the autophagy pathway, which in the long run may lead to apoptosis.

Depending on the applied method of introduction into the host cell, different levels of silencing expression of PRODH/POX protein can be achieved. This can be calculated using the formula:

% silencing= (PRODH/POX expression in control cells) - (PRODH/POX expression in tested cells)/ (PRODH/POX expression in control cells)

According to the invention, it is possible to achieve at least 10% effectiveness in silencing expression of a gene encoding PRODH/POX protein , especially at least 15%, especially at least 20%, especially at least 30%, especially at least 35%, especially at least 40%, especially at least 45%, especially at least 50%, especially at least 55%, or even 100%.

Tables 1 and 2 below present oligonucleotide sequences for silencing expression of the gene encoding PRODH/POX protein according to the invention.

More specifically, Table 1 presents oligonucleotide sequences according to the invention that silence expression of the gene encoding PRODH/POX protein and which are based on DNA sequence. Table 2 presents oligonucleotide sequences according to the invention that silence the expression of the gene encoding PRODH/POX protein and which are based on RNA sequence.

Table 1. DNA sequences for silencing expression of a gene encoding PRODH/POX protein

Table 2. RNA sequences for silencing PRODH/POX protein expression based on RNA sequences.

The subject matter of the invention also concerns an expression vector for silencing expression of a gene encoding PRODH/POX protein. Such vector comprises introduced nucleic acid sequences according to the invention. Such vector can preferably be any plasmid, in particular a plasmid that enables the expression of at least one introduced nucleic acid sequence according to the invention. The expression vector according to the invention may comprise expression control elements operably linked to nucleic acid sequences according to the invention in order to enable the efficient expression of a nucleic acid sequence according to the invention upon introduction into a cell, such as promoter, signals for translation initiation and termination. The vector according to the invention preferably can also be a transposon or a virus, such as a lentivirus or a retrovirus. Such vectors are produced using methods known in the art, and the resultant clones can be introduced into the relevant cells to obtain host cells, in the standard way, such as lipofection, electroporation, thermal shock, or chemical methods.

The subject matter of the invention also concerns a host cell comprising such an expression vector. The host cell may be a prokaryotic cell, such as a bacterial cell, but also a eukaryotic cell, such as an animal cell, especially a mammalian cell, in particular a human cell. The host cell may also be a plant cell. Such host cells can be obtained in any standard way known in the art, using commercially available means and conditions as recommended by their manufacturers.

The subject matter of the invention also concerns a cell clone with silenced expression of a gene encoding PRODH/POX protein, comprising a nucleic acid according to the invention or a vector according to the invention. The cell clone according to the invention is obtained in any standard way known in the art, using a nucleic acid or a vector according to the invention, due to which the obtained clone has silenced expression of a gene encoding PRODH/POX protein. For example, the cell clone can be obtained according to this invention through transfection of a relevant host cell with the expression vector according to the invention, or using other methods of introducing nucleic acids into the cell; for example, using a gene gun, as it is known in the art. The cell clone according to the invention is preferably a clone of MCF-7 breast cancer cells comprising a vector according to the invention, preferably in the form of a plasmid, as described above.

The double-stranded nucleic acids according to this invention can also be used to obtain a non-human transgenic organism with silenced expression of a gene encoding PRODH/POX protein, such as a non-human transgenic animal. Such transgenic organisms can be obtained in any way known in the art, for example, through transfection. A transgenic organism obtained in this way, such as a non-human transgenic animal, comprises at least one cell comprising at least one nucleic acid according to this invention or a vector according to this invention.

The subject matter of the invention also concerns a pharmaceutical composition as described above, which can be used for therapeutic and/or preventive purposes in disorders or diseases characterized by an impaired proline metabolism, as described above. Such pharmaceutical compositions are produced in any standard way using methods known to the skilled persons. The composition according to the invention comprises a pharmaceutically acceptable carrier or diluent. According to this invention, any pharmaceutically acceptable carriers and diluents can be used, i.e., substances suitable for pharmaceutical applications, as it is known in the field. Carriers and diluents suitable for use in pharmaceutical compositions are known. The composition according to the invention can be administered via any route, for example, enterally, orally, or parenterally, for example in an intravenous, intramuscular or subcutaneous injection, etc. It can also be administered locally, in a targeted manner.

Industrial application

The double-stranded nucleic acid sequences designed and produced by the present inventors silence expression of PRODH/POX protein through post-transcription silencing of a gene encoding PRODH/POX protein, in particular through the use of RNA interference (RNAi), in particular by inducing mRNA degradation or blocking its translation by means of short, non-coding RNA molecules, such as shRNA, siRNA, or microRNA. This makes it possible to use the solutions according to the invention to modulate, in particular to silence, an expression of PRODH/POX protein, and consequently to modify proline metabolism in a cell as shown in Figures 3, 4, and 6.

The nucleic acid sequences designed and produced by the present inventors can be used to modify existing cell lines and to establish new cell lines or transgenic organisms, such as a new clone of MCF-7 cells with silenced expression of PRODH/POX, as shown in Fig. 3 and 6.

Moreover, the nucleic acid sequences designed and produced by the present inventors can be used to assess expression of PRODH/POX protein as starter sequences (primers) in PCR reactions and their modifications (inter alia, RT-PCR, RT-QPCR) and to manufacture a microarray for identification of PRODH/POX protein encoding gene transcript expression. The solutions according to the invention can be used to test the control of cell metabolism, to obtain diagnostic tests, assess a degree of neoplasm malignancy and the related survival prognosis, and, by modifying the control of protein expression, the solutions can also be used as a component of a therapy, especially an antineoplastic therapy, or a therapy for other diseases characterized by an impaired proline metabolism.

Target sequences with indicated attachment sites of primers to the sequence of mRNA encoding PRODH/POX protein, and highliting transcript variant 1 (tv.l) and transcript variant 2 (tv.2), are presented in Table 1 above.

Table 3 below shows DNA sequences that can be used for the analysis of PRODH/POX protein expression as primers in PCR reactions and their modifications, such as RT-PCR, RT-QPCR, or for amplification of a given fragment of a gene encoding PRODH/POX protein.

The solutions according to the invention enable silencing expression of a gene encoding PRODH/POX protein. Thus, the invention can be used to silence an expression and to regulate PRODH/POX protein and proline metabolism (Fig. 3, 4, and 6) through the use of methods, among others, based on RNAi, especially shRNA, siRNA or microRNA. According to the invention, it is possible to use both deoxynucleic and ribonucleic nucleic acids.

Table 3. DNA sequences for the analysis of expression of a gene encoding PRODH/POX protein. These sequences enable the formation of a specified mRNA transcript as shown in this table, and consequently the appropriate protein fragment, which can be formed upon using a sequence according to the invention

The invention will be illustrated below by examples and figures, which however shall not limit in any way the scope of invention protection as defined in the patent claims.

Brief description of the figures:

Fig. 1 presents a diagram of the cellular proline cycle: Pro - proline; PRODH/POX - proline dehydrogenase/proline oxidase; P5C - Al-pyrroline-5-carboxylic acid; ROS - reactive oxygen species; ATP - adenosine-5'-triphosphate; Glu - glutamine; a -KG - a- ketoglutarate; p53 - p53 protein; X - an exemplary amino acid, e.g., glycine; HIF-la - hypoxia- inducible factor 1.

Fig. 2 presents a diagram of the cellular proline utilization pathway. Pro - proline; PRODH/POX - proline dehydrogenase/proline oxidase; shRNA PRODH/POX - a sequence silencing PRODH/POX introduced using the RNAi method based on shRNA; P5C - Δ1- pyrroline-5-carboxylic acid; ROS - reactive oxygen species; ATP - adenosine-5'- triphosphate; GlyPro - glycyl-proline; AMPK - protein kinase activated by AMP; AKT - actin kinase; mTOR - mTOR kinase; HIF- 1 a - hypoxia- inducible factor- 1 ; VEGF - vascular endothelial growth factor ; TNF - tumor necrosis factor; IL-1 - interleukin-1; COX-2 - cyclooxygenase 2; NF-κΒ - transcription factor.

Fig. 3. presents the effect of silencing PRODH/POX expression and the addition of glycyl-proline (GlyPro) on survival (A), DNA biosynthesis (B), collagen biosynthesis (C), prolidase activity (D), and intracellular proline concentration (E) in breast cancer cells (MCF-7) and cells with silenced expression of PRODH/POX (MCF-7^{shPR0DH P0X}).

Fig. 4. presents the expression of β-actin, PRODH/POX, p53 protein, caspase-3 and -9 (total and active form), PARP protein (total and active form), PUMA protein, iNOS, NF- KB, HIF-Ια, mTOR, COX-2, AMPK-a and -β, Atg5, Atg7 and beclin-1 in breast cancer cells (MCF-7) and cells with silenced expression of POX (MCF-7^shPRODH/pox).

Fig. $. presents a simplified schematic representation of shRNA, siRNA, and microRNA. mRNA - messenger RNA; DICER - DICER protein; RISC - protein complex with endoribonuclease activity; siRNA - short interfering RNA; shRNA - short hairpin RNA; miRNA - microRNA. Fig. 6. presents PRODH/POX protein expression in MCF-7 and MCF-7^shPRODH/pox cells tested using the Western Blot method. MCF-7 cells are control cells, and MCF- ₇shPRODH^/pox _{cells cells} transfected with PRODH/POX shRNA sequences according to the invention (clones 1-3). Clone 1 of CF-7^{shpR0DH P0X} comprises the sequence id. no. 2 and the sequence id. no. 5. Clone 2 of MCF-7^shPR0DH/P0X comprises the sequence id. no. 1 and the sequence id. no. 4. Clone 3 of CF-7^shpRODH/pox comprises the sequence id. no. 3 and the sequence id. no. 6. The values given above the bands represent the degree of lowered expression of the PRODH/POX protein encoding gene as compared with the control. Fibroblast cell (FIBRO) homogenate was used as a negative control, while homogenate of DLD-1 colon cancer cells was used as a positive control.

Fig. 7. presents the mRNA sequence of variant 1 of proline dehydrogenase 1 (PRODH) transcript in Homo sapiens species in cDNA form (sequence id. no. 17). In the presented sequence, sequence id. no. 1, sequence id. no. 2, and sequence id. no. 3 are indicated. Iindividual nucleotides are in 10-letter columns. Remarks: 1) the sequence located at 502 to 522 (tctaggacag aggctattca ac) is sequence id. no. 1; 2) the sequence located at 1790 to 1810 (g catgtgtgac cagatcagct) is sequence id. no. 2; 3) the sequence located at 1837 to 1857 (gtgt acaagtacgt gccctat) is sequence id. no. 3.

Fig. 8. presents the mRNA sequence of variant 2 of proline dehydrogenase 1 (PRODH) transcript of Homo sapiens species (sequence id. no. 18) in the cDNA form. In the presented sequence, sequence id. no. 1, sequence id. no. 2, and sequence id. no. 3 were indicated individual nucleotides are in 10-letter columns. Remarks: 1) the sequence located at 87 to 107 (ctag gacagaggct attcaac) is sequence id. no. 1; 2) the sequence located at 1374 to 1394 (gcatgt gtgaccagat cagct) is sequence id. no. 2; 3) the sequence located at 1422 to 1442 (gtgtacaag tacgtgccct at) is sequence id. no. 3.

The invention will now be illustrated by the examples below, which, however, are non-limiting in any way as regards the scope of the invention defined in the patent claims. Unless otherwise stated, all methods, reagents, and parameters are such as commonly used in the field of this invention and as recommended by their manufacturers. Examples

Example 1

Design and obtaining shRNA sequence

• Selecting the appropriate gene fragment

An analysis of mRNA nucleotide sequence of a gene encoding PRODH/POX protein was performed using a sequence available from the NCBI (National Center of Biotechnology Information) database regarding the complete sequence of PRODH 1 (GenBank: AF120278.1; date of accession: 5/15/2014), transcription variant 1 (tvl) (NCBI Reference Sequence: NM_016335.4; date of accession: 5/15/2014) and transcription variant 2 (tv2) (NCBI Reference Sequence: NM_001195226.1; date of accession: 5/15/2014). Based on the above, potential locations to "attach" the silencing sequence were selected. The designed sequences are presented in Tables 1 and 2.

• Designing the structure of the shRNA sequence for the gene encoding PRODH/POX The sequences were designed using the AsiDesigner online tool

(http://sysbio.kribb.re.kr:8080/AsiDesigner/menuDesigner.jsf), and subsequently the DNA sequences were synthesized by the company Genomed (Genomed S. A., Warszawa). The sequences were purified using HPLC.

Tables 4 and 5 present the oligonucleotide sequences for silencing expression of a gene encoding PRODH/POX protein according to the invention based on DNA and RNA sequences, respectively. In the tables below, the nucleotide linker between the sequences according to the invention was marked with yyy, whereas the sequences flanking the sequences according to the invention were marked with xxx. Both the linker sequence (yyy) and the flanking sequences (xxx) can be of any kind.

Table 4. Oligonucleotide sequences silencing the PRODH/POX protein expression based on DNA sequence.

F - forward; R - reverse.

Table 5. Oligonucleotide sequences silencing the PRODH/POX protein expression based on RNA sequence.

F - forward; R - reverse.

Example 2

Obtaining a plasmid vector for silencing expression of a gene encoding PRODH/POX protein and a prokaryotic host cell with silenced expression of the gene encoding PRODH/POX protein comprising this plasmid vector

Preparing the plasmid vector

• Amplification of the vector

A circular plasmid vector, pSuper.puro (OligoEngine, Seattle, WA, USA; VEC-PBS- 0008) with ampicillin and puromycin resistance gene was used in the study. The vector was introduced into E. coli NEB 10-beta bacteria (Bio Labs, Ipswich, United Kingdom) by the heat shock method in the standard way. Subsequently, the cell suspension was plated in the standard way on a plate with a bacterial medium (LB medium with agar) comprising a selective antibiotic (ampicillin). The cells were kept in an incubator for 24 h in standard conditions (temperature 37°C, complete humidity, 5% CO2). After 24 h, the bacterial colonies were used to start a liquid culture (with LB medium) comprising a selective antibiotic (ampicillin) and was incubated for 24 hours in the standard way.

• Preparing the miniprep and quality check of plasmid DNA

Plasmid DNA was isolated from the established liquid cultures using NucleoSpin® Plasmid (Macherey-Nagel, Diiren, Germany). The isolated plasmid DNA was measured using NanoDrop device and subsequently electrophoretically separated in an agarose gel in the standard way.

• Cutting the vector and isolating from agarose gel

Plasmid DNA was treated with restriction enzymes Bglll and HINDIII in the standard way, as recommended by the kit manufacturer (Promega, Medison, USA). The linearization of the plasmid was tested by the electrophoretic separation. The linear plasmid was cut out of the gel and purified using a commercially available purification kit in the standard way.

Introducing the insert into a plasmid vector and obtaining a prokaryotic host cell with silenced expression of a gene encoding PRODH/POX protein comprising the plasmid vector according to the invention

In the first step, each pair of the shRNA sequences was annealed in the standard way. The mixture of shRNA and the vector was subsequently ligated in the standard way, as recommended by the kit manufacturer. The vector with the insert was introduced into E. coli NEB 10-beta bacteria by the heat shock method in the standard way. The transformed bacteria were plated on selective bacterial mediums (LB medium with agar and ampicillin) in the standard way. After 24 h incubation in standard conditions, positive clones, being host cells with silenced expression of the gene encoding PRODH/POX protein, were verified using the PCR method and by cleavage by restriction enzymes (Bglll and HIND III) and electrophoretic separation in the agarose gel in the standard way known in the art. After obtaining positive results, bacterial transformation was carried out again with the DNA construct confirmed at the previous step, as described above. After the repeated positive verification of bacterial clones, plasmid DNA was isolated and used to transfect the MCF-7 cells. The obtained results confirm that, thanks to the use of the vector according to the invention, prokaryotic host cells with silenced expression of the gene encoding PRODH/POX protein were obtained.

Example 3

Obtaining a eukaryotic cell clone with silenced expression of a gene encoding PRODH/POX protein comprising the plasmid vector according to the invention

Transfection of eukaryotic cells

• Verifying cells for antibiotic resistance

MCF-7 breast cancer cells (HTB-22; ATCC, Manassas, VA, USA) were preselected using puromycin (a selective antibiotic) for 2 weeks in order to determine the effective lethal dose of the antibiotic for these cells in the standard way.

• Preparing the cells

The MCF-7 cells were cultured in standard conditions (temperature 37°C, complete humidity, 5% C0₂) in a medium supplemented as recommended by the manufacturer.

• Transfecting the cells with the plasmid vector

The MCF-7 cells were transfected with plasmid vectors comprising the designed sequence using Lipofectamine in the OPTI-DMEM culture medium (Gibco, Thermo Scientific Fischer) in the standard way. After 24 h incubation, the transfection medium was removed, the cells were cultured in the medium as recommended by the supplier of the MCF- 7 cells and a selective antibiotic - puromycin, with the final concentration of 1 μg/ml. The cells were subjected to 14-day selection with puromycin in the standard way. After the selection period, the obtained clones were verified in the standard way. The expression of PRODH/POX protein was determined in the obtained protein extract using the Western Blot method (Fig. 6), and the effectiveness of silencing the gene encoding PRODH/POX protein was determined by densitometric measurement. The expression of PRODH/POX protein was obtained using a goat antibody against PRODH/POX (Everest Biotech, Upper Heyford, UK). The densitometric measurement was performed using ImageJ software. Three cell clones were obtained: clone 1 MCF-7^{shpRODH pox} comprising the sequence id. no. 2 and the sequence id. no. 5; clone 2 MCF-7^{shPRODH POX} comprising the sequence id. no. 1 and the sequence id. no. 4; and clone 3 MCF-7^shPR0DH/P0X comprising the sequence id. no. 3 and the sequence id. no. 6. As can be seen in Fig. 6., the expression of PRODH/POX protein in MCF-7 cells and MCF-7 cells with silenced expression of the gene encoding PRODH/POX protein through transfection with shRNA PRODH/POX sequences according to the invention (MCF-7^{shPRODH POX}) (cell clones 1 to 3) is clearly different. Namely, the expression of PRODH/POX protein was suppressed in the case of MCF-7 cell clones transfected with shRNA PRODH/POX sequences according to the invention (clones 1 to 3 in Fig. 6). There is a clear difference in the intensity of bands for cell clones 1 to 3 (lines 2 to 4) in comparison with the positive control (a homogenate of DLD-1 colon cancer cells) (line 6) and native (control) MCF-7 cells (line 1). This difference proves the effectiveness of silencing expression of the gene encoding PRODH/POX protein. The efficiency of silencing expression obtained using clone 1 was 39.49%. The efficiency of silencing expression obtained with the use of clone 2 was 49.57%. The efficiency of silencing expression obtained using clone 3 was 13.42%. The obtained results prove that a cell clone with silenced expression of the gene encoding PRODH/POX protein was obtained, and thus they prove the effective and efficient inhibition of the PRODH/POX protein encoding gene expression thanks to the use of nucleic acid sequences according to the invention in a eukaryotic cell.

Claims

1. A double-stranded nucleic acid for silencing expression of a gene encoding PRODH/POX protein in a cell, wherein the double-stranded nucleic acid comprises at least a sense strand and an antisense strand, each having at least 19 nucleotides in length, which are substantially complementary to each other, wherein the sense strand comprises a first sequence, and the antisense strand comprises a second sequence complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein, and wherein the double- stranded nucleic acid, upon introducing it into a cell expressing the gene encoding PRODH/POX protein, silences the expression of the gene.

2. The double-stranded nucleic acid according to claim 1, characterized in that the double- stranded nucleic acid is a double- stranded deoxynucleic acid (dsDNA).

3. The double-stranded nucleic acid according to claim 1, characterized in that the double- stranded nucleic acid is a double-stranded ribonucleic acid (dsRNA).

4. The double- stranded nucleic acid according to claim 1 or 2, characterized in that it is a double-stranded deoxynucleic acid, wherein the sense strand comprises the first sequence selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), and the antisense strand comprises the second sequence selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

5. The double-stranded nucleic acid according to claim 4, characterized in that it comprises a sequence of id. no. 1 as the first sequence and a sequence id. no. 4 as the second sequence, or a sequence of id. no. 2 as the first sequence and a sequence of id. no. 5 as the second sequence, or a sequence of id. no. 3 as the first sequence and a sequence of id. no. 6 as the second sequence.

6. The double- stranded nucleic acid according to claim 1 or 3, characterized in that it is a double-stranded ribonucleic acid, wherein the sense strand comprises the first sequence selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), and the antisense strand comprises the second sequence selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).

7. The double-stranded nucleic acid according to claim 6, characterized in that it comprises a sequence of id. no. 7 as the first sequence and a sequence of id. no. 10 as the second sequence, or a sequence of id. no. 8 as the first sequence and a sequence of id. no. 11 as the second sequence, or a sequence of id. no. 9 as the first sequence and a sequence of id. no. 12 as the second sequence.

8. An expression vector for silencing expression of a gene encoding PRODH/POX protein, characterized in that it comprises a double-stranded nucleic acid as specified in any one of the claims 1 to 5.

9. The expression vector according to claim 8, characterized in that this vector is a plasmid, a transposon, or a virus.

10. A host cell, characterized in that it comprises a double- stranded nucleic acid as specified in any one of the claims 1 to 7, or an expression vector as specified in claim 8 or 9, preferably selected from a prokaryotic cell, such as a bacterial cell, and a eukaryotic cell, such as a plant cell and an animal cell, especially a mammalian cell, in particular a human cell.

11. A cell clone with silenced expression of a gene encoding PRODH/POX protein, characterized in that it comprises a double-stranded nucleic acid as specified in any one of the claims 1 to 7, or an expression vector as specified in claim 8 or 9.

12. The cell clone according to claim 11, characterized in that the clone is a clone of MCF-7 cells, preferably comprising dsDNA as the double-stranded nucleic acid, which dsDNA comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).

13. A pharmaceutical composition for silencing expression of a gene encoding PRODH/POX protein in an organism, characterized in that it comprises a double- stranded nucleic acid as specified in any one of the claims 1 to 7, or an expression vector as specified in claim 8 or 9, and a pharmaceutically acceptable carrier or diluent.

14. The pharmaceutical composition according to claim 13, characterized in that it comprises dsDNA, which comprises the first sequence selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), and the second sequence selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

15. The pharmaceutical composition according to claim 13 or 14, characterized in that it comprises dsDNA as a double- stranded nucleic acid, which dsDNA comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).

16. The pharmaceutical composition according to claim 13, characterized in that it comprises dsRNA, which comprises the first sequence selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7),

17. The pharmaceutical composition according to claim 13 or 16, characterized in that it comprises dsRNA as a double- stranded nucleic acid, which dsRNA comprises a CUAGGACAGAGGCUAUUCAAC sequence (sequence id. no. 7) and a GUUGAAUAGCCUCUGUCCUAG sequence (sequence id. no. 10).

18. An in vitro method of silencing expression of a gene encoding PRODH/POX protein in a cell, characterized in that it comprises the steps of:

(a) introducing a double- stranded nucleic acid as specified in any one of the claims 1 to 7 or an expression vector as specified in any one of the claims 8 to 9 into the cell; and

(b) keeping the cell with the introduced double-stranded nucleic acid or vector from step (a) in conditions and for a period of time sufficient to for silencing expression of the gene encoding PRODH/POX protein in the cell.

19. The in vitro method of silencing expression according to claim 18, characterized in that in step a) dsDNA is introduced, which preferably comprises a CTAGGACAGAGGCTATTCAAC sequence (sequence id. no. 1) and a GTTGAATAGCCTCTGTCCTAG sequence (sequence id. no. 4).

20. The in vitro method of silencing expression according to claim 19, characterized in that in step a) dsRNA is introduced, preferably comprising a CUAGGACAGAGGCUAUUCAAC sequence (sequence id. no. 7) and a GUUGAAUAGCCUCUGUCCUAG sequence (sequence id. no. 10).

21. The method according to any one of the claims 18 to 20, characterized in that silencing expression of the gene encoding PRODH/POX protein is achieved by using the RNAi method, preferably based on shRNA, miRNA, or siRNA.

22 The method according to claim 21, characterized in that the RNAi method based on shRNA is used for silencing expression of the gene, wherein shRNA preferably comprises a pair of sequences selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1) and GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4) connected to each other in 5'- 3' orientation by a nucleotide linker having 5 to 15 nucleotides in length; and CTAGGACAGAGGCTATTCAAC (sequence id. no. 1) and GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4) connected to each other in 3 '-5' orientation by a nucleotide linker having 5 to 15 nucleotides in length.

23. A double- stranded nucleic acid as specified in any one of the claims 1 to 7 for use in therapy.

24. A double-stranded nucleic acid as specified in any one of the claims 1 to 7 for use in the treatment and/or prevention of a disorder or disease characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta.

25. A double-stranded nucleic acid as specified in any one of the claims 1 to 7 for use for inhibiting a growth and/or proliferation of a neoplastic cell.

26. A double-stranded nucleic acid as specified in any one of the claims 1 to 7 for use for inducing an apoptosis and/or autophagy in a cell, preferably in a neoplastic cell.

27. A double- stranded nucleic acid as specified in any one of the claims 1 to 7 for use for regulating proline metabolism in an organism.

28. A double-stranded nucleic acid as specified in any one of the claims 1 to 7 for use in diagnostics.

29. A double-stranded nucleic acid as specified in any one of the claims 1 to 7 for use in diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfect.

30. A double- stranded nucleic acid as specified in any one of the claims 1 to 7 for use in the manufacture of a cell line with silenced expression of a gene encoding PRODH/POX protein.

31. A double-stranded nucleic acid as specified in any one of the claims 1 to 7 for use in the manufacture of a non-human transgenic organism with silenced expression of a gene encoding PRODH/POX protein.

32. A double-stranded nucleic acid as specified in any one of the claims 1 to 7 for use in the manufacture of a cell clone with silenced expression of a gene encoding PRODH/POX protein, preferably a clone of MCF-7 cells with silenced expression of a gene encoding PRODH/POX protein.

33. A single- stranded nucleic acid for determining an expression of a gene encoding PRODH/POX protein in a cell, wherein the single-stranded nucleic acid comprises at least one sequence having at least 15 nucleotides in length, which is substantially complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein.

34. The single-stranded nucleic acid according to claim 33, characterized in that it comprises a sequence having at least 19 nucleotides in length.

35. The single-stranded nucleic acid according to claim 33 or 34, characterized in that it is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are substantially complementary, on at least part of their length, to the mRNA encoding the PRODH/POX protein.

36. The single-stranded nucleic acid according to claim 33 or 34, characterized in that it is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are substantially complementary, on at least part of their length, to the mRNA part encoding PRODH/POX protein.

37. The single-stranded nucleic acid according to one of the claims 33 to 35, characterized in that it is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), or a sequence comprising an antisense strand selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

38. The single-stranded nucleic acid according to claim 33 or 34 or 36, characterized in that it is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), or a sequence comprising an antisense strand selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).

39. The single-stranded nucleic acid as specified in one of the claims 33 to 38 for use in the manufacture of a microarray for identification of PRODH/POX protein encoding gene transcript expression.

40. The single-stranded nucleic acid for use according to claim 39, characterized in that it comprises a sequence having at least 19 nucleotides in length.

41. The single-stranded nucleic acid as specified in one of the claims 33 to 38 for use in obtaining a sequence having at least partially the length of the cDNA or mRNA of the gene encoding PRODH/POX protein in a cell, wherein the single-stranded nucleic acid comprises at least one sequence having at least 15 nucleotides in length, which is substantially complementary, on at least part of its length, to the mRNA encoding PRODH/POX protein.

42. The single-stranded nucleic acid for use according to claim 41, characterized in that it comprises a sequence having at least 19 nucleotides in length.

43. The single-stranded nucleic acid for use according to claim 41 or 42, characterized in that it is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand which are substantially complementary, on at least part of their length, to the mRNA part encoding PRODH/POX protein.

44. The single- stranded nucleic acid for use according to any one of the claims 41 to 43, characterized in that it is a single-stranded deoxynucleic acid, wherein it can be a sequence comprising a sense strand selected from: CTAGGACAGAGGCTATTCAAC (sequence id. no. 1), GCATGTGTGACCAGATCAGCT (sequence id. no. 2), and GTGTACAAGTACGTGCCCTAT (sequence id. no. 3), or a sequence comprising an antisense strand selected from: GTTGAATAGCCTCTGTCCTAG (sequence id. no. 4), AGCTGATCTGGTCACACATGC (sequence id. no. 5), and ATAGGGCACGTACTTGTACAC (sequence id. no. 6).

45. The single-stranded nucleic acid for use according to claim 41 or 42, characterized in that it is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand or a sequence comprising an antisense strand, which are substantially complementary, on at least part of their length, to the mRNA part encoding PRODH/POX protein.

46. The single- stranded nucleic acid for use according to claim 45, characterized in that it is a single-stranded ribonucleic acid, wherein it can be a sequence comprising a sense strand selected from: CUAGGACAGAGGCUAUUCAAC (sequence id. no. 7), GCAUGUGUGACCAGAUCAGCU (sequence id. no. 8), and GUGUACAAGUACGUGCCCUAU (sequence id. no. 9), or a sequence comprising an antisense strand selected from: GUUGAAUAGCCUCUGUCCUAG (sequence id. no. 10), AGCUGAUCUGGUCACACAUGC (sequence id. no. 11), and AUAGGGCACGUACUUGUACAC (sequence id. no. 12).

47. The single-stranded nucleic acid as specified in any one of the claims 33 to 38 for use in diagnostics of diseases characterized by an impaired proline metabolism, preferably a neoplastic disease, especially breast cancer, Marfan syndrome, Ehlers-Danlos syndrome, and osteogenesis imperfecta.