WO2018232735A1 - Utilisation d'un régulateur piézo dans la préparation d'un médicament - Google Patents

Utilisation d'un régulateur piézo dans la préparation d'un médicament Download PDF

Info

Publication number
WO2018232735A1
WO2018232735A1 PCT/CN2017/089768 CN2017089768W WO2018232735A1 WO 2018232735 A1 WO2018232735 A1 WO 2018232735A1 CN 2017089768 W CN2017089768 W CN 2017089768W WO 2018232735 A1 WO2018232735 A1 WO 2018232735A1
Authority
WO
WIPO (PCT)
Prior art keywords
piezo1
residues
mouse
human
piezo2
Prior art date
Application number
PCT/CN2017/089768
Other languages
English (en)
Inventor
Bailong XIAO
Tingxin ZHANG
Yanfeng Wang
Shaopeng CHI
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Priority to PCT/CN2017/089768 priority Critical patent/WO2018232735A1/fr
Priority to CN201780092357.9A priority patent/CN111032069B/zh
Publication of WO2018232735A1 publication Critical patent/WO2018232735A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Definitions

  • the present disclosure relates to a bio-medicine , and more particularly to use of regulator used for activating or inhibiting Piezo in preparation of a medicament.
  • Mechanosensitive (MS) ion channels are molecular force transducers that are specialized to rapidly convert various mechanical forces into electrochemical signals for controlling key biological activities such as touch perception, hearing and blood pressure regulation. It is thus imperative to understand how this conversion process, termed mechanogating, precisely occurs. While significant progresses have been made in studying prokaryotic MS channels (i.e. MscL) , we know relatively little about the mechanogating mechanisms of mammalian MS cation channels.
  • Piezo1 and Piezo2 The evolutionarily conserved Piezo family of proteins, including Piezo1 and Piezo2, has been established as the long-sought mammalian MS cation channels.
  • Piezos In mice, Piezos have been shown to play critical roles in various mechanotransduction processes, including the sensation of touch, hearing and blood flow-associated shear stress.
  • mutations of Piezo genes resulting in altered channel functions have been linked to a number of genetic diseases involving mechanotransduction.
  • the Piezo channel represents a prototype of mammalian mechanosensitive cation channels. However, its mechanogating mechanisms remain unclear.
  • Embodiments of the present disclosure seek to solve at least one of the problems existing in the prior art to at least some extent, or to provide a consumer with a useful commercial choice.
  • Piezo1 chemical activators termed termed termed termed termed termed termed® that directly bind to and activate Piezo1 via modulating its mechanosensitivity.
  • Centurys act through the N-terminal extracellular loop regions that might reside in the distal blade-structure, instead of the C-terminal ion-conducting pore located away, suggesting a long-distance allosteric modulation of mechanogating.
  • the central region is identified to form the -long intracellular beam-structure, which bridges the blade to the pore.
  • Mutagenesis characterizations of specific extracellular loop regions or single residues in the beam reveal key determinants for cauliflower modulations and mechanotransduction and designated modalities for distinct mechanical stimuli such as poking and stretch.
  • SERCA2 a widely expressed endoplasmic-reticulum-localized Ca 2+ ATPase critical for maintaining cellular Ca 2+ homeostasis, as a novel regulatory protein of Piezo1.
  • SERCA2 binds to a 14-residue-constituted linker region that connects the pore-module and mechanotransduction-module, and inhibits Piezo1-mediated currents via suppressing its mechanosensitivity. Mutating residues in the linker region affects the mechanosensitivity and SERCA2-mediated modulation of Piezo1, demonstrating the key role of these residues in mechanogating and regulation.
  • SERCA2-mediated regulation critically controls Piezo1-dependent migration of endothelial cells.
  • regulator in preparation of a medicament for regulating at least one of the following, wherein the regulator is used for activating or inhibiting Piezo: blood vessel development; blood pressure regulation; red blood cell function; epithelia homeostasis; congenital lymphatic dysplasia; neuronal differentiation; renal function; bladder dysfunction; bone function; cell growth and migration; cancer development and metastasis; gentle touch; mechanical pain; lung function; neuromuscular function.
  • the regulator used for activating or inhibiting Piezo showed significant effect in regulating at least one of the described above.
  • the Piezo is Piezo1 or Piezo2.
  • the Piezo is from mouse or human beings.
  • the regulator is used for activating Piezo, wherein activating Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the extracellular loop regions of the N-terminal mechanotransduction-module; (2) the distal blade structure.
  • “acting on ” refer to but not limited to activating ⁇ binding or conduction.
  • the regulator is termed1, Sprint2 or functional analogs thereof.
  • the inventors surpringly found that Game1, Sprint2 or functional analogs thereof can activate Piezo1 effectively.
  • the regulator is polypeptide or functional analogs thereof , wherein the polypeptide is defined above.
  • the polypeptide is the extracellular loop regions of residues 657-677 and 870-921 of mouse Piezo1 ; or residues 651-671 and 875-926 of human Piezo1; or the extracellular loop regions of residues 762-782 and 1020-1071 of mouse Piezo2; residues 758-778 and 1054-1105 of human piezo2.
  • the regulator is used for inhibiting Piezo
  • inhibiting Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the C-terminal fragment of 1960-2547 of mouse Piezo1; or the C-terminal fragment of 1944-2521 of human Piezo1; (2) the C-terminal fragment of 2243-2822 of mouse Piezo2; or the C-terminal fragment of 2173-2752 of human Piezo1; (3) the linker region of mouse Piezo1: 2172-EKKYPQPKGQKKKK-2185; or the linker region of human Piezo1: 2156-EKKYPQPKGQKKKK-2169; and (4) the linker region of mouse Piezo2: 2455-EKRYPQPRGQKKKK-2468 ; or the linker region of human Piezo2: 2385-EKKYPQPKGQKKKK-2398.
  • “acting on ” aslocrefer to but not limited to activating ⁇ binding or conduction.
  • the regulator acting on at least one of the above sites or /or functional areas of Piezo can inhibite Piezo effectly.
  • the regulator is SERCA2 or functional analogs thereof.
  • SERCA2 or functional analogs thereof can inhibite Piezo1 effectively.
  • the regulator is polypeptide or functional analogs thereof , wherein the polypeptide is defined above, preferably, wherein the polypeptide is the linker region of mouse Piezo1: 2172 -2185 EKKYPQPKGQKKKK (SEQ ID NO: 1) ; or the linker region of human Piezo1: 2156-2169 EKKYPQPKGQKKKK; or the linker region of mouse Piezo2: 2455-2468 EKRYPQPRGQKKKK (SEQ ID NO: 3) ; or the linker region of human Piezo2: 2385-2398 EKKYPQPKGQKKKK (SEQ ID NO: 4) .
  • the polypeptide defined above or functional analogs thereof can inhibit effectively.
  • the polypeptide defined above or functional analogs thereof can be acted as Piezo inhibitor.
  • a method for screening drugs wherein the drugs is used for regulating at least one of the following: blood vessel development; blood pressure regulation; red blood cell function; epithelia homeostasis; congenital lymphatic dysplasia; neuronal differentiation; renal function; bladder dysfunction; bone function; cell growth and migration; cancer development and metastasis; gentle touch; mechanical pain; lung function; neuromuscular function, wherein the method comprising: (1) contacting candidate compounds with cells expressing Piezo channels, wherein the cells is from mouse or human beings ; (2) detecting activation levels or conformational changes of at least one of the following sites or /or functional areas of the Piezo before and after the contact: a.
  • the extracellular loop regions of the N-terminal mechanotransduction-module b. the distal blade structure.
  • the featured -long intracellular beam-structure f. residues F1302-Q1363 of the beam-structure of mouse Piezo1; or residues Y1307-R1368 of human Piezo1; g.
  • the drug selected by the above method according to the embodiment can be used effectively for at least one of the said functions.
  • the above mentioned method may possess at least one of the following additional features:
  • the Piezor is Piezor1 or Piezor2.
  • a method of treating Piezor related disease comprise: administrating regulator to a subject in need thereof, wherein the regulator is used for activating or inhibiting Piezo. It's found that regulator used for activating or inhibiting Piezo can treat Piezor related disease effectively.
  • the above mentioned method may possess at least one of the following additional features:
  • Piezo related disease include at least one of the following:
  • DHS hereditary stomatocytosis
  • DA5 distal arthrogryposis type 5
  • GS Gordon syndrome
  • MFS Marden-Walker syndrome
  • the regulator is used for activating Piezo
  • activating Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the extracellular loop regions of the N-terminal mechanotransduction-module; (2) the distal blade structure.
  • the regulator used for activating Piezo through one of the above sites or /or functional areas of Piezo can treat Piezor related disease effectively, such as dehydrated hereditary stomatocytosis (DHS) , distal arthrogryposis type 5 (DA5) , Gordon syndrome (GS) and Marden-Walker syndrome (MWS) , and generalized lymphatic dysplasia .
  • DHS dehydrated hereditary stomatocytosis
  • DA5 distal arthrogryposis type 5
  • GS Gordon syndrome
  • MFS Marden-Walker syndrome
  • generalized lymphatic dysplasia generalized lymphatic dysplasia
  • the regulator is used for inhibiting Piezo, wherein inhibiting Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the C-terminal fragment of 1960-2547 of mouse Piezo1; or the C-terminal fragment of 1944-2521 of human Piezo1; (2) the C-terminal fragment of 2243-2822 of mouse Piezo2; or the C-terminal fragment of 2173-2752 of human Piezo1; (3) the linker region of mouse Piezo1: 2172-EKKYPQPKGQKKKK-2185; or the linker region of human Piezo1: 2156-EKKYPQPKGQKKKK-2169; and (4) the linker region of mouse Piezo2: 2455-EKRYPQPRGQKKKK-2468 ; or the linker region of human Piezo2: 2385-EKKYPQPKGQKKKK-2398, optionally, wherein the regulator is SERCA2 or functional analog
  • Fig. 1 shows topological and structural illustration of the key components identified to be critical for Sprinto1;
  • Fig. 2 shows identification of Example1 and Example2 that evoke Piezo1-mediated Ca 2+ influx
  • Fig. 3 shows characterization of the electrophysiological effects of Sprint1
  • Fig. 4 shows Example1/2 and Yoda1 directly bind to the N-terminal region of 1-2190;
  • Fig. 5 shows the two extracellular loop regions 657-677 and 870-921 are critical for Sprinting and styrene-styrene-styrene-styrene-styrene-styrene-styrene-styrene-styrene-styrene-styrene-styrene-styrene-styrene-sstyrene-N
  • Fig. 6 shows mapping the intracellular beam domain
  • Fig. 7 shows L1342 and L1345 located in the beam domain determine the chemical activation and mechanosensitivity of mPiezo1;
  • Fig. 8 shows identification of SERCA2 as a novel interacting protein of Piezo1
  • Fig. 9 shows the linker region 2172-2185 of Piezo1 that connects the central pore and the peripheral propeller-structure is critical for SERCA2 interaction;
  • Fig. 10 shows SERCA2 inhibits Piezo1-mediated poking-evoked currents
  • Fig. 11 shows SERCA2 suppresses Piezo1 mechanosensitivity through the linker region
  • Fig. 12 shows regulation of Piezo1-dependent mechanotransduction processes by SERCA2 in HUVEC.
  • regulator in preparation of a medicament for regulating at least one of the following, wherein the regulator is used for activating or inhibiting Piezo: blood vessel development; blood pressure regulation; red blood cell function; epithelia homeostasis; congenital lymphatic dysplasia; neuronal differentiation; renal function; bladder dysfunction; bone function; cell growth and migration; cancer development and metastasis; gentle touch; mechanical pain; lung function; neuromuscular function.
  • the regulator used for activating or inhibiting Piezo showed significant effect in regulating at least one of the described above .
  • the Piezo is Piezo1 or Piezo2 .
  • the regulator used for activating or inhibiting Piezo1 or Piezo2 showed more significant effect in regulating at least one of the described above .
  • the Piezo is from mouse or human beings.
  • the regulator is used for activating Piezo, wherein activating Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the extracellular loop regions of the N-terminal mechanotransduction-module; (2) the distal blade structure.
  • “acting on ” refer to but not limited to activating ⁇ binding or conduction.
  • the regulator is termed1, Sprint2 or functional analogs thereof.
  • the inventors surpringly found that Game1, Sprint2 or functional analogs thereof can activate Piezo1 effectively.
  • the regulator is polypeptide or functional analogs thereof , wherein the polypeptide is defined above.
  • the polypeptide is the extracellular loop regions of residues 657-677 and 870-921 of mouse Piezo1 ; or residues 651-671 and 875-926 of human Piezo1; or the extracellular loop regions of residues 762-782 and 1020-1071 of mouse Piezo2; residues 758-778 and 1054-1105of human piezo2.
  • the regulator is used for inhibiting Piezo
  • inhibiting Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the C-terminal fragment of 1960-2547 of mouse Piezo1; or the C-terminal fragment of 1944-2521 of human Piezo1; (2) the C-terminal fragment of 2243-2822 of mouse Piezo2; or the C-terminal fragment of 2173-2752 of human Piezo1; (3) the linker region of mouse Piezo1: 2172-EKKYPQPKGQKKKK-2185; or the linker region of human Piezo1: 2156-EKKYPQPKGQKKKK-2169; and (4) the linker region of mouse Piezo2: 2455-EKRYPQPRGQKKKK-2468 ; or the linker region of human Piezo2: 2385-EKKYPQPKGQKKKK-2398.
  • “acting on ” aslocrefer to but not limited to activating ⁇ binding or conduction.
  • the regulator acting on at least one of the above sites or /or functional areas of Piezo can inhibite Piezo effectly.
  • the regulator is SERCA2 or functional analogs thereof.
  • SERCA2 or functional analogs thereof can inhibite Piezo1 effectively.
  • the regulator is polypeptide or functional analogs thereof , wherein the polypeptide is defined above, preferably, wherein the polypeptide is the linker region of mouse Piezo1: 2172 -2185 EKKYPQPKGQKKKK (SEQ ID NO: 1) ; or the linker region of human Piezo1: 2156-2169 EKKYPQPKGQKKKK; or the linker region of mouse Piezo2: 2455-2468 EKRYPQPRGQKKKK (SEQ ID NO: 3) ; or the linker region of human Piezo2: 2385-2398 EKKYPQPKGQKKKK (SEQ ID NO: 4) .
  • the polypeptide defined above or functional analogs thereof can inhibite Piezo effectively.
  • the polypeptide defined above or functional analogs thereof can be acted as Piezo inhibitor.
  • a method for screening drugs wherein the drugs is used for regulating at least one of the following: blood vessel development; blood pressure regulation; red blood cell function; epithelia homeostasis; congenital lymphatic dysplasia; neuronal differentiation; renal function; bladder dysfunction; bone function; cell growth and migration; cancer development and metastasis; gentle touch; mechanical pain; lung function; neuromuscular function, wherein the method comprising: (1) contacting candidate compounds with cells expressing Piezo channels, wherein the cells is from mouse or human beings ; (2) detecting activation levels or conformational changes of at least one of the following sites or /or functional areas of the Piezo before and after the contact: a.
  • the extracellular loop regions of the N-terminal mechanotransduction-module b. the distal blade structure.
  • the featured -long intracellular beam-structure f. residues F1302-Q1363 of the beam-structure of mouse Piezo1; or residues Y1307-R1368 of human Piezo1; g.
  • the drug selected by the above method according to the embodiment can be used effectively for at least one of the said functions.
  • the Piezor is Piezor1 or Piezor2.
  • a method of treating Piezor related disease comprise: administrating regulator to a subject in need thereof, wherein the regulator is used for activating or inhibiting Piezo. It's found that regulator used for activating or inhibiting Piezo can treat Piezor related disease effectively.
  • Piezor related disease include at least one of the following:
  • DHS hereditary stomatocytosis
  • DA5 distal arthrogryposis type 5
  • GS Gordon syndrome
  • MFS Marden-Walker syndrome
  • the regulator is used for activating Piezo
  • activating Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the extracellular loop regions of the N-terminal mechanotransduction-module; (2) the distal blade structure.
  • the regulator is used for inhibiting Piezo, wherein inhibiting Piezo is achieved by acting on at least one of the following sites or /or functional areas of Piezo: (1) the C-terminal fragment of 1960-2547 of mouse Piezo1; or the C-terminal fragment of 1944-2521 of human Piezo1; (2) the C-terminal fragment of 2243-2822 of mouse Piezo2; or the C-terminal fragment of 2173-2752 of human Piezo1; (3) the linker region of mouse Piezo1: 2172-EKKYPQPKGQKKKK-2185; or the linker region of human Piezo1: 2156-EKKYPQPKGQKKKK-2169; and (4) the linker region of mouse Piezo2: 2455-EKRYPQPRGQKKKK-2468 ; or the linker region of human Piezo2: 2385- EKKYPQPKGQKKKK-2398, optionally, wherein the regulator is SERCA2 or functional analog
  • the present invention aslo provides a pharmaceutical composition comprising regulator used for activating or inhibiting Piezo, such as Piezo activator critic1, romance2 or Piezo inhibitor SERCA2.
  • the pharmaceutical composition can futher comprise pharmaceutically acceptable excipient, carrier, adjuvant, solvent and a combination thereof.
  • the present invention provides a method of treating, preventing or ameliorating a disease or disorder, comprising administrating a safe and effective amount of a combination of drugs containing compounds and one or more therapeutic active agents.
  • the combination of drugs comprises one or more additional drugs for treatment of Piezor related disease.
  • the amount of the compound of the pharmaceutical composition disclosed herein refers to an amount which can be effectively activate or inhibite Piezor through at least one of the following loci and /or functional regions: a. the extracellular loop regions of the N-terminal mechanotransduction-module; b. the distal blade structure. c. the extracellular loop regions of residues 657-677 and 870-921 of mouse Piezo1 ; or residues 651-671 and 875-926 of human Piezo1; d. the extracellular loop regions of residues 762-782 and 1020-1071 of mouse Piezo2; residues 758-778 and 1054-1105 of human piezo2; e. the featured -long intracellular beam-structure; f.
  • the dosage of active ingredient in the compositions of this invention may be varied, however, it is necessary that the amount of the active ingerdient be such that a suitable dosage form is obtained.
  • the active ingredient may be administered to patients (animals or human) in need of such treatment in dosage that will provide optimal pharmaceutical efficacy. The selected dosage upon the desired therapeutic effect, on the route of administration, and on the duration of the treatment.
  • the dosage will vary from patient to patient depending upon the nature and severity of disease, the patient's weight, special diet then being followed by a patient, concurrent medication, and other factors which those skilled in the art will recognize.
  • the dosage range will generally be about 0.5 mg to 1.0 g per patient per day which may be administered in single or multiple doses. In one embodiment, the dosage range will be about 0.5 mg to 500 mg per patient per day; in anther embodiment about 0.5 mg to 200 mg per patient per day; and in yet another embodiment about 5 mg to 50 mg per patient per day.
  • a pharmaceutically acceptable derivative includes pharmaceutically acceptable salts, esters, salts of such esters, or any other adduct or derivative which upon administration to a patient in need thereof is capable of providing, directly or indirectly, a compound as otherwise described herein, or a metabolite or residue thereof.
  • the pharmaceutical compositions of the invention may be prepared and packaged in bulk form wherein a safe and effective amount of a compound of Formula (I) disclosed herein can be extracted and then given to the patient, such as with powders or syrups.
  • dosage levels of between 0.0001 to 10 mg/kg of body weight daily are administered to the patient to obtain effective activation or inhibiton of Piezo.
  • the pharmaceutical compositions of the invention may be prepared and packaged in unit dosage form wherein each physically discrete unit contains a safe and effective amount of a compound of Formula (I) disclosed herein.
  • the pharmaceutical compositions of the invention commonly contain from about 0.5 mg to 1 g, or 1 mg to 700 mg, or 5 mg to 100 mg, of the compound.
  • the weight ratio of the compound of the present invention to the second active ingredient may be varied and depend upon the effective dose of each ingredient. Generally, an effective dose of each will be used. Thus, for example, when a compound of the present invention is combined with another agent, the weight ratio of the compound of the present invention to the other agent will generally range from about 1000:1 to about 1:1000, such as about 200:1 to 1:200. Combinations of a compound of the present invention and other active ingredients will generally also be within the aforementioned range, but in each case, an effective dose of each active ingredient should be used.
  • “Pharmaceutically acceptable excipient” as used herein means a pharmaceutically acceptable material, composition or vehicle involved in giving form or consistency to the pharmaceutical composition. Each excipient must be compatible with the other ingredients of the pharmaceutical composition when commingled, such that interactions which would substantially reduce the efficacy of the compound of the invention when administered to a patient and would result in pharmaceutically unacceptable compositions are avoided. In addition, each excipient must of course be of sufficiently high purity to render it pharmaceutically acceptable.
  • Suitable pharmaceutically acceptable excipients will vary depending upon the particular dosage form chosen.
  • suitable pharmaceutically acceptable excipients may be chosen for a particular function that they may serve in the composition.
  • certain pharmaceutically acceptable excipients may be chosen for their ability to facilitate the production of uniform dosage forms.
  • Certain pharmaceutically acceptable excipients may be chosen for their ability to facilitate the production of stable dosage forms.
  • Certain pharmaceutically acceptable excipients may be chosen for their ability to facilitate the carrying or transporting the compound of the present invention once administered to the patient from one organ, or portion of the body, to another organ, or portion of the body.
  • Certain pharmaceutically acceptable excipients may be chosen for their ability to enhance patient compliance.
  • Suitable pharmaceutically acceptable excipients include the following types of excipients: diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, coating agents, wetting agents, solvents, co-solvents, suspending agents, emulsifiers, sweetners, flavoring agents, flavor masking agents, coloring agents, anticaking agents, humectants, chelating agents, plasticizers, viscosity increasing agents, antioxidants, preservatives, stabilizers, surfactants, and buffering agents.
  • excipients may serve more than one function and may serve alternative functions depending on how much of the excipient is present in the formulation and what other ingredients are present in the formulation.
  • Skilled artisans possess the knowledge and skill in the art to enable them to select suitable pharmaceutically acceptable excipients in appropriate amounts for use in the invention.
  • resources that are available to the skilled artisan which describe pharmaceutically acceptable excipients and may be useful in selecting suitable pharmaceutically acceptable excipients. Examples include Remington's Pharmaceutical Sciences (Mack Publishing Company) , The Handbook of Pharmaceutical Additives (Gower Publishing Limited) , and The Handbook of Pharmaceutical Excipients (the American Pharmaceutical Association and the Pharmaceutical Press) .
  • compositions of the invention are prepared using techniques and methods known to those skilled in the art. Some of the methods commonly used in the art are described in Remington's Pharmaceutical Sciences (Mack Publishing Company) .
  • Another aspect of the present invention is related to a method for preparing a pharmaceutical composition.
  • the pharmaceutical composition contains the compound disclosed herein and pharmaceutically acceptable excipient, carrier, adjuvant, vehicle or a combination thereof, the method comprises mixing various ingredients.
  • the pharmaceutical composition containing the compound disclosed herein can be prepared at for example environment temperature and under barometric pressure.
  • dosage forms include those adapted for (1) oral administration such as tablets, capsules, caplets, pills, troches, powders, syrups, elixers, suspensions, solutions, emulsions, sachets, and cachets; (2) parenteral administration such as sterile solutions, suspensions, and powders for reconstitution; (3) transdermal administration such as transdermal patches; (4) rectal administration such as suppositories; (5) inhalation such as aerosols, solutions, and dry powders; and (6) topical administration such as creams, ointments, lotions, solutions, pastes, sprays, foams, and gels.
  • oral administration such as tablets, capsules, caplets, pills, troches, powders, syrups, elixers, suspensions, solutions, emulsions, sachets, and cachets
  • parenteral administration such as sterile solutions, suspensions, and powders for reconstitution
  • transdermal administration such as transdermal patches
  • rectal administration such as sup
  • the compounds disclosed herein can be prepared to oral. In the other embodiment, the compounds disclosed herein can be prepared to inhalation. In the still other embodiment, the compounds disclosed herein can be prepared to nasal administration. In the yet other embodiment, the compounds disclosed herein can be prepared to transdermal administration. In the still yet other embodiments, the compounds disclosed herein can be prepared to topical administration.
  • compositions provided herein may be provided as compressed tablets, tablet triturates, chewable lozenges, rapidly dissolving tablets, multiple compressed tablets, or enteric-coating tablets, sugar-coated, or film-coated tablets.
  • Enteric-coated tablets are compressed tablets coated with substances that resist the action of stomach acid but dissolve or disintegrate in the intestine, thus protecting the active ingredients from the acidic environment of the stomach.
  • Enteric-coatings include, but are not limited to, fatty acids, fats, phenylsalicylate, waxes, shellac, ammoniated shellac, and cellulose acetate phthalates.
  • Sugar-coated tablets are compressed tablets surrounded by a sugar coating, which may be beneficial in covering up objectionable tastes or odors and in protecting the tablets from oxidation.
  • Film-coated tablets are compressed tablets that are covered with a thin layer or film of a water-soluble material.
  • Film coatings include, but are not limited to, hydroxyethylcellulose, sodium carboxymethylcellulose, polyethylene glycol 4000, and cellulose acetate phthalate. Film coating imparts the same general characteristics as sugar coating.
  • Multiple compressed tablets are compressed tablets made by more than one compression cycle, including layered tablets, and press-coated or dry-coated tablets.
  • the tablet dosage forms may be prepared from the active ingredient in powdered, crystalline, or granular forms, alone or in combination with one or more carriers or excipients described herein, including binders, disintegrants, controlled-release polymers, lubricants, diluents, and/or colorants. Flavoring and sweetening agents are especially useful in the formation of chewable tablets and lozenges.
  • the pharmaceutical compositions provided herein may be provided as soft or hard capsules, which can be made from gelatin, methylcellulose, starch, or calcium alginate.
  • the hard gelatin capsule also known as the dry-filled capsule (DFC) , consists of two sections, one slipping over the other, thus completely enclosing the active ingredient.
  • the soft elastic capsule (SEC) is a soft, globular shell, such as a gelatin shell, which is plasticized by the addition of glycerin, sorbitol, or a similar polyol.
  • the soft gelatin shells may contain a preservative to prevent the growth of microorganisms.
  • Suitable preservatives are those as described herein, including methyl-and propyl-parabens, and sorbic acid.
  • the liquid, semisolid, and solid dosage forms provided herein may be encapsulated in a capsule.
  • Suitable liquid and semisolid dosage forms include solutions and suspensions in propylene carbonate, vegetable oils, or triglycerides. Capsules containing such solutions can be prepared as described in U.S. Pat. Nos. 4,328,245; 4,409,239; and 4,410,545.
  • the capsules may also be coated as known by those of skill in the art in order to modify or sustain dissolution of the active ingredient.
  • compositions provided herein may be provided in liquid and semisolid dosage forms, including emulsions, solutions, suspensions, elixirs, and syrups.
  • An emulsion is a two-phase system, in which one liquid is dispersed in the form of small globules throughout another liquid, which can be oil-in-water or water-in-oil.
  • Emulsions may include a pharmaceutically acceptable non-aqueous liquids or solvent, emulsifying agent, and preservative.
  • Suspensions may include a pharmaceutically acceptable suspending agent and preservative.
  • Aqueous alcoholic solutions may include a pharmaceutically acceptable acetal, such as a di (lower alkyl) acetal of a lower alkyl aldehyde, e.g., acetaldehyde diethyl acetal; and a water-miscible solvent having one or more hydroxy groups, such as propylene glycol and ethanol.
  • Elixirs are clear, sweetened, and hydroalcoholic solutions.
  • Syrups are concentrated aqueous solutions of a sugar, for example, sucrose, and may also contain a preservative.
  • a solution in a polyethylene glycol may be diluted with a sufficient quantity of a pharmaceutically acceptable liquid carrier, e.g., water, to be measured conveniently for administration.
  • liquid and semisolid dosage forms include, but are not limited to, those containing the active ingredient (s) provided herein, and a dialkylated mono-or poly-alkylene glycol, including, 1, 2-dimethoxymethane, diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl ether, polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl ether, wherein 350, 550, and 750 refer to the approximate average molecular weight of the polyethylene glycol.
  • a dialkylated mono-or poly-alkylene glycol including, 1, 2-dimethoxymethane, diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl ether, polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl ether, wherein 350, 550, and 750 refer to the approximate average molecular weight of the polyethylene glycol.
  • formulations may further comprise one or more antioxidants, such as butylated hydroxytoluene (BHT) , butylated hydroxyanisole (BHA) , propyl gallate, vitamin E, hydroquinone, hydroxycoumarins, ethanolamine, lecithin, cephalin, ascorbic acid, malic acid, sorbitol, phosphoric acid, bisulfite, sodium metabisulfite, thiodipropionic acid and its esters, and dithiocarbamates.
  • antioxidants such as butylated hydroxytoluene (BHT) , butylated hydroxyanisole (BHA) , propyl gallate, vitamin E, hydroquinone, hydroxycoumarins, ethanolamine, lecithin, cephalin, ascorbic acid, malic acid, sorbitol, phosphoric acid, bisulfite, sodium metabisulfite, thiodipropionic acid and its esters, and dithiocarbamates
  • dosage unit formulations for oral administration can be microencapsulated.
  • the formulation can also be prepared to prolong or sustain the release as for example by coating or embedding particulate material in polymers, wax, or the like.
  • compositions provided herein for oral administration may be also provided in the forms of liposomes, micelles, microspheres, or nanosystems.
  • Miccellar dosage forms can be prepared as described in U.S. Pat. No. 6,350,458.
  • compositions provided herein may be provided as non-effervescent or effervescent, granules and powders, to be reconstituted into a liquid dosage form.
  • Pharmaceutically acceptable carriers and excipients used in the non-effervescent granules or powders may include diluents, sweeteners, and wetting agents.
  • Pharmaceutically acceptable carriers and excipients used in the effervescent granules or powders may include organic acids and a source of carbon dioxide.
  • Coloring and flavoring agents can be used in all of the above dosage forms.
  • the compounds disclosed herein can also be coupled to soluble polymers as targeted medicament carriers.
  • Such polymers may encompass polyvinylpyrrolidone, pyran copolymer, polyhydroxypropylmethacrylamidophenol, polyhydroxyethylaspartamidophenol or polyethylene oxide polylysine, substituted by palmitoyl radicals.
  • the compounds may furthermore be coupled to a class of biodegradable polymers which are suitable for achieving controlled release of a medicament, for example polylactic acid, poly-epsilon-caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydroxypyrans, polycyanoacrylates and crosslinked or amphipathic block copolymers of hydrogels.
  • compositions provided herein may be formulated as immediate or modified release dosage forms, including delayed-, sustained, pulsed-, controlled, targeted-, and programmed-release forms.
  • compositions provided herein may be co-formulated with other active ingredients which do not impair the desired therapeutic action, or with substances that supplement the desired action.
  • compositions provided herein may be administered parenterally by injection, infusion, or implantation, for local or systemic administration.
  • Parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular, intrasynovial, and subcutaneous administration.
  • compositions provided herein may be formulated in any dosage forms that are suitable for parenteral administration, including solutions, suspensions, emulsions, micelles, liposomes, microspheres, nanosystems, and solid forms suitable for solutions or suspensions in liquid prior to injection.
  • dosage forms can be prepared according to conventional methods known to those skilled in the art of pharmaceutical science (see, Remington: The Science and Practice of Pharmacy, supra) .
  • compositions intended for parenteral administration may include one or more pharmaceutically acceptable carriers and excipients, including, but not limited to, aqueous vehicles, water-miscible vehicles, non-aqueous vehicles, antimicrobial agents or preservatives against the growth of microorganisms, stabilizers, solubility enhancers, isotonic agents, buffering agents, antioxidants, local anesthetics, suspending and dispersing agents, wetting or emulsifying agents, complexing agents, sequestering or chelating agents, cryoprotectants, lyoprotectants, thickening agents, pH adjusting agents, and inert gases.
  • aqueous vehicles water-miscible vehicles
  • non-aqueous vehicles non-aqueous vehicles
  • antimicrobial agents or preservatives against the growth of microorganisms stabilizers, solubility enhancers, isotonic agents, buffering agents, antioxidants, local anesthetics, suspending and dispersing agents, wetting or emuls
  • Suitable aqueous vehicles include, but are not limited to, water, saline, physiological saline or phosphate buffered saline (PBS) , sodium chloride injection, Ringers injection, isotonic dextrose injection, sterile water injection, dextrose and lactated Ringers injection.
  • Non-aqueous vehicles include, but are not limited to, fixed oils of vegetable origin, castor oil, corn oil, cottonseed oil, olive oil, peanut oil, peppermint oil, safflower oil, sesame oil, soybean oil, hydrogenated vegetable oils, hydrogenated soybean oil, and medium-chain triglycerides of coconut oil, and palm seed oil.
  • Water-miscible vehicles include, but are not limited to, ethanol, 1, 3-butanediol, liquid polyethylene glycol (e.g., polyethylene glycol 300 and polyethylene glycol 400) , propylene glycol, glycerin, N-methyl-2-pyrrolidone, N, N-dimethylacetamide, and dimethyl sulfoxide.
  • Suitable antimicrobial agents or preservatives include, but are not limited to, phenols, cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoates, thimerosal, benzalkonium chloride (e.g., benzethonium chloride) , methyl-and propyl-parabens, and sorbic acid.
  • Suitable isotonic agents include, but are not limited to, sodium chloride, glycerin, and dextrose.
  • Suitable buffering agents include, but are not limited to, phosphate and citrate.
  • Suitable antioxidants are those as described herein, including bisulfite and sodium metabisulfite.
  • Suitable local anesthetics include, but are not limited to, procaine hydrochloride.
  • Suitable suspending and dispersing agents are those as described herein, including sodium carboxymethylcelluose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone.
  • Suitable emulsifying agents include those described herein, including polyoxyethylene sorbitan monolaurate, polyoxyethylene sorbitan monooleate 80 and triethanolamine oleate.
  • Suitable sequestering or chelating agents include, but are not limited to EDTA.
  • Suitable pH adjusting agents include, but are not limited to, sodium hydroxide, hydrochloric acid, citric acid, and lactic acid.
  • Suitable complexing agents include, but are not limited to, cyclodextrins, including ⁇ -cyclodextrin, ⁇ -cyclodextrin, hydroxypropyl- ⁇ -cyclodextrin, sulfobutylether- ⁇ -cyclodextrin, and sulfobutylether 7- ⁇ -cyclodextrin ( CyDex, Lenexa, Kans. ) .
  • compositions provided herein may be formulated for single or multiple dosage administration.
  • the single dosage formulations are packaged in an ampoule, a vial, or a syringe.
  • the multiple dosage parenteral formulations must contain an antimicrobial agent at bacteriostatic or fungistatic concentrations. All parenteral formulations must be sterile, as known and practiced in the art.
  • the pharmaceutical compositions are provided as ready-to-use sterile solutions.
  • the pharmaceutical compositions are provided as sterile dry soluble products, including lyophilized powders and hypodermic tablets, to be reconstituted with a vehicle prior to use.
  • the pharmaceutical compositions are provided as ready-to-use sterile suspensions.
  • the pharmaceutical compositions are provided as sterile dry insoluble products to be reconstituted with a vehicle prior to use.
  • the pharmaceutical compositions are provided as ready-to-use sterile emulsions.
  • the pharmaceutical compositions may be formulated as a suspension, solid, semi-solid, or thixotropic liquid, for administration as an implanted depot.
  • the pharmaceutical compositions provided herein are dispersed in a solid inner matrix, which is surrounded by an outer polymeric membrane that is insoluble in body fluids but allows the active ingredient in the pharmaceutical compositions diffuse through.
  • Suitable inner matrixes include polymethylmethacrylate, polybutyl-methacrylate, plasticized or unplasticized polyvinylchloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene-vinyl acetate copolymers, silicone rubbers, polydimethylsiloxanes, silicone carbonate copolymers, hydrophilic polymers, such as hydrogels of esters of acrylic and methacrylic acid, collagen, cross-linked polyvinyl alcohol, and cross-linked partially hydrolyzed polyvinyl acetate.
  • Suitable outer polymeric membranes include polyethylene, polypropylene, ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, ethylene/vinyl acetate copolymers, silicone rubbers, polydimethyl siloxanes, neoprene rubber, chlorinated polyethylene, polyvinylchloride, vinyl chloride copolymers with vinyl acetate, vinylidene chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber epichlorohydrin rubbers, ethylene/vinyl alcohol copolymer, ethylene/vinyl acetate/vinyl alcohol terpolymer, and ethylene/vinyloxyethanol copolymer.
  • the pharmaceutical composition of the invention is prepared to a dosage form adapted for administration to a patient by inhalation, for example as a dry powder, an aerosol, a suspension, or a solution composition.
  • the invention is directed to a dosage form adapted for administration to a patient by inhalation as a dry powder.
  • the invention is directed to a dosage form adapted for administration to a patient by inhalation as a dry powder.
  • Dry powder compositions for delivery to the lung by inhalation typically comprise a compound disclosed herein or a pharmaceutically acceptable salt thereof as a finely divided powder together with one or more pharmaceutically-acceptable excipients as finely divided powders.
  • compositions particularly suited for use in dry powders are known to those skilled in the art and include lactose, starch, mannitol, and mono-, di-, and polysaccharides.
  • the finely divided powder may be prepared by, for example, micronisation and milling.
  • the size-reduced (e.g. micronised) compound can be defined by a D 50 value of about 1 to about 10 microns (for example as measured using laser diffraction) .
  • Aerosols may be formed by suspending or dissolving a compound disclosed herein or a pharmaceutically acceptable salt thereof in a liquified propellant.
  • Suitable propellants include halocarbons, hydrocarbons, and other liquified gases.
  • Representative propellants include: trichlorofluoromethane (propellant 11) , dichlorofluoromethane (propellant 12) , dichlorotetrafluoroethane (propellant 114) , tetrafluoroethane (HFA-134a) , 1, 1-difluoroethane (HFA-152a) , difluoromethane (HFA-32) , pentafluoroethane (HFA-12) , heptafluoropropane (HFA-227a) , perfluoropropane, perfluorobutane, perfluoropentane, butane, isobutane, and pentane.
  • the aerosol may contain additional pharmaceutically-acceptable excipients typically used with MDIs such as surfactants, lubricants, cosolvents and other excipients to improve the physical stability of the formulation, to improve valve performance, to improve solubility, or to improve taste.
  • additional pharmaceutically-acceptable excipients typically used with MDIs such as surfactants, lubricants, cosolvents and other excipients to improve the physical stability of the formulation, to improve valve performance, to improve solubility, or to improve taste.
  • compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the patient for a prolonged period of time.
  • the active ingredient may be delivered from the patch by iontophoresis as generally described in Pharmaceutical Research, 3 (6) , 318 (1986) .
  • compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols or oils.
  • Ointments, creams and gels may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agent and/or solvents.
  • bases may thus, for example, include water and/or an oil such as liquid paraffin or a vegetable oil such as arachis oil or castor oil, or a solvent such as polyethylene glycol.
  • Thickening agents and gelling agents which may be used according to the nature of the base include soft paraffin, aluminium stearate, cetostearyl alcohol, polyethylene glycols, woolfat, beeswax, carboxypolymethylene and cellulose derivatives, and/or glyceryl monostearate and/or non-ionic emulsifying agents.
  • Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilising agents, dispersing agents, suspending agents or thickening agents.
  • Powders for external application may be formed with the aid of any suitable powder base, for example, talc, lactose or starch.
  • Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilising agents, suspending agents or preservatives.
  • Topical preparations may be administered by one or more applications per day to the affected area; over skin areas occlusive dressings may advantageously be used. Continuous or prolonged delivery may be achieved by an adhesive reservoir system.
  • the therapies disclosed herein comprise administrating a safe and effective amount of the compound or the pharmaceutical composition containing the compound to patients in need.
  • Each example disclosed herein comprises the method of treating the diseases above comprising administrating a safe and effective amount of the compound to patients in need.
  • the compound of the invention or the pharmaceutical composition thereof may be administered by any suitable route of administration, including both systemic administration and topical administration.
  • Systemic administration includes oral administration, parenteral administration, transdermal administration and rectal administration.
  • Parenteral administration refers to routes of administration other than enteral or transdermal, and is typically by injection or infusion.
  • Parenteral administration includes intravenous, intramuscular, and subcutaneous injection or infusion.
  • Topical administration includes application to the skin as well as intraocular, otic, intravaginal, inhaled and intranasal administration.
  • the compound of the invention or the pharmaceutical composition thereof may be administered orally.
  • the compound of the invention or the pharmaceutical composition thereof may be administered by inhalation.
  • the compound of the invention or the pharmaceutical composition thereof may be administered intranasally.
  • the compound of the invention or the pharmaceutical composition thereof may be administered once or according to a dosing regimen wherein a number of doses are administered at varying intervals of time for a given period of time. For example, doses may be administered one, two, three, or four times per day. In one embodiment, a dose is administered once per day. In a further embodiment, a dose is administered twice per day. Doses may be administered until the desired therapeutic effect is achieved or indefinitely to maintain the desired therapeutic effect. Suitable dosing regimens for the compound of the invention or the pharmaceutical composition thereof depend on the pharmacokinetic properties of that compound, such as absorption, distribution, and half-life, which can be determined by the skilled artisan.
  • suitable dosing regimens including the duration such regimens are administered, for the compound of the invention or the pharmaceutical composition thereof depend on the disorder being treated, the severity of the disorder being treated, the age and physical condition of the patient being treated, the medical history of the patient to be treated, the nature of concurrent therapy, the desired therapeutic effect, and like factors within the knowledge and expertise of the skilled artisan. It will be further understood by such skilled artisans that suitable dosing regimens may require adjustment given an individual patient's response to the dosing regimen or over time as individual patient needs change.
  • the compounds of the present invention may be administered either simultaneously with, or before or after, one or more other therapeutic agents.
  • the compounds of the present invention may be administered separately, by the same or different route of administration, or together in the same pharmaceutical composition as the other agents.
  • the pharmaceutical composition or combination of the present invention can be in unit dosage of about 1-1000 mg of active ingredients for a subject of about 50-70 kg, preferably about 1-500 mg or about 1-250 mg or about 1-150 mg or about 0.5-100 mg or about 1-50 mg of active ingredients.
  • the therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the disorder or disease.
  • the above-cited dosage properties are demonstrable in vitro and in vivo tests using advantageously mammals, e.g., mice, rats, dogs, monkeys or isolated organs, tissues and preparations thereof.
  • the compounds of the present invention can be applied in vitro in the form of solutions, e.g., preferably aqueous solutions, and in vivo either enterally or parenterally, advantageously intravenously, e.g., as a suspension or in aqueous solution.
  • a therapeutically effective dosage of the compound disclosed herein from about 0.1 mg to about 2,000 mg per day.
  • the pharmaceutical compositions should provide a dosage of from about 0.1 mg to about 2000 mg of the compound.
  • pharmaceutical dosage unit forms are prepared to provide from about 1 mg to about 2,000 mg, about 10 mg to about 1,000 mg, about 20 mg to about 500 mg, or about 25 mg to about 250 mg of the active ingredient or a combination of essential ingredients per dosage unit form.
  • pharmaceutical dosage unit forms are prepared to provide about 10 mg, 20 mg, 25 mg, 50 mg, 100 mg, 250 mg, 500 mg, 1000 mg or 2000 mg of the active ingredient.
  • a prodrug of a compound of the invention is a functional derivative of the compound which, upon administration to a patient, eventually liberates the compound of the invention in vivo.
  • Administration of a compound of the invention as a prodrug may enable the skilled artisan to do one or more of the following: (a) modify the onset of action of the compound in vivo; (b) modify the duration of action of the compound in vivo; (c) modify the transportation or distribution of the compound in vivo; (d) modify the solubility of the compound in vivo; and (e) overcome a side effect or other difficulty encountered with the compound.
  • Typical functional derivatives used to prepare prodrugs include modifications of the compound that are chemically or enzymatically cleaved in vivo. Such modifications, which include the preparation of phosphates, amides, esters, thioesters, carbonates, and carbamates, are well known to those skilled in the art.
  • Human embryonic kidney 293T (HEK293T) cells were grown in Dulbecco’s Modified Eagle Medium containing 4.5mg/ml glucose, 10%fetal bovine serum, 1%penicillin/streptomycin. Cells were seeded in 50ug/ml poly-D-lysine coated 96-well plates (3 x 10 4 cells/well) and allowed to grow for about 18 h, and then co-transfected with a total of 250 ng cDNA containing Piezo1 or Piezo2 and GCaMP6s using lipofectamine 2000 (Invitrogen, Life technology) .
  • Dulbecco’s Modified Eagle Medium containing 4.5mg/ml glucose, 10%fetal bovine serum, 1%penicillin/streptomycin. Cells were seeded in 50ug/ml poly-D-lysine coated 96-well plates (3 x 10 4 cells/well) and allowed to grow for about 18 h, and then co-transfected with a total
  • PCA1 and PCA2 Piezo1 Chemical Activator 1 and 2
  • PCA1 and PCA2 were identified from the fragment library.
  • PCA1 was purchased from Alfa Aesar.
  • PCA2 and Yoda1 were synthesized from the laboratories of Drs. Wei He and Liansuo Zu, respectively. See the Supplementary Experiment Procedures for the chemical synthesis.
  • Fura-2 single cell Ca 2+ imaging was performed according to the previous protocol.
  • mCherry-Piezo1 cDNA (1 ⁇ g) -transfected HEK293T cells were plated onto 12-mm round glass coverslips which were coated with poly-D-lysine and placed in 24-well plates, and subject to Fura-2single cell Ca2+ imaging about 36 h post transfection.
  • Cells were washed with the buffer containing 1xHBSS (1.3mM Ca 2+ ) and 10 mM HEPES (pH7.2) , incubated with 2.5 ⁇ M Fura-2 and 0.05%Pluronic F-127 (Life technologies) for ⁇ 1h after, then washed again with the buffer.
  • the coverslip was mounted into an inverted Nikon-Tie microscopy equipped with a CoolSNAP CCD camera and Lambda XL light box (Sutter Instrument) , and mCherry positive and negative cells were selected for measurement of the 340/380 ratio with a 20 X objective (N. A. 0.75) using the MetaFluor Fluorescence Ratio Imaging software (Molecular Device) .
  • Protocols for HEK293T cell culture, transient transfection and Patch-clamp experiments with an Axopatch 200B amplifier (Axon Instruments) or HEKA EPC10 were essentially similar to the previously described 6, 8.
  • recording electrodes had a resistance of 2-3 M ⁇ when filled with internal solution composed of (in mM) 133 CsCl, 1 CaCl 2 , 1 MgCl2, 5 EGTA, 10 HEPES (pH 7.3 with CsOH) , 4 MgATP and 0.4 Na 2 GTP.
  • the extracellular solution was composed of (in mM) 133 NaCl, 3 KCl, 2.5 CaCl2, 1 MgCl 2 , 10 HEPES (pH 7.3 with NaOH) and 10 glucose. All experiments were done at room temperature. Currents were sampled at 20 kHz, filtered at 5 kHz using Clampex 10.4 software (Axon Instruments) or Patchmaster software. Leak currents before mechanical stimulations were subtracted off-line from the current traces. Voltages were not corrected for a liquid junction potential (LJP) except for ion selectivity experiments. LJP was calculated using Clampex 10.4 software.
  • Stretch-activated currents were recorded in the cell-attached patch clamp configuration as described previously 8. Currents were sampled at 20 kHz and filtered at 2 kHz. Pipette were filled with a solution consisting of (in mM) 130 NaCl, 5 KCl, 10 HEPES, 1 CaCl2, 1 MgCl2 , 10 TEA-Cl (pH 7.3 with NaOH) and external solution used to zero the membrane potential consisted of (in mM) 140 KCl, 10 HEPES, 1 MgCl2, 10 glucose (pH 7.3 with KOH) . All experiments were done at room temperature.
  • Membrane patches were stimulated with 500 ms negative pressure pulses through the recording electrode using Patchmaster controlled pressure clamp HSPC-1 device (ALAscientific) . Stretch-activated channels were recorded at a holding potential of -80 mV with pressure steps from 0 to -100 mm Hg (-10 mm Hg increments) , and 4-11 recording traces were averaged percell for analysis.
  • I (P) [1 + exp (- (P –P50) /s) ] -1, where I is the peak of stretch-activated current at a given pressure, P is the applied patch pressure (in mm Hg) , P50 is the pressure value that evoked a current value which is 50%of Imax, and s reflects the current sensitivity to pressure.
  • the protein purification procedure was essentially similar to our previously described protocols FPLC (Superose 6 column) peak fractions containing mPiezo1 wild type or mutant proteins were subject for SPR binding experiments.
  • the purified Piezo1 proteins were cross-linked at room temperature with DSS (disuccinimidyl suberate) , BS3 (bis [sulfosuccinimidyl] suberate) , Sulfo-GMBS (N- [gmaleimidobutyryloxy] sulfosuccinimide ester) whose spacer arm lengths are and respectively.
  • DSS disuccinimidyl suberate
  • BS3 bis [sulfosuccinimidyl] suberate
  • Sulfo-GMBS N- [gmaleimidobutyryloxy] sulfosuccinimide ester
  • the pLink search parameters were similar to what had been previously described 30: instrument, HCD; precursor mass tolerance, 20 ppm; fragment mass tolerance 20 ppm; cross-linker, BS3/DSS (cross-linking sites K and protein N terminus, cross-link mass-shift 138.0680796, mono-link massshift156.0786442) ; cross-linker, Sulfo-GMBS (cross-linking sites K or protein N terminus with cysteine, cross-link mass-shift 165.0422, mono-link mass-shift 183.05276) ; fixed modification C57.02146 was specified for BS3/DSS search; peptide length, minimum 4 amino acids and maximum 100 amino acids per chain; peptide mass, minimum 400 and maximum 10,000 Da per chain; enzyme, Trypsin, with up to two missed cleavage sites per chain (four per cross-link) .
  • HEK293T cells were cultured on the 4-Chamber Glass Bottom Dish (In Vitro Scientific) , and then transfected with 2 ⁇ g mPiezo1-Clover (1365) -mRuby2 (C) or co-transfected with 1 ⁇ g mPiezo1-Clover (C) and 1 ⁇ g mPiezo1-mRuby2 (C) cDNA, respectively. 36 h after transfection, cells were washed with the buffer containing 1xHBSS (1.3mM Ca2+) and 10mM HEPES (pH7.2) .
  • Clover was excited at 488nm with an argon laser and detected through a 560 nm bandpass filter, whereas mRuby2 was excited at 559 nm using a yellow Laser and detected through a 585 nm long-pass filter.
  • the FRET was determined for individual cells transfected with mPiezo1-Clover (1365) -mRuby2 (C) or co-transfected with mPiezo1-Clover (C) and mPiezo1-mRuby2 (C) using the acceptor photobleaching method 35.
  • a selected area of a cell was photo-bleached with the 559 nm laser for 3 sto achieve ⁇ 80%of photobleaching effect of the mRuby2 fluorescence, and the Clover fluorescence was obtained before and after photobleaching the mRuby2 acceptor.
  • the mouse Piezo1 (mPiezo1) and mouse Piezo2 (mPiezo2) clones were generously provided by Dr. Ardem Patapoutian at the Scripps Research Institute.
  • the Piezo1-Flag construct was generated by replacing the C-terminal GST-tag of the Piezo1-GST-ires-GFP or Piezo2-GST-ires-GFP construct with the Flag-tag.
  • the Flag-SERCA2 clone was a gift from Dr. Xun Huang at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. All the mutations, truncations and other molecular cloning were conducted with the one step cloning kit according to the instruction manual (Vazyme Biotech) . All constructs were verified by sequencing.
  • Human embryonic kidney 293T (HEK293T) cells were cultured in DMEM supplemented with 10%fetal bovine serum (FBS) , 50 U/mL penicillin and 50 ⁇ g/mL streptomycin.
  • Neuro-2A (N2A) cells were cultured in MEM containing 10%FBS, non-essential amino acids, 1 mM sodium pyruvate, 50 U/mL penicillin and 50 ⁇ g/mL streptomycin.
  • Human umbilical vein endothelial cells (HUVECs) were purchased from Allcells Co. Ltd.
  • HUVECs were used for the experiments for up to 8 passages.
  • the cells were transfected using polyethylenimine (PEI) (Polysciences) or Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.
  • the mPiezo1 antibody was custom generated by Abgent Co. Ltd (Suzhou, China) . The procedure is summarized briefly as follows. The C-terminal extracellular region of mPiezo1 (amino acids 2218-2453) was expressed in bacteria and purified for immunization in rabbit, then the mPiezo1 rabbit antibody was purified by antigen affinity chromatography. The antibody was used at concentrations of 1:500 –1:2000 for western blotting.
  • antibodies used for western blotting include rabbit anti-GST (Millipore, 1:3,000) , mouse anti-SERCA2 (Thermo, MA3-910, 1:1,000) , mouse anti-Flag (Sigma, clone M2, 1:3,000) , mouse anti-eNOS (BD Biosciences, 1:1000) , mouse anti-p (S1177) -eNOS (BD Biosciences, 1:1,000) , rabbit anti- ⁇ -actin (Cell Signaling Technology, 1:3,000) .
  • Cell lysates derived from HEK293T transiently transfected with the indicated constructs were prepared as previously described.
  • glutathione magnetic beads Pieris
  • the beads were washed 5 times and boiled for 5-10 minutes in 1 ⁇ SDS loading buffer.
  • the protein samples were separated by SDS-PAGE gels and then subjected to either silver staining according to the instruction manual (Sigma) or western blotting.
  • the anti-Flag M2 magnetic beads (Sigma) were used.
  • N2A cells were lysed in the Tris-HCl lysis buffer [10 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM EDTA, 1%Triton X-100, 0.5%NP-40, protease inhibitors (Roche) and PhosSTOP phosphatase inhibitors (Roche) ] on ice for 1 h.
  • the protein G magnetic beads (Cell Signaling Technology) were incubated with either IgG or the anti-SERCA2 antibody (Thermo, MA3-910, 1: 100) at 4 °C for 2 h.
  • the antibody-bound beads were incubated with the N2A cell lysates at 4 °C for overnight, and subsequently washed for 5 times with lysis buffer.
  • the immunoprecipitated proteins were subjected to SDS-PAGE and western blotting analysis.
  • Protein samples derived from the GST pull-down, immunoprecipitation or HUVEC cell lysates were subjected to SDS-PAGE gels and electrophoresis separation.
  • the proteins were transferred to 0.45 ⁇ m PVDF membranes (Millipore) for western blotting according to the procedure described previously. In brief, the membrane was blocked by 5%non-fat milk (Bio-rad) in TBST buffer (TBS buffer with 0.1%Tween-20) and incubated with the primary antibodies for overnight.
  • the membrane was incubated with the peroxidase-conjugated anti-rabbit IgG secondary antibody (CST, 1:10,000) or anti-mouse IgG secondary antibody (pierce, 1: 20,000) at room temperature for 1 h, followed with washing and detection using the ECL detection kit (Pierce) .
  • CST peroxidase-conjugated anti-rabbit IgG secondary antibody
  • pierce anti-mouse IgG secondary antibody
  • Knock-down of Piezo1 in N2A cells was achieved by infection of the lentivirus containing either control or mPiezo1 shRNAs.
  • the PLL3.7 lentivirus vector containing the shRNA encoding sequence and the helper vectors (pMDLg/pRRE, pRSV-Rev and pCMV-VSV-G) were co-transfected into HEK293T cells using PEI.
  • virus present in the culture medium were collected and filtered through a filter of 0.45 ⁇ m size (Millipore) .
  • the virus-containing medium was further concentrated by 200-fold using polyethylene glycol precipitation (Sigma) .
  • shRNA or siRNA sequences are listed in below:
  • mPiezo1 shRNA TCGGCGCTTGCTAGAACTTCA (SEQ ID NO: 5) ;
  • hPiezo1 siRNA AGAAGAAGAUCGUCAAGUA (SEQ ID NO: 7) ;
  • hSERCA2 siRNA mix pool
  • AAGCAGGACAUCAAUGAGCAA (SEQ ID NO: 8) ;
  • AAGGUGAUACUUGUUCCCUUA (SEQ ID NO: 9) ;
  • the Real-Time PCR primers used for Piezo1 include:
  • Piezo1 Forward primer 5’-TGCCATGCTCCTCTATCTGCT-3’ (SEQ ID NO: 12) ;
  • Piezo1 Reverse primer 5’-GGCGCACACATAGATCCAGTA-3’ (SEQ ID NO: 13) ;
  • GAPDH Forward primer 5’-GCACCACCAACTGCTTAG-3’ (SEQ ID NO: 14) ;
  • GAPDH Reverse primer 5’-GGATGCAGGGATGATGTTC-3’ (SEQ ID NO: 15) .
  • single-guide RNA (sgRNA) sequence was designed by the CRISPR Design Tool (http: //crispr. mit. edu) and then a pair of complementary oligo DNA segments containing the sgRNA sequence were synthesized, annealed and inserted into the Cas9-gRNA expression plasmid pX330 (Addgene) .
  • the plasmid-based donor repair template was made with the pcDNA3.1 (-) plasmid (containing an ires-GFP reporter) by inserting a pair of mPiezo1 genome sequences (about 600 bp) flanking the site G2410 as homology arms and the inserted Flag tag sequence.
  • N2A cells were transfected with the pX330 plasmid containing sgRNA sequence and the donor plasmid. 48 hours after transfection, GFP positive cells were isolated and sub-cultured into 96-well plates (single cell per well) by fluorescence activated cell sorting (FACS) . Then the grown cell clones were selected and insertion of the Flag-tag encoding sequence into the Piezo1 genome was detected by PCR and sequencing.
  • FACS fluorescence activated cell sorting
  • the mPiezo1 sgRNA sequence UGGGGAGCAAGCGGGCACCA (SEQ ID NO: 16) ;
  • the cells were then incubated with the rabbit anti-Flag antibody (Sigma, clone M2, 1:500) or mouse anti-SERCA2 (1:500) at room temperature for 1 hour. After washing with the TBST buffer, cells were incubated with the Alexa Fluor 594 donkey-anti-rabbit IgG secondary antibody (Invitrogen, 1:500) or Alexa Fluor 488 donkey-anti-mouse IgG secondary antibody (Invitrogen, 1:500) at room temperature for 1 hour. After washing, coverslips were mounted onto the glass slide for confocal imaging.
  • rabbit anti-Flag antibody Sigma, clone M2, 1:500
  • mouse anti-SERCA2 1:500
  • the images were analyzed using the Nikon NIS-Elements AR software or the SoftWoRx Explorer software (GE Healthcare Life Sciences) .
  • Fura-2 single cell Ca 2+ imaging was performed according to the previous protocol.
  • Flag-SERCA2-ires-GFP cDNA cDNA (0.5 ⁇ g) or Flag-SERCA2-IRES-GFP cDNA (0.5 ⁇ g) -transfected HEK293T cells were plated onto and placed in 24-well plates, and subject to Fura-2 single cell Ca 2+ imaging about 36 h post transfection.
  • Protocols for HEK293T cell culture, transient transfection and Patch-clamp experiments with an Axopatch 200B amplifier (Axon Instruments) or HEKA EPC10 were essentially similar to the previously described 19 .
  • Axopatch 200B amplifier Anaxon Instruments
  • HEKA EPC10 HEKA EPC10
  • Flag-SERCA2-ires-GFP/Piezo1-mCherry or FLAG-SERCA2-ires-RFP/Piezo1-pp-GST-ires-GFP were co-transfected for identifying co-expressing cells showing both GFP and mCherry or RFP signals.
  • the observed mechanically activated currents were similar between the two transfection conditions, and therefore the data were combined.
  • recording electrodes had a resistance of 2-3 M ⁇ when filled with internal solution composed of (in mM) 133 CsCl, 1 CaCl 2 , 1 MgCl 2 , 5 EGTA, 10 HEPES (pH 7.3 with CsOH) , 4 MgATP and 0.4 Na 2 GTP.
  • the extracellular solution was composed of (in mM) 133 NaCl, 3 KCl, 2.5 CaCl 2 , 1 MgCl 2 , 10 HEPES (pH 7.3 with NaOH) and 10 glucose. All experiments were done at room temperature. Currents were sampled at 20 kHz, filtered at 5 kHz using Clampex 10.4 software (Axon Instruments) or Patchmaster software. Leak currents before mechanical stimulations were subtracted off-line from the current traces. Voltages were not corrected for a liquid junction potential (LJP) .
  • LJP liquid junction potential
  • Stretch-activated currents were recorded in the cell-attached patch clamp configuration as described previously 19 . Currents were sampled at 20 kHz and filtered at 2 kHz. Pipette were filled with a solution consisting of (in mM) 130 NaCl, 5 KCl, 10 HEPES, 1 CaCl 2 , 1 MgCl 2 , 10 TEA-Cl (pH 7.3 with NaOH) and external solution used to zero the membrane potential consisted of (in mM) 140 KCl, 10 HEPES, 1 MgCl 2 , 10 glucose (pH 7.3 with KOH) . All experiments were done at room temperature.
  • Membrane patches were stimulated with 500 ms negative pressure pulses through the recording electrode using Patchmaster controlled pressure clamp HSPC-1 device (ALA-scientific) . Stretch-activated channels were recorded at a holding potential of -80 mV with pressure steps from 0 to -100 mm Hg (-10 mm Hg increments) , and 4-11 recording traces were averaged per cell for analysis.
  • Patchmaster controlled pressure clamp HSPC-1 device ALA-scientific
  • I (P) [1 + exp (- (P –P 50 ) /s) ] -1 , where I is the peak of stretch-activated current at a given pressure, P is the applied patch pressure (in mm Hg) , P 50 is the pressure value that evoked a current value which is 50%of Imax, and s reflects the current sensitivity to pressure.
  • the cell migration assay was performed using the transwell permeable supports (8.0 ⁇ m pores, Corning) .
  • HUVECs transfected with siRNAs were starved with EGM-2 medium without FBS for 4-6 hours, and then digested with 0.25%trypsin-EDTA (Gibco) .
  • Cells were re-suspended and sub-cultured into the transwell insert at a concentration of 5 ⁇ 10 4 cells /well in 100 ⁇ l EGM-2 medium containing 0.4%FBS.
  • the lower compartment was added with 500 ⁇ l EGM2 medium supplemented with 0.4%FBS and 25 ng/mL VEGF (Peprotech) .
  • the insert was fixed by 4%PFA for 10 minutes at 37 °C. After washing with 1 ⁇ PBS, the cells on the inside of each insert were swabbed gently and the underside of each insert was stained by 0.1%crystal violet (Amersco) .
  • the migrating cells were imaged using an Olympus IX73 light microscopy and evaluated with the ImageJ software (National Institutes of Health) .
  • the sequence from the linker region (amino acids 2171-2185) of the mPiezo1 protein was synthesized and myristoylated at its N-terminus (myr-NH2-TEKKYPQPKGQKKKK-COOH) by GeneScript (Nanjng, China) .
  • the scrambled peptide was synthesized with the same composition and did not resemble any known protein (myr-NH2-KQKPKTKEKYKQKGT-COOH) .
  • the peptides was added to the cell lysates with a working concentration of 200 ⁇ M and incubated overnight.
  • the peptides were pre-mixed in the internal solution (50 ⁇ M, 200 ⁇ M) and filled in the pipettes.
  • the peptides was added to the culture medium for at least 30 minutes with a final concentration of 50 ⁇ M.
  • siRNAs specifically targeting human SERCA2 were purchased from Qiagen.
  • the siRNA targeting mouse SERCA2 was sythesized by Sigma.
  • Scrambled siRNA and the siRNA targeting human Piezo1 were synthesized by GenePharma Co. Ltd. (Shanghai, China) .
  • Yoda1 was purchased from Maybrige.
  • GsMTx4 was purchased from Tocris Bioscience. Other chemicals were purchased from Sigma or Ameresco.
  • the long intracellular beam might utilize L1342/L1345 as a pivot point to form a lever-like apparatus, enabling Piezo1 to effectively transduce force from the distal mechanosensing blade to the central ion-conducting pore (Fig. 1) .
  • the inventors next examined the effect of romance on Piezo1 whole-cell currents evoked via poking the plasma membrane with a piezo-driven blunted glass pipette.
  • the poking-induced whole-cell currents of mPiezo1-mRuby2-expressing cells were increased 3.8 ⁇ 0.5 and 5.4 ⁇ 0.7 folds, suggesting potentiation of Piezo1-mediated mechanically activated currents.
  • the inventors further examined the step-wise poking-induced currents of Piezo1 in the presence of DMSO, Brussels1 and Yoda1.
  • the inventors next employed the Surface Plasmon Resonance (SPR) binding assay to examine whether Listing1/2 directly bind to purified mPiezo1 proteins solubilized in the C 12 E 10 detergent.
  • SPR Surface Plasmon Resonance
  • Piezo1 proteins 50 ⁇ g/ml were optimally immobilized onto the research-grade CM5 sensor chip by using the buffer containing 10 mM sodium acetate (pH 5.0) , 150 mM NaCl, 0.026%C 12 E 10 and 0.05%Surfactant P20.
  • Negative-staining electron-microscopy revealed that the low pH buffer condition appeared not to cause notable changes of the integrity of the Piezo1 proteins.
  • Yoda1 has been shown to activate purified Piezo1 proteins reconstituted into lipid bilayers, indicating a direct binding mechanism.
  • real-time SPR binding assay showed that Yoda1 bound to the immobilized mPiezo1 proteins with a K d of 45.6 ⁇ 14.3 ⁇ M (Fig. 4e, f) , close to its estimated EC 50 of ⁇ 17.1 ⁇ M.
  • the 657-677 and 870-921 loop regions play critical roles in mechanically activating Piezo1.
  • the poking-induced Imax of mPiezo1- ⁇ (657-677) (3.2 ⁇ 0.7 pA/pF) and mPiezo1- ⁇ (870-921) (2.1 ⁇ 0.5 pA/pF) were only 4.3 ⁇ 1.3%and 3.3 ⁇ 0.8%of mPiezo1-mediated currents (61.7 ⁇ 7.8 pA/pF) , respectively (Fig. 5c) .
  • the two mutants retained Yoda1 responsiveness (Fig. 5d -g)
  • the mPiezo1- ⁇ (657-677) -or mPiezo1- ⁇ (870-921) -mediated currents in the presence of Yoda1 are smaller than that of mPiezo1 (Fig. 5e) .
  • Residues F1301-Q1363 constitute the intracellular beam-structure.
  • the N-terminal part of Piezo1 that contains the region critical for romance might constitute the featured distal blade-structure of the three-bladed, propeller-like Piezo1.
  • the featured -long intracellular beam-structure that connects the blades to the pore in the intracellular side (Fig. 1) might be critically involved.
  • the molecular composition of the beam-structure has not been resolved in the medium-resolution cryo-EM structure of Piezo1.
  • CXMS mass spectrometry
  • the purified mPiezo1 proteins were cross-linked using the cross-linkers including Sulfo-GMBS, DSS, and BS, followed by protease digestion and mass spectrometry analysis.
  • the cross-linked peptide pairs identified from these samples the K1329-C2099, K1340-K2112 and K1358-K2541 cross-links, helped us assign the predicted long-helical region of F1301-Q1363 to the beam-structure that immediately follows the predicted TM26 (I1280-Y1300) (Fig. 1a and Fig. 6a-c) .
  • the proposed assignment predicts that the residue 1365, located at the proximal side of the beam, should be in close proximity to the C-terminal end.
  • FRET Fluorescent Resonance Energy Transfer
  • HEK293T cells transfected with mPiezo1-Clover (1365) -mRuby2 (C) remained responsiveness to Brusselss and Yoda1 and displayed similar poking-induced currents as cells transfected with mPiezo1-mRuby2, demonstrating the proper expression and function of the fusion protein.
  • photobleaching of the acceptor mRuby2 resulted in an enhanced fluorescence of the Clover donor, suggesting that FRET occurred between the locations of the residue 1365 and the C-terminus (Fig. 6d, e) .
  • the FRET efficiency was even stronger than that derived from the neighboring C-terminus in cells co-transfected with mPiezo1-Clover (C) and mPiezo1-mRuby2 (C) (Fig. 6d, e) , further supporting the close proximity between the residue 1365 and the C-terminus.
  • the L1342A/L1345A mutant has impaired mechanosensitivity.
  • the L1342A/L1345A mutant had drastically reduced poking-induced Imax (24.0 ⁇ 4.5 pA) , which is 21.0 ⁇ 3.9%of mPiezo1-mediated Imax (114.6 ⁇ 17.4) (Fig. 7e, f) .
  • the inactivation Tau of the mutant is not different from that of the mPiezo1 (Fig. 7g) .
  • the abolished stretch-induced currents of the mPiezo1- ⁇ (657-677) and mPiezo1- ⁇ (870-921) mutants Fig.
  • L1342A/L1345A remained to be activated by stretch (Fig. 7h) , but had reduced mechanosensitivity (mPiezo1 vs L1342A/L1345A: -27.1 ⁇ 3.1 vs -46.2 ⁇ 6.4 mmHg of P 50 ) (Fig. 7i) .
  • SERCA1-3 Sarcoplasmic /Endoplasmic-Reticulum Ca2+ ATPase
  • SERCA Sarcoplasmic /Endoplasmic-Reticulum Ca2+ ATPase
  • GST glutathione-S-transferase
  • the inventors detected a strong band that matches the molecular weight of the Piezo1-GST protein of ⁇ 300 kDa specifically in the Piezo1-GST sample, but not in the GST control sample (Fig. 8a) , indicating a successful pull-down of the Piezo1-GST proteins.
  • a protein band migrated near the molecular marker of 130 kDa was specifically visualized in the Piezo1-GST sample group (Fig. 8a) .
  • the band was excised for mass spectrometry analysis, resulting in the identification of peptides that correspond to the isoform 2 of the sarcoplasmic/endoplasmic-reticulum Ca 2+ ATPase (SERCA2) .
  • SERCA2 is an SR/ER-localized Ca 2+ ATPase for recycling cytosolic Ca 2+ into the SR/ER Ca 2+ store, a process critical for maintaining Ca 2+ homeostasis in nearly all cell types including endothelial cells.
  • Flag-tagged SERCA2 construct that encodes the widely expressed splicing variant of SERCA2, SERCA2b.
  • Pull-down experiments from HEK293T cells co-transfected with Piezo1-GST and Flag-SERCA2 revealed that the Flag-SERCA2 proteins were pulled down together with the Piezo1-GST proteins using the glutathione beads (Fig. 8b) .
  • no Flag-SERCA2 proteins were detected from pulled-down samples derived from cells transfected with either Piezo1-GST alone or GST/Flag-SERCA2 (Fig. 8b) .
  • SERCA2a the other splicing variant of SERCA2 that is majorly expressed in cardiomyocytes, was also able to interact with Piezo1
  • the two other isoforms of the SERCA family SERCA1 (mainly expressed in skeletal muscles) and SERCA3 (expressed in a limited number of non-muscle cells) , are also able to interact with Piezo1.
  • the inventors next focused on characterizing the interaction between SERCA2 and Piezo1.
  • Piezo1 functions as a mechanosensitive cation channel in the plasma membrane (PM)
  • SERCA2 is an ER Ca 2+ pump.
  • the inventors therefore employed immunofluorescent staining to examine the endogenous co-localization between Piezo1 and SERCA2.
  • the anti-Piezo1 antibody used for western blot studies in Fig. 8d did not have the required specificity and affinity for staining endogenously expressed Piezo1 proteins, prompting the inventors to use the CRISPR/Cas9 technology to generate a Piezo1-Flag knock-in N2A cell line.
  • the Flag-encoding sequence was inserted after the position corresponding to the residue G2420 of mouse Piezo1.
  • Piezo1-Flag protein in the knock-in cell line was verified by specific anti-Flag immunostaining.
  • the Piezo1-Flag knock-in cells showed similar Yoda1 (aPiezo1 chemical activator 24 ) -evoked Ca 2+ responses and poking-induced currents as the wild-type N2A cells did, demonstrating the normal functionality of the endogenous Piezo1-Flag proteins.
  • the fragment of 1960-2547 contains the structurally resolved Peripheral Helix 1-4 (PH1-4) , the Anchor, the Linker and the pore-module that includes the Outer Helix (OH) , C-terminal extracellular domain (CED) , Inner Helix (IH) , and C-terminal Intracellular Domain (CTD) (Fig. 9a) .
  • PH1-4 Peripheral Helix 1-4
  • CED C-terminal extracellular domain
  • IH Inner Helix
  • CTD Intracellular Domain
  • the linker region (2172-2185) that connects the Anchor and OH is exposed to the intracellular surface, but is partially masked by the CTD (Fig. 9a) . Therefore the linker region could serve as a binding element for SERCA2.
  • the linker-containing fragments of 2171-2483 (without CTD) and 2171-2547 (with CTD) were able to interact with SERCA2, while the linker-free fragment of 2186-2547 showed nearly abolished interaction (Fig. 9a, d, e) .
  • the fragment of 2171-2483 without CTD appeared to have stronger interaction with SERCA2 than the fragment of 2171-2547 with CTD (Fig. 9a, d, e) , consistent with partially masking the linker region by the CTD.
  • the inventors went on to identify the key contributing residues within the 14-residue-constituted linker region for SERCA2 interaction. Remarkably, neutralizing either the residues 2172-2181 [Piezo1- (2172-2181) 10A] or the cluster of 4 lysine residues (2182-2185) (Piezo1-KKKK-AAAA) in Piezo1 to alanine reduced SERCA2 interaction (Fig. 9f, g) . These data demonstrate that the residues in the linker region are required for the interaction between Piezo1 and SERCA2.
  • the linker region is critically required for SERCA2 interaction to both the full-length Piezo1 and the structurally defined C-terminal fragments
  • the inventors hypothesize that the linker likely serves as a direct binding site for SERCA2.
  • the inventors synthesized the linker-peptide (2171-2185) and the scrambled control peptide with myristoylation at the N-terminal residue for allowing membrane penetration and then tested their effect in affecting Piezo1-SERCA2 interaction.
  • the linker-peptide, but not the scrambled-peptide significantly reduced the interaction between Piezo1 and SERCA2 (Fig. 9h, i) , indicating that the linker-peptide and Piezo1 compete for SERCA2 interaction.
  • endogenous Piezo1-mediated mechanosensitive currents can be regulated by SERCA2. Consistent with the previous studies of N2A cells 23 , poking-induced a step-dependent inward current with a maximal MA current of 85.2 ⁇ 10.5 pA (Fig. 10d, e) . Overexpression of SERCA2 significantly suppressed the endogenous MA currents to 28.2 ⁇ 3.8 pA (Fig. 10d, e) . By contrast, siRNA-mediated knockdown of endogenous SERCA2 significantly enhanced the current to 316.0 ⁇ 65.3 pA (Fig. 10d, e) . These data demonstrate that endogenously expressed Piezo1 is functionally regulated by SERCA2.
  • Piezo1 is expressed in endothelial cells for proper vascular development and blood pressure regulation, promoting us to investigate the regulation of Piezo1 by SERCA2 in this cell type.
  • the inventors detected a relatively small endogenous poking-induced current (24.8 ⁇ 2.5 pA) .
  • the current was significantly reduced when Piezo1 was knocked down with a siRNA against Piezo1 (10.5 ⁇ 0.9 pA) (Fig.
  • SERCA2 suppresses the mechanosensitivity of Piezo1 through the linker region
  • the linker is critical for mechanogating of Piezo1
  • linker mutants are intrinsically impaired for generating mechanosensitive currents.
  • the linker plays a critical role in mechanogating of Piezo1 likely by coupling the peripheral mechanotransduction-modules to the central ion-conducting pore.
  • SERCA2 affects Piezo1-dependent migration of endothelial cells
  • Piezo1-mediated mechanotransduction has been shown to play critical roles in mediating the migration process of HUVEC 5 , which might be required for proper development of blood vessels.
  • siRNA-mediated knockdown of Piezo1 inhibited HUVEC migration as examined by the transwell assay (Fig. 12a, b) .
  • knockdown of SERCA2 increased the cell migration (Fig. 12a, b) .
  • the SERCA2 knockdown-induced effect on cell migration was inhibited either by simultaneously knocking down Piezo1 proteins (Fig. 12c) or functionally blocking Piezo1 channel activities using either the non-specific blocker ruthenium red (RR) or the relatively specific blocker GsMTX4 (Fig. 12d) .
  • the knock-down efficiency of SERCA2 and Piezo1 is shown.
  • eNOS endothelial NO synthesis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Pain & Pain Management (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Rheumatology (AREA)
  • Neurology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Biotechnology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne l'utilisation d'un régulateur dans la préparation d'un médicament pour la régulation d'au moins l'un des éléments suivants, le régulateur étant utilisé pour activer ou inhiber par voie piézo: le développement de vaisseaux sanguins ; la régulation de la pression sanguine ; la fonction des globules rouges ; l'homéostasie épithéliale; la dysplasie lymphatique congénitale ; la différenciation neuronale ; la fonction rénale ; le dysfonctionnement de la vessie ; la fonction osseuse ; la croissance et la migration cellulaires ; le développement du cancer et la métastase ; le toucher doux; la douleur mécanique ; la fonction pulmonaire ; la fonction neuromusculaire.
PCT/CN2017/089768 2017-06-23 2017-06-23 Utilisation d'un régulateur piézo dans la préparation d'un médicament WO2018232735A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/CN2017/089768 WO2018232735A1 (fr) 2017-06-23 2017-06-23 Utilisation d'un régulateur piézo dans la préparation d'un médicament
CN201780092357.9A CN111032069B (zh) 2017-06-23 2017-06-23 Piezo调节剂在制备药物中的用途

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2017/089768 WO2018232735A1 (fr) 2017-06-23 2017-06-23 Utilisation d'un régulateur piézo dans la préparation d'un médicament

Publications (1)

Publication Number Publication Date
WO2018232735A1 true WO2018232735A1 (fr) 2018-12-27

Family

ID=64736238

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2017/089768 WO2018232735A1 (fr) 2017-06-23 2017-06-23 Utilisation d'un régulateur piézo dans la préparation d'un médicament

Country Status (2)

Country Link
CN (1) CN111032069B (fr)
WO (1) WO2018232735A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021005268A1 (fr) 2019-07-08 2021-01-14 Itä-Suomen Yliopisto Agonistes des protéines piezo permettant de prévenir ou de faire régresser des dépôts amyloïdes anormaux
WO2021016941A1 (fr) * 2019-07-31 2021-02-04 Tsinghua University Utilisation d'une structure et d'un mécanisme de mécano-déclenchement de canaux piézoélectriques de préparation de médicaments et technologies

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111751532B (zh) * 2020-07-20 2022-07-12 河南省医药科学研究院 Piezo1蛋白作为食管癌标志物的应用
CN114732819B (zh) * 2022-04-15 2024-04-12 常州大学 Yoda1作为有效成分在制备气道平滑肌舒张剂中的应用
CN115120723B (zh) * 2022-05-09 2023-05-26 浙江大学 巨噬细胞Piezo1敲除在促进缺血组织血管新生中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103249878A (zh) * 2010-08-23 2013-08-14 Irm有限责任公司，特拉华有限责任公司 机械激活的阳离子通道

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106011278B (zh) * 2016-07-18 2020-01-21 宁波大学医学院附属医院 人胃肠肿瘤中piezo2基因的检测试剂

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103249878A (zh) * 2010-08-23 2013-08-14 Irm有限责任公司，特拉华有限责任公司 机械激活的阳离子通道

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
TAO BAI ET AL.: "Bioinformatics analysis of Piezo1 and detection of its expression in the gut", WORLD CHINESE JOURNAL OF DIGESTOLOGY, vol. 23, no. 30, 28 October 2015 (2015-10-28), pages 4816 - 4821 *
TAO BAI ET AL.: "Bioinformatics analysis of Piezo2 and its expression detection in the gut", CHONGQING MEDICINE, vol. 45, no. 15, 31 May 2016 (2016-05-31), pages 2040 - 2047 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021005268A1 (fr) 2019-07-08 2021-01-14 Itä-Suomen Yliopisto Agonistes des protéines piezo permettant de prévenir ou de faire régresser des dépôts amyloïdes anormaux
CN114126617A (zh) * 2019-07-08 2022-03-01 东芬兰大学 防止或逆转异常淀粉样蛋白沉积的压电激动剂
WO2021016941A1 (fr) * 2019-07-31 2021-02-04 Tsinghua University Utilisation d'une structure et d'un mécanisme de mécano-déclenchement de canaux piézoélectriques de préparation de médicaments et technologies

Also Published As

Publication number Publication date
CN111032069B (zh) 2023-04-07
CN111032069A (zh) 2020-04-17

Similar Documents

Publication Publication Date Title
WO2018232735A1 (fr) Utilisation d'un régulateur piézo dans la préparation d'un médicament
Galloway et al. Mitochondrial morphology—emerging role in bioenergetics
Thornell et al. Regulators of Slc4 bicarbonate transporter activity
PT1606409E (pt) Proteína de ligação do receptor de nogo
Guo et al. TRPP2 and STIM1 form a microdomain to regulate store-operated Ca 2+ entry and blood vessel tone
US11236147B2 (en) Methods and compositions for the inhibition of TRPV4
AU2011279703B2 (en) Materials and method for suppressing inflamatory and neuropathic pain
ES2353674T3 (es) Factores de unión del factor ii de crecimiento similar a la insulina (igf-ii).
EP3773638A1 (fr) Compositions et méthodes de traitement d'une perte de la vision par la génération de photorécepteurs bâtonnets à partir de cellules gliales de müller
US20210369677A1 (en) Small molecule activators of polycystin-2 (pkd2) and uses thereof
ES2819238T3 (es) Agente farmacéutico polipeptídico de proteína X contra el virus de la hepatitis B
US9493542B2 (en) Methods of using ERBB2 conjugate peptides
WO2022056473A1 (fr) Compositions et méthodes de traitement de maladies
AU3922999A (en) Agents interfering with the binding of protein tyrosine phosphatase pest to domains of signalling proteins as inhibitors of cell migration and/or of focal adhesion
Pejman et al. Peptide LIQ Promotes Cell Protection against Zinc-Induced Cytotoxicity through Microtubule Stabilization
Du et al. Identification of Glucosidase II that regulates STIM1 activation dynamics
Ungewiß Adhesive and signaling properties of Dsg2 in intestinal epithelial barrier regulation
WO2016038608A1 (fr) Peptides dérivés du récepteur de l'angiotensine et leur utilisation
Angelini Role of CLIC1 and L-type calcium channels in the pathophysiology of glioblastoma and ventricular arrhythmias
Zhang Functional studies of kisspeptin analogues and the human kisspeptin receptor
Visic The role of the Sigma1 receptor (s1R) in Store-operated calcium entry (SOCE) microdomains
Chintan Activation of arginase and the endothelin system in models of ischemic retinopathy
Bin et al. Ekaterina Turlova 2, 3, Dan Zhu 2, 4, Herbert Y. Gaisano, Hong-Shuo Sun 2, 3, and Shuzo 10 Sugita 11
Ulengin Atlastin Mediated Endoplasmic Reticulum Network Formation In Hereditary Spastic Paraplegia
Conte Unraveling the Multifunctionality of Human Spindly

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17914990

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17914990

Country of ref document: EP

Kind code of ref document: A1