US20150152422A1 - Mirnas as therapeutic targets in cancer - Google Patents

Mirnas as therapeutic targets in cancer Download PDF

Info

Publication number
US20150152422A1
US20150152422A1 US14/554,965 US201414554965A US2015152422A1 US 20150152422 A1 US20150152422 A1 US 20150152422A1 US 201414554965 A US201414554965 A US 201414554965A US 2015152422 A1 US2015152422 A1 US 2015152422A1
Authority
US
United States
Prior art keywords
mir
cell
expression
seq
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/554,965
Inventor
Jingfang Ju
Bo Song
Yuan Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Research Foundation of State University of New York
Original Assignee
The Research Foundation For The State University Of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Research Foundation For The State University Of New York filed Critical The Research Foundation For The State University Of New York
Priority to US14/554,965 priority Critical patent/US20150152422A1/en
Publication of US20150152422A1 publication Critical patent/US20150152422A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to compositions and methods relating to the identification and characterization of genes and biological pathways related to these genes as represented by the expression of the identified genes, as well as use of microRNAs (miRNAs) related to such, for therapeutic, prognostic, and diagnostic applications, particularly those methods and compositions related to assessing and/or identifying pathological conditions directly or indirectly related to miR-192 or miR-215.
  • miRNAs microRNAs
  • DHFR Dihydrofolate reductase
  • TS Thymidylate Synthase
  • DHFR catalyzes the reduction of folate and 7, 8 dihydrofolate to 5, 6, 7, 8 tetrahydrofolate, the latter as the one-carbon donor is essential for the formation of thymidylate (dTMP) which is the precursor for DNA synthesis (see Banerjee et al., “Novel aspects of resistance to drugs targeted to dihydrofolate reductase and thymidylate synthase, Biochim. Biophys. Acta. (2002) 1587: 164-173).
  • dTMP thymidylate
  • TS catalyzes the reductive methylation of dUMP by CH2H4folate to produce dTMP and H2folate (see Carreras et al., “The catalytic mechanism and structure of thymidylate synthase,” Annu. Rev. Biochem. (1995) 64: 721-762).
  • DHFR inhibitors such as methotrexate (MTX), and TS inhibitors, such as 5-fluorouracil (5-FU) and Tomudex or Ralitrexed (TDX, ZD1694)
  • MTX methotrexate
  • TS inhibitors such as 5-fluorouracil (5-FU) and Tomudex or Ralitrexed
  • MTX methotrexate
  • 5-FU 5-fluorouracil
  • TDX, ZD1694 5-fluorouracil
  • TDX, ZD1694 5-fluorouracil
  • TDX the third-generation TS inhibitor
  • ZD1694 the third-generation TS inhibitor
  • the inhibitor of DHFR is widely used in the treatment of human leukemia, osteosarcoma and choriocarcinoma.
  • DHFR protein levels are reported to be associated with drug resistance (see Banerjee et al., “Novel aspects of resistance to drugs targeted to dihydrofolate reductase and thymidylate synthase,” Biochem. Biophys. Acta. (2002) 1587: 164-173), and low tumor expression levels of TS have also been linked with improved outcome for colon cancer patients treated with 5-FU chemotherapy (see Soong et al., “Prognostic significance of thymidylate synthase, dihydropyrimidine dehydrogenase and thymidine phosphorylase protein expression in colorectal cancer patients treated with or without 5-fluorouracil-based chemotherapy,” Ann. Oncol. (2008) 19: 915-919).
  • MTX has the highest activity at the time when DNA synthesis, DHFR activity, DHFR content, and DHFR mRNA content increased and the lowest activity at the time when they decreased (see Yamauchi et al., “Ohdo S. Cell-cycle-dependent pharmacology of methotrexate in HL-60,” J. Pharmacol. Sci. (2005) 99: 335-341).
  • the invention provides an isolated inhibitory nucleic acid molecule that is complementary to at least a portion of miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9).
  • the inhibitory nucleic acid molecule decreases the expression of the at least a portion of miR-192 or miR-215 in a cell.
  • the nucleic acid molecule is an antisense nucleic acid molecule.
  • the antisense nucleic acid molecule has at least an 85% sequence identity to the portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9).
  • the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3 and 10.
  • the inhibiting nucleic acid molecule has at least 85% sequence identity to the sequence.
  • the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3 or 9-10.
  • an expression vector comprises the inhibitory nucleic acid molecule.
  • the inhibitory nucleic acid molecule may be operably linked to a promoter suitable for expression in a mammalian cell.
  • the vector may be a viral vector.
  • a cell comprises the vector.
  • the invention further provides an isolated inhibitory nucleic acid molecule that corresponds to at least a portion of miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9).
  • the inhibitory nucleic acid molecule decreases the expression of the miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9) in a cell.
  • the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3 and 10.
  • the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3 or 9-10.
  • the inhibiting nucleic acid molecule has at least 85% sequence identity to the portion of SEQ ID NOs:1 or 9, or at least 85% sequence identity to SEQ ID NOs:2, 3 or 10.
  • the nucleic acid molecule is also an shRNA or an siRNA.
  • the nucleic acid molecule comprises at least one modification. The modification may be a non-natural internucleotide linkage, a backbone modification, or a substituted sugar moiety.
  • an expression vector comprises the inhibitory nucleic acid molecule.
  • the inhibitory nucleic acid molecule may be operably linked to a promoter suitable for expression in a mammalian cell.
  • the vector may be a viral vector.
  • a cell comprises the vector.
  • the invention further provides an isolated inhibitory nucleic acid molecule that corresponds to a portion of a miR-192 promoter that binds to a p53 binding sequence (SEQ ID NO: 25).
  • the inhibitory nucleic acid molecule comprises or consists essentially of a sequence or a complementary sequence of SEQ ID NO:25, a fragment thereof, or a variant thereof.
  • the inhibitory nucleic acid molecule has at least 85% sequence identity to SEQ ID NO: 25 or a fragment thereof.
  • Methods for delivery of the inhibitory nucleic acid molecules include, but are not limited to, using a delivery system such as viral vectors, liposomes, polymers, microspheres, gene therapy vectors, naked DNA vectors, carbon nanotubes and chemical linkers.
  • a delivery system such as viral vectors, liposomes, polymers, microspheres, gene therapy vectors, naked DNA vectors, carbon nanotubes and chemical linkers.
  • the invention further provides a method of modulating expression of a component of a cell, comprising contacting the cell with a nucleic acid comprising a portion of a sequence or a complementary sequence selected from an miR-192 sequence (SEQ ID NO:1), an miR-215 nucleic acid sequence (SEQ ID NO:9), miR-192 promoter binding site for p53 (SEQ ID NO:25), an antisense miR-192 sequence, an antisense miR-215 sequence and an antisense to the miR-192 promoter binding site for p53 in an amount sufficient to modulate the cellular component.
  • the nucleic acid is an antisense nucleic acid.
  • the nucleic acid may be an siRNA or an shRNA.
  • the cellular component is miR-192 or miR-215.
  • the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3, 10, antisense SEQ ID NO: 2 and antisense SEQ ID NO: 3 and an antisense SEQ ID NO: 10.
  • the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10, 25 or antisense sequences thereof.
  • the cellular component is p21 or p53.
  • the cellular component is regulated by p53.
  • the cellular component is DHFR or TS.
  • the invention further provides a method of modulating proliferation of a cell, comprising contacting the cell with a nucleic acid having a sequence or a complementary sequence to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), a p53 region that binds to a miR-192 promoter or the miR-192 promoter that binds to p53 (SEQ ID NO:25) in an amount effective to modulate proliferation of the cell.
  • the nucleic acid is an antisense nucleic acid.
  • the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3, 10 and 25.
  • the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10 or 25 or an antisense sequence thereof.
  • the nucleic acid is an siRNA or an siRNA.
  • the cell is a cancer stem cell.
  • the cell is a neoplastic cell.
  • the method of modulating proliferation of a cell is a method of increasing the proliferation of a cell.
  • the invention further provides a method of increasing the sensitivity of a cell to a chemotherapeutic agent, comprising contacting the cell with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9) an miR-192 promoter binding site for p53 (SEQ ID NO:25) or a p53 region that binds to the miRNA-192 promoter, in an amount effective to sensitize the cell to the chemotherapeutic agent.
  • chemotherapeutic agents include, but are not limited to, methotrexate, fluorouracil (5-FU), nolatrexed, ZD9331, GS7904L and ralitrexed.
  • the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3, 10 and 25.
  • the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10, and 25.
  • the nucleic acid is an antisense nucleic acid.
  • the nucleic acid is an siRNA or an shRNA.
  • the cell is a cancer stem cell. In another embodiment, the cell is a neoplastic cell.
  • the invention further provides a method of increasing the sensitivity of a cell to radiation, comprising contacting the cell with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9) an miR-192 promoter binding site for p53 (SEQ ID NO:25) or a p53 region that binds to the miRNA-192 promoter, in an amount effective to sensitize the cell to radiation.
  • the nucleic acid is an antisense nucleic acid.
  • the nucleic acid is an siRNA or an shRNA.
  • the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3 and 10.
  • the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10, and 25.
  • the cell is a cancer stem cell.
  • the cell is a neoplastic cell.
  • the invention further provides a method of treating a neoplasm in a subject, comprising administering to the subject an effective amount of a nucleic acid molecule that inhibits expression of miR-192 or miR-215, and a second therapy, wherein inhibition of expression of miR-192 or miR-215 sensitizes the neoplasm to the second therapy.
  • the second therapy comprises administering a chemotherapeutic agent.
  • the chemotherapeutic agent is selected from the group consisting of a DHFA inhibitor and examples of chemotherapeutic agents include, but are not limited to, methotrexate, fluorouracil (5-FU), nolatrexed, ZD9331, GS7904L and ralitrexed.
  • the second therapy comprises administering radiation to the subject.
  • the neoplasm may be cancer.
  • the cancer may be selected from the group consisting of colon cancer, pancreatic cancer, lung cancer, breast cancer, cervical cancer, gastric cancer, kidney cancer, leukemia, liver cancer, lymphoma, ovarian cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, testicular cancer, and uterine cancer.
  • the invention further provides a method of diagnosing a neoplasm in a subject comprising determining the level of expression of miR-192 or miR-215.
  • the method of diagnosing the neoplasm in the subject comprises determining the level of expression of miR-192 and miR-215.
  • the invention further provides a method of identifying a neoplasm resistant to chemotherapy comprising determining the level of expression in the neoplasm of miR-192 or miR-215, and identifying the neoplasm as resistant to therapy if the level of the miR-215 is elevated or the level of miR-192 is reduced as compared to a control.
  • the method of identifying the neoplasm resistant to chemotherapy comprises determining the levels of miR-192 and miR-215, and identifying the neoplasm as resistant to therapy if the levels of miR-192 and miR-215 are elevated.
  • the invention further provides a method of determining whether a neoplasm is a candidate for treatment with a chemotherapeutic agent comprising evaluating the level of expression of an miRNA, wherein the miRNA is miR-192 or miR-215, and rejecting the candidate if the expression of the miRNA is elevated; or accepting the candidate if the expression of the miRNA is reduced.
  • the miRNA is miR-192 and miR-215.
  • the rejected candidate would be a candidate for the methods of increasing sensitivity or treating a neoplasm discussed herein.
  • the invention further provides a kit for analysis of a pathological sample.
  • the kit comprising in a suitable container an miRNA hybridization reagent for determining the level of miR-192 or miR-215.
  • the mRNA hybridization reagent comprises a hybridization probe.
  • the mRNA hybridization reagent comprises amplification primers.
  • the hybridization probe or amplification primers complementary to a sequence selected from the group consisting of SEQ ID NOs:1, 2, 3, 9, 10 and fragments thereof.
  • the pathological sample can be any sample commonly taken from a subject, such as, for example, blood, urine, tissue, or other bodily fluid.
  • the invention further provides a method of identifying an agent that inhibits expression of an miRNA selected from the group consisting of miR-192 and miR-215, which comprises contacting a cell that expresses the miRNA with an agent, and comparing the expression level of the miRNA in the cell contacted by the agent with the expression level of the miRNA in the absence of the agent, wherein the agent is an inhibitor of the miRNA if expression of the miRNA is reduced.
  • the test cell overexpresses the miRNA.
  • FIG. 1 depicts a predicted secondary structure of the interaction between miR-192 and the 3′-UTR region of DHFR mRNA.
  • FIG. 2A is a graph illustrating the expression of miR-192 in HCT-116 (wt-p53) cells transfected with miR-192.
  • FIG. 2B is a graph illustrating the expression of miR-24 in HCT-116 (wt-p53) cells transfected with miR-24.
  • FIG. 2C depicts an image from a Western immunoblot showing the expression of DHFRT protein in HCT-116 (wt-p53) cells transfected with DHFR specific siRNA, miR-192 or miR-24.
  • FIG. 2D is a graph illustrating the expression of DHFR mRNA in HCT-116 (wt-p53) cells transfected with DHFR specific siRNA, miR-192 or miR-24.
  • FIG. 3 is a graph illustrating the impact of miR-192 on cell proliferation with MTX treatment in HCT-116 (wt-p53) cells transfected with DHFR specific siRNA or miR-192.
  • FIGS. 4A-D is a graph illustrating the impact of miR-192 on cell proliferation in HCT-116 (wt-p53) cells ( FIG. 4A ), RKO cells ( FIG. 4B ), HCT-116 (null-p53) cells ( FIG. 4C ) and HT-29 ( FIG. 4D ) cells transfected with non-specific miR or miR-192.
  • FIGS. 5 A-D are graphs illustrating impact of miR-192 on cell proliferation in HCT-116 (wt-p53) ( FIG. 5 A-B) and HCT-116 (null-p53) ( FIG. 5 C-D) cells transfected with non-specific miR or miR-192.
  • FIGS. 6A-B are images from a Western immunoblot of p53, p21 and Bax expression in HCT-116 (wt-p53) cells transfected with non-specific miR, DHFR siRNA or miR-192.
  • FIG. 7 is an image from a Western immunoblot for E2F3 and Rb expression in HCT-116 (wt-p53) cells transfected with non-specific miR, DHFR siRNA or miR-192.
  • FIG. 8A is an image from a Western immunoblot for p53 expression in HCT-116 (wt-p53) cells, RKO (wt-p53) cells, HCT-116 (null-p53) cells and HT-29 cells after treatment with MTX.
  • FIG. 8B is a graph depicting the expression of endogenous mature miR-192 in HCT-116 (wt-p53) cells, RKO (wt-p53) cells, HCT-116 (null-p53) cells and HT-29 cells after treatment with MTX.
  • FIG. 9A is a diagram of miR-192 p53 binding site relative to miR-192 on chromosome 11.
  • FIG. 9B is a graph illustrating the immunoprecipitation qPCR analysis using chromosome DNA isolated with non-specific a-tubulin, p53 monoclonal antibody for the conserved p53 binding site located on the miR-192 or p21 promoter.
  • FIG. 10 shows inhibition of cell proliferation in either HCT-116 (wt-p53) (Panel A) or U-2 OS (Panel B) cells transfected with miR-215 precursors, i.e., a longer piece of miRNA (72 bps) with hairpin stem loop structure that is further processed by DICER to mature miRNA, compared with a non-specific miRNA control.
  • miR-215 precursors i.e., a longer piece of miRNA (72 bps) with hairpin stem loop structure that is further processed by DICER to mature miRNA, compared with a non-specific miRNA control.
  • the reduction in OD for cultures of HCT-116 (wt-p53) or U-2 OS cells were approximately 40% or 58% at day 5 respectively.
  • FIG. 11 depicts proportions of cultured U-2 OS or MG63 cells, and U-2 OS or MG63 cells transfected with miR-192 or miR-215 at various stages of the cell cycle.
  • FIG. 12 depicts the levels of cell cycle control gene products p53 and p21 determined by Western immunoblot analysis.
  • FIG. 13 provides alignments of miR-215 with regions of DHFR and TS.
  • FIG. 14 depicts an analysis of levels of DHFR (Panel A) or TS (Panel B) protein in cells transfected with miR-215.
  • FIG. 15 depicts the levels of DHFR or TS mRNA in U-2 OS cells transfected with miR-215.
  • FIG. 16 depicts the level of luciferase reporter activity from a construct containing the 3′ UTR binding sequence for miR-215 (or a mutated binding sequence) in response to transfection with miR-215.
  • FIG. 17 shows that the effect of miR-192 (Panel A) or miR-215 (Panel B) on proliferation of HCT-116 (wt-p53) cells treated with methotrexate.
  • FIG. 18 depicts miR-192 and miR-215 expression in CD133 + HCT-116 (wt-p53) cells as compared to CD133 ⁇ cells.
  • FIG. 19 depicts miR-215 expression in paired human colon cancer and counterpart normal tissues.
  • miR-192 and miR-215 individually, decrease the expression of TS and DHFR protein, and further found that miR-192 and miR-215, individually, change the sensitivity of cancerous cells such as, for example, HCT-116 (wt-p53) or U-2 OS cells to TDX or MTX.
  • cancerous cells such as, for example, HCT-116 (wt-p53) or U-2 OS cells to TDX or MTX.
  • TDX or MTX are considered to be more effective on the cells in the S-phase. As illustrated in FIGS.
  • siRNAs specific against TS or DHFR do not decrease the cells in the S-phase, whereas the cells in the S-phase were reduced in the miR-192 transfected cells and miR-215 transfected cells.
  • down-regulating miR-192 or miR-215 increases the sensitivity of a cell or a subject to chemotherapy.
  • colon cancer stem cells depend on, at least in part, elevated miR-192 or miR-215 to have a reduced cell proliferation phenotype.
  • the advantage of tumor stem cells using miR-192 or miR-215 to achieve this is that translational control by miR-192 or miR-215 is an acute response, readily reversible without permanently degrading its target mRNAs such as TS and DHFR or trigger apoptosis. This also suggests why half of the colon cancer cases containing wild type p53 are still resistant to chemotherapeutic treatment.
  • This mechanism also provides a novel approach to selectively killing colon cancer stem cells by inhibiting miR-192 or miR-215 and subsequently eliminating them with chemotherapeutic agents. Furthermore, this mechanism also provides a novel approach for identifying a candidate who will respond to chemotherapeutic treatment by inhibiting miR-192 and/or miR-215.
  • the invention is directed to methods for the assessment, analysis, and/or therapy of a cell or subject where certain genes have a reduced or increased expression (relative to normal) as a result of an increased or decreased expression of miR-192 or miR-215.
  • the expression profile and/or response to miR-192 or miR-215 expression or inhibition may be indicative of a disease or an individual with a pathological condition such as, for example, cancer.
  • the miR-192 or miR-215 inhibitors may include antisense nucleic acids or molecules.
  • Antisense nucleic acids are effective in inhibiting human miRNAs.
  • Antisense nucleic acids include non-enzymatic nucleic acid compounds that bind to a target nucleic acid by, for example, RNA-RNA, RNA-DNA or RNA-PNA interactions and effect the target nucleic acid. Generally, these molecules are complementary to a target sequence along a single contiguous sequence of the antisense nucleic acid.
  • the antisense nucleic acid reduces expression of miR-192 or miR-215.
  • the inhibitors include fragments of the nucleic acid molecules that bind to miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9), bind to an miR-192 promoter binding sequence for p53 (SEQ ID NO:25), or bind to the p53 sequence that is complementary to the miR-192 promoter.
  • a suitable fragment can be at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides in length.
  • suitable fragments include nucleic acids having sequences complementary to SEQ ID NOs:2, 3, 9 or fragments thereof.
  • nucleic acids complimentary to other portions of SEQ ID NO:1 or SEQ ID NO:9 would be equally effective.
  • antisense nucleic acids may also bind to a substrate nucleic acid and form a loop.
  • the antisense nucleic acids may be complementary to two or more non-contiguous substrate sequences and/or two or more non-contiguous sequence portions of an antisense nucleic acid may be complementary to a target sequence.
  • antisense nucleic acids may be complementary to a guide strand of an miRNA positioned in the RNA silencing complex.
  • antisense nucleic acids may be used to target a nucleic acid by means of DNA-RNA interactions.
  • RNase H is activated to digest the target nucleic acid as would be understood by one of ordinary skill in the art.
  • the antisense nucleic acids may comprise one or more RNase H activating region capable of activating RNase H to cleave a target nucleic acid.
  • the RNase H activating region may comprise any suitable backbone.
  • the RNase H activating region may comprise a phosphodiester, phosphorothioate, phosphorodithioate, 5′-thiophosphate, phosphoramidate and/or methylphosphonate.
  • the nucleic acid molecule may comprise one or more modifications.
  • Antisense nucleic acids according to the embodiments may comprise natural-type oligonucleotides and modified oligonucleotides.
  • the antisense nucleic acid may comprise phosphorothioate-type oligodeoxyribonucleotides, phosphorodithioate-type oligodeoxyribonucleotides, methylphosphonate-type oligodeoxyribonucleotides, phosphoramidate-type oligodeoxyribonucleotides, H-phosphonate-type oligodeoxyribonucleotides, triester-type oligodeoxyribonucleotides, alpha-anomer-type oligodeoxyribonucleotides, peptide nucleic acids, locked nucleic acids, and nucleic acid-modified compounds. It will be readily apparent to one of ordinary skill in the art that other oligodeoxyribonu
  • the modification may comprise internucleoside linkages.
  • an inhibitory nucleic acid may be based on T-modified oligonucleotides containing oligodeoxynucleotide gaps with internucleotide linkages modified to phosphorothioates for nuclease resistance.
  • the presence of methylphosphonate modifications increases the affinity of the oligonucleotide for its target RNA and thus increases its effectiveness in inhibiting the target RNA. This modification also increases the nuclease resistance of the modified oligonucleotide.
  • the modification may comprise a backbone modification.
  • oligomers having modified backbones may include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • nucleobase oligomers that have modified oligonucleotide backbones include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates, phosphinates, phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates.
  • Other forms, including, but not limited to, salts, mixed salts and free acid forms, are also contemplated.
  • Nucleobase oligomers having modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • the modification may also comprise one or more substituted sugar moieties.
  • the RNase H activating region may comprise deoxyribose, arabino and/or fluoroarabino nucleotide sugar chemistry.
  • Such modifications may also include 2′-O-methyl and 2′-methoxyethoxy modifications, 2′-dimethylaminooxyethoxy, 2′-aminopropoxy and 2′-fluoro, and modifications at other positions on the oligonucleotide or other nucleobase oligomer, particularly the 3′ position of the sugar on the 3′ terminal nucleotide.
  • Nucleobase oligomers may also have sugar mimetics.
  • both the sugar and the internucleoside linkage may be replaced with novel groups.
  • the nucleobase units are maintained for hybridization with at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25).
  • the invention relates to the use of interference RNA (RNAi) to alter the expression of miR-192 or miR-215.
  • RNAi interference RNA
  • the expression is altered by reducing the expression of miR-192 or miR-215.
  • the expression of miR-192 and miR-215 is altered.
  • the expression is altered by reducing the expression of miR-192 and miR-215.
  • RNAi comprises double stranded RNA that can specifically block expression of a target gene. Double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner.
  • RNAi provides a useful method of inhibiting gene expression in vitro or in vivo.
  • RNAi can comprise either long stretches of dsRNA identical or substantially identical to the target nucleic acid sequence or short stretches of dsRNA identical to or substantially identical to only a region of the target nucleic acid sequence.
  • RNAi includes, but are not limited to, small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), and other RNA species, such as non-enzymatic nucleic acids, which can be cleaved in vivo to form siRNAs.
  • RNAi may also include RNAi expression vectors capable of giving rise to transcripts which form dsRNAs or shRNAs in cells, and/or transcripts which can produce siRNAs in vivo.
  • the RNAi may comprise a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the RNA transcript for the target gene.
  • These RNAi have the advantage of being able to tolerate variations in sequence that may arise from, for example, genetic mutation, strain polymorphism or evolutionary divergence.
  • the number of tolerated nucleotide mismatches between the target sequence and the RNAi sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA.
  • the antisense nucleic acid molecule has at least 85% sequence identity to SEQ ID NOs:1-3, 9 or 10.
  • Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art and calculating the percent difference between the nucleotide sequences.
  • the preferred sequence identity between the inhibitory RNA and the portion of the target gene is greater than 90%, 95%, 96%, 97%, 98%, 99% or 100%.
  • the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing under specified conditions with a portion of the target gene transcript.
  • the double-stranded structure may be formed by a single self-complementary RNA strand or two complementary RNA strands.
  • RNA duplex formation may be initiated either inside or outside the cell.
  • the RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition.
  • the siRNAs are around 19-30 nucleotides long, and even more preferably 21-23 nucleotides.
  • the siRNAs effectively recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target mRNA is degraded by the nucleases in the protein complex.
  • the 21-23 nucleotides siRNA molecules comprise a 3′ hydroxyl group.
  • the siRNA can be generated by the processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer.
  • siRNA molecules can be purified using a number of techniques known to those of skill in the art such as, for example, gel electrophoresis, non-denaturing column chromatography, chromatography, glycerol gradient centrifugation, and/or affinity purification with an antibody.
  • the shRNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such shRNAs for gene silencing in mammalian cells are known in the art. Preferably, such shRNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is recognized in the art that siRNAs can be produced by processing a shRNA in the cell.
  • the invention relates to the use of suitable ribozyme molecules, such as, for example, RNA endoribonucleases and hammerhead ribozymes, designed to catalytically cleave mRNA transcripts to prevent translation of mRNA.
  • ribozyme molecules such as, for example, RNA endoribonucleases and hammerhead ribozymes, designed to catalytically cleave mRNA transcripts to prevent translation of mRNA.
  • Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA, which have a base sequence of 5′-UG-3′.
  • polynucleotide or expression vector therapy for treating neoplasia featuring a polynucleotide encoding an inhibitory nucleic acid molecule or analog thereof that targets miR-192 or miR-215 is provided.
  • the antisense nucleic acid may cause inhibition of expression by hybridizing with miR-192 or miR-215 and/or genomic sequences encoding miR-192 or miR-215.
  • Expression vectors encoding inhibitory nucleic acid molecules can be delivered to cells of a subject having a neoplasia in a form in which they can be taken up and expressed so that therapeutically effective levels may be achieved.
  • the expression vector produces an oligonucleotide which is complementary to at least a unique portion of miR-192 or miR-215.
  • Methods for delivery of the polynucleotides to the cell according to the invention include, but are not limited to, using a delivery system such as viral vectors, liposomes, polymers, microspheres, gene therapy vectors, naked DNA vectors, carbon nanotubes and chemical linkers.
  • a delivery system such as viral vectors, liposomes, polymers, microspheres, gene therapy vectors, naked DNA vectors, carbon nanotubes and chemical linkers.
  • Nucleic acid probes may also be modified so that they are resistant to endogenous nucleases such as, for example, exonucleases and/or endonucleases, and are therefore stable in vivo.
  • Inhibitory nucleic acid molecule expression for use in polynucleotide therapy methods can be directed from any suitable promoter and regulated by any appropriate mammalian regulatory element. Promoters may include, but are not limited to, the human cytomegalovirus, simian virus 40, and/or metallothionein promoters. In this embodiment, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers.
  • Transducing viral vectors such as, for example, retroviral, adenoviral, lentiviral and adeno-associated viral vectors, can be used as expression vectors for somatic cell gene therapy.
  • Viral vectors are especially useful because of their high efficiency of infection, and stable integration and expression.
  • a polynucleotide encoding an inhibitory nucleic acid molecule can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a target cell type of interest.
  • Other viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus.
  • the invention comprises an inhibitory nucleic acid molecule that corresponds to a portion of a miR-192 promoter binding sequence for p53 (SEQ ID NO:25).
  • the inhibitory nucleic acid molecule comprises or consists essentially of a sequence or a complementary sequence of SEQ ID NO:25, a fragment thereof or a variation thereof.
  • SEQ ID NO:25 is a portion of the miR-192 promoter (SEQ ID NO:8) that binds to p53. Accordingly, the expression of miR-192 can be altered by administering an inhibitory nucleic acid molecule that comprises a sequence of SEQ ID NO:25, a fragment thereof, or a variation thereof.
  • the inhibitory nucleic acid molecule would bind to the p53 site at the miR-192 promoter binding site and thereby block the binding of p53 to the miR-192 promoter.
  • the expression of miR-192 can also be altered by administering an inhibitory nucleic acid molecule that comprises a sequence complementary to SEQ ID NO:25, a fragment thereof, or a variation thereof.
  • the inhibitory nucleic acid molecule would bind to the miR-192 promoter thereby blocking p53 from binding to the miR-192 promoter region and block transcription of miR-192.
  • the inhibitory nucleic acid molecule can consist essentially of a sequence or a sequence complementary to SEQ ID NO:25, a fragment thereof, or a variation.
  • the inhibitory nucleic acid molecule may contain other components that are not involved in binding to the p53 binding sequence or the miR-192 promoter region. These components may include, but are not limited to, other nucleic acids, amino acids ligands, linkers, or other modification that will not effect the primary function of the inhibitory nucleic acid molecule in these embodiments, blocking the binding of p53 to the miR-192 promoter region and inhibiting the transcription of miR-192.
  • the inhibitor nucleic acid molecule may contain other nucleotides complementary to a position of the miR-192 promoter (SEQ ID NO:8) that it does not interact with the p53 binding sequence.
  • a fragment of the sequence of complementary sequence would be adequate to block the binding of p53 to the miR-192 promoter and the transcription of miR-192.
  • a suitable fragment can be at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides in length.
  • Example 8 a three base pair gap between SEQ ID NO:25 and the p53 binding is discussed. Accordingly, 100% homology is not necessary. Instead, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% homology is sufficient to enable the inhibitory nucleic acid molecule to bind to the miR-192 promoter or the p53 binding site.
  • a non-viral approach may be employed for the introduction of an inhibitory nucleic acid molecule therapeutic to a cell of a patient diagnosed as having a neoplasia.
  • an inhibitory nucleic acid molecule that targets a miRNA-215 can be introduced into a cell by administering the nucleic acid in the presence of lipofection, asialoorosomucoid-polylysine conjugation, or by micro-injection under surgical conditions.
  • the inhibitory nucleic acid molecules are administered in combination with a liposome and protamine.
  • Gene transfer can also be achieved using non-viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell.
  • the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.
  • the cellular components may comprise miR-192 or miR-215, p21, p53, DHFR, TS or any cellular component regulated by these components.
  • miR-192 or miR-215, p21, p53, DHFR, TS or any cellular component regulated by these components are also provided.
  • the cellular components may comprise miR-192 or miR-215, p21, p53, DHFR, TS or any cellular component regulated by these components.
  • miR-192 or miR-215, p21, p53, DHFR, TS or any cellular component regulated by these components.
  • p53 and p21 a downstream target of the p53 pathway of growth control, are reported to block cells at G2 checkpoint mainly through inhibiting Cdc2 activity, the cyclin-dependent kinase that normally drives cells into mitosis, which is the ultimate target of pathways that mediate rapid arrest in G2 in response to DNA damage as reported in, for example, Taylor et al., “Regulation of the G2/M transition by p53”, Oncogene. (2001); 20: 1803-1815; Stark et al., “Control of the G2/M transition,” Mol. Biotechnol. (2006); 32: 227-248; and Bunz et al., “Requirement for p53 and p21 to sustain G2 arrest after DNA damage”, Science. (1998); 282: 1497-1501.
  • miR-192 or miR-215 can induce G2-arrest in HCT-116 (wt-p53) and U-2 OS cells.
  • Transfection of miR-192 or miR-215 precursor into HCT-116 (wt-p53) and U-2 OS cells to analyze the mechanism of cell proliferation inhibition by miR-192 or miR-215 indicate that over-expression of miR-192 or miR-215 led to a significant increase of the p53 and p21 protein in both HCT-116 (wt-p53) and U-2 OS cells.
  • FIGS. 6 and 12 depicts an evaluation of the levels of cell cycle control genes p53 and p21 by Western immunoblot analysis. As illustrated in FIGS.
  • miR-192 or miR-215 contributes to the inhibition of cell proliferation at least partially by the induction of G2-arrest in HCT-116 (wt-p53) and U-2 OS cells, which was through over-expression of G2-checkpoint genes p53 and p21.
  • miR-192 or miR-215 suppresses cell proliferation. Since most miRNAs have more than one target range from dozens to hundreds (see Wiemer, “The role of microRNAs in cancer: No small matter”, Eur. J. Cancer. (2007) 43:1529-1544), miR-192 or miR-215 most likely targets the enzymes for DNA biosynthesis, such as TS and DHFR, and also leads to the inhibition of cell proliferation in cancer cells. As illustrated in FIG. 13 , the inventors used the Sanger database (microrna.sanger.ac.uk) to identify TS and DHFR as the putative targets of miR-192 and miR-215. As illustrated in FIGS.
  • the inventors extracted the proteins and searched for the changes in TS or DHFR protein levels by Western immunoblot analysis. Oligofectamine alone and non-specific miRNA were used as the negative controls.
  • the DHFR expression is down-regulated by miR-192.
  • miR-192 as a positive control of DHFR down-regulation, the over-expression of miR-215 and miR-192 was confirmed by real time qRT-PCR analysis using U6 RNA to normalize the expression (see FIG. 11 ).
  • Introduction of miR-192 or miR-215 clearly decreases TS or DHFR protein levels (see FIG. 2 and FIG. 14 , lanes 3 and 4).
  • the inventors also analyzed the expression level of TS or DHFR mRNA using real time qRT-PCR analysis. As illustrated in FIG. 15 , the inventors discovered that there was no reduction in TS or DHFR mRNA expression by miR-192 or miR-215 (column 3) and miR-192 (column 4). Thus, the suppression of TS or DHFR expression was regulated at the translational level without the degradation of TS or DHFR mRNA.
  • a method of increasing proliferation of a cell is provided using the mechanisms of the various pathways disclosed herein.
  • the cell is contacted with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter.
  • the amount of nucleic acid complementary to miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25) effective to increase proliferation of the cell is not particularly limited. In embodiments, the amount is in the range of more than about 20% for cell proliferation and more than about 2-fold of IC 50 .
  • the nucleic acid may comprise an antisense nucleic acid, siRNA or shRNA.
  • the cell may comprise a cancer stem cell or a neoplastic cell.
  • a method of increasing the sensitivity of a cell to a chemotherapeutic agent is provided using the mechanisms of the various pathways disclosed herein.
  • the cell is contacted with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25).
  • the amount of nucleic acid complementary to miR-192, (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter effective to sensitize the cell to the chemotherapeutic agent is not particularly limited. In embodiments, the amount is in the range of more than about 20% for cell proliferation and more than about 2-fold of IC 50 . In an embodiment, the chemotherapeutic agent is selected from the group consisting of a DHFA inhibitor and a TS inhibitor.
  • chemotherapeutic agent examples include, but are not limited to, methotrexate (MTX), fluorouracil (5-FU), nolatrexed, ZD9331, GS7904L and ralitrexed (TDX).
  • MTX methotrexate
  • 5-FU fluorouracil
  • TDX ralitrexed
  • the nucleic acid may comprise an antisense nucleic acid, siRNA or shRNA.
  • the cell may comprise a cancer stem cell or a neoplastic cell.
  • a method of increasing the sensitivity of a cell to radiation is provided using the mechanisms of the various pathways disclosed herein.
  • the cell is contacted with a nucleic acid complementary to at least a portion of miR-192, (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25).
  • the amount of nucleic acid complementary to miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter effective to sensitize the cell to radiation is not particularly limited. In embodiments, the amount is in the range of more than about 20% for cell proliferation and more than about 2-fold of IC 50 .
  • the nucleic acid may comprise an antisense nucleic acid, siRNA or shRNA.
  • the cell may comprise a cancer stem cell or a neoplastic cell.
  • compositions and methods of the present invention involve a first therapy an inhibitor of miR-192 or miR-215 or an expression construct encoding miR-192 or miR-215, used in combination with a second therapy to enhance the effect of the miR-192 or miR-215 therapy, or increase the therapeutic effect of the second therapy being employed to treat a neoplasm.
  • a second therapy to enhance the effect of the miR-192 or miR-215 therapy, or increase the therapeutic effect of the second therapy being employed to treat a neoplasm.
  • These compositions would be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with the miR-192 or miR-215 and the second therapy at the same or different time.
  • compositions or pharmacological formulation that includes one or more of the agents, or by contacting the cell with two or more distinct compositions or formulations, wherein one composition provides (1) administering to the subject an effective amount of a nucleic acid molecule that inhibits expression of miR-192 or miR-215 and/or (2) a second therapy, in which the inhibition of expression of miR-192 or miR-215 sensitizes the neoplasm to the second therapy.
  • the second therapy may comprise administering chemotherapy, radiotherapy, surgical therapy, immunotherapy or gene therapy.
  • the chemotherapeutic agent is selected from the group consisting of a DHFR inhibitor and a TS inhibitor.
  • the chemotherapeutic agents include, but are not limited to, DHFR inhibitors or TS inhibitors such as, for example, MTX, pemetrexed, 5-FU, raltitrexed (TDX), nolatrexed, ZD9331, and/or GS7904L.
  • MTX MTX
  • pemetrexed 5-FU
  • TDX raltitrexed
  • nolatrexed ZD9331
  • GS7904L GS7904L
  • any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the vector or any protein or other agent. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy.
  • chemotherapeutic agent is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.
  • the neoplasm being treated is a form of cancer.
  • Cancers that may be evaluated by methods and compositions of the invention include any suitable cancer cells known to one of ordinary skill in the art. The inventors have found that the present invention is particularly useful in treating cancer cells from the colon or the pancreas, including pancreatic ductal adenocarcinoma.
  • other suitable cells include cancer cells of the bladder, blood, bone, bone marrow, brain, breast, cervix, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, rectum, skin, stomach, testis, tongue, or uterus.
  • Other conditions treatable by the compositions and methods of the present invention will be readily apparent to one of ordinary skill in the art.
  • An inhibitory nucleic acid molecule of the invention, or other negative regulator of miR-192 or miR-215 may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form.
  • Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the compounds to patients suffering from a neoplasia. Administration may begin before the patient is symptomatic.
  • administration may be parenteral, intravenous, intraarterial, subcutaneous, intratumoral, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intrahepatic, intracapsular, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, suppository, or oral administration.
  • Therapeutic formulations and methods for making such formulations are well known in the art.
  • the formulations can be administered to human patients in therapeutically effective amounts to provide therapy for a neoplastic disease or condition.
  • the preferred dosage of inhibitory nucleic acid of the invention is likely to depend on such variables as the type and extent of the disorder, the overall health status of the particular patient, the formulation of the compound excipients, and its route of administration.
  • Therapy may be provided at any suitable location and under any suitable conditions. The duration of the therapy depends on various factors readily understood by one of ordinary skill in the art. Drug administration may also be performed at any suitable interval. For example, therapy may be given in predetermined on-and-off intervals as appropriate.
  • the therapy can be used to slow the spreading of the cancer, to slow the cancer's growth, to kill or arrest cancer cells, to relieve symptoms caused by the cancer, or to prevent cancer.
  • treatment with an inhibitory nucleic acid molecule of the invention may be combined with therapies such as, for example, radiotherapy, surgery, or chemotherapy for the treatment of proliferative disease.
  • a method of diagnosing a neoplasm in a subject comprises determining the level of expression of miR-192 or miR-215.
  • the present invention has identified increases in the expression of miR-192 or miR-215, and corresponding decreases in the expression of TS and DHFR that are associated with cellular proliferation. Alterations in the expression level of one or more of the following other markers used to diagnose a neoplasia are also contemplated. If desired, alterations in the expression of any combination of these markers is used to diagnose or characterize a neoplasia as would be readily apparent to one of ordinary skill in the art.
  • a subject is diagnosed as having or having a propensity to develop a neoplasia, the method comprising measuring markers in a biological sample from a patient, and detecting an alteration in the expression of test marker molecules relative to the sequence or expression of a reference molecule. While the following approaches describe diagnostic methods featuring a miR-192 or miR-215, the skilled artisan will appreciate that any one or more of the markers set forth above is useful in such diagnostic methods. Increased expression of a miR-192 or miR-215 is correlated with neoplasia. Accordingly, the invention provides compositions and methods for identifying a neoplasia in a subject.
  • the present invention provides a number of diagnostic assays that are useful for the identification or characterization of a neoplasia. Alterations in gene expression are detected using methods known to the skilled artisan and described herein. Such information can be used to diagnose a neoplasia.
  • diagnostic methods of the invention are used to assay the expression of miR-192 or miR-215 in a biological sample relative to a reference sample.
  • the level of miR-192 or miR-215 is detected using a nucleic acid probe that specifically binds at least a portion of miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9).
  • exemplary nucleic acid probes that specifically bind miR-192 or miR-215 are described herein.
  • the biological sample can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • PCR methods are used to identify an increase in the expression of miR-192 or miR-215.
  • PCR methods are used to identify an alteration in the sequence of miR-192 or miR-215.
  • the invention provides probes that are capable of detecting miR-192 or miR-215. Such probes may be used to hybridize to a nucleic acid sequence derived from a patient having a neoplasia. The specificity of the probe determines whether the probe hybridizes to a naturally occurring sequence, allelic variants, or other related sequences. Hybridization techniques may be used to identify mutations indicative of a neoplasia or may be used to monitor expression levels of these genes.
  • a measurement of a nucleic acid molecule in a subject sample may be compared with a diagnostic amount present in a reference. Any significant increase or decrease in the level of test nucleic acid molecule or polypeptide in the subject sample relative to a reference may be used to diagnose a neoplasia.
  • Test molecules include any one or more of markers disclosed herein.
  • the reference is the level of test polypeptide or nucleic acid molecule present in a control sample obtained from a patient that does not have a neoplasia.
  • the reference is a baseline level of test molecules present in a biologic sample derived from a patient prior to, during, or after treatment for a neoplasia.
  • the reference can be a standardized curve.
  • the subject sample can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • a method of identifying a neoplasm resistant to chemotherapy comprises determining the level of expression in the neoplasm of miR-192 or miR-215, and identifying the neoplasm as resistant to therapy if the level of miR-192 or miR-215 is elevated, or identifying the neoplasm as not resistant to therapy if the level of miR-192 or miR-215 is reduced.
  • a method of determining whether a neoplasm is a candidate for treatment with a chemotherapeutic agent comprises evaluating the level of expression of miR-192 or miR-215 and rejecting the candidate if expression of the miR-192 or miR-215 is elevated, or accepting the candidate if the expression of miR-192 or miR-215 is reduced.
  • kits for analysis of a pathological sample Any of the compositions described herein may be comprised in the kit.
  • reagents for isolating miRNA, labeling miRNA, and/or evaluating a miRNA population using an array, nucleic acid amplification, and/or hybridization can be included in a kit, as well as reagents for preparation of samples from blood samples.
  • the kit may further include reagents for creating or synthesizing miRNA probes.
  • the kits may comprise, in suitable container means, an enzyme for labeling the miRNA by incorporating labeled nucleotides or unlabeled nucleotides that are subsequently labeled.
  • the kit can include amplification reagents.
  • the kit may include various supports, such as glass, nylon, polymeric beads, and the like, and/or reagents for coupling any probes and/or target nucleic acids. It may also include one or more buffers, such as a reaction buffer, labeling buffer, washing buffer, or a hybridization buffer, compounds for preparing the miRNA probes, and components for isolating miRNA.
  • Other kits of the invention may include components for making a nucleic acid array comprising miRNA, and thus, may include, for example, a solid support.
  • the pathological sample can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • kits for implementing methods of the invention described herein are specifically contemplated.
  • the kit may comprise, in suitable container means, any suitable solvents, buffers, reagents, or additives known to one of ordinary skill in the art including, but not limited to, those generally used for manipulating RNA, such as formamide, loading dye, ribonuclease inhibitors, and DNase.
  • kits may include an array containing miRNA probes.
  • arrays may include, for example, arrays relevant to a particular diagnostic, therapeutic, or prognostic application.
  • the array may contain one or more probes that is indicative of a disease or condition, susceptibility or resistance to a drug or treatment, susceptibility to toxicity from a drug or substance, prognosis, and/or genetic predisposition to a disease or condition.
  • kits there can be nucleic acid molecules that contain or can be used to amplify a sequence that is a variant of, identical to or complementary to all or part of any SEQ ID described herein.
  • a kit or array of the invention can contain one or more probes for the miRNAs identified by the SEQ IDs described herein. Any nucleic acid discussed above may be implemented as part of a kit.
  • kits may be packaged in any suitable manner known to one of ordinary skill in the art such as, for example, in aqueous media or in lyophilized form.
  • kits of the present invention may also include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale.
  • Such containers may include injection or blow molded plastic containers into which the desired vials are retained.
  • kits may also include components that facilitate isolation of the labeled miRNA. It may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses.
  • Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.
  • kits will also include instructions for employing the kit components as well as the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.
  • a method of identifying an agent that inhibits the expression or activity of miR-192 or miR-215 comprises contacting a cell that expresses the miR-192 or miR-215 with an agent, and comparing the expression level of the miR-192 or miR-215 in the cell contacted by the agent with the expression level of the miR-192 or miR-215 in the absence of the agent.
  • the agent is an inhibitor of the miR-192 or miR-215 if expression of the miR-192 or miR-215 is reduced.
  • the test cell may overexpress the miRNA.
  • Compounds that modulate the expression or activity of a miR-192 or miR-215 are useful in the methods of the invention for the treatment, prevention, diagnosis and prognostication of a neoplasm or subject.
  • the method of the invention may measure a decrease in transcription of miR-192 or miR-215 or an alteration in the transcription or translation of the target of miR-192 or miR-215. Any number of methods are available for carrying out screening assays to identify such compounds.
  • the method comprises contacting a cell that expresses miR-192 or miR-215 with an agent and comparing the level of miR-192 or miR-215 expression in the cell contacted by the agent with the level of expression in a control cell, wherein an agent that decreases the expression of miR-192 or miR-215 thereby, in combination with a secondary therapy, inhibits a neoplasia.
  • candidate compounds are identified that specifically bind to and alter the activity of miR-192 or miR-215 of the invention. Methods of assaying such biological activities are known in the art. The efficacy of such a candidate compound is dependent upon its ability to interact with miR-192 or miR-215. Such an interaction can be readily assayed using any number of standard binding techniques and functional assays.
  • Potential agonists and antagonists of miR-192 or miR-215 include, but are not limited to, organic molecules, peptides, peptide mimetics, polypeptides, nucleic acid molecules, and antibodies that bind to a nucleic acid sequence of the invention and thereby inhibit or extinguish its activity.
  • Potential antagonists also include small molecules that bind to miR-192 or miR-215 thereby preventing binding to cellular molecules with which the miR-192 or miR-215 normally interacts, such that the normal biological activity of miR-192 or miR-215 is reduced or inhibited.
  • Small molecules of the invention preferably have a molecular weight below 2,000 daltons, more preferably between 300 and 1,000 daltons, and still more preferably between 400 and 700 daltons. It is preferred that these small molecules are organic molecules.
  • the invention also includes novel compounds identified by the above-described screening assays. These compounds are characterized in one or more appropriate animal models to determine the efficacy of the compound for the treatment of a neoplasia. Characterization in an animal model can also be used to determine the toxicity, side effects, or mechanism of action of treatment with such a compound. Furthermore, novel compounds identified in any of the above-described screening assays may be used for the treatment of a neoplasia in a subject. Such compounds are useful alone or in combination with other conventional therapies known in the art.
  • the invention can be used to evaluate differences between stages of disease, such as between hyperplasia, neoplasia, precancer and cancer, or between a primary tumor and a metastasized tumor. Moreover, it is contemplated that samples that have differences in the activity of certain pathways may also be compared. It is further contemplated that nucleic acids molecules of the invention can be employed in diagnostic and therapeutic methods with respect to any of the above pathways or factors. Thus, in some embodiments of the invention, a miRNA may be differentially expressed with respect to one or more of the above pathways or factors.
  • the samples can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • miRNA profiles may be generated to evaluate and correlate those profiles with pharmacokinetics.
  • miRNA profiles may be created and evaluated for patient tumor and blood samples prior to the patient's being treated or during treatment to determine if there are miRNAs whose expression correlates with the outcome of the patient. Identification of differential miRNAs can lead to a diagnostic assay involving them that can be used to evaluate tumor and/or blood samples to determine what drug regimen the patient should be provided. In addition, it can be used to identify or select patients suitable for a particular clinical trial. If a miRNA profile is determined to be correlated with drug efficacy or drug toxicity, that may be relevant to whether that patient is an appropriate patient for receiving the drug or for a particular dosage of the drug.
  • samples such as urine, bodily fluid or tissue, can also be used.
  • samples from patients with a variety of diseases can be evaluated to determine if different diseases can be identified based on blood miRNA levels.
  • a diagnostic assay can be created based on the profiles that doctors can use to identify individuals with a disease or who are at risk to develop a disease.
  • the samples may be any sample commonly taken from a patient, such as, for example, blood, urine or tissue.
  • treatments can be designed based on miRNA profiling.
  • miR-192 Regulates the Expression of DHFR
  • miRNAs that potentially interact with the 3′-UTR region of DHFR mRNA.
  • Bioinformatic analysis of the secondary structure of the 3′-UTR of the DHFR mRNA and miRNA binding sites reduced the candidate miRNAs to a small number. From this analysis, miR-192 was identified as a candidate that may regulate DHFR.
  • FIG. 1 shows the secondary structure of the 3′-UTR of the DHFR mRNA and the target sequence that interacts with miR-192.
  • miR-192 a miR-192 precursor was transfected into HCT-116 (wt-p53) cells. A non-specific miR was used as a negative control. It has been reported that the expression of DHFR is regulated by miR-24. A DHFR siRNA and miR-24 were used as positive controls.
  • Over-expression of miR-192 ( FIG. 2A ) and miR-24 ( FIG. 2B ) was confirmed by real time qRTPCR analysis using U6 RNA to normalize the expression.
  • DHFR protein was analyzed using Western immunoblot analysis and the results are shown in FIG. 2C .
  • human colon cancer cell lines HCT-116 (wt-p53), cells were transfected with miR-192 or miR-24.
  • the cells were maintained in McCoy's 5A medium (Life Technologies).
  • the media was supplemented with 10% dialyzed fetal bovine serum (Hyclone Laboratories).
  • the cell line were grown at 37° C. in a humidified incubator with 5% CO 2 .
  • the HCT-116 (wt-p53) cells transfected as follows.
  • the cells (2 ⁇ 10 5 ) were plated in 6-well plates and transfected with 100 nmol/L of either miR-192 or miR-24 precursors or nonspecific control miR (Ambion) after 24 h with Oligofectamine (Invitrogen) according to the manufacturer's instructions.
  • Small interfering RNA (siRNA) specific to DHFR On-Target plus SMARTpool L-008799-00-0010, human DHFR, NM — 000791) (Dharmacon) and transfected with Oligofectamine (Invitrogen) according to the manufacturer's protocols at a final concentration of 100 nmol/L.
  • siRNA specific to DHFR was used as the positive control.
  • miR-24 a miRNA that also targets DHFR (Mishra, et al., “A miR-24 microRNA binding site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance: Prof. Nat'l. Acad. Sci. (2007) 104:13513-13518) was also used as a positive control.
  • the cells were scraped and lysed in radioimmunoprecipitation assay buffer (Sigma). Equal amount of proteins were resolved by SDS-PAGE on 12% gels by the method of Laemmli, “Cleavage of structured proteins during the assemble of the head of bacteriophase 74,” Nature (1970) 227:680-685, and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories). The membranes were then blocked by 5% nonfat milk in TBS-0.5% Tween 20 at room temperature for 1 hour.
  • the primary antibodies used for the analysis included mouse anti-DHFR monoclonal antibody (mAb; 1:250; BD Biosciences), and mouse anti-a-tubulin mAb (1:1,000; TU-02) (Santa Cruz Biotechnology). Horseradish peroxidase-conjugated antibodies against mouse or rabbit (1:1,000; Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate.
  • FIG. 2C is the resulting Western immunoblot that shows overexpression of miR-192 clearly decreased the expression of DHFR protein ( FIG. 2C , lane 4).
  • lane 1 is the control
  • lane 2 is the cells transfected with non-specific miR control
  • lane 3 is the cells transfected with siRNA specific to DHFR
  • lane 4 is from cells transfected with miR-192
  • lane 5 is the cells transfected with miR-24.
  • the results show that the potency of miR-192 ( FIG. 2C , lane 4) for decreasing DHFR expression was comparable to miR-24 ( FIG. 2C , lane 5).
  • DHFR mRNA The expression level of DHFR mRNA were analyzed using real time qRT-PCR analysis. The analysis was performed as follows. Total RNA, including miRNA, was isolated from cell lines by using TRIzol reagent (Invitrogen) according to the manufacturer's instructions at 24 h after transfection. cDNA was synthesized with the High Capacity cDNA synthesis kit (Applied Biosystems) using 2 ⁇ g of total RNA as the template and random primers. Real-time qRT-PCR analysis was done on the experimental mRNAs. The PCR primers and probes for DHFR, and the internal control gene GAPDH were purchased from Applied Biosystems.
  • FIG. 2D The results indicated that there was no reduction in DHFR mRNA expression by miR-192 (lane 4) and miR-24 (lane 5).
  • each bar corresponds to each lane illustrated in FIG. 2C (see above).
  • the results demonstrate that the suppression of DHFR expression was regulated at the translational level without the degradation of DHFR mRNA.
  • the decreased expression of DHFR by siRNA was clearly caused by mRNA degradation (lane 3, FIG. 2D ).
  • HCT-116 (wt-p53) cells were plated in 96-well plates at 1 ⁇ 10 3 cells/well in triplicate. They were transfected with miR-192 precursor ( FIG. 3 , lane 4), non-specific control miRNA ( FIG. 3 , lane 2), or siRNA against DHFR ( FIG. 3 , lane 3) in 100 ⁇ l of medium. Twenty-four hours later, MTX in 100 ⁇ l medium (final concentration 25 nM) was added, and incubated for 72 hours. One sample was only transfected with non-specific miR and was not treated with MTX ( FIG. 3 , lane 1).
  • miR-192 Inhibits Cell Proliferation of HCT-116 (wt-p53), RKO (wt-p53) and HT-29 (mut-p53) Colon Cancer Cell Lines
  • HCT-116 wt-p53
  • HCT-116 null-p53
  • RKO wt-p53
  • HT-29 mut-p53 colon cancer cell lines.
  • the human colon cancer cell lines HCT-116 (wt-p53) and HCT-116 (null-p53) were provided by Prof. Bert Vogelstein (The Johns Hopkins University) and were maintained in McCoy's 5A medium (Life Technologies).
  • the other two human colon cancer cell lines, RKO (wt-p53) and HT-29 (mut-p53) were obtained from the American Type Culture Collection.
  • the HT-29 (mut-p53) cell line has a missense mutation in codon 273 of p53 resulting in an Argto-His substitution.
  • RKO (wt-p53) and HT-29 (mut-p53) cells were maintained in Eagle's MEM and Iscove's Modified Dulbecco's Medium at the American Type Culture Collection, respectively. All media were supplemented with 10% dialyzed fetal bovine serum (Hyclone Laboratories). All cell lines were grown at 37° C. in a humidified incubator with 5% CO 2 . The cell lines were transfected as described above (see Examples 1 and 2).
  • HCT-116 wt-p53
  • HCT-116 null-p53
  • RKO wt-p53
  • HT-29 cells FIG. 4D
  • miR-192 precursor Illustrated as — ⁇ —
  • non-specific control miRNA Illustrated as — ⁇ —
  • Cells were cultured for 24, 48, 72, or 96 hours.
  • the absorbance at 450 and 630 nm was measured after incubation with 10 ⁇ l of WST-1 for 2 hours.
  • a non-specific miR was used as a negative control.
  • the non-specific control miR has no effect on cellular proliferation, indicating that this effect caused by miR-192 is highly specific.
  • the results clearly showed that the effect of miR-192 on the inhibition of cellular proliferation is more potent in colon cancer cells containing wild type p53, further indicating that miR-192's function depends on the status of p53.
  • HCT-116 wt-p53
  • HCT-116 null-p53
  • FIG. 5B HCT-116 (null-p53) cells transfected with non-specific control miR (left line graph) or miR-192 (right line graph).
  • This experiment was performed as follows.
  • the HCT-116 (wt-p53) and HCT-116 (null-p53) cells lines as described above (see Example 3) were transfected with miR-192 precursor and the non-specific control miRNA described as above (see Examples 1 and 2).
  • the cells were harvested and resuspended at 0.5-1 ⁇ 10 5 cells/ml in modified Krishan buffer containing 0.1% sodium citrate and 0.3% NP-40 and kept at 4° C. Before being analyzed by flow cytometry, cells were treated with 0.02 mg/ml RNase H and stained with 0.05 mg/ml propidium iodide (Sigma).
  • HCT-116 (wt-p53) cells transfected with non-specific miR had the following cell cycle profile G1: 38.78%, G2: 17.46%, S: 43.76%, G1/S: 0.89%, and G2/S: 0.40%.
  • the HCT-116 (wt-p53) cells transfected with miR-192 had the follow cell cycle profile G1: 40.84%, G2: 44.71%, S: 14.45%, G1/S: 2.83%, and G2/S: 3.09%.
  • HCT-116 (null) cells transfected with non-specific miR had the following cell cycle profile G1: 40.15%, G2: 13.33%, S: 46.52%, G1/S: 0.86%, and G2/S: 0.29%.
  • the HCT-116 (null) cells transfected with miR-192 had the follow cell cycle profile G1: 35.65%, G2: 19.06%, S: 45.29%, G1/S: 0.79% and G2/S: 0.42%.
  • FIG. 5 show that miR-192 induces both G1 (>2-fold) and G2 arrest (>3-fold) in HCT-116 (wt-p53) cells ( FIG. 5A ). By contrast, this effect has not been observed in HCT-116 (null-p53) cells ( FIG. 5B ).
  • the cell cycle analysis data is highly consistent with the cell proliferation results that the function of miR-192 is dependent on the presence of wild type p53 for cell cycle control.
  • HCT-116 (wt-p53) cells FIG. 6A
  • RKO (wt-p53) cells FIG. 6B
  • non-specific miR FIG. 6A , lane 2; and FIG. 6 B., lane 1
  • DHFR siRNA FIG. 6A , lane 3; and FIG. 6 B., lane 2
  • miR-192 FIG. 6A , lane 4; and FIG. 6 B., lane 3
  • Non-transfected HCT-116 (wt-p53) was used as a negative control ( FIG. 6A , lane 1).
  • Alpha-tubulin was used as a protein loading control.
  • the cells were scraped and lysed in RIPA buffer (Sigma). Equal amount of proteins were resolved by SDS-PAGE on 12% gels by the method of Laemmli, and transferred to polyvinylidene fluoride membranes (BIO-RAD Laboratories). The membranes were then blocked by 5% nonfat milk in TBS-T (Tris-buffered saline and 0.5% Tween-20) at room temperature for 1 hour.
  • TBS-T Tris-buffered saline and 0.5% Tween-20
  • the primary antibodies used for the analysis included mouse anti-p53 mAb (1:1000, DO-1) (Santa Cruz Biotechnology), mouse anti-p21 mAb (1:1000, F-5) (Santa Cruz Biotechnology), and mouse anti- ⁇ -tubulin mAb (1:1000, TU-02) (Santa Cruz Biotechnology).
  • Horseradish peroxidase-conjugated antibodies against mouse or rabbit (1:1000) (Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate.
  • FIG. 6 shows the results of Western immunoblot analysis in HCT-116 (wt-p53) 10 cells ( FIG. 6A ) and RKO (wt-p53) cells ( FIG. 6B ).
  • miR-192 increased the expression of the p53 protein ( FIG. 6A , lane 4) over 10-fold and p21 10-fold.
  • siRNA against DHFR FIG. 6A , lane 3
  • the expression of Bax was not altered by miR-192.
  • Similar results were obtained for RKO (wt-p53) cells ( FIG. 6B , lane 3 (miR-192), lane 1 (non-specific miR) and lane 2 (siRNA of DHFR)).
  • HVT-116 (wt-p53) cells as described above (see Example 3) were transfected with non-specific miR ( FIG. 7 , lane 2), DHFR siRNA ( FIG. 7 , lane 3) or miR-192 ( FIG. 7 , lane 4) according to the procedure described above (see Examples 1 and 2).
  • One HCT-116 (wt-p53) sample was not transfected, and used as a negative control ( FIG. 7 , lane 1).
  • Western immunoblot analysis was performed according to the procedure described above (see Example 5), except that rabbit anti-E2F-3 polyclonal antibody (1:1000, C-18) (Santa Cruz Biotechnology) was used.
  • endogenous mature miR-192 was analyzed by real time qRT-PCT analysis using an internal control RNU6B as an internal standard for normalization.
  • the cDNA synthesis was carried out with the High Capacity cDNA synthesis kit (Applied Biosystems) using 10 ng of total RNA as template.
  • the miRNA sequence-specific RT-PCR primers for miR-192 and endogenous control RNU6B were purchased from Ambion.
  • Real-time quantitative reverse transcription-PCR (qRT-PCR) analysis was carried out using Applied Biosystems 7500 Real-Time PCR System.
  • the gene expression ⁇ C T values of miRNAs from each sample were calculated by normalizing with internal control RNU6B and relative quantitation values were plotted.
  • FIG. 8B The results are illustrated in FIG. 8B where an open bar indicates an MTX( ⁇ ) sample, and a dashed bar indicates an MTX(+) sample.
  • the qRT-PCT FIG. 8B shows that induction of p53 by MTX caused a significant increase of miR-192 expression.
  • MTX treatment in HCT-116 (null-p53) and HT-29 (mut-p53) cells did not cause any change in the expression of miR-192 ( FIG. 8B ).
  • FIG. 9A is a schematic diagram showing the position of the miR-192 promoter (over 3 kb) relative to the location of the miR-192 precursor on chromosome 11.
  • chromatin immunoprecipitation-qRT-PCT ChoIP-qPCR
  • Non-related antibody ⁇ -tubulin (TU-02, Santa Cruz Biotechnology) was used as a negative control. Immunoprecipitation was performed based on the manufacturer's protocols of Active Motif.
  • the primer sequences for the miR-192 promoter and the p21 promoter are listed as follows:
  • miR-192 promoter (forward primer): (SEQ ID NO: 4) 5′-AGCACCTCCCATGTCACC-3′ miR-192 promoter (reverse primer): (SEQ ID NO: 5) 5′-CAAGGCAGAGCCAGAGC-3′ p21 promoter (forward primer): (SEQ ID NO: 6) 5′-GCTGGTGGCTATTTTGTCCTTGGGC-3′ p21 promoter (reverse primer): (SEQ ID NO: 7) 5′-AGAATCTGACTCCCAGCACACACTC-3′
  • the isolated p53 specific binding DNA was PCR amplified using primers which span the predicted p53 binding sites of the miR-192 promoter or the positive control p21 promoter transcriptionally regulated by p53 protein.
  • FIG. 9 shows the immunoprecipitation qPCR analysis of the predicted miR-192 promoter with conserved p53 binding sequence.
  • FIG. 9B shows that the p53 protein directly interacts with the miR-192 promoter based on ChIP-qPCR analysis with a 4-fold enriched signal of with p53 specific monoclonal antibody compared to the non-specific antibody control DNA. This data establishes the existence of a conserved p53 binding site at the promoter region of miR-192.
  • the binding sequence is 5′-cgccatgcctxxxggccttgccc-3′ (SEQ ID NO:25), with a 3-base-pair gap represented by “x”. This suggests that miR-192, like miR-34, is another miRNA that is involved in the p53 tumor suppressor network.
  • Luciferase reporter assay was used to determine the transcriptional activation of conserved p53-binding promoter of miR-192.
  • pGL3-Basic promoterless luciferase reporter plasmid (Promega) was used in this study.
  • Double-stranded DNA oligonucleotides of conserved p53-binding sequence of miR-192 was synthesized and annealed and cloned upstream of firefly luciferase in the pGL3-Basic plasmid (miR-192-pGL3).
  • the p53-binding site oligonucleotide (bold) contains MluI at the 5′-end and BglII sequence at the 3′-end (5′-ACGCGTCCCATGTCACCACCAGGGGTCGCCATGCCTCCTGGCCTTGCCCAGCAAG ATCT-3′) (SEQ ID NO:8).
  • Control vector and miR-192-pGL3 vector were transfected into both HCT-116 (wt-p53) and HCT-116 (null-p53) cells.
  • transfected HCT-116 (wt-p53) and HCT-116 (null-p53) cells were also treated with 5 ⁇ mol/L 5-fluorouracil for 24 hours.
  • the promoter activity of each construct was quantified by dual luciferase assay (Promega) 24 hours after transfection. Firefly luciferase temperature for 1 hour.
  • the primary antibodies used for the analysis included mouse anti-DHFR monoclonal antibody (mAb; 1:250) (BD Biosciences), mouse anti-p53 mAb (1:1,000; DO-1) (Santa Cruz Biotechnology), mouse antip21mAb (1:1,000; F-5) (Santa Cruz Biotechnology), and mouse anti-a-tubulin mAb (1:1,000; TU-02) (Santa Cruz Biotechnology). Horseradish peroxidase-conjugated antibodies against mouse or rabbit (1:1,000) (Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate.
  • the conserved p-53 binding site at the promoter region of miR-192 can activate luciferase expression only in HCT-116 (wt-p53) cells.
  • the activation was further enhanced by induced p53 expression in HCT (wt-p53) cells treated with 5-fluorouracil.
  • the induction of luciferase activity was completely absent from the HCT-116 (null-p53) cells. This evidences that miR-192, like miR-34, is another miRNA that is involved in the p53 tumor suppressor network.
  • p53 is one of the most frequent altered tumor suppressor gene in colorectal cancer.
  • the potential function of multiple miRNAs involved in p53 tumor suppressor network is to provide the p53 with greater flexibility in rapidly responding to different growth condition changes, by perhaps having unique miRNAs (e.g. miR-34, miR-192) mediate the regulation of the key mRNA targets.
  • miR-192 was one of the miRNAs with reduced expression in a large cohort of colon cancer patient samples, further supporting the potential impact and clinical relevance of miR-192 in colon cancer.
  • the decrease or loss of the suppressive function of miR-192 in colon cancer may be an important factor related to cell cycle control and chemosensitivity to anti-folate based therapy.
  • Example 1-8 establish that miR-192 is directly involved in the regulation of a key anticancer target DHFR.
  • the expression and function of the miR-192 is largely dependent on the presence of functional wild type p53.
  • miR-192 may be used as a novel therapeutic option for treating cancer via an effective delivery system either alone or in combination with anti-folate compounds.
  • miR-215 Inhibits Cell Proliferation of HCT-116(wt-p53) and U-2 OS Cells
  • HCT-116 (wt-p53), HCT-116 (null-p53), U-2 OS, and MG63 cells (2 ⁇ 10 5 ) were plated in six-well plates, and transfected with 100 nM of either miR-215, miR-192 precursors or non-specific control miRNA (Ambion) after 24 h by Oligofectamine (Invitrogen) according to the manufacturer's protocols.
  • siRNA specific to TS (Mishra, et al., “AmiR-24 microRNA binding site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance,” Prof. Nat'l. Acad. Sci.
  • siRNA specific to DHFR ON-TARGET plus SMARTpool L-008799-00-0010, human DHFR, NM — 000791
  • Oligofectamine Oligofectamine
  • RNA including miRNA was isolated from cell lines at 24 h after transfection, or from Stem cell lines or snap frozen tissues by using TRIzol reagent (Invitrogen) according to the manufacturer's instructions.
  • Real-time qRT-PCR confirmed the increased expression of miR-215 in the transfected cells.
  • cDNA synthesis was carried out with the High Capacity cDNA synthesis kit (Applied Biosystems) using 10 ng of total RNA as template.
  • the miRNA sequence-specific RT-PCR primers for miR-215 and endogenous control RNU6B were purchased from Ambion.
  • Real-time quantitative reverse transcription-PCR (qRT-PCR) analysis was carried out using Applied Biosystems 7500 Real-Time PCR System.
  • the PCR master mix containing TaqMan 2 ⁇ Universal PCR Master Mix (No Amperase UNG), 10 ⁇ TaqMan assay and RT products in 20 ⁇ l volume were processed as follows: 95° C. for 10 min, and then 95° C.
  • HCT-116 wt-p53
  • HCT-116 null-p53
  • U-2 OS MG63 cells
  • MG63 cells were plated in 96-well plates in triplicate at 1 ⁇ 10 3 cells/well after transfection with miR-215 precursor or non-specific control miRNA. Cells were cultured for 24, 48, 72, 96 h. The absorbance at 450 and 630 nm was measured after incubation with 10 ⁇ l of WST-1 for 2 h.
  • HCT-116 wt-p53
  • U-2 OS cells compared with the non-specific miRNA control
  • the reduction in HCT-116 (wt-p53) or U-2 OS cells were approximately 40% or 58% at day 5 respectively ( FIG. 10 ).
  • miR-215 Induces G2-Arrest in HCT-116 (Wt-p53) and U-2 OS Cells.
  • HCT-116 wt-p53
  • HCT-116 null-p53
  • U-2 OS MG63 cells
  • miR-215 precursor precursor and the non-specific control miRNA described as above.
  • cells were harvested and resuspended at 0.5-1 ⁇ 10 5 cells/ml in modified Krishan buffer containing 0.1% sodium citrate and 0.3% NP-40 and kept at 4° C.
  • cells were treated with 0.02 mg/ml RNase H and stained with 0.05 mg/ml propidium iodide (Sigma).
  • miR-215 transduced U-2 OS cells the proportion of cells in the G2-phase was higher and the proportion of cells in the S-phase was lower than that in control cells (18.50% vs 29.69%; 52.08% vs 41.24%; FIG. 11 ).
  • the G2/S ratio was increased in miR-215 transfected cells (0.35 vs 0.72; >2-fold).
  • the results showed that miR-215 causes increased accumulation of cells at G2-phase, whereas cells in S-phase decrease. Similar results were observed in transfected I-WT-116 (wt-p53) cells.
  • miR-215 Increases the Expression of Cell Cycle Control Genes p53 and p21.
  • p53 and p21 a downstream target of the p53 pathway of growth control, are reported to block cells at G2 checkpoint mainly through inhibiting activity of Cdc2, the cyclin-dependent kinase that normally drives cells into mitosis, which is the ultimate target of pathways that mediate rapid arrest in G2 in response to DNA damage.
  • miR-215 we transfected miR-215 precursor into HCT-116 (wt-p53) and U-2 OS cells, and evaluated the levels of cell cycle control genes p53 and p21 by western immunoblot analysis.
  • the cells were scraped and lysed in RIPA buffer (Sigma). Equal amounts of proteins were resolved by SDS-PAGE on 12% gels by the method of Laemmli, and transferred to polyvinylidene fluoride membranes (BIO-RAD Laboratories). The membranes were then blocked by 5% nonfat milk in TBS-T (Tris-buffered saline and 0.5% Tween-20) at room temperature for 1 h.
  • TBS-T Tris-buffered saline and 0.5% Tween-20
  • mice anti-TS mAb (1:400, Millipore
  • mouse anti-DHFR mAb (1:250, BD Bioscience)
  • mouse anti-p53 mAb (1:1000, DO-1
  • mouse anti-p21 mAb (1:1000, F-5)
  • mouse anti- ⁇ -tubulin mAb (1:1000, TU-02) purchased from Santa Cruz Biotechnology.
  • Horseradish peroxidase-conjugated antibodies against mouse (1:1000, Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate (BIO-RAD).
  • miR-215 led to a significant increase of the p53 and p21 protein in both HCT-116 (wt-p53) and U-2 OS cells. ( FIG. 12 ). The results indicated that miR-215 contributed to the inhibition of cell proliferation at least partially by the induction of G2-arrest in HCT-116(wt-p53) and U-2 OS cells through over-expression of G2-checkpoint genes p53 and p21.
  • DHFR and TS are the Direct Targets of miR-215
  • TS and DHFR were identified as putative targets of miR-215 ( FIG. 13 ).
  • proteins were extracted from miR-215-transfected cells and from control cells and changes in TS or DHFR protein levels were determined by western immunoblot analysis ( FIG. 14 ).
  • Oligofectamine alone and non-specific miRNA were used as the negative controls.
  • miR-192 which had been observed to down-regulate DHFR, was used as a positive control of DHFR down-regulation.
  • Over-expression of miR-192 and miR-215 was confirmed by real time qRT-PCR analysis using U6 RNA to normalize the expression.
  • TS or DHFR protein levels FIG. 14 , lane 3 and 4
  • Expression levels of TS or DHFR mRNA were analyzed using real time qRT-PCR analysis ( FIG. 15 ). The results indicated that there was no reduction in TS or DHFR mRNA expression by miR-215 (column 3) and miR-192 (column 4). Thus, the suppression of TS or DHFR expression was regulated at the translational level without the degradation of TS or DHFR mRNA.
  • plasmids were constructed containing the fragments of the 3′UTR of TS or DHFR in the downstream region of firefly luciferase.
  • the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion) was used to determine the targets of miR-215.
  • Double stranded DNA oligonucleotides containing the miR-215 binding sequence (wt-miR-215) or mismatch sequence (mut-miR-215) in 3′UTR of TS or DHFR mRNA and the HindIII and SpeI restriction site overhangs were synthesized (IDT, Coralville, Iowa) and annealed and cloned downstream of firefly luciferase in the pMIR-REPORT plasmid.
  • the sequences of these synthesized oligonucleotides are provided below.
  • the 3′UTR of TS includes two miR-215 binding sites: one is located at 84-104 bp, one is located at 216-236 bp.
  • HCT-116 wt-p53 cells alone (control) or together with miR-215 precursor. Twenty-four hours before transfection, HCT116 (wt-p53) and HCT 116 (null-p53) cells were plated in the 96-well plates at 1.5 ⁇ 10 4 cells each well in triplicate.
  • pMIR-REPORT constructs 100 ng) together with ing of Renilla luciferase plasmid phRL-SV40 (Promega, Madison, Wis.) were transfected by Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.) according to the protocols provided by the manufacturer.
  • luciferase activity was measured by the dual-luciferase reporter assay system (Promega, Madison, Wis.) according to the instructions. Firefly luciferase activity for each condition was normalized by dividing to Renilla internal control and then compared to pMIR-REPORT.
  • TS and DHFR are the major targets of cancer chemotherapy in the clinic.
  • TDX the third-generation TS inhibitor, is an active agent in the treatment of human colon and breast cancer.
  • Inhibitors of DHFR, such as MTX are widely used in the treatment of human leukemia, osteosarcoma and choriocarcinoma. Increased DHFR protein levels are reported to be associated with drug resistance, and low tumor expression levels of TS have also been linked with improved outcome for colon cancer patients treated with 5-FU chemotherapy.
  • Yamauchi et al observed that MTX has the highest activity at the time when DNA synthesis, DHFR activity, DHFR content, and DHFR mRNA content increased and the lowest activity at the time when they decreased.
  • miR-215 decreased the expression of TS and DHFR protein, we then test if miR-215 can change the sensitivity of TDX or MTX in the HCT-116 (wt-p53) or U-2 OS cells.
  • FIG. 17A shows that the IC 50 of TDX in HCT-116(wt-p53) cells transfected with miR-215 was 98.7 nM, whereas in the negative control was 18.6 nM, in the positive control was 8.5 nM.
  • FIG. 8B showed that 83.6% of transduced U-2 OS cells still alive at 200 nM of MTX.
  • the IC 50 of MTX in the negative control was 49.7 nM, whereas 37.3 nM in the positive control.
  • Cancer stem cells also named cancer initiating cells, exhibit low rate of division and proliferation in their niche that help them to avoid chemotherapy and radiation.
  • miR-215 expression influences the growth and chemosensitivity in cancer stem cells
  • miR-215 levels in colon cancer stem cells were measured using real-time qRT-PCR. Expression of miR-215 was determined to be greater than 2-fold higher in the colon cancer stem cells than in the controls ( FIG. 18 ).
  • miR-215 expression in 22 paired human colon cancer and counterpart normal tissues was analyzed by real-time qRT-PCR ( FIG. 19 ). Eighteen of 22 colon cancer samples (81.8%) showed decreased miR-215 level (P ⁇ 0.05).
  • miR-192 and miR-215 would be altered in a subject simultaneously according to the methods discussed above, or that the inhibitory molecule would comprise a combination of miR-192 and miR-215. When both are altered, it is expected that there would be greater than the effect observed with either miR-192 or miR-215, or would have a synergistic effect. For example, it is expected that if miR-192 and miR-215 are both inhibited in a subject, then the sensitivity to a chemotherapeutic agent would be increased, and that this increase would be greater than the increase in sensitivity observed with miR-192 or miR-215. It is further expected that if miR-192 and miR-215 are upregulated together, then the decrease in cell proliferation would be greater than observed with miR-192 or miR-215.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

MicroRNAs (miRNAs) are a class of non-coding small RNA molecules that regulate gene expression at the post-transcriptional level by interacting with 3′ untranslated regions (UTRs) of their target mRNAs. The invention relates to the application of miR-192 and miR-215. Both of these miRNAs impact cellular proliferation through the p53-miRNA circuit, and interact with dihydrofolate reductase (DHFR) and thymidylate synthase (TS). Particularly, upregulation of these miRNAs reduces cellular proliferation. The invention relates to this discovery. For example, inhibiting miR-192 and/or miR-215 sensitizes a neoplasm or a subject with a neoplasm to chemotherapeutic agents. Furthermore, measuring the levels of miR-192 and/or miR-215 provides one with information regarding whether the neoplasm or subject will respond to chemotherapeutic agents. Accordingly, the invention relates to composition and methods relating to the identification, characterization and modulation of the expression of miR-192 and miR-215.

Description

    CROSS REFERENCE TO RELATED APPLICATIONS
  • This application is a divisional application of U.S. application Ser. No. 12/996,249 which was filed Mar. 15, 2011, which is the United States national phase of International Application No. PCT/US2009/046353 filed Jun. 5, 2009, which claims the benefit of U.S. Provisional Application No. 61/122,377 which was filed on Dec. 13, 2008 and U.S. Provisional Application No. 61/059,197 which was filed Jun. 5, 2008. The disclosure of each of these documents is hereby incorporated in its entirety by reference.
  • STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
  • The invention was made using U.S. Government funds, and therefore the U.S. Government has rights in the invention.
  • FIELD OF THE INVENTION
  • The present invention relates to compositions and methods relating to the identification and characterization of genes and biological pathways related to these genes as represented by the expression of the identified genes, as well as use of microRNAs (miRNAs) related to such, for therapeutic, prognostic, and diagnostic applications, particularly those methods and compositions related to assessing and/or identifying pathological conditions directly or indirectly related to miR-192 or miR-215.
  • BACKGROUND OF THE INVENTION
  • Dihydrofolate reductase (DHFR) and Thymidylate Synthase (TS) are two key enzymes for DNA synthesis and represent some of the most important targets for cancer chemotherapy. DHFR catalyzes the reduction of folate and 7, 8 dihydrofolate to 5, 6, 7, 8 tetrahydrofolate, the latter as the one-carbon donor is essential for the formation of thymidylate (dTMP) which is the precursor for DNA synthesis (see Banerjee et al., “Novel aspects of resistance to drugs targeted to dihydrofolate reductase and thymidylate synthase, Biochim. Biophys. Acta. (2002) 1587: 164-173). TS catalyzes the reductive methylation of dUMP by CH2H4folate to produce dTMP and H2folate (see Carreras et al., “The catalytic mechanism and structure of thymidylate synthase,” Annu. Rev. Biochem. (1995) 64: 721-762). DHFR inhibitors, such as methotrexate (MTX), and TS inhibitors, such as 5-fluorouracil (5-FU) and Tomudex or Ralitrexed (TDX, ZD1694), are widely used chemotherapeutic drugs for the treatment of osteosarcoma and colon cancer (see Widemann et al., “Understanding and managing methotrexate nephrotoxicity,” Oncologist. (2006) 11: 694-703; see also Calvert, “An overview of folate metabolism: features relevant to the action and toxicities of antifolate anticancer agents,” Semin. Oncol. (1999) 26: 3-10).
  • As such, TS and DHFR are the major targets of cancer chemotherapy in the clinic today. TDX, the third-generation TS inhibitor, is an active agent in the treatment of human colon and breast cancer (see Drake et al., “Resistance to tomudex (ZD1694): multifactorial in human breast and colon carcinoma cell lines,” Biochem. Pharmacol. (1996) 51: 1349-1355). The inhibitor of DHFR, such as MTX, is widely used in the treatment of human leukemia, osteosarcoma and choriocarcinoma. Increased DHFR protein levels are reported to be associated with drug resistance (see Banerjee et al., “Novel aspects of resistance to drugs targeted to dihydrofolate reductase and thymidylate synthase,” Biochem. Biophys. Acta. (2002) 1587: 164-173), and low tumor expression levels of TS have also been linked with improved outcome for colon cancer patients treated with 5-FU chemotherapy (see Soong et al., “Prognostic significance of thymidylate synthase, dihydropyrimidine dehydrogenase and thymidine phosphorylase protein expression in colorectal cancer patients treated with or without 5-fluorouracil-based chemotherapy,” Ann. Oncol. (2008) 19: 915-919). However, MTX has the highest activity at the time when DNA synthesis, DHFR activity, DHFR content, and DHFR mRNA content increased and the lowest activity at the time when they decreased (see Yamauchi et al., “Ohdo S. Cell-cycle-dependent pharmacology of methotrexate in HL-60,” J. Pharmacol. Sci. (2005) 99: 335-341).
  • Thus, there exists a need for better prognostic and diagnostic measures, treatment and control of neoplasm through application of small molecules to target cells to affect various cellular components, such as TS and DHFR involved in cellular proliferation of neoplasia.
  • SUMMARY OF THE INVENTION
  • The invention provides an isolated inhibitory nucleic acid molecule that is complementary to at least a portion of miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9). The inhibitory nucleic acid molecule decreases the expression of the at least a portion of miR-192 or miR-215 in a cell. In an embodiment, the nucleic acid molecule is an antisense nucleic acid molecule. The antisense nucleic acid molecule has at least an 85% sequence identity to the portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9). In another embodiment, the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3 and 10. In this embodiment, the inhibiting nucleic acid molecule has at least 85% sequence identity to the sequence. In another embodiment, the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3 or 9-10. In another embodiment, an expression vector comprises the inhibitory nucleic acid molecule. The inhibitory nucleic acid molecule may be operably linked to a promoter suitable for expression in a mammalian cell. The vector may be a viral vector. In another embodiment, a cell comprises the vector.
  • The invention further provides an isolated inhibitory nucleic acid molecule that corresponds to at least a portion of miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9). The inhibitory nucleic acid molecule decreases the expression of the miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9) in a cell. In one embodiment, the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3 and 10. In another embodiment, the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3 or 9-10. In another embodiment, the inhibiting nucleic acid molecule has at least 85% sequence identity to the portion of SEQ ID NOs:1 or 9, or at least 85% sequence identity to SEQ ID NOs:2, 3 or 10. The nucleic acid molecule is also an shRNA or an siRNA. In an embodiment, the nucleic acid molecule comprises at least one modification. The modification may be a non-natural internucleotide linkage, a backbone modification, or a substituted sugar moiety. In another embodiment, an expression vector comprises the inhibitory nucleic acid molecule. The inhibitory nucleic acid molecule may be operably linked to a promoter suitable for expression in a mammalian cell. The vector may be a viral vector. In another embodiment, a cell comprises the vector.
  • The invention further provides an isolated inhibitory nucleic acid molecule that corresponds to a portion of a miR-192 promoter that binds to a p53 binding sequence (SEQ ID NO: 25). The inhibitory nucleic acid molecule comprises or consists essentially of a sequence or a complementary sequence of SEQ ID NO:25, a fragment thereof, or a variant thereof. In this embodiment, the inhibitory nucleic acid molecule has at least 85% sequence identity to SEQ ID NO: 25 or a fragment thereof.
  • Methods for delivery of the inhibitory nucleic acid molecules include, but are not limited to, using a delivery system such as viral vectors, liposomes, polymers, microspheres, gene therapy vectors, naked DNA vectors, carbon nanotubes and chemical linkers. One of ordinary skill in the art would recognize other methods of delivering the inhibitory nucleic acid molecules into the cell or subject.
  • The invention further provides a method of modulating expression of a component of a cell, comprising contacting the cell with a nucleic acid comprising a portion of a sequence or a complementary sequence selected from an miR-192 sequence (SEQ ID NO:1), an miR-215 nucleic acid sequence (SEQ ID NO:9), miR-192 promoter binding site for p53 (SEQ ID NO:25), an antisense miR-192 sequence, an antisense miR-215 sequence and an antisense to the miR-192 promoter binding site for p53 in an amount sufficient to modulate the cellular component. In an embodiment, the nucleic acid is an antisense nucleic acid. The nucleic acid may be an siRNA or an shRNA. In an embodiment, the cellular component is miR-192 or miR-215. In another embodiment, the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3, 10, antisense SEQ ID NO: 2 and antisense SEQ ID NO: 3 and an antisense SEQ ID NO: 10. In another embodiment, the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10, 25 or antisense sequences thereof. In another embodiment, the cellular component is p21 or p53. In another embodiment, the cellular component is regulated by p53. In another embodiment, the cellular component is DHFR or TS.
  • The invention further provides a method of modulating proliferation of a cell, comprising contacting the cell with a nucleic acid having a sequence or a complementary sequence to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), a p53 region that binds to a miR-192 promoter or the miR-192 promoter that binds to p53 (SEQ ID NO:25) in an amount effective to modulate proliferation of the cell. In another embodiment, the nucleic acid is an antisense nucleic acid. In another embodiment, the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3, 10 and 25. In another embodiment, the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10 or 25 or an antisense sequence thereof. In another embodiment, the nucleic acid is an siRNA or an siRNA. In another embodiment, the cell is a cancer stem cell. In another embodiment, the cell is a neoplastic cell. In another embodiment, the method of modulating proliferation of a cell is a method of increasing the proliferation of a cell.
  • The invention further provides a method of increasing the sensitivity of a cell to a chemotherapeutic agent, comprising contacting the cell with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9) an miR-192 promoter binding site for p53 (SEQ ID NO:25) or a p53 region that binds to the miRNA-192 promoter, in an amount effective to sensitize the cell to the chemotherapeutic agent. Examples of chemotherapeutic agents include, but are not limited to, methotrexate, fluorouracil (5-FU), nolatrexed, ZD9331, GS7904L and ralitrexed. In another embodiment, the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3, 10 and 25. In another embodiment, the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10, and 25. In embodiments, the nucleic acid is an antisense nucleic acid. In another embodiment, the nucleic acid is an siRNA or an shRNA. In another embodiment, the cell is a cancer stem cell. In another embodiment, the cell is a neoplastic cell.
  • The invention further provides a method of increasing the sensitivity of a cell to radiation, comprising contacting the cell with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9) an miR-192 promoter binding site for p53 (SEQ ID NO:25) or a p53 region that binds to the miRNA-192 promoter, in an amount effective to sensitize the cell to radiation. In embodiments, the nucleic acid is an antisense nucleic acid. In another embodiment, the nucleic acid is an siRNA or an shRNA. In another embodiment, the portion has a sequence selected from the group consisting of SEQ ID NOs:2, 3 and 10. In another embodiment, the nucleic acid molecule has a sequence consisting essentially of SEQ ID NOs:1-3, 9-10, and 25. In another embodiment, the cell is a cancer stem cell. In another embodiment, the cell is a neoplastic cell.
  • The invention further provides a method of treating a neoplasm in a subject, comprising administering to the subject an effective amount of a nucleic acid molecule that inhibits expression of miR-192 or miR-215, and a second therapy, wherein inhibition of expression of miR-192 or miR-215 sensitizes the neoplasm to the second therapy. In another embodiment, the second therapy comprises administering a chemotherapeutic agent. In one embodiment, the chemotherapeutic agent is selected from the group consisting of a DHFA inhibitor and examples of chemotherapeutic agents include, but are not limited to, methotrexate, fluorouracil (5-FU), nolatrexed, ZD9331, GS7904L and ralitrexed. In another embodiment, the second therapy comprises administering radiation to the subject. The neoplasm may be cancer. The cancer may be selected from the group consisting of colon cancer, pancreatic cancer, lung cancer, breast cancer, cervical cancer, gastric cancer, kidney cancer, leukemia, liver cancer, lymphoma, ovarian cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, testicular cancer, and uterine cancer.
  • The invention further provides a method of diagnosing a neoplasm in a subject comprising determining the level of expression of miR-192 or miR-215. In one embodiment, the method of diagnosing the neoplasm in the subject comprises determining the level of expression of miR-192 and miR-215.
  • The invention further provides a method of identifying a neoplasm resistant to chemotherapy comprising determining the level of expression in the neoplasm of miR-192 or miR-215, and identifying the neoplasm as resistant to therapy if the level of the miR-215 is elevated or the level of miR-192 is reduced as compared to a control. In one embodiment the method of identifying the neoplasm resistant to chemotherapy comprises determining the levels of miR-192 and miR-215, and identifying the neoplasm as resistant to therapy if the levels of miR-192 and miR-215 are elevated.
  • The invention further provides a method of determining whether a neoplasm is a candidate for treatment with a chemotherapeutic agent comprising evaluating the level of expression of an miRNA, wherein the miRNA is miR-192 or miR-215, and rejecting the candidate if the expression of the miRNA is elevated; or accepting the candidate if the expression of the miRNA is reduced. In one embodiment, the miRNA is miR-192 and miR-215. In another embodiment, the rejected candidate would be a candidate for the methods of increasing sensitivity or treating a neoplasm discussed herein.
  • The invention further provides a kit for analysis of a pathological sample. The kit comprising in a suitable container an miRNA hybridization reagent for determining the level of miR-192 or miR-215. In an embodiment, the mRNA hybridization reagent comprises a hybridization probe. In another embodiment, the mRNA hybridization reagent comprises amplification primers. In another embodiment, the hybridization probe or amplification primers complementary to a sequence selected from the group consisting of SEQ ID NOs:1, 2, 3, 9, 10 and fragments thereof. The pathological sample can be any sample commonly taken from a subject, such as, for example, blood, urine, tissue, or other bodily fluid.
  • The invention further provides a method of identifying an agent that inhibits expression of an miRNA selected from the group consisting of miR-192 and miR-215, which comprises contacting a cell that expresses the miRNA with an agent, and comparing the expression level of the miRNA in the cell contacted by the agent with the expression level of the miRNA in the absence of the agent, wherein the agent is an inhibitor of the miRNA if expression of the miRNA is reduced. In an embodiment, the test cell overexpresses the miRNA.
  • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1 depicts a predicted secondary structure of the interaction between miR-192 and the 3′-UTR region of DHFR mRNA.
  • FIG. 2A is a graph illustrating the expression of miR-192 in HCT-116 (wt-p53) cells transfected with miR-192.
  • FIG. 2B is a graph illustrating the expression of miR-24 in HCT-116 (wt-p53) cells transfected with miR-24.
  • FIG. 2C depicts an image from a Western immunoblot showing the expression of DHFRT protein in HCT-116 (wt-p53) cells transfected with DHFR specific siRNA, miR-192 or miR-24.
  • FIG. 2D is a graph illustrating the expression of DHFR mRNA in HCT-116 (wt-p53) cells transfected with DHFR specific siRNA, miR-192 or miR-24.
  • FIG. 3 is a graph illustrating the impact of miR-192 on cell proliferation with MTX treatment in HCT-116 (wt-p53) cells transfected with DHFR specific siRNA or miR-192.
  • FIGS. 4A-D is a graph illustrating the impact of miR-192 on cell proliferation in HCT-116 (wt-p53) cells (FIG. 4A), RKO cells (FIG. 4B), HCT-116 (null-p53) cells (FIG. 4C) and HT-29 (FIG. 4D) cells transfected with non-specific miR or miR-192.
  • FIGS. 5 A-D are graphs illustrating impact of miR-192 on cell proliferation in HCT-116 (wt-p53) (FIG. 5 A-B) and HCT-116 (null-p53) (FIG. 5 C-D) cells transfected with non-specific miR or miR-192.
  • FIGS. 6A-B are images from a Western immunoblot of p53, p21 and Bax expression in HCT-116 (wt-p53) cells transfected with non-specific miR, DHFR siRNA or miR-192.
  • FIG. 7 is an image from a Western immunoblot for E2F3 and Rb expression in HCT-116 (wt-p53) cells transfected with non-specific miR, DHFR siRNA or miR-192.
  • FIG. 8A is an image from a Western immunoblot for p53 expression in HCT-116 (wt-p53) cells, RKO (wt-p53) cells, HCT-116 (null-p53) cells and HT-29 cells after treatment with MTX.
  • FIG. 8B is a graph depicting the expression of endogenous mature miR-192 in HCT-116 (wt-p53) cells, RKO (wt-p53) cells, HCT-116 (null-p53) cells and HT-29 cells after treatment with MTX.
  • FIG. 9A is a diagram of miR-192 p53 binding site relative to miR-192 on chromosome 11.
  • FIG. 9B is a graph illustrating the immunoprecipitation qPCR analysis using chromosome DNA isolated with non-specific a-tubulin, p53 monoclonal antibody for the conserved p53 binding site located on the miR-192 or p21 promoter.
  • FIG. 10 shows inhibition of cell proliferation in either HCT-116 (wt-p53) (Panel A) or U-2 OS (Panel B) cells transfected with miR-215 precursors, i.e., a longer piece of miRNA (72 bps) with hairpin stem loop structure that is further processed by DICER to mature miRNA, compared with a non-specific miRNA control. The reduction in OD for cultures of HCT-116 (wt-p53) or U-2 OS cells were approximately 40% or 58% at day 5 respectively.
  • FIG. 11 depicts proportions of cultured U-2 OS or MG63 cells, and U-2 OS or MG63 cells transfected with miR-192 or miR-215 at various stages of the cell cycle.
  • FIG. 12 depicts the levels of cell cycle control gene products p53 and p21 determined by Western immunoblot analysis.
  • FIG. 13 provides alignments of miR-215 with regions of DHFR and TS.
  • FIG. 14 depicts an analysis of levels of DHFR (Panel A) or TS (Panel B) protein in cells transfected with miR-215.
  • FIG. 15 depicts the levels of DHFR or TS mRNA in U-2 OS cells transfected with miR-215.
  • FIG. 16 depicts the level of luciferase reporter activity from a construct containing the 3′ UTR binding sequence for miR-215 (or a mutated binding sequence) in response to transfection with miR-215.
  • FIG. 17 shows that the effect of miR-192 (Panel A) or miR-215 (Panel B) on proliferation of HCT-116 (wt-p53) cells treated with methotrexate.
  • FIG. 18 depicts miR-192 and miR-215 expression in CD133+ HCT-116 (wt-p53) cells as compared to CD133 cells.
  • FIG. 19 depicts miR-215 expression in paired human colon cancer and counterpart normal tissues.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The inventors have discovered that miR-192 and miR-215, individually, decrease the expression of TS and DHFR protein, and further found that miR-192 and miR-215, individually, change the sensitivity of cancerous cells such as, for example, HCT-116 (wt-p53) or U-2 OS cells to TDX or MTX. The inventors have found that down-regulation of TS or DHFR protein by a siRNA specific against TS or DHFR increases the sensitivity of TDX or MTX in the colon cancer or osteosarcoma cell lines, whereas even though miR-192 and miR-215 also down-regulated the expression levels of TS or DHFR, they did not increase the chemosensitivity of TDX or MTX compared to a non-specific miRNA control. TDX or MTX are considered to be more effective on the cells in the S-phase. As illustrated in FIGS. 5 and 11, siRNAs specific against TS or DHFR do not decrease the cells in the S-phase, whereas the cells in the S-phase were reduced in the miR-192 transfected cells and miR-215 transfected cells. Thus, down-regulating miR-192 or miR-215 increases the sensitivity of a cell or a subject to chemotherapy.
  • The inventors have found that colon cancer stem cells depend on, at least in part, elevated miR-192 or miR-215 to have a reduced cell proliferation phenotype. The advantage of tumor stem cells using miR-192 or miR-215 to achieve this is that translational control by miR-192 or miR-215 is an acute response, readily reversible without permanently degrading its target mRNAs such as TS and DHFR or trigger apoptosis. This also suggests why half of the colon cancer cases containing wild type p53 are still resistant to chemotherapeutic treatment. This mechanism also provides a novel approach to selectively killing colon cancer stem cells by inhibiting miR-192 or miR-215 and subsequently eliminating them with chemotherapeutic agents. Furthermore, this mechanism also provides a novel approach for identifying a candidate who will respond to chemotherapeutic treatment by inhibiting miR-192 and/or miR-215.
  • In certain aspects, the invention is directed to methods for the assessment, analysis, and/or therapy of a cell or subject where certain genes have a reduced or increased expression (relative to normal) as a result of an increased or decreased expression of miR-192 or miR-215. The expression profile and/or response to miR-192 or miR-215 expression or inhibition may be indicative of a disease or an individual with a pathological condition such as, for example, cancer.
  • According to a first embodiment, the miR-192 or miR-215 inhibitors may include antisense nucleic acids or molecules. Antisense nucleic acids are effective in inhibiting human miRNAs. Antisense nucleic acids include non-enzymatic nucleic acid compounds that bind to a target nucleic acid by, for example, RNA-RNA, RNA-DNA or RNA-PNA interactions and effect the target nucleic acid. Generally, these molecules are complementary to a target sequence along a single contiguous sequence of the antisense nucleic acid. In this embodiment, the antisense nucleic acid reduces expression of miR-192 or miR-215.
  • In another embodiment, the inhibitors include fragments of the nucleic acid molecules that bind to miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9), bind to an miR-192 promoter binding sequence for p53 (SEQ ID NO:25), or bind to the p53 sequence that is complementary to the miR-192 promoter. A suitable fragment can be at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides in length. Non-limiting examples of suitable fragments include nucleic acids having sequences complementary to SEQ ID NOs:2, 3, 9 or fragments thereof. One of ordinary skill in the art recognizes that nucleic acids complimentary to other portions of SEQ ID NO:1 or SEQ ID NO:9 would be equally effective.
  • In another embodiment, antisense nucleic acids may also bind to a substrate nucleic acid and form a loop. In this embodiment, the antisense nucleic acids may be complementary to two or more non-contiguous substrate sequences and/or two or more non-contiguous sequence portions of an antisense nucleic acid may be complementary to a target sequence.
  • In another embodiment, antisense nucleic acids may be complementary to a guide strand of an miRNA positioned in the RNA silencing complex. In another embodiment, antisense nucleic acids may be used to target a nucleic acid by means of DNA-RNA interactions. In this embodiment, RNase H is activated to digest the target nucleic acid as would be understood by one of ordinary skill in the art. For example, the antisense nucleic acids may comprise one or more RNase H activating region capable of activating RNase H to cleave a target nucleic acid. The RNase H activating region may comprise any suitable backbone. For example, in this embodiment, the RNase H activating region may comprise a phosphodiester, phosphorothioate, phosphorodithioate, 5′-thiophosphate, phosphoramidate and/or methylphosphonate.
  • In another embodiment, the nucleic acid molecule may comprise one or more modifications. Antisense nucleic acids according to the embodiments may comprise natural-type oligonucleotides and modified oligonucleotides. For example, in this embodiment, the antisense nucleic acid may comprise phosphorothioate-type oligodeoxyribonucleotides, phosphorodithioate-type oligodeoxyribonucleotides, methylphosphonate-type oligodeoxyribonucleotides, phosphoramidate-type oligodeoxyribonucleotides, H-phosphonate-type oligodeoxyribonucleotides, triester-type oligodeoxyribonucleotides, alpha-anomer-type oligodeoxyribonucleotides, peptide nucleic acids, locked nucleic acids, and nucleic acid-modified compounds. It will be readily apparent to one of ordinary skill in the art that other oligonucleotides are within the scope and spirit of this invention.
  • In another embodiment, the modification may comprise internucleoside linkages. For example, an inhibitory nucleic acid may be based on T-modified oligonucleotides containing oligodeoxynucleotide gaps with internucleotide linkages modified to phosphorothioates for nuclease resistance. The presence of methylphosphonate modifications increases the affinity of the oligonucleotide for its target RNA and thus increases its effectiveness in inhibiting the target RNA. This modification also increases the nuclease resistance of the modified oligonucleotide.
  • In another embodiment, the modification may comprise a backbone modification. For example, oligomers having modified backbones may include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For example, nucleobase oligomers that have modified oligonucleotide backbones include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates, phosphinates, phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. Other forms, including, but not limited to, salts, mixed salts and free acid forms, are also contemplated.
  • Nucleobase oligomers having modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include, but are not limited to, those having morpholino linkages, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, and/or amide backbones.
  • In another embodiment, the modification may also comprise one or more substituted sugar moieties. For example, the RNase H activating region may comprise deoxyribose, arabino and/or fluoroarabino nucleotide sugar chemistry. Such modifications may also include 2′-O-methyl and 2′-methoxyethoxy modifications, 2′-dimethylaminooxyethoxy, 2′-aminopropoxy and 2′-fluoro, and modifications at other positions on the oligonucleotide or other nucleobase oligomer, particularly the 3′ position of the sugar on the 3′ terminal nucleotide. Nucleobase oligomers may also have sugar mimetics. In another embodiment, both the sugar and the internucleoside linkage may be replaced with novel groups. The nucleobase units are maintained for hybridization with at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25).
  • Those skilled in the art will recognize that the foregoing are non-limiting examples and that any combination of phosphate, sugar and base chemistry of a nucleic acid that supports the activity of RNase H enzyme is within the scope of the present invention.
  • According to another embodiment, the invention relates to the use of interference RNA (RNAi) to alter the expression of miR-192 or miR-215. In one embodiment, the expression is altered by reducing the expression of miR-192 or miR-215. In another embodiment, the expression of miR-192 and miR-215 is altered. In another embodiment, the expression is altered by reducing the expression of miR-192 and miR-215. RNAi comprises double stranded RNA that can specifically block expression of a target gene. Double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner. RNAi provides a useful method of inhibiting gene expression in vitro or in vivo. RNAi can comprise either long stretches of dsRNA identical or substantially identical to the target nucleic acid sequence or short stretches of dsRNA identical to or substantially identical to only a region of the target nucleic acid sequence.
  • In embodiments RNAi includes, but are not limited to, small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), and other RNA species, such as non-enzymatic nucleic acids, which can be cleaved in vivo to form siRNAs. In this embodiment, RNAi may also include RNAi expression vectors capable of giving rise to transcripts which form dsRNAs or shRNAs in cells, and/or transcripts which can produce siRNAs in vivo.
  • The RNAi may comprise a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the RNA transcript for the target gene. These RNAi have the advantage of being able to tolerate variations in sequence that may arise from, for example, genetic mutation, strain polymorphism or evolutionary divergence. The number of tolerated nucleotide mismatches between the target sequence and the RNAi sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 3′ end of the siRNA strand that is complementary to the target RNA do not significantly contribute to specificity of the target recognition. In this embodiment, the antisense nucleic acid molecule has at least 85% sequence identity to SEQ ID NOs:1-3, 9 or 10.
  • Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art and calculating the percent difference between the nucleotide sequences. In this embodiment, the preferred sequence identity between the inhibitory RNA and the portion of the target gene is greater than 90%, 95%, 96%, 97%, 98%, 99% or 100%. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing under specified conditions with a portion of the target gene transcript.
  • The double-stranded structure may be formed by a single self-complementary RNA strand or two complementary RNA strands. RNA duplex formation may be initiated either inside or outside the cell. The RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition.
  • In this embodiment, the siRNAs are around 19-30 nucleotides long, and even more preferably 21-23 nucleotides. The siRNAs effectively recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target mRNA is degraded by the nucleases in the protein complex. In embodiments, the 21-23 nucleotides siRNA molecules comprise a 3′ hydroxyl group. In certain embodiments, the siRNA can be generated by the processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer. The siRNA molecules can be purified using a number of techniques known to those of skill in the art such as, for example, gel electrophoresis, non-denaturing column chromatography, chromatography, glycerol gradient centrifugation, and/or affinity purification with an antibody.
  • In this embodiment, the shRNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such shRNAs for gene silencing in mammalian cells are known in the art. Preferably, such shRNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is recognized in the art that siRNAs can be produced by processing a shRNA in the cell.
  • In another embodiment, the invention relates to the use of suitable ribozyme molecules, such as, for example, RNA endoribonucleases and hammerhead ribozymes, designed to catalytically cleave mRNA transcripts to prevent translation of mRNA. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA, which have a base sequence of 5′-UG-3′.
  • According to another embodiment, polynucleotide or expression vector therapy for treating neoplasia featuring a polynucleotide encoding an inhibitory nucleic acid molecule or analog thereof that targets miR-192 or miR-215 is provided. In this embodiment, the antisense nucleic acid may cause inhibition of expression by hybridizing with miR-192 or miR-215 and/or genomic sequences encoding miR-192 or miR-215. Expression vectors encoding inhibitory nucleic acid molecules can be delivered to cells of a subject having a neoplasia in a form in which they can be taken up and expressed so that therapeutically effective levels may be achieved. The expression vector produces an oligonucleotide which is complementary to at least a unique portion of miR-192 or miR-215. Methods for delivery of the polynucleotides to the cell according to the invention include, but are not limited to, using a delivery system such as viral vectors, liposomes, polymers, microspheres, gene therapy vectors, naked DNA vectors, carbon nanotubes and chemical linkers. One of ordinary skill in the art would recognize other methods of delivering polynucleotides into the cell or subject. Nucleic acid probes may also be modified so that they are resistant to endogenous nucleases such as, for example, exonucleases and/or endonucleases, and are therefore stable in vivo.
  • Inhibitory nucleic acid molecule expression for use in polynucleotide therapy methods can be directed from any suitable promoter and regulated by any appropriate mammalian regulatory element. Promoters may include, but are not limited to, the human cytomegalovirus, simian virus 40, and/or metallothionein promoters. In this embodiment, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers.
  • Transducing viral vectors such as, for example, retroviral, adenoviral, lentiviral and adeno-associated viral vectors, can be used as expression vectors for somatic cell gene therapy. Viral vectors are especially useful because of their high efficiency of infection, and stable integration and expression. In this embodiment, for example, a polynucleotide encoding an inhibitory nucleic acid molecule can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a target cell type of interest. Other viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus.
  • In another embodiment, the invention comprises an inhibitory nucleic acid molecule that corresponds to a portion of a miR-192 promoter binding sequence for p53 (SEQ ID NO:25). The inhibitory nucleic acid molecule comprises or consists essentially of a sequence or a complementary sequence of SEQ ID NO:25, a fragment thereof or a variation thereof. The inventors have discovered that SEQ ID NO:25 is a portion of the miR-192 promoter (SEQ ID NO:8) that binds to p53. Accordingly, the expression of miR-192 can be altered by administering an inhibitory nucleic acid molecule that comprises a sequence of SEQ ID NO:25, a fragment thereof, or a variation thereof. In this embodiment, the inhibitory nucleic acid molecule would bind to the p53 site at the miR-192 promoter binding site and thereby block the binding of p53 to the miR-192 promoter. The expression of miR-192 can also be altered by administering an inhibitory nucleic acid molecule that comprises a sequence complementary to SEQ ID NO:25, a fragment thereof, or a variation thereof. In this embodiment, the inhibitory nucleic acid molecule would bind to the miR-192 promoter thereby blocking p53 from binding to the miR-192 promoter region and block transcription of miR-192.
  • The inhibitory nucleic acid molecule can consist essentially of a sequence or a sequence complementary to SEQ ID NO:25, a fragment thereof, or a variation. In such embodiments, the inhibitory nucleic acid molecule may contain other components that are not involved in binding to the p53 binding sequence or the miR-192 promoter region. These components may include, but are not limited to, other nucleic acids, amino acids ligands, linkers, or other modification that will not effect the primary function of the inhibitory nucleic acid molecule in these embodiments, blocking the binding of p53 to the miR-192 promoter region and inhibiting the transcription of miR-192. For example, the inhibitor nucleic acid molecule may contain other nucleotides complementary to a position of the miR-192 promoter (SEQ ID NO:8) that it does not interact with the p53 binding sequence.
  • To effectively block the binding of p53 to the miR-192 promoter and the transcription of miR-192, the full sequence or complementary sequence of SEQ ID NOs:8 or 25 need not be utilized. A fragment of the sequence of complementary sequence would be adequate to block the binding of p53 to the miR-192 promoter and the transcription of miR-192. A suitable fragment can be at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides in length.
  • In Example 8 (see below), a three base pair gap between SEQ ID NO:25 and the p53 binding is discussed. Accordingly, 100% homology is not necessary. Instead, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% homology is sufficient to enable the inhibitory nucleic acid molecule to bind to the miR-192 promoter or the p53 binding site.
  • In another embodiment, a non-viral approach may be employed for the introduction of an inhibitory nucleic acid molecule therapeutic to a cell of a patient diagnosed as having a neoplasia. For example, an inhibitory nucleic acid molecule that targets a miRNA-215 can be introduced into a cell by administering the nucleic acid in the presence of lipofection, asialoorosomucoid-polylysine conjugation, or by micro-injection under surgical conditions. In this embodiment, the inhibitory nucleic acid molecules are administered in combination with a liposome and protamine. Gene transfer can also be achieved using non-viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell.
  • For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.
  • Methods of modulating expression of cellular components in an amount sufficient to modulate the cellular component are also provided. In embodiments, the cellular components may comprise miR-192 or miR-215, p21, p53, DHFR, TS or any cellular component regulated by these components. One of ordinary skill in the art would recognize that other cellular components may be modulated and are within the scope and spirit of this invention.
  • p53 and p21, a downstream target of the p53 pathway of growth control, are reported to block cells at G2 checkpoint mainly through inhibiting Cdc2 activity, the cyclin-dependent kinase that normally drives cells into mitosis, which is the ultimate target of pathways that mediate rapid arrest in G2 in response to DNA damage as reported in, for example, Taylor et al., “Regulation of the G2/M transition by p53”, Oncogene. (2001); 20: 1803-1815; Stark et al., “Control of the G2/M transition,” Mol. Biotechnol. (2006); 32: 227-248; and Bunz et al., “Requirement for p53 and p21 to sustain G2 arrest after DNA damage”, Science. (1998); 282: 1497-1501.
  • The inventors have discovered that miR-192 or miR-215 can induce G2-arrest in HCT-116 (wt-p53) and U-2 OS cells. Transfection of miR-192 or miR-215 precursor into HCT-116 (wt-p53) and U-2 OS cells to analyze the mechanism of cell proliferation inhibition by miR-192 or miR-215 indicate that over-expression of miR-192 or miR-215 led to a significant increase of the p53 and p21 protein in both HCT-116 (wt-p53) and U-2 OS cells. FIGS. 6 and 12 depicts an evaluation of the levels of cell cycle control genes p53 and p21 by Western immunoblot analysis. As illustrated in FIGS. 6 and 12, miR-192 or miR-215 contributes to the inhibition of cell proliferation at least partially by the induction of G2-arrest in HCT-116 (wt-p53) and U-2 OS cells, which was through over-expression of G2-checkpoint genes p53 and p21.
  • The inventors have discovered that miR-192 or miR-215 suppresses cell proliferation. Since most miRNAs have more than one target range from dozens to hundreds (see Wiemer, “The role of microRNAs in cancer: No small matter”, Eur. J. Cancer. (2007) 43:1529-1544), miR-192 or miR-215 most likely targets the enzymes for DNA biosynthesis, such as TS and DHFR, and also leads to the inhibition of cell proliferation in cancer cells. As illustrated in FIG. 13, the inventors used the Sanger database (microrna.sanger.ac.uk) to identify TS and DHFR as the putative targets of miR-192 and miR-215. As illustrated in FIGS. 2 and 14, at 48 h after transfection, the inventors extracted the proteins and searched for the changes in TS or DHFR protein levels by Western immunoblot analysis. Oligofectamine alone and non-specific miRNA were used as the negative controls. The DHFR expression is down-regulated by miR-192. Using miR-192 as a positive control of DHFR down-regulation, the over-expression of miR-215 and miR-192 was confirmed by real time qRT-PCR analysis using U6 RNA to normalize the expression (see FIG. 11). Introduction of miR-192 or miR-215 clearly decreases TS or DHFR protein levels (see FIG. 2 and FIG. 14, lanes 3 and 4). The inventors also analyzed the expression level of TS or DHFR mRNA using real time qRT-PCR analysis. As illustrated in FIG. 15, the inventors discovered that there was no reduction in TS or DHFR mRNA expression by miR-192 or miR-215 (column 3) and miR-192 (column 4). Thus, the suppression of TS or DHFR expression was regulated at the translational level without the degradation of TS or DHFR mRNA.
  • In another embodiment, a method of increasing proliferation of a cell is provided using the mechanisms of the various pathways disclosed herein. In this embodiment, the cell is contacted with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter. The amount of nucleic acid complementary to miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25) effective to increase proliferation of the cell is not particularly limited. In embodiments, the amount is in the range of more than about 20% for cell proliferation and more than about 2-fold of IC50. In embodiments, the nucleic acid may comprise an antisense nucleic acid, siRNA or shRNA. In embodiments, the cell may comprise a cancer stem cell or a neoplastic cell.
  • In another embodiment, a method of increasing the sensitivity of a cell to a chemotherapeutic agent is provided using the mechanisms of the various pathways disclosed herein. In this embodiment, the cell is contacted with a nucleic acid complementary to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25). The amount of nucleic acid complementary to miR-192, (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter effective to sensitize the cell to the chemotherapeutic agent is not particularly limited. In embodiments, the amount is in the range of more than about 20% for cell proliferation and more than about 2-fold of IC50. In an embodiment, the chemotherapeutic agent is selected from the group consisting of a DHFA inhibitor and a TS inhibitor. Examples of chemotherapeutic agent include, but are not limited to, methotrexate (MTX), fluorouracil (5-FU), nolatrexed, ZD9331, GS7904L and ralitrexed (TDX). One of ordinary skill would recognize other chemotherapeutic agents useful in this embodiment. In embodiments, the nucleic acid may comprise an antisense nucleic acid, siRNA or shRNA. In embodiments, the cell may comprise a cancer stem cell or a neoplastic cell.
  • In another embodiment, a method of increasing the sensitivity of a cell to radiation is provided using the mechanisms of the various pathways disclosed herein. In this embodiment, the cell is contacted with a nucleic acid complementary to at least a portion of miR-192, (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25). The amount of nucleic acid complementary to miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192 promoter effective to sensitize the cell to radiation is not particularly limited. In embodiments, the amount is in the range of more than about 20% for cell proliferation and more than about 2-fold of IC50. In embodiments, the nucleic acid may comprise an antisense nucleic acid, siRNA or shRNA. In embodiments, the cell may comprise a cancer stem cell or a neoplastic cell.
  • In still another embodiment, the compositions and methods of the present invention involve a first therapy an inhibitor of miR-192 or miR-215 or an expression construct encoding miR-192 or miR-215, used in combination with a second therapy to enhance the effect of the miR-192 or miR-215 therapy, or increase the therapeutic effect of the second therapy being employed to treat a neoplasm. These compositions would be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with the miR-192 or miR-215 and the second therapy at the same or different time. This may be achieved by contacting the cell with one or more compositions or pharmacological formulation that includes one or more of the agents, or by contacting the cell with two or more distinct compositions or formulations, wherein one composition provides (1) administering to the subject an effective amount of a nucleic acid molecule that inhibits expression of miR-192 or miR-215 and/or (2) a second therapy, in which the inhibition of expression of miR-192 or miR-215 sensitizes the neoplasm to the second therapy.
  • The second therapy may comprise administering chemotherapy, radiotherapy, surgical therapy, immunotherapy or gene therapy. In an embodiment, the chemotherapeutic agent is selected from the group consisting of a DHFR inhibitor and a TS inhibitor. The chemotherapeutic agents include, but are not limited to, DHFR inhibitors or TS inhibitors such as, for example, MTX, pemetrexed, 5-FU, raltitrexed (TDX), nolatrexed, ZD9331, and/or GS7904L. One of ordinary skill would recognize other chemotherapeutic agents useful in this embodiment. It is contemplated that the combination therapy may be provided in any suitable manner or under any suitable conditions readily apparent to one of ordinary skill in the art.
  • For example, administration of any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the vector or any protein or other agent. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy.
  • A wide variety of other chemotherapeutic agents may be used in accordance with the present invention. A “chemotherapeutic agent” is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.
  • In embodiments, the neoplasm being treated is a form of cancer. Cancers that may be evaluated by methods and compositions of the invention include any suitable cancer cells known to one of ordinary skill in the art. The inventors have found that the present invention is particularly useful in treating cancer cells from the colon or the pancreas, including pancreatic ductal adenocarcinoma. However, other suitable cells include cancer cells of the bladder, blood, bone, bone marrow, brain, breast, cervix, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, rectum, skin, stomach, testis, tongue, or uterus. Other conditions treatable by the compositions and methods of the present invention will be readily apparent to one of ordinary skill in the art.
  • An inhibitory nucleic acid molecule of the invention, or other negative regulator of miR-192 or miR-215 may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the compounds to patients suffering from a neoplasia. Administration may begin before the patient is symptomatic. Any appropriate route of administration may be employed, for example, administration may be parenteral, intravenous, intraarterial, subcutaneous, intratumoral, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intrahepatic, intracapsular, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, suppository, or oral administration. Therapeutic formulations and methods for making such formulations are well known in the art.
  • The formulations can be administered to human patients in therapeutically effective amounts to provide therapy for a neoplastic disease or condition. The preferred dosage of inhibitory nucleic acid of the invention is likely to depend on such variables as the type and extent of the disorder, the overall health status of the particular patient, the formulation of the compound excipients, and its route of administration.
  • Therapy may be provided at any suitable location and under any suitable conditions. The duration of the therapy depends on various factors readily understood by one of ordinary skill in the art. Drug administration may also be performed at any suitable interval. For example, therapy may be given in predetermined on-and-off intervals as appropriate.
  • Depending on the type of cancer and its stage of development, the therapy can be used to slow the spreading of the cancer, to slow the cancer's growth, to kill or arrest cancer cells, to relieve symptoms caused by the cancer, or to prevent cancer. As described herein, if desired, treatment with an inhibitory nucleic acid molecule of the invention may be combined with therapies such as, for example, radiotherapy, surgery, or chemotherapy for the treatment of proliferative disease.
  • In another embodiment, a method of diagnosing a neoplasm in a subject is provided. In this embodiment, the method comprises determining the level of expression of miR-192 or miR-215.
  • As described herein, the present invention has identified increases in the expression of miR-192 or miR-215, and corresponding decreases in the expression of TS and DHFR that are associated with cellular proliferation. Alterations in the expression level of one or more of the following other markers used to diagnose a neoplasia are also contemplated. If desired, alterations in the expression of any combination of these markers is used to diagnose or characterize a neoplasia as would be readily apparent to one of ordinary skill in the art.
  • In an embodiment, a subject is diagnosed as having or having a propensity to develop a neoplasia, the method comprising measuring markers in a biological sample from a patient, and detecting an alteration in the expression of test marker molecules relative to the sequence or expression of a reference molecule. While the following approaches describe diagnostic methods featuring a miR-192 or miR-215, the skilled artisan will appreciate that any one or more of the markers set forth above is useful in such diagnostic methods. Increased expression of a miR-192 or miR-215 is correlated with neoplasia. Accordingly, the invention provides compositions and methods for identifying a neoplasia in a subject. The present invention provides a number of diagnostic assays that are useful for the identification or characterization of a neoplasia. Alterations in gene expression are detected using methods known to the skilled artisan and described herein. Such information can be used to diagnose a neoplasia.
  • In an embodiment, diagnostic methods of the invention are used to assay the expression of miR-192 or miR-215 in a biological sample relative to a reference sample. In one embodiment, the level of miR-192 or miR-215 is detected using a nucleic acid probe that specifically binds at least a portion of miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9). Exemplary nucleic acid probes that specifically bind miR-192 or miR-215 are described herein. The biological sample can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • In an embodiment, quantitative PCR methods are used to identify an increase in the expression of miR-192 or miR-215. In another embodiment, PCR methods are used to identify an alteration in the sequence of miR-192 or miR-215. The invention provides probes that are capable of detecting miR-192 or miR-215. Such probes may be used to hybridize to a nucleic acid sequence derived from a patient having a neoplasia. The specificity of the probe determines whether the probe hybridizes to a naturally occurring sequence, allelic variants, or other related sequences. Hybridization techniques may be used to identify mutations indicative of a neoplasia or may be used to monitor expression levels of these genes.
  • In embodiments, a measurement of a nucleic acid molecule in a subject sample may be compared with a diagnostic amount present in a reference. Any significant increase or decrease in the level of test nucleic acid molecule or polypeptide in the subject sample relative to a reference may be used to diagnose a neoplasia. Test molecules include any one or more of markers disclosed herein. In an embodiment, the reference is the level of test polypeptide or nucleic acid molecule present in a control sample obtained from a patient that does not have a neoplasia. In another embodiment, the reference is a baseline level of test molecules present in a biologic sample derived from a patient prior to, during, or after treatment for a neoplasia. In yet another embodiment, the reference can be a standardized curve. The subject sample can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • In another embodiment, a method of identifying a neoplasm resistant to chemotherapy is provided. In this embodiment, the method comprises determining the level of expression in the neoplasm of miR-192 or miR-215, and identifying the neoplasm as resistant to therapy if the level of miR-192 or miR-215 is elevated, or identifying the neoplasm as not resistant to therapy if the level of miR-192 or miR-215 is reduced.
  • In another embodiment, a method of determining whether a neoplasm is a candidate for treatment with a chemotherapeutic agent is provided. In this embodiment, the method comprises evaluating the level of expression of miR-192 or miR-215 and rejecting the candidate if expression of the miR-192 or miR-215 is elevated, or accepting the candidate if the expression of miR-192 or miR-215 is reduced.
  • In another embodiment, a kit for analysis of a pathological sample is provided. Any of the compositions described herein may be comprised in the kit. In a non-limiting example, reagents for isolating miRNA, labeling miRNA, and/or evaluating a miRNA population using an array, nucleic acid amplification, and/or hybridization can be included in a kit, as well as reagents for preparation of samples from blood samples. The kit may further include reagents for creating or synthesizing miRNA probes. The kits may comprise, in suitable container means, an enzyme for labeling the miRNA by incorporating labeled nucleotides or unlabeled nucleotides that are subsequently labeled. In certain aspects, the kit can include amplification reagents. In other aspects, the kit may include various supports, such as glass, nylon, polymeric beads, and the like, and/or reagents for coupling any probes and/or target nucleic acids. It may also include one or more buffers, such as a reaction buffer, labeling buffer, washing buffer, or a hybridization buffer, compounds for preparing the miRNA probes, and components for isolating miRNA. Other kits of the invention may include components for making a nucleic acid array comprising miRNA, and thus, may include, for example, a solid support. The pathological sample can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • Kits for implementing methods of the invention described herein are specifically contemplated. In some embodiments, there are kits for preparing miRNA for multi-labeling and kits for preparing miRNA probes and/or miRNA arrays. In these embodiments, the kit may comprise, in suitable container means, any suitable solvents, buffers, reagents, or additives known to one of ordinary skill in the art including, but not limited to, those generally used for manipulating RNA, such as formamide, loading dye, ribonuclease inhibitors, and DNase.
  • In other embodiments, kits may include an array containing miRNA probes. Such arrays may include, for example, arrays relevant to a particular diagnostic, therapeutic, or prognostic application. For example, the array may contain one or more probes that is indicative of a disease or condition, susceptibility or resistance to a drug or treatment, susceptibility to toxicity from a drug or substance, prognosis, and/or genetic predisposition to a disease or condition.
  • For any kit embodiment, including an array, there can be nucleic acid molecules that contain or can be used to amplify a sequence that is a variant of, identical to or complementary to all or part of any SEQ ID described herein. In certain embodiments, a kit or array of the invention can contain one or more probes for the miRNAs identified by the SEQ IDs described herein. Any nucleic acid discussed above may be implemented as part of a kit.
  • The components of the kits may be packaged in any suitable manner known to one of ordinary skill in the art such as, for example, in aqueous media or in lyophilized form. The kits of the present invention may also include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained.
  • In this embodiment, the kits may also include components that facilitate isolation of the labeled miRNA. It may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.
  • A kit will also include instructions for employing the kit components as well as the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.
  • In another embodiment, a method of identifying an agent that inhibits the expression or activity of miR-192 or miR-215 is provided. In embodiments, the method comprises contacting a cell that expresses the miR-192 or miR-215 with an agent, and comparing the expression level of the miR-192 or miR-215 in the cell contacted by the agent with the expression level of the miR-192 or miR-215 in the absence of the agent. According to this embodiment, the agent is an inhibitor of the miR-192 or miR-215 if expression of the miR-192 or miR-215 is reduced. In this embodiment, the test cell may overexpress the miRNA.
  • Compounds that modulate the expression or activity of a miR-192 or miR-215 are useful in the methods of the invention for the treatment, prevention, diagnosis and prognostication of a neoplasm or subject. The method of the invention may measure a decrease in transcription of miR-192 or miR-215 or an alteration in the transcription or translation of the target of miR-192 or miR-215. Any number of methods are available for carrying out screening assays to identify such compounds. In an embodiment, the method comprises contacting a cell that expresses miR-192 or miR-215 with an agent and comparing the level of miR-192 or miR-215 expression in the cell contacted by the agent with the level of expression in a control cell, wherein an agent that decreases the expression of miR-192 or miR-215 thereby, in combination with a secondary therapy, inhibits a neoplasia. In another embodiment, candidate compounds are identified that specifically bind to and alter the activity of miR-192 or miR-215 of the invention. Methods of assaying such biological activities are known in the art. The efficacy of such a candidate compound is dependent upon its ability to interact with miR-192 or miR-215. Such an interaction can be readily assayed using any number of standard binding techniques and functional assays.
  • Potential agonists and antagonists of miR-192 or miR-215 include, but are not limited to, organic molecules, peptides, peptide mimetics, polypeptides, nucleic acid molecules, and antibodies that bind to a nucleic acid sequence of the invention and thereby inhibit or extinguish its activity. Potential antagonists also include small molecules that bind to miR-192 or miR-215 thereby preventing binding to cellular molecules with which the miR-192 or miR-215 normally interacts, such that the normal biological activity of miR-192 or miR-215 is reduced or inhibited. Small molecules of the invention preferably have a molecular weight below 2,000 daltons, more preferably between 300 and 1,000 daltons, and still more preferably between 400 and 700 daltons. It is preferred that these small molecules are organic molecules.
  • The invention also includes novel compounds identified by the above-described screening assays. These compounds are characterized in one or more appropriate animal models to determine the efficacy of the compound for the treatment of a neoplasia. Characterization in an animal model can also be used to determine the toxicity, side effects, or mechanism of action of treatment with such a compound. Furthermore, novel compounds identified in any of the above-described screening assays may be used for the treatment of a neoplasia in a subject. Such compounds are useful alone or in combination with other conventional therapies known in the art.
  • It is also contemplated that the invention can be used to evaluate differences between stages of disease, such as between hyperplasia, neoplasia, precancer and cancer, or between a primary tumor and a metastasized tumor. Moreover, it is contemplated that samples that have differences in the activity of certain pathways may also be compared. It is further contemplated that nucleic acids molecules of the invention can be employed in diagnostic and therapeutic methods with respect to any of the above pathways or factors. Thus, in some embodiments of the invention, a miRNA may be differentially expressed with respect to one or more of the above pathways or factors. The samples can be any sample commonly used within the art, such as, for example, blood, urine, tissue or other bodily fluid.
  • In certain embodiments, miRNA profiles may be generated to evaluate and correlate those profiles with pharmacokinetics. For example, miRNA profiles may be created and evaluated for patient tumor and blood samples prior to the patient's being treated or during treatment to determine if there are miRNAs whose expression correlates with the outcome of the patient. Identification of differential miRNAs can lead to a diagnostic assay involving them that can be used to evaluate tumor and/or blood samples to determine what drug regimen the patient should be provided. In addition, it can be used to identify or select patients suitable for a particular clinical trial. If a miRNA profile is determined to be correlated with drug efficacy or drug toxicity, that may be relevant to whether that patient is an appropriate patient for receiving the drug or for a particular dosage of the drug. One of ordinary skill in the art would recognize that other samples, such as urine, bodily fluid or tissue, can also be used.
  • In addition to the above prognostic assay, samples from patients with a variety of diseases can be evaluated to determine if different diseases can be identified based on blood miRNA levels. A diagnostic assay can be created based on the profiles that doctors can use to identify individuals with a disease or who are at risk to develop a disease. The samples may be any sample commonly taken from a patient, such as, for example, blood, urine or tissue. Alternatively, treatments can be designed based on miRNA profiling.
  • All references mentioned herein are incorporated in their entirety by reference into this application.
  • It is to be understood and expected that variations in the principles of the invention herein disclosed may be made by one skilled in the art and it is intended that such modifications are to be included within the scope of the present invention. The following examples only illustrate particular ways to use the novel technique of the invention, and should not be construed to limit the scope of the invention in any way.
  • Example 1 miR-192 Regulates the Expression of DHFR
  • There are several miRNAs that potentially interact with the 3′-UTR region of DHFR mRNA. Bioinformatic analysis of the secondary structure of the 3′-UTR of the DHFR mRNA and miRNA binding sites reduced the candidate miRNAs to a small number. From this analysis, miR-192 was identified as a candidate that may regulate DHFR.
  • FIG. 1 shows the secondary structure of the 3′-UTR of the DHFR mRNA and the target sequence that interacts with miR-192. To experimentally confirm the expression of DHFR was regulated by miR-192, a miR-192 precursor was transfected into HCT-116 (wt-p53) cells. A non-specific miR was used as a negative control. It has been reported that the expression of DHFR is regulated by miR-24. A DHFR siRNA and miR-24 were used as positive controls. Over-expression of miR-192 (FIG. 2A) and miR-24 (FIG. 2B) was confirmed by real time qRTPCR analysis using U6 RNA to normalize the expression.
  • The expression of DHFR protein was analyzed using Western immunoblot analysis and the results are shown in FIG. 2C. In this experiment, human colon cancer cell lines, HCT-116 (wt-p53), cells were transfected with miR-192 or miR-24. The cells were maintained in McCoy's 5A medium (Life Technologies). The media was supplemented with 10% dialyzed fetal bovine serum (Hyclone Laboratories). The cell line were grown at 37° C. in a humidified incubator with 5% CO2.
  • The HCT-116 (wt-p53) cells transfected as follows. The cells (2×105) were plated in 6-well plates and transfected with 100 nmol/L of either miR-192 or miR-24 precursors or nonspecific control miR (Ambion) after 24 h with Oligofectamine (Invitrogen) according to the manufacturer's instructions. Small interfering RNA (siRNA) specific to DHFR (On-Target plus SMARTpool L-008799-00-0010, human DHFR, NM000791) (Dharmacon) and transfected with Oligofectamine (Invitrogen) according to the manufacturer's protocols at a final concentration of 100 nmol/L. siRNA specific to DHFR was used as the positive control. miR-24, a miRNA that also targets DHFR (Mishra, et al., “A miR-24 microRNA binding site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance: Prof. Nat'l. Acad. Sci. (2007) 104:13513-13518) was also used as a positive control.
  • At 48 hours after transfection with miR-192 or miR-24 precursors or nonspecific control miRNA, the cells were scraped and lysed in radioimmunoprecipitation assay buffer (Sigma). Equal amount of proteins were resolved by SDS-PAGE on 12% gels by the method of Laemmli, “Cleavage of structured proteins during the assemble of the head of bacteriophase 74,” Nature (1970) 227:680-685, and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories). The membranes were then blocked by 5% nonfat milk in TBS-0.5% Tween 20 at room temperature for 1 hour. The primary antibodies used for the analysis included mouse anti-DHFR monoclonal antibody (mAb; 1:250; BD Biosciences), and mouse anti-a-tubulin mAb (1:1,000; TU-02) (Santa Cruz Biotechnology). Horseradish peroxidase-conjugated antibodies against mouse or rabbit (1:1,000; Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate.
  • FIG. 2C is the resulting Western immunoblot that shows overexpression of miR-192 clearly decreased the expression of DHFR protein (FIG. 2C, lane 4). In this image, lane 1 is the control, lane 2 is the cells transfected with non-specific miR control, lane 3 is the cells transfected with siRNA specific to DHFR, lane 4 is from cells transfected with miR-192 and lane 5 is the cells transfected with miR-24. The results show that the potency of miR-192 (FIG. 2C, lane 4) for decreasing DHFR expression was comparable to miR-24 (FIG. 2C, lane 5).
  • The expression level of DHFR mRNA were analyzed using real time qRT-PCR analysis. The analysis was performed as follows. Total RNA, including miRNA, was isolated from cell lines by using TRIzol reagent (Invitrogen) according to the manufacturer's instructions at 24 h after transfection. cDNA was synthesized with the High Capacity cDNA synthesis kit (Applied Biosystems) using 2 μg of total RNA as the template and random primers. Real-time qRT-PCR analysis was done on the experimental mRNAs. The PCR primers and probes for DHFR, and the internal control gene GAPDH were purchased from Applied Biosystems. qRT-PCR was done on an ABI 7500HT instrument under the following conditions: 50° C., 2 min of reverse transcription; 95° C., 10 min; 95° C., 15 sec; 60° C., 1 min. The reaction was done for up to 40 cycles (n=3). GAPDH was used as an internal standard for normalization.
  • The results (FIG. 2D) indicated that there was no reduction in DHFR mRNA expression by miR-192 (lane 4) and miR-24 (lane 5). In FIG. 2D, each bar corresponds to each lane illustrated in FIG. 2C (see above). The results demonstrate that the suppression of DHFR expression was regulated at the translational level without the degradation of DHFR mRNA. By contrast, the decreased expression of DHFR by siRNA was clearly caused by mRNA degradation (lane 3, FIG. 2D).
  • Example 2 Increased Expression of miR-192 Sensitizes Cells to Methotrexate (MTX) Treatment
  • This was confirmed by studying cellular proliferation in cells transfected with miR-192 and treated with MTX. HCT-116 (wt-p53) cells were plated in 96-well plates at 1×103 cells/well in triplicate. They were transfected with miR-192 precursor (FIG. 3, lane 4), non-specific control miRNA (FIG. 3, lane 2), or siRNA against DHFR (FIG. 3, lane 3) in 100 μl of medium. Twenty-four hours later, MTX in 100 μl medium (final concentration 25 nM) was added, and incubated for 72 hours. One sample was only transfected with non-specific miR and was not treated with MTX (FIG. 3, lane 1). Ten microliters of WST-1 (Roche Applied Science) was added to each well. After 2 hours of incubation, absorbance was measured at 450 and 630 nm respectively (n=3). Non-specific control miRNA alone was used as a negative control (FIG. 3, lane 1), and siRNA incubation with MTX was used as a positive control (FIG. 3, lane 3).
  • With equal molar concentration of MTX at 25 nM (IC-10), cell proliferation was reduced by 10% in non specific control miR treated cells (FIG. 3, lane 2). However, cell proliferation was reduced by nearly 70% in cells transfected with miR-192, demonstrating a synergistic effect in combination with MTX (FIG. 3, lane 4). By contrast, cells treated with siRNA against DHFR were inhibited by 55% (FIG. 3, lane 3). The more potent effect of miR-192 plus MTX compared to siRNA targeting specifically to DHFR suggests that miR-192 may also target additional mRNA targets through imperfect base pairing.
  • Example 3 miR-192 Inhibits Cell Proliferation of HCT-116 (wt-p53), RKO (wt-p53) and HT-29 (mut-p53) Colon Cancer Cell Lines
  • To assess the functional significance of miR-192, the impact of miR-192 on cellular proliferation was evaluated using HCT-116 (wt-p53), HCT-116 (null-p53), RKO (wt-p53) and HT-29 (mut-p53) colon cancer cell lines. The human colon cancer cell lines HCT-116 (wt-p53) and HCT-116 (null-p53) were provided by Prof. Bert Vogelstein (The Johns Hopkins University) and were maintained in McCoy's 5A medium (Life Technologies). The other two human colon cancer cell lines, RKO (wt-p53) and HT-29 (mut-p53), were obtained from the American Type Culture Collection. The HT-29 (mut-p53) cell line has a missense mutation in codon 273 of p53 resulting in an Argto-His substitution. RKO (wt-p53) and HT-29 (mut-p53) cells were maintained in Eagle's MEM and Iscove's Modified Dulbecco's Medium at the American Type Culture Collection, respectively. All media were supplemented with 10% dialyzed fetal bovine serum (Hyclone Laboratories). All cell lines were grown at 37° C. in a humidified incubator with 5% CO2. The cell lines were transfected as described above (see Examples 1 and 2).
  • The cellular proliferation was evaluated as follows. HCT-116 (wt-p53) (FIG. 4A), HCT-116 (null-p53) (FIG. 4C), RKO (wt-p53) (FIG. 4B), and HT-29 cells (FIG. 4D) were plated in 96-well plates in triplicate at 1×103 cells per well after transfection with miR-192 precursor (illustrated as —▴—) or non-specific control miRNA (illustrated as —▪—). Cells were cultured for 24, 48, 72, or 96 hours. The absorbance at 450 and 630 nm was measured after incubation with 10 μl of WST-1 for 2 hours. A non-specific miR was used as a negative control.
  • The results (see FIG. 4) show that the overexpression of miR-192 can suppress cellular proliferation in HCT-116 (wt-p53) cells by over 55% (n=3) (FIG. 4A) and RKO (wt-p53) cells by 48% (n=3) (FIG. 4B), with less impact on HCT-116 (null-p53) (15%, n=3) (FIG. 4C) and HT-29 cell lines (24%, n=3) (FIG. 4D). By contrast, the non-specific control miR has no effect on cellular proliferation, indicating that this effect caused by miR-192 is highly specific. The results clearly showed that the effect of miR-192 on the inhibition of cellular proliferation is more potent in colon cancer cells containing wild type p53, further indicating that miR-192's function depends on the status of p53.
  • Example 4
  • To determine whether the miR-192's impact on cellular proliferation was related to cell cycle control, the effect on cell cycle control was analyzed by flow cytometry using HCT-116 (wt-p53) (FIG. 5A) and HCT-116 (null-p53) (FIG. 5B) cells transfected with non-specific control miR (left line graph) or miR-192 (right line graph). This experiment was performed as follows. The HCT-116 (wt-p53) and HCT-116 (null-p53) cells lines as described above (see Example 3) were transfected with miR-192 precursor and the non-specific control miRNA described as above (see Examples 1 and 2). At 36 hours after transfection, the cells were harvested and resuspended at 0.5-1×105 cells/ml in modified Krishan buffer containing 0.1% sodium citrate and 0.3% NP-40 and kept at 4° C. Before being analyzed by flow cytometry, cells were treated with 0.02 mg/ml RNase H and stained with 0.05 mg/ml propidium iodide (Sigma).
  • In the HCT-116 (wt-p53) cells transfected with non-specific miR had the following cell cycle profile G1: 38.78%, G2: 17.46%, S: 43.76%, G1/S: 0.89%, and G2/S: 0.40%. The HCT-116 (wt-p53) cells transfected with miR-192 had the follow cell cycle profile G1: 40.84%, G2: 44.71%, S: 14.45%, G1/S: 2.83%, and G2/S: 3.09%. In the HCT-116 (null) cells transfected with non-specific miR had the following cell cycle profile G1: 40.15%, G2: 13.33%, S: 46.52%, G1/S: 0.86%, and G2/S: 0.29%. The HCT-116 (null) cells transfected with miR-192 had the follow cell cycle profile G1: 35.65%, G2: 19.06%, S: 45.29%, G1/S: 0.79% and G2/S: 0.42%.
  • The results (FIG. 5) show that miR-192 induces both G1 (>2-fold) and G2 arrest (>3-fold) in HCT-116 (wt-p53) cells (FIG. 5A). By contrast, this effect has not been observed in HCT-116 (null-p53) cells (FIG. 5B). The cell cycle analysis data is highly consistent with the cell proliferation results that the function of miR-192 is dependent on the presence of wild type p53 for cell cycle control.
  • Example 5 miR-192 Expression is Dependent on p53
  • To further analyze the cell cycle control genes involved in miR-192 overexpression, a number of cell cycle control genes were analyzed (p53, p21, Bax, E2F3, Rb). HCT-116 (wt-p53) cells (FIG. 6A) and RKO (wt-p53) cells (FIG. 6B), as described above (see Example 3), were transfected with non-specific miR (FIG. 6A, lane 2; and FIG. 6B., lane 1), DHFR siRNA (FIG. 6A, lane 3; and FIG. 6B., lane 2) and miR-192 (FIG. 6A, lane 4; and FIG. 6B., lane 3) according to the procedure discussed above (see Examples 1 and 2). Non-transfected HCT-116 (wt-p53) was used as a negative control (FIG. 6A, lane 1). Alpha-tubulin was used as a protein loading control. At 48 hours after transfection, the cells were scraped and lysed in RIPA buffer (Sigma). Equal amount of proteins were resolved by SDS-PAGE on 12% gels by the method of Laemmli, and transferred to polyvinylidene fluoride membranes (BIO-RAD Laboratories). The membranes were then blocked by 5% nonfat milk in TBS-T (Tris-buffered saline and 0.5% Tween-20) at room temperature for 1 hour. The primary antibodies used for the analysis included mouse anti-p53 mAb (1:1000, DO-1) (Santa Cruz Biotechnology), mouse anti-p21 mAb (1:1000, F-5) (Santa Cruz Biotechnology), and mouse anti-α-tubulin mAb (1:1000, TU-02) (Santa Cruz Biotechnology). Horseradish peroxidase-conjugated antibodies against mouse or rabbit (1:1000) (Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate.
  • FIG. 6 shows the results of Western immunoblot analysis in HCT-116 (wt-p53) 10 cells (FIG. 6A) and RKO (wt-p53) cells (FIG. 6B). miR-192 increased the expression of the p53 protein (FIG. 6A, lane 4) over 10-fold and p21 10-fold. By contrast, siRNA against DHFR (FIG. 6A, lane 3) did not cause an increase in expression of p53 and p21. The expression of Bax was not altered by miR-192. Similar results were obtained for RKO (wt-p53) cells (FIG. 6B, lane 3 (miR-192), lane 1 (non-specific miR) and lane 2 (siRNA of DHFR)).
  • Example 6
  • The expression of miR-192 on the expression of E2F3 and Rb in HCT-116 (wt-p53) cells was also analyzed. In these experiments, HVT-116 (wt-p53) cells, as described above (see Example 3) were transfected with non-specific miR (FIG. 7, lane 2), DHFR siRNA (FIG. 7, lane 3) or miR-192 (FIG. 7, lane 4) according to the procedure described above (see Examples 1 and 2). One HCT-116 (wt-p53) sample was not transfected, and used as a negative control (FIG. 7, lane 1). Western immunoblot analysis was performed according to the procedure described above (see Example 5), except that rabbit anti-E2F-3 polyclonal antibody (1:1000, C-18) (Santa Cruz Biotechnology) was used.
  • The results (FIG. 7) indicated that miR-192 caused a decreased expression of E2F3 and Rb (FIG. 7, lane 4). The results further confirmed the notion that the function of miR-192 is clearly dependent on the status of wild type p53. It has been well characterized that the induction of the p53 dependent cell cycle check point control gene p21 is the key to trigger cell cycle arrest at both the G1 and G2 phase. The expression of the proapoptotic protein Bax was not altered, suggesting that the reduced proliferation may not be due to increased apoptosis. miR-192 overexpression also caused a slight decrease in the expression of E2F3 and Rb (FIG. 7), some of the key regulators of the G2/M transition. The decreased expression of E2F3 and Rb may be partially responsible for both the G1/S and G2/M arrest caused by miR-192 overexpression.
  • Example 7
  • With over-expression of miR-192 by transfection, both HCT-116 (wt-p53) and RKO (wt-p53) cells undergo cell cycle arrest at the G1 and G2 phase leading to decreased cellular proliferation. Bioinformatic analysis also reveals that there is a putative p53 binding site in the miR-192 promoter region.
  • To confirm this direct regulatory relationship, the following experiments were performed. First, the expression of the p53 protein was induced by treatment with MTX in HCT-116 (wt-p53) cells, RKO (wt-p53) cells, HCT-116 (null-p53) cells and HT-29 (mut-p53) cells (see Examples 1 and 2 for description of cell lines). Western immunoblot using mouse anti-p53 mAb (1:1000, DO-1) (Santa Cruz Biotechnology) according to the procedure discussed in Example 4 demonstrated that MTX treatment induced p53 protein expression (FIG. 8A).
  • Thereafter, the expression of endogenous mature miR-192 was analyzed by real time qRT-PCT analysis using an internal control RNU6B as an internal standard for normalization. The cDNA synthesis was carried out with the High Capacity cDNA synthesis kit (Applied Biosystems) using 10 ng of total RNA as template. The miRNA sequence-specific RT-PCR primers for miR-192 and endogenous control RNU6B were purchased from Ambion. Real-time quantitative reverse transcription-PCR (qRT-PCR) analysis was carried out using Applied Biosystems 7500 Real-Time PCR System. The PCR master mix containing TaqMan 2× Universal PCR Master Mix (No Amperase UNG), 10+ TaqMan assay and RT products in 20 μl volume were processed as follows: 95° C. for 10 minutes, and then 95° C. for 15 seconds, 60° C. for 60 seconds for up to 40 cycles (n=3). Signal was collected at the endpoint of every cycle. The gene expression ΔCT values of miRNAs from each sample were calculated by normalizing with internal control RNU6B and relative quantitation values were plotted.
  • The results are illustrated in FIG. 8B where an open bar indicates an MTX(−) sample, and a dashed bar indicates an MTX(+) sample. The qRT-PCT (FIG. 8B) shows that induction of p53 by MTX caused a significant increase of miR-192 expression. By contrast, MTX treatment in HCT-116 (null-p53) and HT-29 (mut-p53) cells did not cause any change in the expression of miR-192 (FIG. 8B). These results suggest that the endogenous expression of miR-192 depends on the wild type p53.
  • Example 8
  • The promoter site of miR-192 contains a well conserved p53 binding sequence. FIG. 9A is a schematic diagram showing the position of the miR-192 promoter (over 3 kb) relative to the location of the miR-192 precursor on chromosome 11. To experimentally confirm a direct interaction between the p53 protein and the miR-192 promoter, chromatin immunoprecipitation-qRT-PCT (ChIP-qPCR) analysis was used to isolate p53-bound chromosome DNA. p21, a known cell cycle regulator transcriptionally regulated by p53, was used as a positive control. Mouse monoclonal antibody (DO-1) against p53 (Santa Cruz Biotechnology) was used for immunoprecipitation of the p53 binding complex. Non-related antibody α-tubulin (TU-02, Santa Cruz Biotechnology) was used as a negative control. Immunoprecipitation was performed based on the manufacturer's protocols of Active Motif. The primer sequences for the miR-192 promoter and the p21 promoter are listed as follows:
  • miR-192 promoter (forward primer):
    (SEQ ID NO: 4)
    5′-AGCACCTCCCATGTCACC-3′
    miR-192 promoter (reverse primer):
    (SEQ ID NO: 5)
    5′-CAAGGCAGAGCCAGAGC-3′
    p21 promoter (forward primer):
    (SEQ ID NO: 6)
    5′-GCTGGTGGCTATTTTGTCCTTGGGC-3′
    p21 promoter (reverse primer):
    (SEQ ID NO: 7)
    5′-AGAATCTGACTCCCAGCACACACTC-3′
  • The isolated p53 specific binding DNA was PCR amplified using primers which span the predicted p53 binding sites of the miR-192 promoter or the positive control p21 promoter transcriptionally regulated by p53 protein.
  • FIG. 9 shows the immunoprecipitation qPCR analysis of the predicted miR-192 promoter with conserved p53 binding sequence. FIG. 9B shows that the p53 protein directly interacts with the miR-192 promoter based on ChIP-qPCR analysis with a 4-fold enriched signal of with p53 specific monoclonal antibody compared to the non-specific antibody control DNA. This data establishes the existence of a conserved p53 binding site at the promoter region of miR-192. The binding sequence is 5′-cgccatgcctxxxggccttgccc-3′ (SEQ ID NO:25), with a 3-base-pair gap represented by “x”. This suggests that miR-192, like miR-34, is another miRNA that is involved in the p53 tumor suppressor network.
  • Luciferase reporter assay was used to determine the transcriptional activation of conserved p53-binding promoter of miR-192. pGL3-Basic promoterless luciferase reporter plasmid (Promega) was used in this study. Double-stranded DNA oligonucleotides of conserved p53-binding sequence of miR-192 was synthesized and annealed and cloned upstream of firefly luciferase in the pGL3-Basic plasmid (miR-192-pGL3). The p53-binding site oligonucleotide (bold) contains MluI at the 5′-end and BglII sequence at the 3′-end (5′-ACGCGTCCCATGTCACCACCAGGGGTCGCCATGCCTCCTGGCCTTGCCCAGCAAG ATCT-3′) (SEQ ID NO:8). Control vector and miR-192-pGL3 vector were transfected into both HCT-116 (wt-p53) and HCT-116 (null-p53) cells. To further induce p53 expression, transfected HCT-116 (wt-p53) and HCT-116 (null-p53) cells were also treated with 5 μmol/L 5-fluorouracil for 24 hours. The promoter activity of each construct was quantified by dual luciferase assay (Promega) 24 hours after transfection. Firefly luciferase temperature for 1 hour. The primary antibodies used for the analysis included mouse anti-DHFR monoclonal antibody (mAb; 1:250) (BD Biosciences), mouse anti-p53 mAb (1:1,000; DO-1) (Santa Cruz Biotechnology), mouse antip21mAb (1:1,000; F-5) (Santa Cruz Biotechnology), and mouse anti-a-tubulin mAb (1:1,000; TU-02) (Santa Cruz Biotechnology). Horseradish peroxidase-conjugated antibodies against mouse or rabbit (1:1,000) (Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate.
  • The conserved p-53 binding site at the promoter region of miR-192 can activate luciferase expression only in HCT-116 (wt-p53) cells. The activation was further enhanced by induced p53 expression in HCT (wt-p53) cells treated with 5-fluorouracil. By contrast, the induction of luciferase activity was completely absent from the HCT-116 (null-p53) cells. This evidences that miR-192, like miR-34, is another miRNA that is involved in the p53 tumor suppressor network.
  • p53 is one of the most frequent altered tumor suppressor gene in colorectal cancer. The potential function of multiple miRNAs involved in p53 tumor suppressor network is to provide the p53 with greater flexibility in rapidly responding to different growth condition changes, by perhaps having unique miRNAs (e.g. miR-34, miR-192) mediate the regulation of the key mRNA targets. miR-192 was one of the miRNAs with reduced expression in a large cohort of colon cancer patient samples, further supporting the potential impact and clinical relevance of miR-192 in colon cancer. The decrease or loss of the suppressive function of miR-192 in colon cancer may be an important factor related to cell cycle control and chemosensitivity to anti-folate based therapy.
  • Example 1-8 establish that miR-192 is directly involved in the regulation of a key anticancer target DHFR. The expression and function of the miR-192 is largely dependent on the presence of functional wild type p53. Thus, miR-192 may be used as a novel therapeutic option for treating cancer via an effective delivery system either alone or in combination with anti-folate compounds.
  • Example 9 miR-215 Inhibits Cell Proliferation of HCT-116(wt-p53) and U-2 OS Cells
  • HCT-116 (wt-p53), HCT-116 (null-p53), U-2 OS, and MG63 cells (2×105) were plated in six-well plates, and transfected with 100 nM of either miR-215, miR-192 precursors or non-specific control miRNA (Ambion) after 24 h by Oligofectamine (Invitrogen) according to the manufacturer's protocols. siRNA specific to TS (Mishra, et al., “AmiR-24 microRNA binding site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance,” Prof. Nat'l. Acad. Sci. (2007) 104:13513-13518) and siRNA specific to DHFR (ON-TARGET plus SMARTpool L-008799-00-0010, human DHFR, NM000791) were purchased from Dharmacon and transfected with Oligofectamine (Invitrogen) at a final concentration of 100 nM. siRNA specific to TS or DHFR were used as the positive controls. miR-192, an miRNA that targets DHFR, was also used as the positive control.
  • Total RNA, including miRNA, was isolated from cell lines at 24 h after transfection, or from Stem cell lines or snap frozen tissues by using TRIzol reagent (Invitrogen) according to the manufacturer's instructions.
  • Real-time qRT-PCR confirmed the increased expression of miR-215 in the transfected cells. cDNA synthesis was carried out with the High Capacity cDNA synthesis kit (Applied Biosystems) using 10 ng of total RNA as template. The miRNA sequence-specific RT-PCR primers for miR-215 and endogenous control RNU6B were purchased from Ambion. Real-time quantitative reverse transcription-PCR (qRT-PCR) analysis was carried out using Applied Biosystems 7500 Real-Time PCR System. The PCR master mix containing TaqMan 2× Universal PCR Master Mix (No Amperase UNG), 10× TaqMan assay and RT products in 20 μl volume were processed as follows: 95° C. for 10 min, and then 95° C. for 15 sec, 60° C. for 60 sec for up to 40 cycles (n=3). Signal was collected at the endpoint of every cycle. The gene expression ΔCT values of miRNAs from each sample were calculated by normalizing with internal control RNU6B and relative quantitation values were plotted.
  • Cell proliferation assays were performed on the transduced cells. HCT-116 (wt-p53), HCT-116 (null-p53), U-2 OS, and MG63 cells were plated in 96-well plates in triplicate at 1×103 cells/well after transfection with miR-215 precursor or non-specific control miRNA. Cells were cultured for 24, 48, 72, 96 h. The absorbance at 450 and 630 nm was measured after incubation with 10 μl of WST-1 for 2 h. A remarkable inhibition of cell proliferation was observed in either HCT-116 (wt-p53) or U-2 OS cells compared with the non-specific miRNA control, and the reduction in HCT-116 (wt-p53) or U-2 OS cells were approximately 40% or 58% at day 5 respectively (FIG. 10).
  • miR-215 Induces G2-Arrest in HCT-116 (Wt-p53) and U-2 OS Cells.
  • To investigate the mechanism by which miR-215 suppressed cell proliferation in HCT-116 (wt-p53) and U-2 OS cells, the impact of miR-215 on cell cycle control was analyzed by flow cytometry at 36 h after transfection. HCT-116 (wt-p53), HCT-116 (null-p53), U-2 OS and MG63 cells were transfected with miR-215 precursor and the non-specific control miRNA described as above. At 36 h after transfection, cells were harvested and resuspended at 0.5-1×105 cells/ml in modified Krishan buffer containing 0.1% sodium citrate and 0.3% NP-40 and kept at 4° C. Before analysis by flow cytometry, cells were treated with 0.02 mg/ml RNase H and stained with 0.05 mg/ml propidium iodide (Sigma).
  • In miR-215 transduced U-2 OS cells, the proportion of cells in the G2-phase was higher and the proportion of cells in the S-phase was lower than that in control cells (18.50% vs 29.69%; 52.08% vs 41.24%; FIG. 11). The G2/S ratio was increased in miR-215 transfected cells (0.35 vs 0.72; >2-fold). The results showed that miR-215 causes increased accumulation of cells at G2-phase, whereas cells in S-phase decrease. Similar results were observed in transfected I-WT-116 (wt-p53) cells.
  • miR-215 Increases the Expression of Cell Cycle Control Genes p53 and p21.
  • p53 and p21, a downstream target of the p53 pathway of growth control, are reported to block cells at G2 checkpoint mainly through inhibiting activity of Cdc2, the cyclin-dependent kinase that normally drives cells into mitosis, which is the ultimate target of pathways that mediate rapid arrest in G2 in response to DNA damage. To further analyze the mechanism of cell proliferation inhibition by miR-215, we transfected miR-215 precursor into HCT-116 (wt-p53) and U-2 OS cells, and evaluated the levels of cell cycle control genes p53 and p21 by western immunoblot analysis.
  • At 48 h after transfection with miR-215, miR-192 precursors or non-specific control miRNA, the cells were scraped and lysed in RIPA buffer (Sigma). Equal amounts of proteins were resolved by SDS-PAGE on 12% gels by the method of Laemmli, and transferred to polyvinylidene fluoride membranes (BIO-RAD Laboratories). The membranes were then blocked by 5% nonfat milk in TBS-T (Tris-buffered saline and 0.5% Tween-20) at room temperature for 1 h. The primary antibodies used for the analysis included mouse anti-TS mAb (1:400, Millipore), mouse anti-DHFR mAb (1:250, BD Bioscience), mouse anti-p53 mAb (1:1000, DO-1), mouse anti-p21 mAb (1:1000, F-5), and mouse anti-α-tubulin mAb (1:1000, TU-02) purchased from Santa Cruz Biotechnology. Horseradish peroxidase-conjugated antibodies against mouse (1:1000, Santa Cruz Biotechnology) were used as the secondary antibodies. Protein bands were visualized with a chemiluminescence detection system using the Super Signal substrate (BIO-RAD).
  • Over-expression of miR-215 led to a significant increase of the p53 and p21 protein in both HCT-116 (wt-p53) and U-2 OS cells. (FIG. 12). The results indicated that miR-215 contributed to the inhibition of cell proliferation at least partially by the induction of G2-arrest in HCT-116(wt-p53) and U-2 OS cells through over-expression of G2-checkpoint genes p53 and p21.
  • Example 10 DHFR and TS are the Direct Targets of miR-215
  • Using the Sanger database (microrna.sanger.ac.uk) TS and DHFR were identified as putative targets of miR-215 (FIG. 13). At 48 hours after transfection, proteins were extracted from miR-215-transfected cells and from control cells and changes in TS or DHFR protein levels were determined by western immunoblot analysis (FIG. 14). Oligofectamine alone and non-specific miRNA were used as the negative controls. miR-192, which had been observed to down-regulate DHFR, was used as a positive control of DHFR down-regulation. Over-expression of miR-192 and miR-215 was confirmed by real time qRT-PCR analysis using U6 RNA to normalize the expression. Introduction of miR-192 or miR-215 clearly decreased TS or DHFR protein levels (FIG. 14, lane 3 and 4). Expression levels of TS or DHFR mRNA were analyzed using real time qRT-PCR analysis (FIG. 15). The results indicated that there was no reduction in TS or DHFR mRNA expression by miR-215 (column 3) and miR-192 (column 4). Thus, the suppression of TS or DHFR expression was regulated at the translational level without the degradation of TS or DHFR mRNA.
  • To confirm whether miR-215 directly targets TS or DHFR, plasmids were constructed containing the fragments of the 3′UTR of TS or DHFR in the downstream region of firefly luciferase. The pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion) was used to determine the targets of miR-215. Double stranded DNA oligonucleotides containing the miR-215 binding sequence (wt-miR-215) or mismatch sequence (mut-miR-215) in 3′UTR of TS or DHFR mRNA and the HindIII and SpeI restriction site overhangs were synthesized (IDT, Coralville, Iowa) and annealed and cloned downstream of firefly luciferase in the pMIR-REPORT plasmid. The sequences of these synthesized oligonucleotides are provided below. The 3′UTR of TS includes two miR-215 binding sites: one is located at 84-104 bp, one is located at 216-236 bp.
  • 198-247 bp of 3′UTR of TS mRNA
    Forward-wt-miR-215
    (SEQ ID NO: 14)
    5′-CTAGTAGTTAACTCCCTGAGGGTATCTGACAATGCTGAGGTTATGA
    ACAAAGTGA-3′
    Reverse-wt-miR-215
    (SEQ ID NO: 15)
    5′-AGCTTCACTTTGTTCATAACCTCAGCATTGTCAGATACCCTCAGGG
    AGTTAACTA-3′
    Forward-mut-miR-215
    (SEQ ID NO: 16)
    5′-CTAGTAGTTAACTCCCTGAGGGTATATC ACGATG T TGATATCAC GA
    ACAAAGTGA-3′
    Reverse-mut-miR-215
    (SEQ ID NO: 17)
    5′-AGCTTCACTTTGTTCGTGATATCAACATCGTGATATACCCTCAGGG
    AGTTAACTA-3′
    62-115 bp of 3′UTR of TS mRNA
    Forward-wt-miR-215-2
    (SEQ ID NO: 18)
    5′-CTAGTAGTTCTTTTTGCTCTAAAAGAAAAAGGAACTAGGTCAAAAA
    TCTGTCCGA-3′
    Reverse-wt-miR-215-2
    (SEQ ID NO: 19)
    5′-AGCTTCGGACAGATTTTTGACCTAGTTCCTTTTTCTTTTAGAGCAA
    AAAGAACTA-3′
    519-578 bp of 3′UTR of DHFR mRNA
    Forward-wt-miR-215
    (SEQ ID NO: 20)
    5′-CTAGTAATTTCAGTGAAAGCAGTGTATTTGCTAGGTCATACCAGAA
    ATCATCAATTGAGGTACGGA-3′
    Reverse-wt-miR-215
    (SEQ ID NO: 21)
    5′-AGCTTCCGTACCTCAATTGATGATTTCTGGTATGACCTAGCAAATA
    CACTGCTTTCACTGAAATTA-3′
    Forward-mut-miR-215
    (SEQ ID NO: 22)
    5′-CTAGTAATTTCAGTGAAAGCAGTGT GCTTGC GATATG ATACCAGAA
    ATCATCAATTGAGGTACGGA-3′
    Reverse-mut-miR-215
    (SEQ ID NO: 23)
    5′-AGCTTCCGTACCTCAATTGATGATTTCTGGTATCATATCGCAAGCA
    CACTGCTTTCACTGAAATTA-3′
  • The constructs were transiently transfected into HCT-116 (wt-p53) cells alone (control) or together with miR-215 precursor. Twenty-four hours before transfection, HCT116 (wt-p53) and HCT 116 (null-p53) cells were plated in the 96-well plates at 1.5×104 cells each well in triplicate. pMIR-REPORT constructs (100 ng) together with ing of Renilla luciferase plasmid phRL-SV40 (Promega, Madison, Wis.) were transfected by Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.) according to the protocols provided by the manufacturer. Thirty hours after transfection, cells were lysated and luciferase activity was measured by the dual-luciferase reporter assay system (Promega, Madison, Wis.) according to the instructions. Firefly luciferase activity for each condition was normalized by dividing to Renilla internal control and then compared to pMIR-REPORT.
  • As shown in FIG. 16, there was a significant decrease of luciferase activity compared to the vector alone. These data demonstrated that TS or DHFR were the direct targets of miR-215, and suggested that the inhibition of cell proliferation by miR-215 was partially due to the down-regulation of these two enzymes.
  • Example 11 Reduced Chemosensitivity to TDX and MTX by Overexpression of miR-215
  • TS and DHFR are the major targets of cancer chemotherapy in the clinic. TDX, the third-generation TS inhibitor, is an active agent in the treatment of human colon and breast cancer. Inhibitors of DHFR, such as MTX, are widely used in the treatment of human leukemia, osteosarcoma and choriocarcinoma. Increased DHFR protein levels are reported to be associated with drug resistance, and low tumor expression levels of TS have also been linked with improved outcome for colon cancer patients treated with 5-FU chemotherapy. However, Yamauchi et al observed that MTX has the highest activity at the time when DNA synthesis, DHFR activity, DHFR content, and DHFR mRNA content increased and the lowest activity at the time when they decreased.
  • In this study, we confirmed miR-215 decreased the expression of TS and DHFR protein, we then test if miR-215 can change the sensitivity of TDX or MTX in the HCT-116 (wt-p53) or U-2 OS cells.
  • HCT-116 (wt-p53) cells were plated in 96-well plates at 1×103 cells/well in triplicate and were transfected with miR-215 precursor, non-specific control miRNA, or siRNA against TS or DHFR in 100 μl of medium. Twenty-four hours later, TDX or MTX in 100 μl medium ranged from 10-200 nM was added, and incubated for 72 hours. To measure viable cells, 10 μl of WST-1 (Roche Applied Science) was added to each well. After 2 hours incubation, absorbance was measured at 450 and 630 nm respectively (n=3). Non-specific control miRNA alone was used as a negative control, and siRNAs incubation with TDX or MTX were used as the positive controls.
  • FIG. 17A shows that the IC50 of TDX in HCT-116(wt-p53) cells transfected with miR-215 was 98.7 nM, whereas in the negative control was 18.6 nM, in the positive control was 8.5 nM. FIG. 8B showed that 83.6% of transduced U-2 OS cells still alive at 200 nM of MTX. The IC50 of MTX in the negative control was 49.7 nM, whereas 37.3 nM in the positive control. These results indicated that down-regulation of TS or DHFR protein by the siRNA specific against TS or DHFR indeed increased the sensitivity of TDX or MTX in the colon cancer or osteosarcoma cell lines, whereas even though miR-215 also down-regulated the expression levels of TS or DHFR, it did not increase the chemosensitivity of TDX or MTX compared to the non-specific miRNA control. TDX or MTX are considered to be more effective on the cells in the S-phase. The cell cycle data showed that siRNAs specific against TS or DHFR did not decrease the cells in the S-phase (FIG. 11), whereas the cells in the S-phase were reduced in the miR-215 transfected cells.
  • Over-Expression of miR-215 in Human Colon Cancer Stem Cells May Contribute to the Low Sensitivity to TDX and MTX.
  • Cancer stem cells also named cancer initiating cells, exhibit low rate of division and proliferation in their niche that help them to avoid chemotherapy and radiation. To determine whether miR-215 expression influences the growth and chemosensitivity in cancer stem cells, miR-215 levels in colon cancer stem cells were measured using real-time qRT-PCR. Expression of miR-215 was determined to be greater than 2-fold higher in the colon cancer stem cells than in the controls (FIG. 18).
  • Example 12 Clinical Human Colon Cancers Show Decreased miR-215 Expression
  • miR-215 expression in 22 paired human colon cancer and counterpart normal tissues was analyzed by real-time qRT-PCR (FIG. 19). Eighteen of 22 colon cancer samples (81.8%) showed decreased miR-215 level (P<0.05).
  • From the description and examples provided above, one of ordinary skill in the art would appreciate the application of miR-192 and miR-215 in various diagnostic tools and treatments.
  • Example 13
  • It is contemplated that miR-192 and miR-215 would be altered in a subject simultaneously according to the methods discussed above, or that the inhibitory molecule would comprise a combination of miR-192 and miR-215. When both are altered, it is expected that there would be greater than the effect observed with either miR-192 or miR-215, or would have a synergistic effect. For example, it is expected that if miR-192 and miR-215 are both inhibited in a subject, then the sensitivity to a chemotherapeutic agent would be increased, and that this increase would be greater than the increase in sensitivity observed with miR-192 or miR-215. It is further expected that if miR-192 and miR-215 are upregulated together, then the decrease in cell proliferation would be greater than observed with miR-192 or miR-215.

Claims (32)

What is claimed is:
1. A method of modulating expression of a component of a cell, comprising contacting the cell with a nucleic acid comprising an inhibitory nucleic acid having a sequence selected from the group consisting of SEQ ID NOs:1, 2, 3, 9, 10, 25, a complementary sequence thereof, a variant thereof on a fragment thereof in an amount sufficient to modulate the cellular component.
2. The method of claim 1, wherein the nucleic acid is an antisense nucleic acid.
3. The method of claim 1, wherein the nucleic acid is an siRNA or an shRNA.
4. The method of claim 1, wherein the cellular component is selected from the group consisting of miR-192 and miR-215.
5. The method of claim 1, wherein the cellular component is p21 or p53.
6. The method of claim 1, wherein the cellular Component is regulated by p53.
7. The method of claim 1, wherein the cellular component is DHFR or TS.
8. A method of increasing proliferation of a cell, comprising contacting the cell with a nucleic acid complementary to at least a portion of a sequence selected from the group consisting of SEQ ID NOs:1, 2, 3, 9, 10, 25 and an antisense sequence of SEQ ID NO:25, in an amount effective to increase proliferation of the cell.
9. A method of increasing the sensitivity of a cell to a chemotherapeutic agent, comprising contacting the cell with a nucleic acid complementary to a sequence selected from the group consisting of SEQ ID NOs:1, 2, 3, 9, 10, 25 and an antisense sequence of SEQ ID NO:25, in an amount effective to sensitize the cell to the chemotherapeutic agent.
10. The method of claim 9, wherein the chemotherapeutic agent is selected from methotrexate, fluorouracil (5-FU), and ralitrexed.
11. A method of increasing the sensitivity of a cell to radiation, comprising contacting the cell with a nucleic acid complementary to at least a portion of a sequence selected from the group consisting of SEQ ID NOs:1, 2, 3, 9, 10, 25 and an antisense sequence of SEQ ID NO:25, in an amount effective to sensitize the cell to radiation.
12. The method of any one of claims 8 to 11, wherein the nucleic acid is an antisense nucleic acid.
13. The method of any one of claims 8 to 11, wherein the nucleic acid is an siRNA or an shRNA.
14. The method of any one of claims 8 to 11, wherein the cell is a cancer stem cell.
15. The method of any one of claims 8 to 11, wherein the cell is a neoplastic cell.
16. A method of treating a neoplasm in a subject, comprising administering to the subject an effective amount of an inhibitory molecule that inhibits expression of miR-192 or miR-215, and a second therapy, wherein inhibition of expression of miR-192 or miR-215 sensitizes the neoplasm to the second therapy.
17. The method of claim 16, wherein the second therapy comprises administering a chemotherapeutic agent.
18. The method of claim 17, wherein the chemotherapeutic agent is selected from methotrexate, fluorouracil (5-FU), and ralitrexed.
19. The method of claim 16, wherein the second therapy comprises administering radiation to the subject.
20. The method of any one of claims 16 to 19, wherein the neoplasm is cancer.
21. The method of claim 20, wherein the cancer is selected from the group consisting of colon cancer, pancreatic cancer, lung cancer, breast cancer, cervical cancer, gastric cancer, kidney cancer, leukemia, liver cancer, lymphoma, ovarian cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, testicular cancer, and uterine cancer.
22. A method of diagnosing a neoplasm in a subject comprising determining the level of expression of miR-192 or miR-215.
23. A method of identifying a neoplasm resistant to chemotherapy comprising determining the level of expression in the neoplasm of a microRNA (miRNA) selected from the group consisting of miR-192 and miR-215, and identifying the neoplasm as resistant to therapy if the level of the miRNA is elevated.
24. A method of determining whether a neoplasm is a candidate for treatment with a chemotherapeutic agent comprising evaluating the level of expression of a microRNA (miRNA) selected from the group consisting of miR-192 and miR-215, and rejecting the candidate if expression of the miRNA is elevated.
25. A kit for analysis of a pathological sample, the kit comprising in a suitable container a hybridization reagent for, determining the level of a miRNA selected from the group consisting of miR-192 or miR-215.
26. The kit of claim 25, wherein the hybridization reagent comprises a hybridization probe.
27. The kit of claim 25, wherein the hybridization reagent comprises amplification primers.
28. A method of identifying an agent that inhibits expression of a microRNA (miRNA) selected-from the group consisting of miR-192 and miR-215 comprising
contacting a cell that expresses the miRNA with an agent; and
comparing an expression level of the miRNA in the cell contacted by the agent with an expression level of the miRNA in the absence of the agent, wherein the agent is an inhibitor of the miRNA if expression of the miRNA is reduced.
29. The method of claim 28, wherein the test cell overexpresses the miRNA.
30. An isolated inhibitory molecule comprising a nucleic acid, wherein the nucleic acid consists essentially of a sequence selected from the group consisting of SEQ ID NO:9, SEQ ID NO:25, a complementary sequence of SEQ ID NO:9, a complementary sequence of SEQ ID NO:25, fragments thereof and variants thereof.
31. The isolated inhibitory molecule, whenever the sequence is selected from the group consisting of the complementary sequence of SEQ ID NO:9, the complementary sequence of SEQ ID NO:25, fragments thereof and variants thereof.
32. The isolated inhibitory molecule, wherein the sequence is SEQ ID NO:25 or a complementary sequence of SEQ ID:25.
US14/554,965 2008-06-05 2014-11-26 Mirnas as therapeutic targets in cancer Abandoned US20150152422A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/554,965 US20150152422A1 (en) 2008-06-05 2014-11-26 Mirnas as therapeutic targets in cancer

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US5919708P 2008-06-05 2008-06-05
US12237708P 2008-12-13 2008-12-13
PCT/US2009/046353 WO2009149318A2 (en) 2008-06-05 2009-06-05 Mirnas as therapeutic targets in cancer
US99624911A 2011-03-15 2011-03-15
US14/554,965 US20150152422A1 (en) 2008-06-05 2014-11-26 Mirnas as therapeutic targets in cancer

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US12/996,249 Division US8927207B2 (en) 2008-06-05 2009-06-05 miRNAs as therapeutic targets in cancer
PCT/US2009/046353 Division WO2009149318A2 (en) 2008-06-05 2009-06-05 Mirnas as therapeutic targets in cancer

Publications (1)

Publication Number Publication Date
US20150152422A1 true US20150152422A1 (en) 2015-06-04

Family

ID=41398881

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/996,249 Active 2029-07-20 US8927207B2 (en) 2008-06-05 2009-06-05 miRNAs as therapeutic targets in cancer
US14/554,965 Abandoned US20150152422A1 (en) 2008-06-05 2014-11-26 Mirnas as therapeutic targets in cancer

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US12/996,249 Active 2029-07-20 US8927207B2 (en) 2008-06-05 2009-06-05 miRNAs as therapeutic targets in cancer

Country Status (3)

Country Link
US (2) US8927207B2 (en)
EP (1) EP2300017A4 (en)
WO (1) WO2009149318A2 (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120301537A1 (en) * 2011-05-23 2012-11-29 Delta-Fly Pharma, Inc. LIPOSOME CONTAINING shRNA MOLECULE TARGETING A THYMIDYLATE SYNTHASE AND USE THEREOF
US8592572B2 (en) * 2011-05-23 2013-11-26 Delta-Fly Pharma, Inc. Liposome containing shRNA molecule targeting a thymidylate synthase and use thereof
EP2748336A4 (en) * 2011-09-08 2015-05-13 Targeted Molecular Diagnostics Llc Methods for determining responsiveness to a dihydrofolate reductase inhibitor
US20170348234A1 (en) * 2014-07-24 2017-12-07 Memorial Sloan-Kettering Cancer Center Method and composition for targeted delivery of therapeutic agents
CN105353113B (en) * 2015-11-05 2017-09-08 中国科学院武汉病毒研究所 Bent plug or its pharmaceutically acceptable salt is drawn to prepare the application in treating or preventing herpesvirus infection medicine in Lip river
CN110290794A (en) 2016-11-01 2019-09-27 纽约州州立大学研究基金会 The microRNA and its purposes in cancer treatment of 5- halo uracil modification
US11236337B2 (en) 2016-11-01 2022-02-01 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
CN116287282A (en) * 2020-06-10 2023-06-23 石河子大学 Exosome miRNA marker for early pregnancy diagnosis of sow and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080306017A1 (en) * 2006-01-05 2008-12-11 The Ohio State University Microrna-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Lung Cancer
US20090023149A1 (en) * 2005-12-01 2009-01-22 Steen Knudsen Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US20090123912A1 (en) * 2005-01-25 2009-05-14 Rosetta Inpharmatics Llc Methods for quantitating small RNA molecules

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69836384T2 (en) * 1997-09-23 2008-02-21 Sarissa, Inc., London ANTISENSE OLIGONUCLEOTIDES AGAINST THYMIDYLATE SYNTHASE
US7683036B2 (en) * 2003-07-31 2010-03-23 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
EP2295604B1 (en) 2004-02-09 2015-04-08 Thomas Jefferson University Diagnosis and treatment of cancers with microRNA located in or near cancer-associated chromosomal features
US20050182005A1 (en) * 2004-02-13 2005-08-18 Tuschl Thomas H. Anti-microRNA oligonucleotide molecules
AU2005214904B2 (en) * 2004-02-13 2011-07-21 Rockefeller University Anti-microRNA oligonucleotide molecules
US7575863B2 (en) * 2004-05-28 2009-08-18 Applied Biosystems, Llc Methods, compositions, and kits comprising linker probes for quantifying polynucleotides
US8173611B2 (en) * 2004-11-12 2012-05-08 Asuragen Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US20070123482A1 (en) * 2005-08-10 2007-05-31 Markus Stoffel Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
CA2663962A1 (en) * 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir-31,mir-145, mir-147, mir-188, mir-215, mir-216, mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090123912A1 (en) * 2005-01-25 2009-05-14 Rosetta Inpharmatics Llc Methods for quantitating small RNA molecules
US20090023149A1 (en) * 2005-12-01 2009-01-22 Steen Knudsen Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US20080306017A1 (en) * 2006-01-05 2008-12-11 The Ohio State University Microrna-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Lung Cancer

Also Published As

Publication number Publication date
WO2009149318A2 (en) 2009-12-10
US20110166201A1 (en) 2011-07-07
EP2300017A4 (en) 2012-12-12
US8927207B2 (en) 2015-01-06
WO2009149318A3 (en) 2010-06-17
EP2300017A2 (en) 2011-03-30

Similar Documents

Publication Publication Date Title
US20150152422A1 (en) Mirnas as therapeutic targets in cancer
Cao et al. miR-150 promotes the proliferation and migration of lung cancer cells by targeting SRC kinase signalling inhibitor 1
Yeh et al. MicroRNA‐138 suppresses ovarian cancer cell invasion and metastasis by targeting SOX4 and HIF‐1α
US20200056177A1 (en) Long non-coding rna used for anticancer therapy
EP2663641B1 (en) Mirna for treating diseases and conditions associated with neo-angiogenesis
US20160024597A1 (en) miRNAs AS THERAPEUTIC TARGETS IN CANCER
JP4658936B2 (en) Compositions and methods for treating lung cancer
ES2664605T3 (en) Treatment of diseases related to interferon regulatory factor 8 (irf8) by inhibition of the natural antisense transcript to the irf8 gene
JP2019512489A (en) MicroRNA and method of using the same
KR20130138778A (en) Treatment of alpha-l-iduronidase (idua) related diseases by inhibition of natural antisense transcript to idua
US20210292764A1 (en) Lung cancer diagnostics and therapeutics with mir-660
EP2753692B1 (en) Microrna-based methods and assays for osteosarcoma
EP3020828A1 (en) Method of predicting response of cancer to treatment
US20190300882A1 (en) Methods of treating neuroblastoma and reagents therefor
CA3075784A1 (en) Methods for treating triple-negative breast cancer comprising a cdk19 inhibitory agent
US9427460B2 (en) Use of miR-494 to modulate TRAIL-induced apoptosis through BIM down-regulation
JP5812491B2 (en) Tumor treatment
EP2912177A1 (en) Treatment of metastatic breast cancer
US20050191672A1 (en) Antisense oligonucleotides and RNA-interfering molecules targeting PAK4
US10905708B2 (en) MicroRNA-based methods and assays for osteocarcinoma
KR101862247B1 (en) Pharmaceutical Composition for Treating Cancer Comprising miRNA having Drug Response to serpinb5 and Application Thereof
WO2024033467A2 (en) Allele specific sirna therapy for dynamin 2-related diseases
WO2014095916A1 (en) Ninjurin-1 as therapeutic target for brain tumor
JP2012171894A (en) Tumor reducing agent
Zhang et al. Study on the molecular mechanism of miR-31 in the invasion and metastasis of glioma cells

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION