WO2018175429A1 - Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer - Google Patents
Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer Download PDFInfo
- Publication number
- WO2018175429A1 WO2018175429A1 PCT/US2018/023346 US2018023346W WO2018175429A1 WO 2018175429 A1 WO2018175429 A1 WO 2018175429A1 US 2018023346 W US2018023346 W US 2018023346W WO 2018175429 A1 WO2018175429 A1 WO 2018175429A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ref
- inhibitor
- apel
- cells
- apx3330
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
- A61K31/201—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids having one or two double bonds, e.g. oleic, linoleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/18—Sulfonamides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/28—Compounds containing heavy metals
- A61K31/282—Platinum compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
- A61K31/343—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/50—Pyridazines; Hydrogenated pyridazines
- A61K31/501—Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/243—Platinum; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- the present disclosure relates generally to the use of an Apurinic/Apyrimidinic Endonuclease/reduction-oxidation (redox) Factor-1 (APEl/Ref-1) inhibitor in a combination therapy to treat various cancers.
- APX3330 originally known as E3330
- APEl/Ref-l's redox activity also referred to herein as "Ref-1 "
- Ref-1 angiogenesis-mediated diseases
- APEl/Ref-1 Apurinic/Apyrimidinic Endonuclease/reduction-oxidation (Redox) Factor-1 (APEl/Ref-1) was originally identified as an endonuclease that plays a key role in the Base Excision Repair (BER) pathway's repair of oxidative and alkylating damage. Later, APEl/Ref-1 was recognized as a redox signaling protein that modulates the activity of certain transcription factors. Since then, additional functions of APEl/Ref-1 have been uncovered. APEl/Ref-l's duality and pivotal positions in repair and redox activities make it a unique target for therapeutic modulation.
- BER Base Excision Repair
- APEl/Ref-1 endonuclease activity is vital to the DNA damage response in all cells, making APEl/Ref-1 a crucial factor in cellular function and survival.
- the repair function has been conserved from E. coli to humans; however, the redox signaling function is observed only in mammals.
- APEl/Ref-1 redox signaling affects numerous transcription factors including STAT3, fflF-la, NF- ⁇ , AP-1, p53, and a few others.
- APEl/Ref-1 redox signaling is a highly regulated process that reduces oxidized cysteine residues in specific transcription factors as part of their transactivation (Figure 1).
- APEl/Ref-1 expression is increased in many tumor types, and that change is associated with increased growth, migration, and drug resistance in tumor cells as well as decreased patient survival.
- APEl/Ref-1 is seen as a critical node in tumor signaling ( Figure 2), and thus, is a prime target for anticancer therapy
- Figure 2 teasing apart APEl/Ref-1 's activities to create a specific inhibitor that targets only its endonuclease or redox function is challenging.
- Ref-1 redox signaling inhibitors a number of compounds isolated from natural sources have been proposed as Ref-1 redox signaling inhibitors, but none have been shown to directly or specifically inhibit Ref-1 redox signaling.
- An example of these natural compounds, resveratrol is typical of the other compounds; it's in vivo efficacy is sporadic at best due to widely varying bioavailability and low molecular specificity.
- curcumin Another presumed natural Ref-1 redox inhibitor, curcumin, has been established as a promiscuous compound, interacting with a variety of molecules to give false-positive results in numerous biological assays. Thus, these are not specific or viable APEl/Ref-1 redox inhibitors.
- APX3330 (formerly called E3330) has been identified as a specific APEl/Ref-1 redox inhibitor.
- APX3330 has been extensively characterized as a direct, highly selective inhibitor of Ref-1 redox activity that does not affect the protein's endonuclease activity ( Figure 6). Treatment with APX3330 has shown tumor growth and progression, with limited toxicity, in both in vitro and in vivo models.
- the present disclosure relates generally to the use of selective APEl/Ref-1 inhibitors, APX3330, and compounds derived therefrom (e.g., APX2009 and APX2014), in a combination therapy to treat various cancers.
- the combination therapies are found to treat cancers such as prostate cancer, colon cancer, ovarian cancer, non-small cell lung carcinoma, malignant peripheral nerve sheath tumors, leukemia, as well as other angiogenesis-mediated diseases (e.g., retinal diseases, cardiovascular diseases).
- the present disclosure is directed to a combination therapy comprising an Apurinic/Apyrimidinic Endonuclease/reduction-oxidation (redox) Factor- 1 (APEl/Ref-1) inhibitor, wherein the APEl/Ref-1 inhibitor inhibits the redox function of APEl/Ref-1 and a second therapeutic agent.
- redox Apurinic/Apyrimidinic Endonuclease/reduction-oxidation Factor- 1
- the present disclosure is directed to use of a combination therapy for the treatment of cancer, the combination therapy comprising an Apurinic/Apyrimidinic Endonuclease/reduction-oxidation (redox) Factor-1 (APEl/Ref-1) inhibitor, wherein the APEl/Ref-1 inhibitor inhibits the redox function of APEl/Ref-1 and a second therapeutic agent.
- redox Apurinic/Apyrimidinic Endonuclease/reduction-oxidation Factor-1
- the present disclosure is directed to use of a combination therapy for the treatment of retinal disease in a subject in need thereof, the combination therapy comprising an Apurinic/Apyrimidinic Endonuclease/reduction-oxidation (redox) Factor-1 (APEl/Ref-1) inhibitor, wherein the APEl/Ref-1 inhibitor inhibits the endonuclease or redox function of APEl/Ref-1 and a second therapeutic agent.
- redox Apurinic/Apyrimidinic Endonuclease/reduction-oxidation Factor-1
- the present disclosure is directed to use of a combination therapy for the treatment of a disease selected from the group consisting of a cardiovascular disease, bacterial infection, gastric inflammatory disorder, and neurodegenerative disease.
- a disease selected from the group consisting of a cardiovascular disease, bacterial infection, gastric inflammatory disorder, and neurodegenerative disease.
- FIG. 1 depicts the dual functions of APEl/Ref-1.
- APEl/Ref-1 is a multifunctional protein involved in redox signaling and DNA repair.
- the redox signaling function (Ref-1) is responsible for reduction of oxidized cysteine residues in certain transcription factors (TF's), leading to increased transcriptional activity and upregulation of genes involved in cell growth, inflammation, angiogenesis, and other cellular functions.
- the DNA repair function (APE1) is responsible for the endonuclease activity in base excision repair, cutting the phosphodiester backbone of DNA at abasic sites created by glycosylases. These cuts allow the abasic sites to be replaced with appropriate nucleotide bases, completing the DNA base excision repair process.
- FIG. 2 depicts Ref-1 signaling as a node in tumor cells and potential inhibitors in related pathways.
- Ref-1 redox signaling promotes the transactivation of transcription factors such as STAT3, HIF- ⁇ , and NF- ⁇ .
- Inhibiting Ref-1 with APX3330 decreases the expression of downstream genes, leading to tumor cell growth arrest and/or death.
- other methods for inhibiting the signaling pathways affected by Ref-1, as well as the enzymes that are upregulated by these pathways have been shown to enhance the cytotoxic and cytostatic effects of Ref- 1 inhibition.
- Figures 3 A & 3B depict that dual-targeting of Ref-1 and Jak/STAT signaling inhibits PDAC tumor growth in a 3D co-culture model.
- Figure 3B depicts the confirmation of inhibition of STAT3 activation via immunob lotting for pSTAT3 Y705 residue after 4 hours of Ruxolitinib treatment (12.5 uM) in the 3D assay 8-10 days post plating.
- Total STAT3 protein is provided as a loading control and reference for the levels of STAT3 in both cell types.
- Representative western blot is shown from an n of 3.
- FIG. 4 depicts the effects of APEl/Ref-1 in human diseases due to its multifunctional nature, APEl/Ref-1 impacts a wide range of human diseases. Altered expression of Ref-1 affects its regulation of multiple transcriptional factors, leading to various cancers, retinal, cardiovascular, gastric and neurodegenerative diseases. Similarly, modified APE1 DNA repair function affects progression of different cancers and neurodegenerative diseases.
- Figure 5 depicts that anticancer treatments inducing oxidative DNA damage alters sensory neuronal function.
- agents include cisplatin, oxalip latin, ionizing radiation as well as other drugs.
- ROS reactive oxygen species
- Pt platinum adduct
- APE apurinic/apyrimidinic endonuclease.
- FIGS. 6A-6E depict the differential role of APE1 Redox Inhibition in Sensory Neurons vs. Tumor Cells.
- Ref-1 redox inhibition has multiple downstream effects on tumor growth, survival, migration and tumor inflammation.
- sensory neuron cells such as DRG neurons
- the addition of APX3330 does not have a negative effect on the cells and promotes survival and functional protection through enhancement of Ref- 1 DNA repair activity against oxidative DNA damaging agents (e.g. cisplatin, oxaliplatin) that invoked the DNA BER pathway (FIG. 6A).
- oxidative DNA damaging agents e.g. cisplatin, oxaliplatin
- APX3330 attenuates neurotoxicity induced by systemic administration of cisplatin to tumor-bearing mice.
- Figure 6B depicts that the treatment paradigm for investigation of the effects of cisplatin and APX3330 on DNA damage within DRG.
- Neuroblastoma cells were implanted subcutaneously into the right flanks of 6-wk old male NSG mice and allowed to proliferate until tumor volumes > 150 mm 3 . Mice were then randomized for treatment with cisplatin + APX3330 treatment.
- Cisplatin and APX3330 were administered concurrently for 3 weeks (Day 0 - Day 17) and endpoints of neuronal toxicity were assessed within the DRG of mice at several time points following the last dose of cisplatin.
- Figure 6C are representative blots demonstrating pH2A.X immunoreactivity at D24 and D31.
- Figures 6D & 6E depict quantification of pH2A.X immunoreactivity.
- An asterisk indicates statistical significance between D18 and D24 as determined by a one-way ANOVA with Tukey's posttest with p ⁇ 0.05.
- a cross indicates statistical significance between Veh Veh group and the Veh C is group, as determined by a two-way ANOVA with Bonferroni's posttest with p ⁇ 0.05.
- Figure 7 depicts that APX3330 has broad potential in a variety of cancers. Supportive pre-clinical data exists for APX3330 in combination with each drug listed in the diagram (second column of boxes from the right) and for each indication (boxes at far right). *In addition to anti- tumor activity, APX3330 provides neuroprotection when administered with agents causing oxidative damage to neurons.
- Figures 8A-8C depict APEl expression and batch effects in cells following siRNA knockdown.
- Figure 8A is a representative Western Blot and densitometry analysis of Pa03C cells following APEl knockdown using 20nM siRNA. Vinculin is used as a loading control.
- siAPEl samples had 10% APEl levels in comparison to the SCR control sample.
- Figure 8B depicts Principal Components Analysis of Uncorrected Gene Expression Data.
- Figure 8C depicts Principal Components Analysis of Corrected Gene Expression Data. Following corrections for batch effects using cell cycle-annotated genes, the SCRl and SCR2 groups come together along the x-axis to form a single SCR group.
- Figures 9A-9C depict the results of scRNA-seq and comparison of analyses.
- Figure 9A is a Violin Plot illustrating the differences in APEl RNA expression counts per million (CPM) reads in the SCR, Detectable siAPEl and Undetectable siAPEl samples.
- Figure 9B depicts Mean Expression and Fold Change Plot using SCR and siAPEl cells as the two groups in the analysis.
- Figure 9C depicts Mean Expression and Fold Change Plot using SCR, detectable siAPEl and undetectable siAPEl cells in the analysis. Note that while the analysis uses three separate groups, this plot uses SCR and siAPEl for calculation of the Mean Expression and Fold Change due to the limitations of the graph.
- Figures 10A-10G depict the identification of differentially expressed genes in relation of APEl levels.
- Figure 10A is a venn diagram showing the three analyses performed on the scRNA-Seq data and the overlapping genes between them. Six genes were significantly changed in all three analyses, (Figure 10B) TMEM45A, (Figure IOC) TMEM126A, ( Figure 10D) TMEM154, ( Figure 10E) COMMD7, ( Figure 10F) ISYNA1 and ( Figure 10G) TNFAIP2. These genes show increased changes in expression as APEl levels are reduced further from SCR to detectable (but reduced) siAPEl to undetectable siAPEl.
- Figures 11A-11C depict overlapping overrepresented canonical pathways.
- Figure 11A depicts the 20 most significantly overrepresented pathways following IPA analysis on the SCR/detectable siAPEl/undetectable siAPEl results.
- the x-axis shows the number of genes that were differentially expressed and in the overrepresented pathways.
- the percentages next to the pathway labels on the y-axis show the percentage of genes in the pathway which are differentially expressed between SCR and siAPEl cells.
- Figure 11B depicts changes in the EIF2 pathway.
- the EIF2 pathway was the pathway most affected by APE1 knockdown with 70 DEGs.
- FIG. 11C is a heatmap showing changes in expression of DEGs per cell involved in the EIF2 pathway. Box showing colors corresponding to normalized changed in expression shown.
- Figures 12A-12D depict the validation of scRNA-Seq by qRT-PCR in Pa03C cells.
- Fig ure 12A depicts genes chosen for qRT-PCR validation following SCR/siAPEl validation.
- Figure 12B depicts genes statistically significant in all 3 analyses chosen for qRT- PCR validation.
- Figure 12C shows the expression of selected genes assessed via qRT-PCR in Pa03C cells. The cells were collected after siRNA knockdown and assessed for a reduction in APE1 protein levels of 80% or greater. Each graph is the result of 3 independent experiments, showing average fold change in siAPE samples compared to SCR +/- SD. *p ⁇ 0.05 (ANCOVA model).
- Figures 13 A & 13B depict the effects of Ref-1 in combination with Docetaxel or Trametinib to PDAC cells and CAFs.
- a higher dose of Docetaxel was used in co-culture due to the decreased potency in the presence of CAFs.
- Figures 14A-14C depict 3D spheroid and in vivo combination studies with APX3330 and Gemcitabine (Gem).
- Low passage patient derived PDAC cells Pa03C, Figure 14A
- CAF19 cancer-associated fibroblasts
- Figure 14B is a graphical representation: *A11 Gem+APX330 treatments significantly different from Gem alone in tumor (p ⁇ 0.01).
- Figure 14C depicts tumor volume 30 days following treatment.
- APX3330 25 mg/kg
- Figures 15A-15C depict the effect of APX3330 and CPI-613 on the HCT-116 cell line.
- Figures 16A-16D depict the different PDAC cell lines exhibiting varied changes to expression of select genes following siRNA knockdown. Expression of selected genes assessed via qRT-PCR in ( Figure 16A) Pa02C cells, ( Figure 16B) Pancl0.05 cells and ( Figure 16C) Pancl98 cells. The cells were collected after siRNA knockdown and assessed for a reduction in APE1 protein levels of 80% or greater. Each graph is the result of 3 independent experiments, showing average fold change in siAPE samples compared to SCR +/- SD. *p ⁇ 0.05 (ANCOVA model).
- Figure 16D is a venn diagram showing the overlapping results of qRT-PCR between the 4 different PDAC cell lines.
- COMMD7, ITGAl, RAB3D and TNFAIP2 were significantly changed in all 4 cell lines.
- PPIF and SIPA1 were differentially expressed in Pa03C, Pa02C and Pancl0.05 cells.
- TAPBP was differentially expressed in Pa03C and Pancl0.05.
- PRDX5, ISYNA1, BCRP and NOTCH3 were common between Pa03C and Pa02C (with BCRP and NOTCH3 changing in opposite directions between the cell lines), while CIRBP was only differentially expressed in Pa03Cs.
- Figure 18 shows that APX3330 and Napabucasin (BBI-608-STAT3 inhibitor) have synergistic tumor killing in patient-derived 3D spheroid model (Tumor + CAFs) of pancreatic cancer. Concentrations shown are in microMolar; Napa 0.125 uM, APX3330 25 or 35 uM, and APX2009 3.5 uM.
- Figures 19A & 19B show that APX3330 in combination with STAT3i napabucasin in 3D spheroid model (tumor and CAF) had synergistic killing of pancreatic tumor cells.
- Figures 20A & 20B show that APX3330 and APX2009 in combination with STAT3i napabucasin in 3D spheroid model (tumor and CAF) demonstrated synergistic tumor cell killing. Concentrations shown are in microMolar; Napa 0.125 uM, APX3330 25 uM, and APX2009 3.5 uM. ** p ⁇ 0.01, *** p ⁇ 0.001. [0036] Figures 21A & 21B depict dual targeting of Ref-1 and STAT3 results in enhanced killing in genetic PDAC model in vitro ( Figure 21A) and in vivo ( Figure 21B).
- Figured 22A-22C show that dual-targeting of CA9 and APE1 kills PDAC tumors in a 3D co-culture pancreatic cancer tumor model.
- Figures 23A-23E depict combination therapy with APEl/Ref-1 inhibitors in a PDAC 3D co-culture model.
- Figure 23A depicts the combination therapy of APX3330 + Obatoclax (Bcl2 antagonist).
- Figure 23B depicts the combination therapy of APX3330 + Entinostat (HDAC 1 & 3 inhibitor).
- Figure 23C depicts the combination therapy of APX3330 + Axitinib (TKI inhibitor).
- Figure 23D depicts the combination therapy of APX3330 + Obatoclax (Bcl2 antagonist).
- Figure 23E depicts the combination therapy of APX3330 + Entinostat (HDAC 1 & 3 inhibitor).
- Figures 24A-24C depict combination therapy with APEl/Ref-1 inhibitors and CPI-613, a mito targeted TCA cycle inhibitor (Figure 24A) or STAT3 inhibitor, napabucasin ( Figures 24B & 24C), in a PDAC 3D co-culture model.
- Figure 25 depicts the effects of ruxolitinib in combination with APX3330 in a 3D model of pancreatic cancer.
- Figure 26 depicts the effects of ruxolitinib on the phosphorylation of p- STAT3 (Y705) in the 3D co-culture model of pancreatic cancer. Particularly, the Western blot depicts p-STAT3 (Y705) after 4 hours of Ruxolitinib (12.5 mM).
- Figure 27 depicts the effect of the combination treatment of Rux+APX in a flank co-culture model on tumor growth delay.
- Figures 28A & 28B depict that combination treatment did not kill the CAFs in the co-cultured tumors.
- Figures 29A-29G depict the anti-tumor efficacy of APX3330 in combination with oxalip latin.
- Figures 30A & 30B depict STAT3 inhibitor Napabucasin and Apel redox inhibitor APX2014 drug combination effects in mouse colon cell line MC-38.
- Figures 31A-31E depict PDH and alpha-KDH Metabolic inhibitor CPI-613 and Apel redox inhibitor APX3330 synergistic drug combination effects in human adenocarcinoma colon suspension cell line Colo-201.
- Figure 31A depicts single agent effects.
- Figure 3 IB depicts combination therapy effects.
- Figures 31C depicts combination EC50 ( ⁇ ).
- Figure 31D depicts Chou-Talalay Index of dose combinations.
- Figure 31E depicts synergy doses.
- Figures 32A-32E depict PDH and alpha-KDH Metabolic inhibitor CPI-613 and Apel redox inhibitor APX3330 (also referred to herein as E3330) synergistic drug combination effects in human carcinoma colon cell line HCT-116.
- Figure 32A depicts single agent effects.
- Figure 32B depicts combination therapy effects.
- Figures 32C depicts combination EC50 ( ⁇ ).
- Figure 32D depicts Chou-Talalay Index of dose combinations.
- Figure 32E depicts synergy doses.
- Figures 33A-33E depict PDH and alpha-KDH Metabolic inhibitor CPI-613 and Apel redox inhibitor APX3330 synergistic drug combination effects in human carcinoma colon cell line HCT-116.
- Figure 33A depicts single agent effects.
- Figure 33B depicts combination therapy effects.
- Figures 33C depicts combination EC50 ( ⁇ ).
- Figure 33D depicts Chou-Talalay Index of dose combinations.
- Figure 33E depicts synergy doses.
- Figures 34A-34E depict PDH and alpha-KDH Metabolic inhibitor CPI-613 and Apel redox inhibitor APX2014 synergistic drug combination effects in human carcinoma colon cell line HCT-116.
- Figure 34 A depicts single agent effects.
- Figure 34B depicts combination therapy effects.
- Figures 34C depicts combination EC50 ( ⁇ ).
- Figure 34D depicts Chou-Talalay Index of dose combinations.
- Figure 34E depicts synergy doses.
- Figures 35A-35E depict GLS1 Metabolic inhibitor CB-839 and Apel redox inhibitor APX3330 synergistic drug combination effects in human carcinoma colon cell line HCT-116.
- Figure 35 A depicts single agent effects.
- Figure 35B depicts combination therapy effects.
- Figures 35C depicts combination EC50 ( ⁇ ).
- Figure 35D depicts Chou-Talalay Index of dose combinations.
- Figure 35E depicts synergy doses.
- Figures 36A & 36B depict the effects of a 3-day treatment of APX2014 +/- cisplatin on the cisplatin resistant bladder cell line, BLCAbOOl.
- Figures 37A & 37B depict the effects of a 3-day treatment of APX2014 +/- cisplatin on the cisplatin resistant bladder cell line, BLCAb002.
- Figures 38A & 38B depict the effects of APX2014 +/- napabucasin on the bladder cell line, T24.
- Figures 39A & 39B depict the effects of APX2009 +/- napabucasin on the bladder cell line, T24.
- Figures 40A & 40B depict the effects of APX2014 +/- napabucasin on the bladder cell line, SCaBER.
- Figures 41A & 41B depict the effects of APX2009 +/- napabucasin on the bladder cell line, SCaBER.
- Figures 42A-42H depict the importance of the APE1/Ref-1-HIF-1-CA9 signaling axis in PDAC cells.
- Figure 42A shows the patient-derived PDAC tumor cell lines 10.05, Pa02C, and Pa03C, as well as the pancreatic CAF cell line CAF19, exposed to 0.2% oxygen for 24 hours. CA9 protein levels were compared via western blot (p ⁇ 0.05 for all cell line differences between normoxia and hypoxia).
- Figure 42B shows that LC50 values for SLC-0111 in PDAC cell lines under hypoxic conditions (0.2% O2) are inversely correlated with CA9 induction in each cell line (R2>0.99).
- Figure 42C depicts 10.05 cells grown in monolayer (2D) and cultured in normoxia or 0.2% O2 for 24 hours and collected for western blot analysis. 10.05 cells alone or in co-culture with CAF 19 cells were grown in 3D cultures for 12 days and collected for western blot analysis. Equal amounts of protein were used from all four samples. CA9 levels in 3D cultures alone and with CAFs were 2.5 and 6.2-fold greater (respectively) than in hypoxia-exposed monolayer cultures.
- Figures 42D-42F show 10.05 cells transfected with the indicated siRNAs and cultured in 3D spheroids.
- IPs of HIFla and a control for non-specific binding were performed using nuclear extracts.
- qPCR for the HBS-containing region of the CA9 promoter was performed. ( Figure 42G, **p ⁇ 0.01).
- Figures 43A-43I depict blockade of CA9 via APEl/Ref-1 or CA9 inhibition.
- Figures 43A & 43B show 10.05 cells treated with APX3330, APX2009, APX2014, and the negative analog RN7-58 and exposed to 0.2% O2 for 24 hours prior to collection and analysis of CA9 mRNA (Figure 43A) and protein (Figure 43B) levels (p ⁇ 0.01 for differences in CA9 mRNA and protein levels at the highest concentration tested of each APEl/Ref-1 inhibitor vs. DMSO).
- Figure 43C show 10.05 cells cultured in 3D spheroids for 12 days prior to collection and Western Blot analysis.
- FIGS. 43D & 43E show 10.05 cells transfected with the indicated siRNAs or treated with the indicated concentrations of APX2009 or APX2014 and exposed to 0.2% 0 2 for 48 hours. Changes in intracellular pH were quantified using a pH-sensitive fluorescent dye (pHrodo Red channel, Figure 43D), and pH-mediated fluorescence changes were imaged by a blinded third party ( Figure 43E).
- Figures 43F-43I show 3D co-cultures with 10.05 ( Figures 43F & 43H) or Pa03C ( Figures 43G & 431) tumor cells (+ CAFs) were treated with increasing concentrations of APX3330, APX2009, and APX2014 (F-G) or SLC-0111 and FC12-531A ( Figures 43H & 431) for 12 days, and fluorescence intensity was measured.
- Figures 44A-44F depict characterization of 3D cultures and effects of dual- targeting APEl/Ref-1 and CA9.
- Figures 44A-44F depict spheroids consisting of 10.05 or Pa03C cells cultured with CAFs for 12 days and collected for IHC. Slides with sections from these cultures were stained with the indicated antibodies/stains. Antibody stains ( Figures 44B and 44D-44F) were counter-stained with hematoxylin. Images are l,600x magnification.
- Figures 45A-45R depict APEl/Ref-1 redox signaling inhibition sensitizes 3D PDAC tumor spheroids to CA9 inhibition with second-generation inhibitors.
- 10.05 and Pa03C cells were plated into 3D cultures with CAF19 cells, and cell growth in these spheroids was measured via fluorescence intensity on days 4, 8, 12, and 16 after plating. The growth of tumor cells vs. CAF cells in the spheroid co-cultures was assessed separately using different fluorescent labels in the two cell types.
- APEl/Ref-1 Inhibitor +++p ⁇ 0.001 vs. APEl/Ref-1 Inhibitor; ⁇ ⁇ 0.05 vs. FC12-531A; AA p ⁇ 0.01 vs. FC12-531A; ⁇ ⁇ 0.001 vs. FC12-531A.
- FIG 46 is a pathway schematic.
- APEl/Ref-1 redox signaling contributes to the transactivation of HIF-1 and certain other transcription factors.
- HIFla is stabilized under hypoxic conditions, leading to the formation of HIF-1 and subsequent expression of CA9.
- CA9 coordinates with the bicarbonate transporter and intracellular CAs to stabilize intracellular pH.
- APEl/Ref-1 redox signaling inhibition (with APX3330, APX2009, or APX2014) attenuates HIF-1 -mediated CA9 expression, sensitizing tumor cells to CA9 inhibition (with SLC-0111 or FC12-531A).
- Ref-1 The multi-functional nature of Ref-1 alludes to its expansive roles in disease, particularly cancers.
- Ref-1 is upregulated in many cancers (Table 1, Figure 4). This increase is frequently associated with tumorigenesis, cancer aggressiveness, increased angiogenesis, radiotherapeutic and chemotherapeutic resistance, and overall poor prognosis. This makes Ref-1 and the transcription factors it regulates prime targets for anticancer therapies.
- Table 1 Tumor tissues/cells with increased Ref- 1 expression
- Ref-1 overexpression is prostate cancer. Overexpression is seen immunohistologically as a higher percentage of cells staining positive for Ref- 1 in the cytoplasm and an increased intensity of Ref- 1 nuclear staining.
- STAT3 is constitutively active in prostate cancer.
- STAT3 inhibition suppresses prostate cancer cell growth.
- STAT3 activation negatively affects overall survival rates and shortens relapse-free survival (RFS).
- FRS relapse-free survival
- a downstream target of STAT3 is survivin; its increased expression is also associated with prostate cancer aggressiveness.
- mRNA expression levels of survivin in prostate biopsy tissues show significantly higher survivin expression in cancerous tissue, which correlates with higher-grade cancer and aggressive phenotypes.
- siRNA knockdown of survivin in prostate cancer cell lines reduces cell proliferation and increases chemo sensitivity to the apoptosis- inducing agent cisp latin. The effects of decreased survivin expression extend in vivo. Mice injected subcutaneously with siRNA survivin knockdown cells exhibit significantly smaller tumors compared with controls.
- Ref-1 redox-specific inhibitors APX3330 and APX2009 decreased survivin mRNA and protein levels in prostate cancer cells by affecting NF- ⁇ activity. These inhibitors also reduced cell proliferation. In vivo, APX2009 reduced survivin protein levels and cell proliferation.
- both STAT3 and survivin present as prime targets for anti-prostate cancer therapies.
- they have been only moderately successful as single-agent therapies. Therefore, the potential combination of inhibiting both Ref-1 redox function and STAT3/survivin provides an avenue of targeting both the overarching regulator and downstream effector of an anti-apoptotic pathway integral to prostate cancer.
- the present disclosure is directed to the combination of an APEl/Ref-1 inhibitor (5-(2,3-dimethoxy-6-methyl l,4-benzoquinoyl)]-2- nonyl-2-propenoic acid (APX3330), [(2E)-2-[(3-methoxy-l,4-dioxo-l,4-dihydronaphthalen-2- yl)methylidene]-N,N-diethylpentanamide] (APX2009), (2E)-2-[(3-methoxy-l,4-dioxo-l,4- dihydronapthalen -2-yl)methylidene]-N-methoxypentanamide] (APX2014)) and a STAT3 inhibitor (e.g., napabucasin) for treating prostate cancer.
- a combination of an APEl/Ref-1 inhibitor and a survivin inhibitor e.g., YM155
- Colon cancer the second leading cause of cancer related death in the U.S., exhibits increased levels of cytoplasmic Ref-1.
- increased Ref-1 expression corresponds to poor patient outcome.
- siRNA Ref-1 knockdown significantly increases the sensitivity of colon cancer cells to ionizing irradiation (IR).
- IR ionizing irradiation
- APX3330 (hereafter referred to as "APX") significantly reduces CCSC growth in vitro and enhances the cytotoxicity of 5-fluorouracil (5-FU), an anti- metabolite chemo therapeutic.
- 5-fluorouracil 5-fluorouracil
- intratumoral administration of APX3330 increases tumor response to 5-fluorouracil (5-FU) delivered intraperitoneally. This indicates that APX3330 could potentiate other colon cancer treatments by inhibiting Ref-1 's crucial redox activity.
- the present disclosure is directed to the combination of an APEl/Ref-1 inhibitor (APX3330, APX2009 and APX2014) and a chemotherapeutic (e.g., 5-FU) for treating colon cancer.
- a combination of an APEl/Ref-1 inhibitor and an inhibitor of PDH and/or KDGH (e.g., CPI-613) for treating colon cancer is disclosed.
- Ref- 1 expression in ovarian cancer has been studied widely. Ref- 1 expression is increased in malignant patient tissue samples, but studies vary as to the location of this increase. [0075] Some studies show increased expression primarily in the cytoplasm. In those studies, cytoplasmic localization of Ref-1 correlates with ovarian tumor progression. Additionally, patients with advanced (stage III/IV) cancer have significantly higher Ref-1 expression and lower overall survival rates than stage I/II patients. Patients with increased cytoplasmic Ref-1 are also more resistant to platinating chemotherapeutics. A different study observed increased Ref-1 nuclear expression, again with greater increases in stage III/IV compared to stage I/II patients.
- Ref-1 knockdown in A2780 (nuclear APE1) and CP70 (cytoplasmic APE1) cells sensitizes both to cisp latin.
- Ref-1 siRNA significantly reduces cell proliferation, colony formation, migration and invasion.
- Ref-1 siRNA treatment of SKOV-3x ovarian cells significantly reduces their growth; the same occurs with APX3330 redox inhibition.
- Ref-1 siRNA cells implanted subcutaneously in mice show markedly reduced growth compared to control tumors: a 3.2-fold increase in tumor-doubling time (from 5 to more than 15 days). The tumors also exhibit reduced glucose metabolism.
- Ref-1 has long been considered a prognostic marker in non-small-cell lung carcinoma (NSCLC), as Ref-1 protein levels are upregulated in patient tumor samples. Nuclear Ref-1 expression in tissue samples presents better survival chances for patients. Cytoplasmic Ref-1 and mRNA expression correlate strongly with poor patient survival and shorter RFS. Both immunohistochemistry and immunoblotting show increased cytoplasmic and reduced nuclear Ref-1 expression in patients with a recurrence of stage I NSCLC. Post- treatment serum Ref-1 levels are inversely associated with overall survival.
- NSCLC non-small-cell lung carcinoma
- Ref-1 affects platinum-based drugs commonly used in NSCLC.
- An increase in Ref-1 expression in NSCLC confers resistance to cisplatin treatment, while Ref-1 siRNA knockdown in A549 cancer cells significantly enhances cisplatin cytotoxicity.
- Patients with tumors not expressing Ref-1 respond better to platinum-paclitaxel therapy and cisplatin- docetaxel-gemcitabine treatment, with longer time to progression and overall survival.
- Ref-1 knockdown with shRNA enhances the anti-tumor activity of oxymatrine, an alkaloid compound that inhibits proliferation of A549 cells.
- Ref-1 plays a vital role in NSCLC progression, and targeting it might lead to better patient outcomes when combined with various chemotherapeutic treatments.
- the present disclosure is directed to a combination of an APEl/Ref-1 inhibitor (e.g., APX3330, APX 2009 and APX2014) and a chemotherapeutic agent (e.g., paclitaxel, cisplatin, docetaxel, gemcitabine) for treating NSCLC.
- a combination of an APEl/Ref-1 inhibitor and a photodynamic therapy for treating NSCLC is disclosed.
- MPNST Malignant Peripheral Nerve Sheath Tumor
- Phosphorylated STAT3 expression may indicate aggressive disease at disease onset.
- a tissue microarray showed STAT3 expression in primary MPNST was associated with worse disease- specific overall survival and event-free survival.
- both a JAK/STAT3 inhibitor and STAT3 knockdown by shRNA prevented tumor formation.
- STAT3's downstream target survivin is amplified in MPNSTs.
- Survivin is highly expressed in MPNST tissue samples.
- Survivin knockdown via siRNA decreases cell growth, inhibits cell cycle progression and increases apoptosis.
- survivin inhibitor YM155 represses MPNST xenograft growth and metastasis in vivo.
- STAT3-HIF-la pathway The role of the STAT3-HIF-la pathway in MPNST supports the notion of STAT3 and/or HIF- ⁇ inhibition as a potential way to treat MPNST. Downstream markers like survivin also present as potential targets. Ref-1 regulates STAT3 as well as HIF- ⁇ ; therefore, targeting Ref-1 would inhibit multiple targets, providing hope for a viable treatment for MPNST. Additionally, the possibility of dual targeting Ref-1 and either STAT3 or HIF- ⁇ alludes to the potential of completely eliminating a pathway that is integral to MPNST progression.
- the present disclosure is directed to a combination of an APEl/Ref-1 inhibitor (e.g., APX3330, APX 2009 and APX2014) and a STAT3 inhibitor (e.g., napabucasin) for treating MPNST.
- a combination of an APEl/Ref-1 inhibitor and a HIF- ⁇ for treating MPNST is disclosed.
- present disclosure is directed to a combination of an APEl/Ref-1 inhibitor and a survivin inhibitor (e.g., YM155) for treating MPNST.
- Ref-1 is highly expressed in T-cell acute lymphoblastic leukemia (T-ALL).
- Blockade of Ref-1 by the redox- specific inhibitor APX3330 potently inhibits viability of leukemia T-cells, including primary cells, relapsed and chemotherapy-resistant cells, and cells from a mouse model of T-ALL.
- Ref-1 redox inhibition promotes leukemia cell apoptosis, which is associated with downregulation of pro-survival genes.
- APX3330 blocks NF- ⁇ function, which decreases inflammation and reverses the progression from pre-AML to frank AML in mice bearing AML-associated epigenetic mutations often observed in healthy individuals with clonal hematopoiesis.
- the present disclosure is directed to a combination of an APEl/Ref-1 inhibitor (e.g., APX3330, APX 2009 and APX2014) and a NF- ⁇ inhibitor (e.g., napabucasin) for treating T-ALL.
- an APEl/Ref-1 inhibitor e.g., APX3330, APX 2009 and APX2014
- a NF- ⁇ inhibitor e.g., napabucasin
- the patient to be treated is carrying TET2 mutations that show signs of clonal hematopoiesis.
- the combination of an APEl/Ref-1 inhibitor e.g., APX3330, APX 2009 and APX2014
- a NF- ⁇ inhibitor can be used for treating patients with TET2 mutations who also have acute myeloid leukemia, myeloproliferative disease or myelodysplastic syndrome.
- Ref-1 Increased levels of Ref-1 are not limited to cancers ( Figure 4). Elevated Ref-1 has been implicated in age-related cataracts. Ref- 1 levels are higher in the lens epithelium cells of patients versus controls, and Ref-1 levels decrease as the opaque degree worsens.
- Ref-1 is highly expressed in developing murine retinas, as well as retinal pigment epithelium (RPE) cells, retinal pericytes, choroid endothelial cells (CECs) and retinal vascular endothelial cells (RVECs).
- RPE retinal pigment epithelium
- CECs choroid endothelial cells
- RVECs retinal vascular endothelial cells
- APX3330 shows that Ref-1 redox activity is required for RVEC proliferation, migration and angiogenesis in vitro.
- APX3330 treatment reduced proliferation, migration and angiogenesis in CECs in primate cells in vitro and had an additive effect when combined with bevacizumab.
- RPEs stressed using oxidized low-density lipoproteins (oxLDLs) were rescued from proliferation decline and senescence by APX.
- APX3330 reduced the transcriptional activity of NF-KB, a key factor associated with inflammation in angiogenesis. It also blocked activation of HIF- 1 a and reduced the expression of its downstream target VEGF.
- VEGF expression via NF- KB and HIF- la is primarily responsible for choroidal neovascularization (CNV), a characteristic of neo vascular Age-related Macular Degeneration (AMD), also known as wet AMD.
- CNV choroidal neovascularization
- AMD Age-related Macular Degeneration
- VLDLR very low density lipoprotein receptor
- Angiogenesis is also a prime component of other retinal diseases, including Retinopathy of Prematurity (ROP) and Diabetic Retinopathy (DR).
- ROP Retinopathy of Prematurity
- DR Diabetic Retinopathy
- Ref-1 's redox ability to modulate angiogenesis makes it worth investigating in those diseases.
- both HIF- la and VEGF are increased in ROP and DR.
- Retinal neovascularization a marker of ROP and DR, is markedly reduced in mice with ischemic retinopathy when treated with siRNA targeting HIF- la or VEGF.
- ocular anti-VEGF therapies are not always effective and may lead to unwanted side effects. Inhibiting the redox activity of Ref-1 may prove to be a more efficacious standalone or adjunctive treatment that can modulate HIF- ⁇ and VEGF in retinal diseases like wet AMD, ROP and DR.
- Ref-1 has also been shown to play a role in several other diseases. Ref-1 's involvement in cardiovascular disease and regulation of blood pressure is illustrated by aortic coarctation- induced hypersensitive rat models showing increased Ref-1 expression levels. Furthermore, heterozygous Ref-1 +/- mice exhibit hypertension and diminished endothelium- dependent vasorelaxation. Ref-1 is part of the SET complex of proteins that are involved in HIV pathogenesis by inhibiting suicidal autointegration. Consequently, knocking down Ref-1 inhibits HIV infection.
- Ref-1 is also implicated in gastric cellular response to Helicobacter pylori (H. pylori) infection. Ref-1 expression levels were elevated following H. pylori infection in human gastric epithelial cells. H. pylori induced ROS and downstream activated genes were higher in Ref-1 deficient cells compared to control, with Ref-1 overexpression reversing these effects. Additionally, Ref-1 siRNA knockdown inhibited H. pylori and TNF-a- induced AP-1 and NF-KB DNA binding, as well as IL-8 mRNA expression and protein secretion in gastric epithelial cells. Collectively, that implicates Ref-1 in gastric inflammatory disorders as well as sepsis.
- NDs neurodegenerative disease
- AD Alzheimer's disease
- PD Parkinson's disease
- ALS amyotrophic lateral sclerosis
- cerebral ischemia is all affected by APE 1 /Ref-1 dysfunction.
- Ref-1 protein levels are elevated in nuclear extracts from the midfrontal cortex and cerebral cortex of AD patients compared to controls, with Ref- 1 redox activity being seen as a compensatory mechanism for increased oxidative stress.
- Ref- 1 redox activity is seen in peripheral blood mononuclear cells of AD patients, suggesting impaired Base Excision Repair (BER). This highlights the different roles that Ref-1 can have within a particular disease.
- Ref-1 levels are elevated in the central nervous system of patients with ALS, a disease exhibiting elevated oxidative stress and DNA damage.
- Ref-1 In PD, loss of Ref- 1 function via gene variants suggests it is a risk factor, contributing to increased oxidative stress that leads to loss of dorsal root ganglion (DRG) neurons.
- Ref-1 is upregulated in cells treated with rotenone and MPP + (l-methyl-4-phenylpyridinium), both of which are used to simulate a PD model. Ref-1 upregulation protects against neuronal death in these cells.
- Ref-1 conditional knockout mice exhibit larger infract volume and diminished recovery of spatial and cognitive function following cerebral ischemia.
- APX3330 and APX2009 can be combined with inhibitors of STAT3, HIFla, CA9, VEGF, NFKB, JAK2, Bcl-2, PTEN, WNT/ -catenin, Endostatin, 5-fluorouracil (5-FU), and a photodynamic therapy (PDT), and the like, and combinations thereof. More particularly, exemplary combinations include APX3330 and/or APX2009 with one or more of a second therapeutic agent selected from those in Tables 2 & 3.
- Suitable dosages of the Ref-1 inhibitor (e.g., APX3330) and second therapeutic agent for use in the combination therapies of the present disclosure will depend upon a number of factors including, for example, age and weight of an individual, at least one precise cancer/disease requiring treatment, severity of a disease, specific Ref-1 inhibitor and/or second therapeutic agent to be combined, nature of a composition, route of administration and combinations thereof.
- a suitable dosage can be readily determined by one skilled in the art such as, for example, a physician, a veterinarian, a scientist, and other medical and research professionals. For example, one skilled in the art can begin with a low dosage that can be increased until reaching the desired treatment outcome or result. Alternatively, one skilled in the art can begin with a high dosage that can be decreased until reaching a minimum dosage needed to achieve the desired treatment outcome or result.
- the combination therapies can include pharmaceutically acceptable carriers, for example, excipients, vehicles, diluents, and combinations thereof.
- pharmaceutically acceptable carriers for example, excipients, vehicles, diluents, and combinations thereof.
- the combination therapies may be formulated as tablets, capsules, granules, powders, or syrups; or for parenteral administration, they may be formulated as injections (intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intravitreal), drop infusion preparations, or suppositories.
- compositions can be prepared by conventional means, and, if desired, the active compounds (i.e., APX3330 and second therapeutic agent) may be mixed with any conventional additive, such as an excipient, a binder, a disintegrating agent, a lubricant, a corrigent, a solubilizing agent, a suspension aid, an emulsifying agent, a coating agent, or combinations thereof.
- any conventional additive such as an excipient, a binder, a disintegrating agent, a lubricant, a corrigent, a solubilizing agent, a suspension aid, an emulsifying agent, a coating agent, or combinations thereof.
- an "individual in need” refers to an individual at risk for or having cancer, and in particular, prostate cancer, breast cancer, ovarian cancer, cervical cancer, osteosarcoma, colon cancer, bladder cancer, pancreatic cancer, gliomas, and the like as listed in Table 1.
- an "individual in need” refers to an individual at risk for or having a retinal disease (e.g., choroidal neovascularization (CNV), age-related macular degeneration (AMD), retinopathy of prematurity (ROP), diabetic retinopathy (DR)).
- a retinal disease e.g., choroidal neovascularization (CNV), age-related macular degeneration (AMD), retinopathy of prematurity (ROP), diabetic retinopathy (DR)
- an "individual in need” refers to an individual at risk for or having cardiovascular disease, bacterial infection, gastric inflammatory disorders, neurodegenerative diseases (e.g., Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), cerebral ischemia).
- AD Alzheimer's disease
- PD Parkinson's disease
- ALS amyotrophic lateral sclerosis
- cerebral ischemia e.g., cerebral ischemia
- an "individual in need” is also used herein to refer to an individual at risk for or diagnosed by a medical professional as having any one of these diseases and/or disorders.
- the methods disclosed herein are directed to a subset of the general population such that, in these embodiments, not all of the general population may benefit from the methods.
- the method embodiments of the present disclosure are directed to specific subsets or subclasses of identified individuals (that is, the subset or subclass of individuals "in need” of assistance in addressing one or more specific conditions noted herein), not all individuals will fall within the subset or subclass of individuals as described herein.
- the individual in need is a human.
- the individual in need can also be, for example, a research animal such as, for example, a non-human primate, a mouse, a rat, a rabbit, a cow, a pig, and other types of research animals known to those skilled in the art.
- a research animal such as, for example, a non-human primate, a mouse, a rat, a rabbit, a cow, a pig, and other types of research animals known to those skilled in the art.
- Notch3 ⁇ -secretase inhibitors, Notch signaling Pancreatic Cancer DLL4-inhibiting antibodies pathway - cell survival
- AT-101 exerts its anti-tumor effects in many ways: it is a BH3-mimetic and also has been shown to inhibit Ref-1 's DNA repair and redox activities. Blockade of the anti-apoptotic proteins Bcl-2 and Bcl-XL through Ref-1 's redox inhibition of STAT3 activity contributes to the enhanced cell killing and tumor growth seen in this combination. Furthermore, in NSCLC cell line A549, siRNA inhibition of APE1 expression significantly sensitizes A549 cells to cisplatin and increased cell apoptosis. Both of these studies point to Ref-1 function as critical in the cells' response to cisplatin, especially in apoptosis signaling through STAT3.
- a second option for uncovering new treatment options is to mine publicly available data sets such as TCGA (The Cancer Genome Atlas) and CCLE (Cancer Cell Line Encyclopedia) to elucidate [in silico] effective combination treatments to utilize in cancer treatment settings.
- the goal is to accelerate the selection of likely increased lethal targets, particularly for aggressive cancers that have few treatment options.
- Chemotherapy- induced peripheral neuropathy is one of the most prevalent dose-limiting toxicities of anticancer therapy. Up to 90% of cancer patients experience chemotherapy- induced peripheral neuropathy (CIPN) at some point during or after anticancer treatment. Indeed, anticancer drugs used for the six most common malignancies pose a substantial risk for CIPN. These drugs include, but are not limited to platinum agents, taxanes, vinca alkaloids, proteasome inhibitors, immunomodulators and even new, targeted therapeutic agents. There are currently no approved treatments to prevent or treat CIPN, thus the neurotoxicity can be dose-limiting for some patients.
- Platinum drugs are an important component of numerous standard-of-care treatment (SOC) regimens for pediatric and adult cancers; for example, oxaliplatin is a part of the FOLFIRINOX and FOLFOX protocols.
- CIPN can persist after treatment is completed. Up to 40% of cancer patients continue to struggle with CIPN five years after treatment ends— and 10% remain symptomatic after more than 20 years. Thus, CIPN directly affects cancer survivorship, quality of life, and may limit future treatment options if cancer recurs.
- APX3330 is a targeted inhibitor of APEl/Ref-l 's redox function, it appears that, in the setting of sensory neurons, it can also enhance the protein's DNA repair (AP endonuclease) activity (Figure 6). Although this seems counterintuitive, APX3330 causes the protein to unfold over time. This unfolding primarily alters the amino end of APEl/Ref-1, affecting its interactions with downstream transcription factor targets by perturbing the equilibrium of the protein's folded/unfolded states and facilitating repair activity.
- APX3330 protected sensory neurons from DNA damage and reactive oxygen species (ROS) production induced by agents such as ionizing IR, cisplatin and oxaliplatin.
- ROS reactive oxygen species
- a critical property of any putative therapeutic for neurotoxicity is that it will not compromise the anticancer function of the treatment(s) administered.
- the enhancement of DNA repair activity by APX3330 was not observed in mitotic cells. It was shown that APX3330 negatively affects the growth and/or survival of tumor cell lines, patient- derived cell lines, and tumors in animal models. Therefore, it is possible that APX3330 could protect postmitotic cells without altering the effects of anticancer drugs on tumor cells ( Figure 6). Additionally, APX3330 does not affect cisplatin or oxaliplatin' s tumor-killing efficacy in vivo, yet it protects DRG neurons from oxidative DNA damage.
- APX3330 could be offered as a neuroprotective mechanism in humans, facilitating BER repair of oxidative DNA damage and protecting sensory neurons.
- DNA repair function not the redox function of APEl/Ref-1 — is necessary for sensory neuronal survival/function. That is opposite from tumor cells.
- APEl knockout in mice results in embryonic lethality, post- implantation, between days E5-E9. As such, it has not historically been possible to generate stable APEl knockout cell lines.
- Pa03C, Pa02C, Pancl0.05 and Pancl98 were obtained from Dr. Anirban Maitra at The Johns Hopkins University. All cells were maintained at 37 °C in 5% CO 2 and grown in DMEM (Invitrogen; Carlsbad, CA) with 10% Serum (Hyclone; Logan, UT). Cell line identity was confirmed by DNA fingerprint analysis (IDEXX BioResearch, Columbia, MO) for species and baseline short-tandem repeat analysis testing. All cell lines were 100% human and a nine-marker short tandem repeat analysis is on file. They were also confirmed to be mycoplasma free.
- siRNAs used were Scrambled (SCR) (5' CCAUGAGGUCAGCAUGGUCUG 3', 5' GACCAUGCUGACCUCAUGGAA 3') (SEQ ID NO:l) and siAPEl (5' GUCUGGUACGACUGGAGUACC 3' (SEQ ID NO:2), 5' UACUCCAGUCGUACCAGACCU 3') (SEQ ID NO:3). All siRNA transfections were performed by plating lxlO 5 cells per well of a 6-well plate and allowing the cells to attach overnight.
- Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA) was used to transfect in the APE1 and SCR siRNA at concentrations between 10 and 50 nM following the manufacturer's indicated protocol. Opti-MEM, siRNA, and Lipofectamine was left on the cells for 16 hours and then regular DMEM media with 10% Serum was added. Cells were assayed for RNA and protein expression 3 days following transfection.
- APE1 Novus Biologicals, Littleton, CO
- Vinculin Sigma, St. Louis, MO
- Ingenuity Pathway Analysis was utilized in performing network analyses (IPA, QIAGEN Redwood City, www.qiagen.com/ingenuity).
- An upstream regulator analysis, canonical pathway analysis, mechanistic networks analysis, causal network analysis, and downstream effects analysis were performed using IPA (results were deemed significant for p-values ⁇ 0.05).
- Algorithms and details of each type of network analysis are presented in Kramer, A., et al., Causal analysis approaches in Ingenuity Pathway Analysis. Bioinformatics, 2014. 30(4): pp. 523-30.
- qRT-PCR was used to measure the mRNA expression levels of the various genes identified from the scRNA-seq analysis. Following transfection, total RNA was extracted from cells using the Qiagen RNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. First-strand cDNA was obtained from RNA using random hexamers and MultiScribe reverse transcriptase (Applied Biosystems, Foster City, CA). Quantitative PCR was performed using SYBR Green Real Time PCR master mix (Applied Biosystems, Foster City, CA) in a CFX96 Real Time detection system (Bio-Rad, Hercules, CA).
- the relative quantitative mRNA level was determined using the comparative Ct method using ribosomal protein L6 (RPL6) (Pa03C) or Actin (Pancl0.05, Pane 198, Pa02C) as the reference gene.
- RPL6 ribosomal protein L6
- Actin Pane 198, Pa02C
- the primers used for qRT-PCR are detailed in Table 4. Experiments were performed in at least triplicate for each sample. Statistical analysis performed using the 2 ⁇ AA Cr method and analysis of covariance (ANCOVA) models. Table 4: Primers used for qRT-PCR.
- siRNA knockdown of APEl did not result in complete loss of the APEl protein, as detected by Western blotting, with 10-20% APEl protein expression observed in the siAPEl samples compared to the scrambled controls (SCR) as shown by representative Western blot shown in Figure 8A.
- 20 nM siRNA was used, as levels greater than this results in off-target effects and cell killing not related to APEl functions. Therefore, in order to clearly identify changes in gene expression specifically related to the amount of APEl protein within each individual cell, single-cell RNA-seq was performed on cells following APEl siRNA knockdown.
- the siAPEl and SCR cells were split across three batches, with one batch containing siAPEl and two batches containing SCR cells (SCR1 and SCR2). Differences between cell batches were corrected by applying the scLVM R package.
- the Biomart R package was used to obtain a list of cell cycle-annotated genes. Specifically, the Gene Ontology (GO) term GO:0007049 was used to identify 189 genes with the annotation name of "cell cycle". Of these 189 genes, only 102 coincided with the genes remaining in the analysis due to removal of genes exhibiting low expression across all cells (gene detection rate quality control filtering).
- a latent variable model was fit to account for cell cycle confounding, while also incorporating treatment and control covariates into the model. Using the fitted latent variable model, it was then possible to regress out the cell cycle confounding and compute a corrected dataset.
- the plot in Figure 8B demonstrates the two principal components before correcting for cell cycle and shows that the most influential source of variation (i.e., the x-axis representing 6.84% of the total variation) in the data corresponds to the axis along which SCRl and SCR2 cells were separated.
- the second most influential source of variation i.e. the y-axis representing 4.57% of the total variation
- siAPEl and SCR cells were separated.
- the number of genes detected per cell averaged 7095.7 using the original (i.e. prior to correcting for cell-cycle confounding) gene expression counts. For each gene, the average number of cells with non-zero gene counts was 42.1 using the original gene expression counts.
- edgeR models the counts with an overdispersed (larger variance) Poisson distribution (also known as the negative-binomial distribution), which may not be appropriate for single cell RNA-seq data due the fact that there are many more zero counts in this data (a phenomenon referred to as zero-inflation) compared to bulk RNA-seq.
- One of the advantages of performing scRNA-seq is that it allows looking at APEl expression in each individual cell. It was therefore possible to use this information to categorize cells within the siAPEl group as having either undetectable APEl (defined as a cell with zero expression of APEl) or detectable APEl (defined as a cell with greater than zero expression of APEl). As previously mentioned, within the siAPEl group there were 25 cells with undetectable APEl (hereafter called undetectable siAPEl) and 20 cells exhibiting detectable but reduced APEl expression (hereafter called detectable siAPEl).
- This model has two parameters that can be tested for joint significance, whereas the initial SCR/siAPEl model only had one parameter to test. While it is possible to estimate the joint significance with a single test of both parameters, the parameter specific significance was computed in order to gain insight into the individual differences between undetectable siAPEl and detectable siAPEl groups with respect to the SCR control. In practice, each of these parameters was tested separately and their joint significance was reported as the resulting p-values using Fisher's method. For two p-values pi j ,p2 j corresponding to test of 3 ⁇ 4, 3 ⁇ 4/ for the f h gene, the combined test statistic is described as
- F -2* ⁇ og( Plj ) - 2*log(/3 ⁇ 4) ⁇ xl
- F is distributed as a chi-squared random variable with four degrees of freedom under the null hypothesis.
- the combined p-value p* is therefore computed as where denotes the cumulative distribution function of a random variable and F * is the empirical test statistic computed similar to F above, only using the computed p-values for each gene.
- Fisher' s method does not enforce the assumption of a consistent direction of differential expression of the two groups when compared to the control. While it may be useful to incorporate the assumption that the direction (positive or negative) of differential expression should be consistent among the detectable and undetectable siAPEl groups directly into the statistical design of the analysis, these ideas were not pursued further.
- This analysis allows for detection of differences that may be present between SCR and detectable siAPEl cells, between SCR and undetectable siAPEl cells, or between SCR and both categories of siAPEl cells.
- the joint analysis guards against a single outlier preventing a gene from being reported as differentially expressed as one parameter may be reported as insignificant, but not the other.
- this experimental design aids in the interpretation of results and helps to identify genes potentially affected by outliers.
- This SCR/detectable siAPEl/undetectable siAPEl analysis identified 2,837 genes using a false discovery rate of 5%.
- One overarching objective of this Example was to ascertain potential combinations of APE1 inhibition with clinically approved drugs that impinge on pathways impacted by altered APE1 expression, initially in pancreatic cancer, but eventually in other cancers.
- TCGA Cancer Genome Atlas
- Both the SCR/siAPEl and SCR/detectable siAPEl/undetectable siAPEl analyses were utilized. Performing this TCGA analysis allowed for measurement of the clinical relevance of the DEGs identified in this Example, and also provided a performance metric for the two analyses.
- the RTCGA toolbox was used to analyze the data from the TCGA.
- a gene is defined as clinically relevant if its expression level at the time of sequencing is statistically significantly related to the number of days until death in patients with pancreatic cancer.
- the statistical significance of a gene is determined using the Cox proportional hazards regression model, a commonly used model in clinical trials and biostatistics. Specifically, the outcome of days until death (accounting for censoring due to a patient still being alive at the time of sequencing) was regressed on the normalized gene expression data of patient tumor samples via bulk RNA-Seq using the R package survival. Only expression levels in the analysis were used, modeling one gene at a time across all tumor types and stages.
- the TCGA analysis resulted in 1,627 genes statistically significantly related to time until death using a false discovery rate of 5%.
- 1,486 DEGs considered from the SCR/siAPEl analysis 246 genes (16.6%) were found to be clinically relevant.
- the SCR/detectable siAPEl/undetectable siAPEl analysis identified 345 clinically relevant genes (16.3 %) out of the available 2,115 DEGs.
- the SCR/detectable siAPEl/undetectable siAPEl analysis identified more DEGs that are clinically relevant without a change in the overall percentage of clinically relevant genes. This further illustrates that the 856 genes unique to the analysis were not statistical anomalies, but authentic results identified due to a more stringent statistical model. Because of this result, all following analyses were carried out using the SCR/detectable siAPEl/undetectable siAPEl results. Gene expression patterns in cancer-related pathways
- IP A Ingenuity pathway analysis
- Tryptophan Degradation X (Mammalian, via Tryptamine) 0.011
- a number of the significant pathways affected by APEl knockdown confirm previous observations and therefore provided validation for the results.
- the mitochondrial dysfunction pathway has 37 DEGs, while there are 42 DEGs in the Huntington's disease signaling pathway.
- Mitochondrial dysfunction is believed to play a role in Huntington' s disease pathology, and prior studies have demonstrated that APEl is important for the maintenance of mitochondrial function. APEl is also known to participate in mitochondrial DNA repair functions. While APEl is known to influence these pathways, this Example expands the understanding of APEl within the cell by implicating the genes in the pathways that are affected by APEl knockdown.
- the "connectivity map" project compared the query gene expression signatures against a database of gene expression profiles derived from treating human cells with various agents to identify similarities and predict drug mechanisms. Incorporating drug sensitivity data of cell lines with similar gene expression profiles were used to predict effective combination treatments.
- Cancer Cell Line Encyclopedia (CCLE, https://portals.broadinstitute.org/ ccle/home) contains baseline gene expression data of 1,036 cancer cell lines and pharmacologic profiles (IC 50 , AUC) for anticancer drugs across 504 cell lines.
- CCLE gene expression profile set as the reference was used, as well as data from Genomics of Drug Sensitivity in Cancer (GDSC) and Cancer Therapeutics Response Portal (CTRP, http://portals.broadinstitute.org/ctrp/).
- Table 6 List of compounds likely to synergize with APX3330 based on CCLE and single cell RNAseq
- RTKi Receptor tyrosine Axitinib 3.32E-09 kinases
- FIG. 14C the beneficial effects of combining APX3330 with gemcitabine in vivo were demonstrated.
- APX3330 25 mg/kg was combined with a standard dose of gemcitabine (35 mg/kg) to demonstrate the "additive" effects of APX3330 in reducing pancreatic tumor volumes.
- the data in Figure 14C is tumor volume at sacrifice. Combination therapy was well-tolerated. There was a significantly decreased tumor volume in the combination treatments of APX3330 with gemcitabine compared to the single agents alone. All treatments, single or combination were significantly different from the vehicle control.
- Pancl0.05 cells derived from a primary PDAC tumor, exhibited similar results to Pa03C cells, with eight of the 12 genes showing similar changes in expression (Figure 16B).
- COMMD7, ITGAl, RAB3D, SIPA1, TAPBP and TNFAIP2 show decrease, while BCRP and PPIF increased expression.
- CIRBP, ISYNA1, NOTCH3 and PRDX5 show no change in expression in the Pane 10.05 cells.
- Pane 198 cells also originating from a primary tumor, produced the most varied results (Figure 16C). No change in expression was seen for BCRP, CIRBP, ISYNA1, NOTCH3, PRDX5, PPIF, SIPA1 and TAPBP.
- COMMD7, ITGAl, RAB3D and TNFAIP2 all showed significantly decreased expression.
- COMMD7, ITGAl, RAB3D and TNFAIP2 were significantly changed in all four patient-derived cell lines tested (Figure 16D).
- BCRP Breast cancer resistance protein
- ABCG2 is an ATP-binding cassette (ABC) transporter that is one of the proteins responsible for multidrug resistance of cancer cells.
- ABSC ATP-binding cassette
- high BCRP expression corresponds to carcinogenesis, tumor progression, early recurrence and poor survival.
- chemotherapeutic drugs are substrates for BCRP, which results in their efflux from and reduced accumulation within the cells.
- An affected drug of particular interest is 5-fluorouracil (5-FU), which is currently part of the treatment regimen for PDAC patients. Therefore, the discovery that APE1 knockdown affects BCRP expression is crucial when looking at future drug combinations to improve survival in PDAC.
- APE1 -targeted agents with 5-FU in tumors genetically similar to Pa02C should respond favorably to this combination due to reduced BCRP expression.
- a study in colon cancer stem cells indeed demonstrated dramatically increased cell killing when 5-FU and an inhibitor of APE1, APX3330, were used in vivo.
- NOTCH3 a highly conserved member of the eponymous Notch signaling pathway, has been implicated in cell survival, proliferation, differentiation, development and homeostasis. Increased Notch3 protein levels have been identified as a prognostic marker for PDAC patients, and leads to increased tumor invasion, metastasis and shortened patient survival. Because of this, Notch3 has become a target for novel cancer therapies, ⁇ -secretase inhibitors and DLL4-inhibiting antibodies both target proteins upstream of Notch3, leading to the inhibition of the Notch signaling pathway.
- Notch3 as being affected by APE1 opens up the possibility of combining APEl-targeted therapies with these inhibitors to enhance (in Pa03C) or counteract (in Pa02C) the effects of APE1 inhibition on NOTCH3 expression and function in PDAC.
- tumor cells were stably transduced with TdTomato (red channel), and CAFs were stably transduced with EGFP (green channel).
- TdTomato red channel
- EGFP green channel
- 3D spheroid cultures were analyzed on Days 4, 8 and 12 after plating using Thermo ArrayScan high-content imaging system as described in Logsdon, Mol Cancer Ther 2016, 15(11), 2722-2732 and Lindblom et al., Toxicologic pathology 2012, 40(1), 18-32.
- 3D culture images were obtained by the ArrayScan system at 2.5x magnification with filters for TdTomato and EGFP. Quantification of tumor and CAF intensity and area was accomplished using 2D projections of these 3D images.
- Spheroids were treated on Days 4 and 8 following ArrayScan analysis/imaging.
- APX3330 and its second generation compounds reduced cell growth, cell proliferation. Moreover, APX2009 and APX2014 appeared as effective as APX3330 even when administered at a lower dosage.
- Pa03C and Pancl0.05 tumor cells were grown in 3D cultures in the presence of CAFs. Spheroids were treated with either single agents, vehicle (DMSO) or combination of targeted agents on days 4 and 8 (black arrows), and the intensity of tumor (red) and CAF (green) were quantified as described in Example 7 every 3-4 days in culture.
- Pa03C and Pancl0.05 tumor cells were grown in 3D cultures in the presence of CAFs (cancer-associated fibroblasts). Spheroids were treated with either single agents, vehicle (DMSO) or combination of targeted agents on Days 4 and 8, and the area of tumor (red) and CAF (green) were quantified following 12 days in culture. Results are shown in Figures 23A- 23E.
- IHC Immunohistochemistry
- Tissues were fixed overnight at room temperature in 10% NBF after which they were transferred through graded concentrations of alcohol to xylene inside a Leica Automated Vacuum Tissue Processor. Tissues were embedded in paraffin before being cut into 5 -mm thick sections, mounted onto positively charged slides, and baked at 60°C. The slides were then deparaffinized in xylene and rehydrated through graded alcohols to water. Antigen retrieval was performed by immersing the slides in a Target Retrieval Solution (Dako) for 20 minutes at 90°C (in a water bath), cooling at room temperature for 10 minutes, washing in water, and then proceeding with immunostaining.
- Dako Target Retrieval Solution
- Treatment of the implanted tumors started on day 11 post implant.
- the co-cultures implanted included 2.5xl0 6 tumor cells +/- 5xl0 6 CAFs, providing a 1 :2 ratio of tumor cell to CAF.
- the tumors had an initial average tumor size of about 200 mm 3 .
- the mice were then administered either 50 mg/kg APX3330 BID in 4% Cr:EtOH, 50 mg/kg Rux SID pm in 4% Cr:EtOH, or combinations of the agents.
- Treatment schedule consisted of treating for 5 days and then giving 2 days off treatment until the tumors reached an average size of 2000 mm 3 .
- mice With no treatment, the mice reached an average tumor size of 2700 mm 3 at day 26, with Rux or APX3330 treatment alone, the mice reached an average size of 1750 m 3 at day 28, and with the combination therapy, the mice reached an average size of 1200 mm 3 at day 31.
- MC-38 cells (Yunhua Liu) were seeded in a 96-well tissue culture plate at 2000 cells/well in DMEM + 10% FBS and grown overnight at 37°C, 5% C0 2 . Media was exchanged with DMEM + 5% FBS drug media containing Napabucasin (SELLECK CHEMICALS) serially diluted 1 :2 in a 5 -point spread of 750 nM to 47 nM and spiked with APX2014 at EC30 (3.0 uM), or APX2014 ECIO (2.0 uM), or alone for single agent. Cells were incubated for 72 hours at 37°C, 5% C0 2 .
- Napabucasin SELLECK CHEMICALS
- FIG. 30A Media was exchanged with DMEM + 5% FBS + 10% Alamar blue fluorescent cell viability indicator (InvitrogenTM) and incubated 4 hours at 37°C, 5 % CO 2 and then read on a fluorescent reader (SynergyTM H4 BioTek). Results are shown in Figure 30A.
- Figure 30B shows APX2014 single agent effect. Data shown is the average of 3 separate cytotoxicity assays; each assay normalized to media only control.
- Colo-201 (Yunhua Liu) was seeded in a 96-well tissue culture plate at 2000 cells/well in RPMI + Sodium Pyruvate + 10% FBS and grown overnight at 37°C, 5% C0 2 .
- Figure 31B shows APX3330 and CPI-613 synergistic combo effects.
- Figure 31C shows APX3330 and CPI-613 EC50 (CalcuSyn).
- Figure 3 ID depicts Chou-Talalay Index (CI) of dose combinations (CalcuSyn).
- Figure 3 IE depicts synergistic drug combinations (CalcuSyn) of APX3330 spiked with 50 uM CPI-613 or 75 uM CPI-613.
- Drug combination synergy was observed at APX3330 dosages of 75 uM and 50 uM when spiked with 50 uM CPI-613.
- Synergy was observed at all but one APX3330 dosage (6.3 uM) when spiked with 75 uM CPI-613.
- Data shown is the average of 3 separate cytotoxicity assays; each assay normalized to media only control.
- HTC-116 (Yunhua Liu) was seeded in a 96-well tissue culture plate at 2000 cells/well in DMEM + 10% FBS and grown overnight at 37°C, 5% C0 2 .
- Drug Media DMEM + 5% FBS was added at dosages of APX3330 (Apexian) in a 5-point spread from 75 uM to 6.3 uM and spiked with CPI-613 (Apexbio Technology) at 75 uM, or 50 uM, or alone for single agent. Cells were incubated for 72 hours at 37°C, 5% C0 2 .
- Figure 32A shows APX3330 and CPI-613 single agent effects.
- Figure 32B shows APX3330 and CPI- 613 synergistic combo effects.
- Figure 32C shows APX3330 and CPI-613 EC50 (CalcuSyn).
- Figure d32D depicts Chou-Talalay Index (CI) of dose combinations (CalcuSyn).
- Figure 32E depicts synergistic drug combinations (CalcuSyn) of APX3330 spiked with 50 uM CPI-613 or 75 uM CPI-613.
- Drug combination synergy was observed at APX3330 dosages of 75 uM and 50 uM when spiked with 50 uM CPI-613.
- Synergy was observed at all but one APX3330 dosage (6.3 uM) when spiked with 75 uM CPI-613.
- Data shown is the average of 3 separate cytotoxicity assays; each assay normalized to media only control.
- HTC-116 (Yunhua Liu) was seeded in a 96-well tissue culture plate at 2000 cells/well in DMEM + 10% FBS and grown overnight at 37°C, 5% C0 2 .
- Drug Media DMEM + 5% FBS was added at dosages of APX3330 (Apexian) from 100 uM to 0.4 uM in a 10-point spread and spiked with CPI-613 (Apexbio Technology) at 100 uM, or 75 uM, or alone for single agent. Cells were incubated for 72 hours at 37°C, 5 % CO 2 .
- Figure 33A shows APX3330 and CPI-613 single agent effects.
- Figure 33B shows APX3330 and CPI-613 synergistic combo effects.
- Figure 33C shows APX3330 and CPI-613 EC50 (CalcuSyn).
- Figure 33D depicts Chou-Talalay Index (CI) of dose combinations (CalcuSyn).
- Figure 33E depicts synergistic drug combinations (CalcuSyn) of APX3330 spiked with 100 uM CPI-613 or 75 uM CPI-613. Drug combination synergy was observed at all APX3330 dosages when spiked with 100 uM CPI-613. Synergy was observed at APX3330 dosages 100 uM - 12.5 uM when spiked with 75 uM CPI-613. Data shown is the average of 3 separate cytotoxicity assays; each assay normalized to media only control.
- HTC-116 (Yunhua Liu) was seeded in a 96-well tissue culture plate at 2000 cells/well in DMEM + 10% FBS and grown overnight at 37°C, 5% C0 2 .
- Drug Media DMEM + 5% FBS was added at dosages of APX2014 (Apexian) in a 5-point spread from 25 uM to 1.6 uM and spiked with CPI-613 (Apexbio Technology) at 75 uM, or 50 uM, or alone for single agent. Cells were incubated for 72 hours at 37°C, 5% C0 2 .
- Figure 34A shows APX2014 and CPI-613 single agent effects.
- Figure 34B shows APX2014 and CPI- 613 synergistic combo effects.
- Figure 34C shows APX2014 and CPI-613 EC50 (CalcuSyn).
- Figure 34D depicts Chou-Talalay Index (CI) of dose combinations (CalcuSyn).
- Figure 34E depicts synergistic drug combinations (CalcuSyn) of APX2014 spiked with 50 uM CPI-613 or 75 uM CPI-613. Drug combination synergy could not be ascertained at APX2014 dosages when spiked with 50 uM CPI-613. Synergy was observed at only one APX2014 dosage (12.5 uM) when spiked with 75 uM CPI-613. Data shown is the average of 3 separate cytotoxicity assays; each assay normalized to media only control.
- HTC-116 (Yunhua Liu) was seeded in a 96-well tissue culture plate at 2000 cells/well in DMEM + 10% FBS and grown overnight at 37°C, 5% C0 2 .
- Drug Media DMEM + 5% FBS was added at dosages of APX3330 (Apexian) from 100 uM to 0.4 uM in a 10-point spread and spiked with CB-839 (Sigma-Aldrich) at 1000 nM, or 500 nM, or alone for single agent. Cells were incubated for 72 hours at 37°C, 5 % C0 2 .
- Figure 35A depicts APX3330 and CB-839 single agent effects.
- Figure 35B depicts APX3330 and CB-839 synergistic combo effects.
- Figure 35C shows APX3330 and CB-839 EC50 (CalcuSyn).
- Figure 35D shows Chou-Talalay Index (CI) of dose combinations (CalcuSyn).
- Figure 35E depicts synergistic drug combinations (CalcuSyn) of APX3330 spiked with 1000 nM CB-839 or 500 nM CB-839 (5-pt only). Drug combination synergy was observed at APX3330 dosages 100 uM - 25 uM when spiked with 1000 nM. Synergy was observed at APX3330 dosages 100 uM - 50 uM when spiked with 500 nM CB-839. Data shown is the average of 3 separate cytotoxicity assays; each assay normalized to media only control. EXAMPLE 23
- the BLCAbOOl (cisplatin resistant) cell line was treated with increasing concentrations of APX2014 and cisplatin as single agents and in combination and assayed in a 96-hour viability assay.
- the concentrations of APX2014 range from 6mM-0.38mM in combination with the indicated cisplatin doses (Figure 36A). Doses of 6mM-3mM were shown to be synergistic with combination indexes of >1.0.
- the concentrations of Cisplatin as a single agent range from 2.5 mM-0.04mM ( Figure 36B).
- the BLCAb002 (cisplatin sensitive) cell line was treated with increasing concentrations of APX2014 and cisplatin as single agents and in combination and assayed in a 96-hour viability assay.
- the concentrations of APX2014 range from 6mM-0.38mM in combination with the indicated cisplatin doses (Figure 37A). Doses of 6mM-1.5mM were shown to be synergistic with combination indexes of >1.0.
- the concentrations of cisplatin as a single agent range from 2.5 mM-0.04mM ( Figure 37B).
- T24 bladder cancer cells were treated with increasing concentrations of napabucasin in the presence or absence of APX2014 (2.5 or 5.0 mM) for 72 hours. The cells were then fixed, stained with methylene blue and relative cell number was calculated via spectrophotometry. Results are shown in Figures 38A & 38B.
- T24 bladder cancer cells were treated with increasing concentrations of napabucasin in the presence or absence of APX2009 (2.5 or 5.0 mM; 3.5 or 7 mM) for 72 hours. The cells were then fixed, stained with methylene blue and relative cell number was calculated via spectrophotometry. Results are shown in Figures 39 A & 39B.
- SCaBER bladder cancer cells were treated with increasing concentrations of napabucasin in the presence or absence of APX2009 (2.5 or 5.0 mM; 3.5 or 7 mM) for 72 hours. The cells were then fixed, stained with methylene blue and relative cell number was calculated via spectrophotometry. Results are shown in Figures 41 A & 41 B.
- siRNA Transfections PDAC cells were transfected with siRNA as previously described in Logsdon et al. (2016 Mol Cancer Ther 15(l l):2722-2732), Fishel et al. (2011 Mol Cancer Ther 10(9): 1698-1708), and Arpin era al. (2016 Mol Cancer Ther 15(5):794-805).
- siRNAs used were scrambled control and siAPEl/Ref-1 (SEQ ID NOS:l-3), as well as OriGene (Rockville, MD) Trisilencer siCA9.
- Inhibitors Small molecule inhibitors were prepared and used as previously described in Logsdon et al. (2016 Mol Cancer Ther 15(l l):2722-2732), Fishel et al. (2011 Mol Cancer Ther 10(9):1698-1708), Su et al. (2011 Biochem 50:82-92), and Zhang et al. (2013 Biochem 52(17):2955-2966).
- APEl/Ref-1 redox signaling was inhibited using APX3330, APX2009, and APX2014 (Apexian Pharmaceuticals; Indianapolis, IN), with RN7-58 (Apexian Pharmaceuticals) used as a negative control that, although structurally similar, does not inhibit APEl/Ref-1 redox signaling activity (Shah et al. 2017 NPJ Precision Oncology 1 ; Kelley et al., 2017 Neural Regen Res 12(l):72-74; Kelley et al., 2016 J Pharmacol Exp Ther 359(2):300-039; Fishel et al., 2011 Mol Cancer Ther 10(9):1698-1708).
- C P Assay Chromatin Immunoprecipitation (ChIP) was performed using the Magna ChIP kit (Millipore). Immunoprecipitation (IP) was performed using polyclonal antibodies for HIFla (Novus) or Rabbit IgG control (Millipore). Binding to the HIF-l-Binding Site (HBS) in the CA9 promoter was measured via qPCR using SYBR Green master mix (Applied Biosystems) in a CFX96 Real-Time System (Bio-Rad).
- HBS HIF-l-Binding Site
- Primer sequences used for ChIP qPCR were: CA9 HBS-Fwd (5' - CTCACTCCACCCCCATCCTA - 3')(SEQ ID NO:32) and CA9 HBS -Rev (5' - GGACCGAGGGAGACAACTAG - 3') (SEQ ID NO:33). 1% of the cross-linked DNA from each sample was evaluated (without IP) as a control to normalize the qPCR signal across samples (Input).
- pH Assay Intracellular pH was measured with pHrodo Red AM Intracellular pH Indicator (LifeTech) as described in Logsdon et al. (2016 Mol Cancer Ther 15(11):2722- 2732). Fluorescent images of pHrodo Red AM-exposed cells were captured with a confocal/two- photon Olympus Fluoview FV-1000 MPE system (Olympus Scientific Solutions America; Waltham, MA) at the Indiana Center for Biological Microscopy facility (Indianapolis, IN) as previously described in Logsdon et al. (2016 Mol Cancer Ther 15(ll):2722-2732).
- qRT-PCR mRNA levels were measured using qRT-PCR as previously described in Logsdon et al. (2016 Mol Cancer Ther 15(l l):2722-2732), Fishel et al. (2011 Mol Cancer Ther 10(9): 1698-1708), Fischer et al. (2015 J Biol Chem 290(5):3057-3068).
- the comparative Ct method was used to quantitate mRNA levels using RPLP0 and B2M as reference genes.
- the primers for CA9, RPLP0, and B2M are commercially available (Applied Biosystems). Experiments were performed in triplicate for each sample.
- Immunohistochemistry 3D spheroid cultures were collected on day 12 after plating, fixed with 4% paraformaldehyde (PFA) (Electron Microscopy Sciences; Hatfield, PA), and permeabilized with 70% ethanol. Fixed/permeabilized 3D cultures were solidified in HistoGel (LifeTech). HistoGel plugs were paraffin embedded and slides were prepared by the laboratory of Dr. Keith Condon (Indiana University School of Medicine; Indianapolis, IN). Samples were stained with the specified antibodies by the Indiana University School of Medicine Research Immunohistochemistry Facility (Indianapolis, IN).
- PFA paraformaldehyde
- CA9 is well-established as a hypoxia-regulated enzyme, the level of CA9 expression induced under hypoxic conditions is variable between patient lines. Therefore, the relative CA9 expression in a selection of low- passage patient-derived PDAC cell lines (10.05, Pa02C, and Pa03C) was determined following 24 hrs exposure to 0.2% oxygen, as compared to cells incubated in normoxic conditions.
- APEl/Ref-1 redox inhibition was also measured in 3D tumor spheroids. 10.05 cells were grown in 3D cultures for 12 days and treated on days 4 and 8 with APX3330, APX2009 and APX2014, or the inactive analog (RN7- 58). APEl/Ref-1 redox inhibition significantly decreased the expression of CA9 protein in 3D tumor cultures in a concentration-dependent manner ( Figure 43C). Importantly, the APX2009 and APX2014 APEl/Ref-1 inhibitors required 10-fold less of the concentration compared to APX3330 to attenuate CA9 expression in the spheroid cultures, further validating the potency of these compounds. The inactive analog (RN7-58) did not affect CA9 expression in PDAC spheroid cultures, once again corroborating the specificity of the effects of the APEl/Ref-1 redox signaling inhibitors on HIFla activity.
- CA9 expression is important for tumor cell growth, and CA9 functions by stabilizing intracellular pH to counteract the acidification that occurs in response to metabolic changes under hypoxic conditions.
- As a functional marker for CA9 activity the effects of CA9 on intracellular pH were evaluated. Hypoxia exposure (0.2% O2 for 48 hrs) did not significantly affect intracellular pH in 10.05 cells ( Figures 43D and 43E), indicating that these cells compensate for the effects of hypoxia on pH.
- CA9 expression was reduced via siRNA the result was a significant decrease in intracellular pH in hypoxia-exposed cells, as measured by increased fluorescence of the pH-sensitive pHrodo Red AM dye ( Figures 43D and 43E).
- APX3330 and SLC-0111 did not affect intracellular pH as single-agents at concentrations up to 50 ⁇ APX3330 or 100 ⁇ SLC-0111, instead requiring the combination of both compounds to acidify hypoxic PDAC cells. Therefore, the APX3330 analogs, APX2009 and APX2014, were used to determine whether APEl/Ref-1 redox inhibition alone can shift intracellular pH in hypoxic PDAC cells given a sufficiently potent inhibitor. Treatment with either 8 ⁇ APX2009 or 5 ⁇ APX2014 alone resulted in a significant increase in fluorescence (normalized to cell survival), indicating decreased intracellular pH with single-agent APEl/Ref-1 redox signaling inhibition (FIGS.
- hypoxia markers CA9 and Glucose Transporter 1 showed positivity in distinct regions ( Figures 44E and 44 F), indicating differential zones of hypoxia within the spheroid cultures.
- FC12-531A SLC-0111 analog
- FC12-531A SLC-0111 analog
- 3 ⁇ FC12- 531A monotherapy significantly affected tumor cell growth in Pa03C co-cultures, but not in 10.05 co-cultures
- FC12-531A significantly enhanced the effects of APX3330, APX2009, and APX2014 on 3D tumor cell growth in both 10.05 and Pa03C co-cultures
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Inorganic Chemistry (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2019549542A JP2020514349A (ja) | 2017-03-20 | 2018-03-20 | 癌の処置のための併用治療剤におけるape1/ref−1阻害剤の使用 |
| CA3056240A CA3056240A1 (en) | 2017-03-20 | 2018-03-20 | Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer |
| US16/092,812 US20190160034A1 (en) | 2017-03-20 | 2018-03-20 | Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer |
| EP18772627.8A EP3430057A4 (en) | 2017-03-20 | 2018-03-20 | USE OF APE1 / REF-1 INHIBITORS IN COMBINATION THERAPIES FOR TREATING CANCER |
| EP20179181.1A EP3735968A1 (en) | 2017-03-20 | 2018-03-20 | Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer |
| US17/026,671 US11648226B2 (en) | 2017-03-20 | 2020-09-21 | Use of APE1/Ref-1 inhibitors for treatment of retinal diseases |
| US18/295,907 US12350247B2 (en) | 2017-03-20 | 2023-04-05 | Use of APE1/Ref-1 inhibitors for treatment of retinal diseases |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762473528P | 2017-03-20 | 2017-03-20 | |
| US62/473,528 | 2017-03-20 | ||
| US201762521082P | 2017-06-16 | 2017-06-16 | |
| US62/521,082 | 2017-06-16 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/092,812 A-371-Of-International US20190160034A1 (en) | 2017-03-20 | 2018-03-20 | Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer |
| US17/026,671 Continuation US11648226B2 (en) | 2017-03-20 | 2020-09-21 | Use of APE1/Ref-1 inhibitors for treatment of retinal diseases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018175429A1 true WO2018175429A1 (en) | 2018-09-27 |
Family
ID=63586117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/023346 Ceased WO2018175429A1 (en) | 2017-03-20 | 2018-03-20 | Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer |
Country Status (5)
| Country | Link |
|---|---|
| US (3) | US20190160034A1 (cg-RX-API-DMAC7.html) |
| EP (2) | EP3430057A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2020514349A (cg-RX-API-DMAC7.html) |
| CA (1) | CA3056240A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2018175429A1 (cg-RX-API-DMAC7.html) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020132401A1 (en) * | 2018-12-20 | 2020-06-25 | Rafael Pharmaceuticals, Inc. | Oral therapy using 6,8-bis-benzylthio-octanoic acid |
| CN111840228A (zh) * | 2019-04-09 | 2020-10-30 | 中国科学院上海药物研究所 | 肿瘤免疫脂质体,其制备方法和用途 |
| WO2021034635A1 (en) * | 2019-08-16 | 2021-02-25 | Rafael Pharmaceuticals, Inc. | Therapeutic methods and compositions for treating cancer using 6,8-bis-benzylthio-octanoic acid and a glutaminase inhibitor |
| WO2021048412A1 (en) * | 2019-09-11 | 2021-03-18 | Seald As | Combination therapies comprising panobinostat for the treatment of cholangiocarcinoma |
| WO2021048419A1 (en) * | 2019-09-11 | 2021-03-18 | Seald As | Combination therapies comprising trametinib for the treatment of cholangiocarcinoma |
| EP3897601A4 (en) * | 2018-12-17 | 2022-08-31 | Indiana University Research And Technology Corporation | TREATMENT OF GASTROINTESTINAL DISEASES AND THEIR SYMPTOMS |
| US12312308B2 (en) | 2022-09-14 | 2025-05-27 | Opus Genetics, Inc. | Salts and esters of APX3330 and therapeutic uses thereof |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190160034A1 (en) * | 2017-03-20 | 2019-05-30 | Indiana University Research And Technology Corporation | Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer |
| CN115317619B (zh) * | 2021-05-10 | 2025-10-17 | 北京化工大学 | 一种核酸纳米载药体及其应用 |
| WO2025147565A1 (en) * | 2024-01-05 | 2025-07-10 | Indiana University Research And Technology Corporation | Treatment of necrotizing enterocolitis and symptoms thereof |
| WO2025231402A1 (en) * | 2024-05-03 | 2025-11-06 | Indiana University Research And Technology Corporation | Methods of inhibiting retinal degeneration |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030229004A1 (en) * | 2002-03-20 | 2003-12-11 | Pangene Corporation | Modulation of tumor cells using BER inhibitors in combination with a sensitizing agent and DSBR inhibitors |
| AU2008304619C1 (en) * | 2007-09-26 | 2020-06-04 | Indiana University Research And Technology Corporation | Benzoquinone derivative E3330 in combination with chemotherapeutic agents for the treatment of cancer and angiogenesis |
| US11331294B2 (en) * | 2007-09-26 | 2022-05-17 | Indiana University Research And Technology Corporation | Benzoquinone derivative E3330 in combination with chemotherapeutic agents for the treatment of bladder cancer |
| KR101982669B1 (ko) * | 2011-05-26 | 2019-05-27 | 인디애나 유니버시티 리서치 앤드 테크놀로지 코퍼레이션 | Ape1 매개된 질환을 치료하기 위한 퀴논 화합물 |
| CN109602734A (zh) * | 2012-03-14 | 2019-04-12 | 印第安纳大学研究及科技有限公司 | 用于治疗白血病的化合物和方法 |
| WO2014047782A1 (zh) * | 2012-09-25 | 2014-04-03 | 鼎泓国际投资(香港)有限公司 | 含有白藜芦醇及白藜芦醇类衍生物和Bcl-2抑制剂的药物组合物及其应用 |
| US20190160034A1 (en) * | 2017-03-20 | 2019-05-30 | Indiana University Research And Technology Corporation | Use of ape1/ref-1 inhibitors in combination therapies for treatment of cancer |
| US20190117602A1 (en) * | 2017-04-17 | 2019-04-25 | Indiana University Research And Technology Corporation | Prevention and reversal of inflammation induced dna damage |
| AU2019218797B2 (en) * | 2018-02-08 | 2023-09-21 | Indiana University Research And Technology Corporation | Targeting ocular diseases with novel APE1/Ref-1 inhibitors |
-
2018
- 2018-03-20 US US16/092,812 patent/US20190160034A1/en not_active Abandoned
- 2018-03-20 JP JP2019549542A patent/JP2020514349A/ja active Pending
- 2018-03-20 EP EP18772627.8A patent/EP3430057A4/en not_active Withdrawn
- 2018-03-20 CA CA3056240A patent/CA3056240A1/en active Pending
- 2018-03-20 EP EP20179181.1A patent/EP3735968A1/en not_active Withdrawn
- 2018-03-20 WO PCT/US2018/023346 patent/WO2018175429A1/en not_active Ceased
-
2020
- 2020-09-21 US US17/026,671 patent/US11648226B2/en active Active
-
2023
- 2023-04-05 US US18/295,907 patent/US12350247B2/en active Active
Non-Patent Citations (4)
| Title |
|---|
| MASOOD, A ET AL.: "Small Molecule Inhibitors of Bcl-2 Family Proteins for Pancreatic Cancer Therapy", CANCERS, vol. 3, no. 2, 1 June 2011 (2011-06-01), pages 1527 - 1549, XP055544694 * |
| MCELYEA, KC ET AL.: "Abstract 5183: Efficacy Study of APX3330, a Ref-1 Redox Inhibitor, and Gemcitabine in a Mouse Pancreatic Ductal Adenocarcinoma Model", CANCER RESEARCH, vol. 76, no. 14, July 2016 (2016-07-01), XP009513883, ISSN: 0008-5472, DOI: 10.1158/1538-7445.AM2016-5183 * |
| REN, T ET AL.: "Sequential Treatment with AT -101 Enhances Cisplatin Chemosensitivity in Human Non-Small Cell Lung Cancer Cells Through Inhibition of Apurinic/Apyrimidinic Endonuclease 1-Activated IL -6/STAT3 Signaling Pathway", DRUG DESIGN, DEVELOPMENT AND THERAPY, vol. 8, 12 December 2014 (2014-12-12), pages 2517 - 2529, XP055544718 * |
| SHAH. F ET AL.: "Exploiting the Ref-1-APE1 Node in Cancer Signaling and Other Diseases: from Bench to Clinic", NPJ PRECISION ONCOLOGY, vol. 1, 8 June 2017 (2017-06-08), pages 1 - 19, XP055544763 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3897601A4 (en) * | 2018-12-17 | 2022-08-31 | Indiana University Research And Technology Corporation | TREATMENT OF GASTROINTESTINAL DISEASES AND THEIR SYMPTOMS |
| WO2020132401A1 (en) * | 2018-12-20 | 2020-06-25 | Rafael Pharmaceuticals, Inc. | Oral therapy using 6,8-bis-benzylthio-octanoic acid |
| JP2022514084A (ja) * | 2018-12-20 | 2022-02-09 | ラファエル ファーマシューティカルズ, インコーポレイテッド | 6,8-ビス-ベンジルチオ-オクタン酸を使用する経口療法 |
| CN111840228A (zh) * | 2019-04-09 | 2020-10-30 | 中国科学院上海药物研究所 | 肿瘤免疫脂质体,其制备方法和用途 |
| WO2021034635A1 (en) * | 2019-08-16 | 2021-02-25 | Rafael Pharmaceuticals, Inc. | Therapeutic methods and compositions for treating cancer using 6,8-bis-benzylthio-octanoic acid and a glutaminase inhibitor |
| WO2021048412A1 (en) * | 2019-09-11 | 2021-03-18 | Seald As | Combination therapies comprising panobinostat for the treatment of cholangiocarcinoma |
| WO2021048419A1 (en) * | 2019-09-11 | 2021-03-18 | Seald As | Combination therapies comprising trametinib for the treatment of cholangiocarcinoma |
| CN114650816A (zh) * | 2019-09-11 | 2022-06-21 | 海尔德股份有限公司 | 用于治疗胆管癌的包含帕比司他的联合疗法 |
| US12312308B2 (en) | 2022-09-14 | 2025-05-27 | Opus Genetics, Inc. | Salts and esters of APX3330 and therapeutic uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190160034A1 (en) | 2019-05-30 |
| EP3430057A4 (en) | 2020-03-11 |
| US20230293471A1 (en) | 2023-09-21 |
| JP2020514349A (ja) | 2020-05-21 |
| CA3056240A1 (en) | 2018-09-27 |
| EP3735968A1 (en) | 2020-11-11 |
| EP3430057A1 (en) | 2019-01-23 |
| US11648226B2 (en) | 2023-05-16 |
| US20210038553A1 (en) | 2021-02-11 |
| US12350247B2 (en) | 2025-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12350247B2 (en) | Use of APE1/Ref-1 inhibitors for treatment of retinal diseases | |
| Shah et al. | Exploiting the Ref-1-APE1 node in cancer signaling and other diseases: from bench to clinic | |
| AU2020202088B2 (en) | Combination therapy for treating cancer | |
| US20190070183A1 (en) | Targeting Casein Kinase-1 and PI3K/AKT/mTOR Pathways for Treatment of c-Myc-Overexpressing Cancers, Organ Transplant Associated Complications and Autoimmune Diseases | |
| Entrialgo-Cadierno et al. | The phospholipid transporter PITPNC1 links KRAS to MYC to prevent autophagy in lung and pancreatic cancer | |
| EP3177292A1 (en) | Compounds and methods for treating cancer | |
| WO2020092615A1 (en) | Treatments for venetoclax-resistant and venetoclax-sensitive acute myeloid leukemia | |
| Duncan et al. | ATF3 coordinates antitumor synergy between epigenetic drugs and protein disulfide isomerase inhibitors | |
| Ricci et al. | Novel ABCG2 antagonists reverse topotecan-mediated chemotherapeutic resistance in ovarian carcinoma xenografts | |
| Hu et al. | Enhanced antitumor activity of cetuximab in combination with the Jak inhibitor CYT387 against non-small-cell lung cancer with various genotypes | |
| Gao et al. | Synergism of FAK and ROS1 inhibitors in the treatment of CDH1-deficient cancers mediated by FAK-YAP signaling | |
| WO2018167519A1 (en) | Biomarker for identifying responders to cancer treatment | |
| Gnagni et al. | Precision oncology targeting FGFRs: A systematic review on pre-clinical activity and clinical outcomes of pemigatinib | |
| KR20150131155A (ko) | 종양 약역학적 반응의 바이오마커 | |
| Njauw et al. | Oncogenic KIT induces replication stress and confers cell cycle checkpoint vulnerability in melanoma | |
| EP3329923A1 (en) | The potential of crbn-independent imid resensitization by epigenetic therapy | |
| Curley et al. | 141 MM-121, an Anti-ErbB3 Antibody, Inhibits PI3K/AKT Signaling and Viability in Platinum-resistant Ovarian Cells and in Primary Ascites Derived From Chemo-resistant Ovarian Cancer Patients | |
| Ang et al. | Cooperative regulation of coupled oncoprotein translation and stability in triple-negative breast cancer by EGFR and CDK12 | |
| US20220296583A1 (en) | Compositions and methods for treatment of ovarian and breast cancer | |
| Timilsina | Targeting Forkhead Box M1 as a Novel Approach to Inhibit Breast Cancer Growth and Progression | |
| EP3649242A2 (en) | Methods of inhibiting cell proliferation and mettl8 activity | |
| Montenegro | Effetti dell'inibizione di HDAC6 sul pathway di NOTCH3 nel carcinoma dell'ovario e nel tumore della mammella triplo negativo. | |
| HK40061501A (en) | Combination therapy for treating cancer | |
| WO2025007147A2 (en) | Methods for sensitizing drug-resistant cancer cells | |
| Howard | Characterization of the CXCR4-LASP1-eIF4F Axis in Triple-Negative Breast Cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 2018772627 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2018772627 Country of ref document: EP Effective date: 20181018 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18772627 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3056240 Country of ref document: CA Ref document number: 2019549542 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |