WO2018174379A1 - Pharmaceutical composition comprising htr2a antagonist as effective ingredient for preventing or treating fatty liver - Google Patents

Abstract

The present invention relates to a pharmaceutical composition comprising an HTR2A inhibitor as an effective ingredient for preventing or treating fatty liver. Being inhibitive of high fat diet-induced fatty liver production and suppressive of the expression of lipogenesis-related genes in hepatocytes, the HTR2A inhibitor of the present invention can be useful as an effective ingredient in a composition for prevention or treatment of fatty liver, and the like.

Description

Pharmaceutical composition for the prevention or treatment of fatty liver containing HTR2A antagonist as an active ingredient

The present invention was made by the task number 2014M3A9D8034464 under the support of the Ministry of Science, ICT and Future Planning, and the research management specialized organization of the project is “Korea Research Foundation”, the research project name is “Bio / Medical Technology Development Project”, and the research project title is “Cell Organ Organelle” Development of reconstruction technology for countermeasures through functional recovery ", the host institution is Korea Advanced Institute of Science and Technology, and the research period is 2016.06.26. to be.

In addition, the present invention was made by the task number 2016M3A9B6902871 under the support of the Ministry of Science, ICT and Future Planning, the research management specialized organization of the project is "Korea Research Foundation", the research project name "Bio / medical technology development project", the research project title is "local Analysis of Adipose Cell Remodeling Mechanism by Cell-derived Serotonin ", Organizer is Korea Advanced Institute of Science and Technology, Research period 2016.06.26.-2017.06.25. to be.

This patent application is filed with the Korean Patent Application No. 10-2017-0037833 filed with the Korean Patent Office on March 24, 2017 and the Korean Patent Application No. 10-2017-0158580 filed with the Korean Patent Office on November 24, 2017. Priority is claimed, the disclosures of which are incorporated herein by reference.

The present invention relates to a pharmaceutical composition for preventing or treating fatty liver, comprising an HTR2A antagonist as an active ingredient.

Fatty liver is a disease in which triglycerides accumulate in liver cells. It is caused by excessive energy such as obesity and metabolic syndrome or excessive alcohol consumption. If fatty liver persists, hepatitis, cirrhosis and even liver cancer can cause a series of diseases. Recently, obesity and rural populations are rapidly increasing not only in western developed countries but also in Korea due to lack of eating habits, drinking culture, and lack of exercise, which is a serious social problem.

Fatty liver develops when the amount of fat accumulated in the liver exceeds the amount of fat metabolized by the liver through the fat metabolism pathway in the liver. Increased absorption of fat from the blood into the liver, increased fat production from the liver, increased triglycerides synthesized in the liver, reduced fat oxidation consumed in the liver, ultra-low-density lipoprotein (VLDL) that exports fat from the liver to the blood In addition, the reduction of very low desity lipoprotein may be seen in pathophysiology of fatty liver.

As a method for preventing and treating fatty liver, methods for controlling metabolic risk factors such as dietary control and limiting alcohol intake are used, but there is a lack of treatment for fatty liver itself. Therefore, researches on various aspects of the development of new fatty liver treatments are currently underway worldwide. Drugs for the prevention or treatment of fatty liver may act as a mechanism for inducing reduction of fat rather than accumulation of fat through the regulation of the fat metabolism pathways described above.

The present inventors have endeavored to develop a substance having anti-fatty activity, and confirmed that the HTR2A antagonist including safogrelate, ketanserine, etc. of the present invention exhibited significant fatty liver improvement effects, and completed the present invention.

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating fatty liver, comprising an HTR2A (5-hydroxytrptamine receptor 2A) inhibitor as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or improving fatty liver, comprising an HTR2A (5-hydroxytrptamine receptor 2A) inhibitor as an active ingredient.

It is still another object of the present invention to provide a method for screening a candidate for preventing or treating fatty liver, comprising the following steps:

(a) contacting a test substance with an isolated cell comprising a 5-hydroxytrptamine receptor 2A (HTR2A) gene or protein; And

(b) measuring the expression level of the HTR2A gene, or the amount or activity of the HTR2A protein:

When the expression level of the HTR2A gene, or the amount or activity of the HTR2A protein is down-regulated in comparison with a cell that does not contact the test substance, the test substance is determined as a candidate for preventing or treating fatty liver.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of fatty liver comprising HTR2A (5-hydroxytrptamine receptor 2A) inhibitor as an active ingredient.

As used herein, the term “fatty liver” refers to a condition in which a greater amount of fat is accumulated in the liver than the proportion of fat (5%) in normal liver. The fatty liver may be classified into alcoholic fatty liver due to excessive drinking and non-alcoholic fatty liver due to obesity, diabetes, hyperlipidemia or drugs. Alcoholic fatty liver is caused by the ingestion of alcohol to promote fat synthesis and normal energy metabolism in the liver, non-alcoholic fatty liver occurs due to causes other than alcohol, the non-alcoholic fatty liver causes abnormal fat metabolism It is known to be frequently accompanied by adult disease.

As used herein, the term "alcoholic fatty liver" refers to a state in which fat is accumulated in liver cells by ingesting excessive alcohol (excessive drinking).

As used herein, the term "non-alcoholic fatty liver" refers to fatty liver caused by causes other than alcohol. It accounts for 57% of the total fatty liver, and is commonly known to be accompanied by the adult disease causing fat metabolism abnormality. One of the causes of adult disease is known to be excessive carbohydrate intake and obesity resulting from obesity. In fact, 75% of patients with nonalcoholic fatty liver have been reported to be obese.

As used herein, the term “HTR2A (5-hydroxytrptamine receptor 2A, or 5-HT2A receptor)” belongs to the serotonin receptor family and is one of the subtypes of the 5-HT2 receptor, which is a G protein-coupled receptor (GPCR). HTR2A was first noticed because of its importance as a target for serotonergic hallucinogens such as LSD, and was later found to mediate the action of many antipsychotic drugs, especially atypical drugs. However, the relationship between the HTR2A and fatty liver is not known yet.

According to one embodiment of the invention, the prevention or treatment of fatty liver is achieved by an inhibitor of HTR2A.

The inhibition of HTR2A can be done in a variety of ways.

As used herein, the term “inhibitor” may be an antagonist. Antagonists are substances that antagonize the binding of certain bioactive substances to their receptors, but do not exhibit physiological activity through their respective receptors. Antagonists, blocking agents, inhibitors, etc. . The antagonist herein includes an inverse agonist for the receptor.

According to a specific embodiment of the present invention, the HTR2A antagonist is Sapogrelate, 5-I-R91150, 5-MeO-NBpBrT, Adatanserin, Altanserin, AMDA (9-Aminomethyl -9,10-dihydroanthracene, Amperozide, Asenapine, BL-1020, Sinanserin, Clozapine, Deramciclane, Fananserin, Plyans Flibanserin, Glemanserin, Iferanserin, Ketanserin, KML-010, Lidanserin, Lubazodone, Lumateperone, Lumeperone, LY- 367,265, Medifoxamine, Mepiprazole, MIN-101, Naphtidrofuryl, Nefazodone, Ollanzapine, Phenoxybenzamine, Pipamperone , Pruvanserin, Lauwolscine, Quetiapine, Risperidone, Ritanserin, It may be selected from the group consisting of Setoperone, Spiperone, Svolrone, Volinanserin, and Xylamidine, but is not limited thereto.

According to the most specific embodiment of the present invention, the HTR2A antagonist is Ketanserin.

According to another embodiment of the present invention, the HTR2A antagonist may be an HTR2A expression inhibitor. The expression inhibitor may be an HTR2A expression inhibitor selected from the group consisting of antisense oligonucleotides, siRNAs, shRNAs and ribozymes that specifically bind to mRNA of the HTR2A gene, but is not limited thereto.

As used herein, the term "antisense oligonucleotide" refers to DNA or RNA or derivatives thereof that contain a nucleic acid sequence complementary to a sequence of a particular mRNA and binds to the complementary sequence within the mRNA to inhibit translation of the mRNA into a protein. An antisense sequence refers to a DNA or RNA sequence that is complementary to HTR2A mRNA (eg, GenBank Accession Nos. NM_000621.4 and NM_001165947.2) and capable of binding to HTR2A mRNA, and translates into HTR2A mRNA, into the cytoplasm. May inhibit the essential activity for translocation, maturation or any other overall biological function of the antisense nucleic acid, 6-100 bases in length, specifically 8-60 bases, more specifically 10 to 40 bases.

The antisense nucleic acid can be modified at one or more base, sugar or backbone positions to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5 (3): 343-55 (1995) ). The nucleic acid backbone can be modified with phosphorothioate, phosphoroester, methyl phosphonate, short chain alkyl, cycloalkyl, short chain heteroatomic, heterocyclic intersaccharide linkages and the like. In addition, antisense nucleic acids may comprise one or more substituted sugar moieties. Antisense nucleic acids can include modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-me pyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosil HMC, 2-aminoadenine, 2 Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine, etc. There is this. In addition, the antisense nucleic acids of the present invention may be chemically bound to one or more moieties or conjugates that enhance the activity and cellular adsorption of the antisense nucleic acids. Cholesterol moieties, cholesteryl moieties, cholic acid, thioethers, thiocholesterols, fatty chains, phospholipids, polyamines, polyethylene glycol chains, adamantane acetic acid, palmityl moieties, octadecylamine, hexylamino-carbonyl-oxy Fat-soluble moieties such as a cholesterol ester moiety, and the like. Oligonucleotides comprising fat-soluble moieties and methods of preparation are already well known in the art (US Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleic acid can increase stability to nucleases and increase the binding affinity of the antisense nucleic acid with the target mRNA.

Antisense oligonucleotides can be synthesized in vitro by conventional methods to be administered in vivo or to allow antisense oligonucleotides to be synthesized in vivo. One example of synthesizing antisense oligonucleotides in vitro is using RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose origin is in the opposite direction of the recognition site (MCS). Such antisense RNA is desirable to ensure that there is a translation stop codon in the sequence so that it is not translated into the peptide sequence.

The design of antisense oligonucleotides that can be used in the present invention can be readily prepared according to methods known in the art with reference to the nucleotide sequences of HTR2A mRNA known to GenBank (Weiss, B. (ed.): Antisense Oligodeoxynucleotides and Antisense RNA: Novel Pharmacological and Therapeutic Agents, CRC Press, Boca Raton, FL, 1997; Weiss, B., et al., Antisense RNA gene therapy for studying and modulating biological processes.Cell.Mol.Life Sci., 55: 334-358 (1999).

As used herein, the term “siRNA” refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99 / 07409 and WO 00/44914) siRNAs are provided as an efficient gene knockdown method or as a gene therapy method because they can inhibit the expression of target genes siRNA was first discovered in plants, worms, fruit flies and parasites. siRNA was developed and used in mammalian cell research.

When the siRNA molecule is used in the present invention, the sense strand (corresponding sequence corresponding to the HTR2A mRNA sequence) and the antisense strand (sequence complementary to the HTR2A mRNA sequence) may be positioned opposite to each other to have a double-chain structure. Or may have a single chain structure with self-complementary sense and antisense strands. siRNAs are not limited to completely paired double-stranded RNA moieties paired with RNA, but paired by mismatches (the corresponding bases are not complementary), bulges (there are no bases corresponding to one chain), and the like. May be included. The total length is 10 to 100 bases, preferably 15 to 80 bases, more preferably 20 to 70 bases.

The siRNA terminal structure can be either blunt or cohesive, as long as the expression of the HTR2A gene can be suppressed by the RNAi effect. The cohesive end structure is possible for both 3'-end protrusion structures and 5'-end protrusion structures.

In the present invention, an siRNA molecule may have a form in which a short nucleotide sequence (eg, about 5-15 nt) is inserted between a self-complementary sense and an antisense strand, and in this case, by expression of a nucleotide sequence The formed siRNA molecules form a hairpin structure by intramolecular hybridization, and form a stem-and-loop structure as a whole. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

In the present invention, the term "prevention" refers to any action that inhibits or delays the onset of the fatty liver by administration of the composition according to the present invention, and "treatment" refers to improving or beneficially modifying fatty liver by administration of the composition. It means all actions.

The composition for preventing or treating fatty liver of the present invention can be used to suppress or improve the onset of fatty liver by administering to a subject who is likely to develop or develop fatty liver.

Compositions and methods of treatment comprising the HTR2A antagonist of the present invention as an active ingredient include mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, cats, etc., which can cause all diseases related to fatty liver as well as humans. Can also be used for.

The composition comprising the HTR2A antagonist of the present invention may further comprise a suitable carrier, excipient or diluent according to conventional methods.

Carriers, excipients and diluents that may be included in the compositions of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The composition comprising the HTR2A antagonist of the present invention, respectively, in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral dosage forms, external preparations, suppositories, or sterile injectable solutions according to a conventional method. Can be formulated and used.

Specifically, when formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, and the like. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate, sucrose ( sucrose, lactose, gelatin and the like can be mixed. In addition to simple excipients, lubricants such as magnesium stearate, talc can also be used. Liquid preparations for oral use include suspensions, solvents, emulsions, and syrups, and include various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. Can be. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

Preferred dosages of the active ingredients of the present invention vary depending on the patient's condition, age, weight, extent of disease, drug form, route of administration, and duration, and may be appropriately selected by those skilled in the art. However, for the desired effect, the active ingredient of the present invention can be administered in 0.0001 ~ 100 mg / kg, preferably in an amount of 0.001 ~ 100 mg / kg divided once to several times daily. The active ingredient of the present invention in the composition should be present in an amount of 0.0001 to 10% by weight, preferably 0.001 to 1% by weight based on the total weight of the total composition.

In addition, the pharmaceutical dosage form of the active ingredient of the present invention may be used in the form of their pharmaceutically acceptable salts, and may be used alone or in combination with other pharmaceutically active ingredients or in a suitable collection.

The pharmaceutical composition of the present invention can be administered to mammals such as mice, rats, cattle, horses, pigs, domestic animals, humans, and the like by various routes. All modes of administration can be expected, for example, to be administered by oral, abdominal, rectal or intravenous, arterial, muscle, inhalation, transdermal, subcutaneous, intradermal, intrauterine, dural or intracerebroventricular injection. Can be.

According to another aspect of the present invention, the present invention provides a food composition for preventing or improving fatty liver comprising an HTR2A inhibitor as an active ingredient.

The HTR2A inhibitor of the present invention is sapogrelate (Sarpogrelate), 5-I-R91150, 5-MeO-NBpBrT, Adatanserin, Altanserin, AMDA (9-Aminomethyl-9,10-dihydroanthracene), Amperozide, Acenapine ), BL-1020, Sinanserin, Clozapine, Deramciclane, Fananserin, Flibanserin, Glemanserin, Iferanserin, Ketan Ketanserin, KML-010, Lidanserin, Lubazodone, Lumateperone, LY-367,265, Medifoxamine, Mepiprazole, MIN-101, Naphtidrofuryl, Nefazodone, Olanzapine, Phenoxybenzamine, Pipamperone, Pruvanserin, Lauwolscine, Queetiapine (Quetiapine) ), Risperidone, Ritanserin, Setoperone, Setoperone, Spiperone, Vololinanserin, and Xylamidine These antagonists may be an HTR2A from the group consisting of, without being limited thereto.

The food composition has a function of preventing or improving fatty liver.

The food composition for preventing or improving fatty liver of the present invention includes the form of pills, powders, granules, tablets, capsules or liquids, and the like to which the composition of the present invention can be added, for example, various foods , For example, drinks, gum, tea, vitamin complexes, dietary supplements and the like.

In addition to the HTR2A inhibitor, the food composition may further include other ingredients that do not interfere with fatty liver improvement, and the type thereof is not particularly limited. For example, various herbal extracts, food acceptable additives, natural carbohydrates, and the like may be contained as additional ingredients, such as conventional foods.

The "food supplement" means a component that can be added to food supplements, and can be used by those skilled in the art as appropriately added to prepare the food of each formulation. Examples of food additives include flavors such as various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, colorants and fillers, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners. , pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like, but is not particularly limited thereto.

Examples of such natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those mentioned above, natural flavoring agents (tautin, stevia extract) and synthetic flavoring agents (saccharin, aspartame, etc.) can also be used.

The food composition of the present invention may include a health functional food. In the present invention, the term "health functional food" refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body. Here, functional means to obtain useful effects for health purposes such as nutrient control or physiological action on the structure and function of the human body.

The health functional food of the present invention can be prepared by a method commonly used in the art, and the preparation can be prepared by adding raw materials and ingredients commonly added in the art. In addition, unlike the general medicine has the advantage that there is no side effect that can occur when taking a long-term use of the drug as a raw material, and excellent portability.

The mixed amount of the active ingredient may be suitably determined depending on the purpose of use (prevention, health or therapeutic treatment). Generally, in the preparation of food, the HTR2A antagonist of the present invention is added at a dose of 1 to 10% by weight, preferably 5 to 10% by weight of the raw material composition. However, in the case of prolonged ingestion for health and hygiene purposes or health control purposes, it may be used at a dose below the above range.

There is no particular limitation on the kind of food. Examples of the food to which the substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, drinks, Alcoholic beverages and vitamin complexes, and the like and include all of the health foods in the conventional sense.

As used herein, the term " improvement " refers to parameters related to a condition in which fatty liver disease improves or alleviates with administration of a composition according to the invention, such as a decrease in triglycerides, a decrease in lipogenesis, a decrease in hepatic fat, and the like. Means any action to reduce the symptoms of fatty liver.

In an embodiment of the present invention, the present inventors confirmed the expression of serotonin synthase Tph1 (Tryptophan hydoxylas 1) in a fatty liver-induced mouse model to confirm the relationship between fatty liver pathophysiology and serotonin. It was confirmed that Tph1 expression was increased in the intestinal tissue, which is the main place of serotonin synthesis (see Fig. 1 and Fig. 2).

In addition, in order to analyze the correlation between increased serotonin and fat, Tph1 gut-specific knockout (Tph1 GKO) was constructed to induce fatty liver and induced fatty liver. It was confirmed that the change was improved (see FIG. 3).

In addition, as a result of quantifying triglycerides in the liver tissue of the mouse, it was confirmed a significant reduction compared to wild type mice (see Figure 4).

Furthermore, in order to find out why fatty liver changes by high-fat diet were improved in Tph1 GKO mice, the expression patterns of liver metabolism-related genes were examined. As a result, Fasn, Acly, Me1, Expression of Gpam, Lpin1, Mogat1 responsible for Scd1 and triglyceride synthesis was confirmed to be reduced (see FIG. 5). It was also confirmed that this change was due to the reduction of Srebp1c, the major gene expression transcription factor of adipogenesis (see FIG. 5).

In order to confirm whether the fatty liver improvement effect by the high fat diet of Tph1 GKO mouse is applied to alcoholic fatty liver, the result of ethanol diet was also confirmed in the mouse (see FIG. 6). In addition, as a result of quantifying triglycerides in the liver tissue of the mouse, it was confirmed a significant decrease compared to wild type mice (see Figure 7).

Ethanol-mediated fatty liver improvement in Tph1 GKO mice was confirmed by increased expression of Cpt1a, which is responsible for fatty acid oxidation in the liver, decreased expression of Cd36, which brings fatty acids into cells, and decreased expression of Lpin1, which synthesizes intracellular triglycerides. 8).

Gene expression of liver tissues was examined to determine whether the Tph1 GKO mice showed improvement in alcoholic and non-alcoholic fatty livers, which were directly involved in serotonin signaling, and were responsible for resorption and metabolism of serotonin receptors and serotonin. Expression of genes was confirmed (see FIG. 9).

Among them, serotonin receptor HTR2A was administered to ketanserine, a receptor-specific antagonist, and the changes in fatty liver due to high fat diet were investigated. As a result, administration of ketanserine with a high fat diet was confirmed that the effect of reducing weight gain (see FIG. 10). In addition, glucose and insulin sensitivity tests confirmed that glucose tolerance and insulin resistance were improved by ketanserine (see FIG. 11). In addition, it was observed that the fatty liver change by the high-fat diet was improved in the ketanserine-treated group (see FIG. 12), and the amount of triglyceride in the liver tissue was significantly reduced (see FIG. 13).

In order to confirm whether the results of the ketanserine of the present invention were directly acted on the liver cells, the hepatocytes of the mouse were first cultured and the ketanserine was directly administered to confirm that the expression of genes related to fat production was reduced (FIG. On the contrary, it was confirmed that administration of an agonist for HTR2A, a target receptor of ketanserine, showed the opposite result (see FIG. 15).

Therefore, inhibiting serotonin, which acts as a liver, inhibits the expression of Srebp1c, a major gene expression transcription factor of lipogenesis, thereby inhibiting the expression of genes related to fat production, thereby improving alcoholic and non-alcoholic fatty liver and triglycerides. The decrease was confirmed, and by confirming that the serotonin receptor mediating this is HTR2A, it was confirmed that the ketanserine of the present invention can be usefully used as a composition for preventing or treating fatty liver.

In addition, the ketanserine of the present invention inhibited the expression of Acly and Me1 involved in adipogenesis in liver cells, and on the contrary, by confirming the increased expression of Acaca and Fasn by an agonist for HTR2A, a target receptor for ketanserine, Ketanserine can be usefully used in the composition for regulating liver fat metabolism.

Further, according to another embodiment of the present invention, it was confirmed that fatty liver accumulation was improved in liver tissue-specific HTR2A-removed mice (Htr2a LKO), thereby improving fatty liver (see FIGS. 17A to 17C), and triglycerides in liver tissue. (hepatic triglyceride) was also found to be significantly reduced in the safogrelate administration group (see Fig. 18) was confirmed that the HTR2A gene is a gene associated with the development of fatty liver, HTR2A antagonist of the present invention composition for the prevention or treatment of fatty liver It can be usefully used.

In addition, according to another embodiment of the present invention, in the liver tissue specific Htr2a-removing mouse (Htr2a LKO), the expression level of genes related to lipogenesis and triglyceride synthesis is reduced, the expression amount of genes related to fatty acid uptake is reduced, HTR2A The gene has been confirmed to be a gene associated with the development of fatty liver, HTR2A antagonist of the present invention can be usefully used as a composition for the prevention or treatment of fatty liver.

In addition, according to another embodiment of the present invention, when the high-fat diet mouse group was administered safogrelate, which is a kind of HTR2A antagonist of the present invention, the weight gain was significantly reduced compared to the vehicle-only group. (FIG. 23), accumulation of fat in liver tissue was reduced (FIGS. 24A and 24B), and hepatic triglycerides were also reduced. Thus, as confirmed through ketanserine and safogrelate, which are a type of HTR2A in the present invention, HTR2A inhibitors inhibit the expression of the HTR2A gene, a gene involved in the onset of fatty liver (expression inhibitor), or antagonize the action of the HTR2A receptor. (Receptor antagonist), it can be usefully used as a composition for the prevention or treatment of fatty liver.

According to another aspect of the invention, the present invention provides a method for screening a candidate for preventing or treating fatty liver, comprising the following steps:

(a) contacting a test substance with an isolated cell comprising a 5-hydroxytrptamine receptor 2A (HTR2A) gene or protein; And

(b) measuring the expression level of the HTR2A gene, or the amount or activity of the HTR2A protein:

When the expression level of the HTR2A gene, or the amount or activity of the HTR2A protein is down-regulated in comparison with a cell that does not contact the test substance, the test substance is determined as a candidate for preventing or treating fatty liver.

The screening method of the candidate for preventing or treating fatty liver of the present invention will be described in detail with each step as follows:

Step (a): HTR2A (5- hydroxytrptamine  receptor 2A) contacting test substance with isolated cells containing genes or proteins

According to the present invention, a test substance is contacted with a cell containing the HTR2A gene or protein.

The cells may be prepared variously, specifically hepatocytes.

According to a specific embodiment of the present invention, hepatocytes of a mouse were isolated and used.

As used to refer to the screening method of the present invention, the term “test material” refers to an unknown substance used in screening to determine whether the expression level of HTR2A gene, or the amount or activity of HTR2A protein is affected. The test substance specifically includes, but is not limited to, extracts, compounds, antisense nucleotides, and proteins.

Step (b): HTR2A  The expression level of the gene, or HTR2A  Measuring the amount or activity of a protein

Subsequently, when the expression level of the HTR2A gene, or the amount or activity of the HTR2A protein in the cells in contact with the test substance is down-regulated compared with the cells not in contact with the test substance, the test substance is a candidate for preventing or treating fatty liver. Determined as a substance.

The measurement of the change in the expression level of the HTR2A gene can be carried out through various methods known in the art. For example, RT-PCR (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Northern blotting (Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine , 102-108, CRC press), hybridization reaction using cDNA microarray (Sambrook et al., Molecular Cloning.A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)) or in situ hybridization reaction (Sambrook et al. , Molecular Cloning.A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)).

When performing according to the RT-PCR protocol, first, total RNA is isolated from cells treated with a sample, and then a first-chain cDNA is prepared using oligo dT primers and reverse transcriptase. Subsequently, the first chain cDNA is used as a template, and PCR reaction is performed using the HTR2A gene-specific primer set. Then, PCR amplification products are electrophoresed, and the formed bands are analyzed to measure changes in the expression level of the HTR2A gene.

Changes in the amount of HTR2A protein can be carried out through various immunoassay methods known in the art. For example, changes in the amount of HTR2A protein include, but are not limited to, radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzymelinked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood assay, and sandwich assay. .

Fatty liver prophylactic or therapeutic candidates determined through the screening method of the present invention can be used to prevent or treat fatty liver.

According to still another aspect of the present invention, the present invention provides a method for preventing fatty liver comprising administering to a subject a pharmaceutical composition comprising the above-described HTR2A (5-hydroxytrptamine receptor 2A) inhibitor of the present invention as an active ingredient. Or provide a method of treatment.

As used herein, the term “administration” or “administer” refers to administering a therapeutically effective amount of a composition of the invention directly to a subject (an individual) in need thereof so that the same amount is formed in the subject's body. Say that.

A "therapeutically effective amount" of a composition means a content of the composition that is sufficient to provide a therapeutic or prophylactic effect to a subject to which the composition is to be administered, and includes "prophylactically effective amount". Also, as used herein, the term "subject" includes, without limitation, human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, monkey, chimpanzee, baboon or rhesus monkey. Specifically, the subject of the present invention is a human.

The method for preventing or treating fatty liver of the present invention is a method comprising administering a pharmaceutical composition for preventing or treating fatty liver, which is an aspect of the present invention, and thus avoids excessive complexity of the present disclosure with respect to overlapping contents. To omit them.

The present invention provides a pharmaceutical composition for preventing or treating fatty liver, comprising an HTR2A (5-hydroxytrptamine receptor 2A) inhibitor as an active ingredient.

The present invention also provides a food composition for preventing or improving fatty liver, comprising an HTR2A inhibitor as an active ingredient.

The present invention also provides a method for screening a candidate for preventing or treating fatty liver.

Since the HTR2A inhibitor of the present invention inhibits fatty liver production induced by high fat diet and inhibits the expression of genes related to adipogenesis in hepatocytes, it may be usefully used as an active ingredient for preventing or treating fatty liver.

1 is a diagram showing that the expression of tryptophan hydroxylase 1 (Tph1), a rate determining step enzyme of serotonin synthesis, is increased by high fat diet in mouse intestinal tissue.

Figure 2 shows that the expression of Tph1, a rate-determining enzyme of serotonin synthesis, increases by ethanol intake in the intestinal tissues of mice.

3 is a diagram showing that fatty liver changes by high fat diet were improved in mice in which Tph1 was specifically removed from intestinal tissue.

4 is a diagram showing that the increase in triglycerides in liver tissue by high fat diet is suppressed in the tissues specifically Tph1 removed.

5 is a diagram showing changes in the expression of genes associated with hepatic fat metabolism by high fat diet in mice in which Tph1 is specifically removed from intestinal tissue.

6 is a diagram showing the improvement of fatty liver changes by ethanol diet in mice in which Tph1 is specifically removed from intestinal tissue.

FIG. 7 is a diagram showing the decrease of triglycerides in liver tissue by ethanol diet in mice in which Tph1 is specifically removed from intestinal tissue.

8 is a diagram showing changes in the expression of genes related to hepatic fat metabolism by ethanol diet in mice in which Tph1 is specifically removed from intestinal tissue.

Figure 9 is a diagram showing the expression of serotonin receptors and serotonin metabolizing enzymes in liver tissue of the mouse.

10 is a diagram showing the weight change when ketanserin was administered to a group of mice fed high fat diet.

Figure 11 shows the increase in glucose and insulin sensitivity when ketanserin is administered to the mouse group.

12 is a graph showing the reduction of fat accumulation in liver tissue as a result of H & E tissue staining when ketanserin, a type of HTR2A antagonist of the present invention, was administered to a group of mice fed high fat diet.

Figure 13 is a diagram showing the reduction of hepatic triglycerides (hepatic triglycerides) when administration of ketanserin, a type of HTR2A antagonist of the present invention, to a group of mice fed high fat diet.

14 is a diagram showing a decrease in expression of genes related to fat production when ketanserin is administered to liver cells of a mouse.

Figure 15 shows the increase in expression of genes associated with fat production when HTR2A agonist is administered to mouse liver cells.

FIG. 16A is a diagram illustrating a vector design for manufacturing an Htr2a floxed mouse, and FIG. 16B is a schematic diagram showing a method of manufacturing an Htr2a LKO mouse by crossing an Htr2a floxed mouse and an Alb-Cre mouse, and FIG. 16C is a manufactured Htr2a LKO. RT-PCR results to confirm knockout of mice.

17 is divided into liver tissue-specific Htr2a gene knockout mice (Htr2a Liver Knock Out mouse, Htr2a LKO) and wild-type mice divided into normal diet group (SCD, standard chow diet), high fat diet (HFD, high fat diet) It is a figure which shows the naked eye (FIG. 17A) and the microscopic findings (FIG. 17B and 17C) after a while.

Figure 18 shows the results of confirming the change in triglycerides in the liver in liver tissue-specific Htr2a removal mice (Htr2a LKO).

19A is a diagram confirming the change in weight of liver tissue-specific Htr2a-removed mice (Htr2a LKO), and FIG. 19B is a diagram confirming the change in weight ratio by organ to body weight.

20 is a diagram confirming the changes in glucose tolerance and insulin resistance of liver tissue specific Htr2a deficient mice (Htr2a LKO) (FIG. 20B).

FIG. 21 shows a comparison of lipid profiles (total cholesterol, fatty acids, triglycerides, HDL cholesterol levels) in plasma of liver tissue specific Htr2a deficient mice (Htr2a LKO).

FIG. 22 is a diagram showing a comparison of expression levels of genes associated with lipo metabolism in liver tissue specific Htr2a-removed mice (Htr2a LKO). FIG.

Figure 23 is a diagram showing the weight change when a group of mice fed high fat diet was administered safogrelate, which is a kind of HTR2A antagonist of the present invention.

FIG. 24 is a diagram showing the reduction of fat accumulation in liver tissue as a result of H & E tissue staining when administration of safogrelate, which is a type of HTR2A antagonist of the present invention, to a group of mice fed high-fat diet (FIG. 24A: 10x; FIG. 24b: 20x).

Figure 25 is a diagram showing a decrease in hepatic triglycerides (hepatic triglyceride) when the administration of safogrelate, which is a type of HTR2A antagonist of the present invention, to a group of mice fed high fat diet.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention.

Example

Example 1: Experimental Animal

1-1. Breeding experimental animals

Seven-week-old male rats (C57BL / 6) were used for pre-sale in a central laboratory animal. At eight weeks of age, five animals were divided into two diet groups (NCD group: normal chow diet and HFD group: high-fat diet). NCD group fed the normal diet and HFD group fed the 60% high-fat diet. The temperature of the kennel was maintained at 23 ℃, diet and drinking water was free to eat for 12 weeks.

In order to perform the ethanol diet, 10-week-old mice were divided into two diet groups (NCD group and ethanol diet group) and used for the experiment. In the general diet, the NCD group was distilled water, and the ethanol group was previously described (Zhou et al., 2003, Exp . Biol . Med . 227: 214-222; Kao et al., 2012, Hepatology . 56: 594-604 Ethanol was administered according to the following method.

To administer ketanserin (Sigma), 12-week-old mice were divided into two treatment groups (control group, ketanserin group) and used in the experiment. Ketanserine group was injected with ketaneserine dissolved in phosphate-buffered saline (PBS) in 1 mg / kg body weight of the mouse and the same amount of PBS daily in the control group.

1-2. Tissue extraction

The mice were anesthetized with Zoletil® (Virbac) intraperitoneally, and then the intraperitoneal incision was taken to extract the intestines and liver.

Example  2: serotonin synthase in intestinal tissue Tph1 ( Tryptophan hydroxylase 1) of  Expression confirmation

The intestinal tissue was removed by the method of Example 1-2 about the NCD group, HFD group, and ethanol diet group of the conditions of Example 1-1. RNA was isolated from the extracted intestinal tissue using Trizol reagent (Invitrogen) and RNA was quantified using a spectrophotometer. 1 μg of the total RNA isolated was synthesized using QuantiTect Reverse Transcription Kit (Qiagen), and realtime PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems). Gene expression levels were normalized using Actb (Actin, beta) as an internal control. Primers used for PCR were prepared using Primer-blast (www.ncbi.nlm.nih.gov/tools/primer-blast/) and the sequences described in Table 1 were used.

gene	Forward primer	Reverse primer
Actb	GGTACCACCATGTACCCAGG	GAAAGGGTGTAAAACGCAGC
Tph1	ACCATGATTGAAGACAACAAGGAG	TCAACTGTTCTCGGCTGATG

As a result, it was confirmed that the expression of Tph1, a serotonin synthase, in the intestinal tissue was significantly increased in both the high fat diet (HFD group) and the ethanol diet (EtOH) (see FIGS. 1 and 2). Therefore, high fat diet and ethanol diet was found to increase the expression of Tph1, a serotonin synthase in the intestinal tissue.

Example 3: Confirmation of Changes in Fatty Liver of Intestinal Tissue-Specific Tph1-Removed Mice (Tph1 GKO)

3-1. Construction of Mice with Tph1 Gene Specific to Intestinal Tissue

Tph1 gut-specific knockout (Tph1 GKO) mice with Tph1 gene-specific intestinal tissues were removed according to the method described in Sumar et al., 2012, Cell Metab . 16: 588-600. Cre mice were made by crossing.

3-2. Microscopic Findings of Liver Tissue in Intestinal Tissue-Specific Tph1-removed Mouse (Tph1 GKO)

In order to observe the liver tissue of the intestinal tissue specific Tph1 removing mouse (Tph1 GKO) prepared in Example 3-1, the liver was extracted by the method described in Example 1-2 and fixed in 10% neutral formalin solution. , Paraffin embedded, cut to 5 μm thickness and adhered to the slide. After the deparaffin and water-containing process, it was stained with hematoxylin and Eosin (Hematoxylin & Eosin).

As a result, it was confirmed that fatty liver changes due to high fat diet were improved in mice in which Tph1 was specifically removed (Tph1 GKO). It was also confirmed that fatty liver was also improved in the result of ethanol diet in Tph1 GKO mice (see FIG. 6). Therefore, it can be seen that the reduction of serotonin is associated with the improvement of fatty liver.

3-3. Determination of Triglycerides in Liver Tissues of Intestinal Tissue-Specific Tph1-removed Mice (Tph1 GKO)

In order to quantify the triglycerides in the liver tissues of the intestinal tissue-specific Tph1-removed mice (Tph1 GKO) prepared in Example 3-1, the liver was extracted by the method described in Example 1-2, followed by a 5% NP-40 solution. After pulverizing in and heated to dissolve all lipid components. Triglyceride Reagent (Sigma) was used to decompose triglycerides into Glycerol, and Glycerol Reagent (Sigma) was used to quantify the amount of Glycerol by color reaction. The protein amount was measured by BCA Protein Assay Kit (Pierce) to correct the triglyceride amount to the amount of protein in the tissue.

As a result, it was confirmed that the triglyceride amount was reduced in both high fat diet and ethanol diet in Tph1 GKO mice (see FIGS. 4 and 7). Therefore, it was found that the decrease in serotonin was also related to the decrease of triglyceride in the liver.

Example  4: intestinal tissue specificity Tph1  Remove mouse ( Tph1 GKO ) Changes in gene expression related to fat metabolism

In order to compare the expression level of adipose metabolism related genes in liver tissues of intestinal tissue-specific Tph1-removed mice (Tph1 GKO) and normal mice (WT), Example 2 was extracted from liver tissues extracted by the method described in Example 1-2. RNA was extracted by the method described in the above, cDNA was synthesized, and realtime PCR was performed. The primers used for PCR used the sequences listed in Table 2 below.

gene	Forward primer	Reverse primer
Actb	GGTACCACCATGTACCCAGG	GAAAGGGTGTAAAACGCAGC
Acaca	CAGTAACCTGGTGAAGCTGGA	GCCAGACATGCTGGATCTCAT
Fasn	AAGCGGTCTGGAAAGCTGAA	AGGCTGGGTTGATACCTCCA
Acly	CCCTCTTCAGCCGACATACC	CTGCTTGTGATCCCCAGTGA
Me1	GACCCGCATCTCAACAAGGA	CAGGAGATACCTGTCGAAGTCA
Scd1	AGAGTCAGGAGGGCAGGTTT	GAACTGGAGATCTCTTGGAGCA
Gpam	CCACAGAGCTGGGAAAGGTT	GTGCCTTGTGTGCGTTTCAT
Agpat	GCGCAATGTCGAGAACATGA	TCATTCCAAGCAGGTCGAGG
Lpin1	CATACAAAGGCAGCCACACG	CGGGGTTCAGTCCCTTGTAG
Mogat1	TTGACCCATGGTGCCAGTTT	GTGGCAAGGCTACTCCCATT
Dgat1	GGATCTGAGGTGCCATCGTC	ATCAGCATCACCACACACCA
Dgat2	CATCATCGTGGTGGGAGGTG	TGGGAACCAGATCAGCTCCAT
Cd36	TGGCCAAGCTATTGCGACAT	ACACAGCGTAGATAGACCTGC
Cpt1a	AGCTCGCACATTACAAGGACA	CCAGCACAAAGTTGCAGGAC
Mtp	TGCTTCCGTTAAAGGTCACACA	CTTGCGGTTTTCCTTTGCCC
Apob	TACTTCCACCCACAGTCCCCT	CCTTAGAAGCCTTGGGCACAT
Pparg	GGTGTGATCTTAACTGCCGGA	GCCCAAACCTGATGGCATTG
Ppargc1a	GCCCAGGTACGACAGCTATG	ACGGCGCTCTTCAATTGCTT
Nr1h3	GCAGGACCAGCTCCAAGTAG	CCCTTCTCAGTCTGCTCCAC
Mlxipl	AAGTTGCTATGCCGGGACAA	ATGACAGCCTCAGGTTTCCG
Srebp1c	GGAGCCATGGATTGCACATT	GGCCCGGGAAGTCACTGT
Esrrg	GTCTTGACAGAGTGCGTGGA	TTCAGCCACCAACAAATGCG

Application of the high-fat diet to Tph1 GKO mice showed that the expression of Fasn, Acly, Me1, Scd1, responsible for de novo lipogenesis, and Gpam, Lpin1, Mogat1, responsible for triglyceride synthesis, were reduced ( See FIG. 5). In addition, this change was confirmed to be due to the reduction of Srebp1c, a major gene expression transcription factor of adipogenesis (see FIG. 5).

In addition, the application of ethanol diet to Tph1 GKO mice showed that fatty liver improvement increased the expression of Cpt1a, which is responsible for fatty acid oxidation in the liver, decreased the expression of Cd36 that brought fatty acids into cells, and reduced Lpin1 expression that synthesizes intracellular triglycerides. It was confirmed by (see Fig. 8).

Example  5: intestinal tissue specificity Tph1  Remove mouse ( Tph1 GKO ) Synthesis of Serotonin Receptor and Metabolic Enzyme Expression in Liver Tissue

In order to compare the expression levels of serotonin receptors, the synthesis of serotonin and the expression of genes related to metabolic enzymes in liver tissues of intestinal tissue-specific Tph1 deficient mice (Tph1 GKO) and normal mice (WT), From the extracted liver tissue, RNA was extracted by the method described in Example 2, cDNA was synthesized, and end-point PCR was performed. Primers used for PCR used the sequences described in Table 3 below.

gene	Forward primer	Reverse primer
Actb	GGTACCACCATGTACCCAGG	GAAAGGGTGTAAAACGCAGC
Htr1a	TCAGCTACCAAGTGATCACCTCT	GTCCACTTGTTGAGCACCTG
Htr1b	TGCTCCTCATCGCCCTCTATG	CTAGCGGCCATGAGTTTCTTCTT
Htr1d	CCTCCAACAGATCCCTGAATG	CAGAGCAATGACACAGAGATGCA
Htr1f	TGTGAGAGAGAGCTGGATTATGG	TAGTTCCTTGGTGCCTCCAGAA
HTR2A	AGCTGCAGAATGCCACCAACTAT	GGGATTGGCATGGATATACCTAC
Htr2b	AAATAAGCCACCTCAACGCCT	TCCCGAAATGTCTTATTGAAGAG
Htr2c	TTCTTAATGTCCCTAGCCATTGC	GCAATCTTCATGATGGCCTTAGT
Htr3a	AAATCAGGGCGAGTGGGAGCTG	GACACGATGATGAGGAAGACTG
Htr3b	CGTGTGGTACCGAGAGGTTT	GGATGGGCTTGTGGTTTCTA
Htr4	ATGGACAAACTTGATGCTAATGTGA	TCACCAGCACCGAAACCAGCA
Htr5a	GATTGACTTCAGTGGGCTCG	AAAGTCAGGACTAGCACTCG
Htr5b	GGAGCCTTCTACCTGCCTCT	ATGAGCTCCGTCAGGAAGAA
Htr6	CCTCACATGGCTGGGATACT	ATCTGAGTTGGGTGGCAGAG
Htr7	CTCGGTGTGCTTTGTCAAGA	TTGGCCATACATTTCCCATT
Tph1	ACCATGATTGAAGACAACAAGGAG	TCAACTGTTCTCGGCTGATG
Tph2	GCCATGCAGCCCGCAATGATGATG	CAACTGCTGTCTTGCTGCTC
Slc6a4	CGCAGTTCCCAGTACAAGC	CGTGAAGGAGGAGATGAGG
Maoa	GCGGTACAAGGGTCTGTTCC	CAGCCAATCCTGAGATGCCG
Maob	GGGCGGCATCTCAGGTATGG	AAGTCCTGCCTCCTACACGG

As a result, the expression of Htr1a, Htr1d, HTR2A, Htr2b, Htr3a, Htr4, Htr7, and Slc6a4 responsible for serotonin reuptake, Maoa responsible for serotonin degradation, and Maob among serotonin receptors were confirmed (see FIG. 9).

Among them, serotonin receptor HTR2A was administered to ketanserine, which is a receptor-specific antagonist, to investigate changes in fatty liver due to high fat diet. As a result, the administration of ketanserine with a high fat diet was confirmed that the weight gain is reduced (see Fig. 10).

Example  6: of the present invention Ketanserin  Of mice by administration Glucose tolerance  And insulin resistance

According to the method described in Example 1-1, i) a general diet group, ii) a general diet and a ketanserine administration group, iii) high fat, in order to confirm the effect of improving the glucose tolerance and insulin resistance of the mouse by administration of the ketanserine of the present invention Diet group, iv) high-fat diet and ketanserine-administered groups were bred, and blood was collected from the caudal vein of mice to measure blood glucose.

After fasting, glucose solution was administered intraperitoneally with 2 g / kg body weight after fasting, and blood glucose was measured after 0, 15, 30, 45, 60, 90, and 120 minutes.

Insulin resistance was measured after 0.75 U / kg body weight of insulin solution after fasting and blood glucose was measured after 0, 15, 30, 45, 60, 90, 120 minutes.

As a result, iv) it was confirmed that impaired glucose tolerance and insulin resistance in the group of mice fed high fat diet when ketanserine was administered (see FIG. 11).

Example 7 Fatty Liver Improvement Effect by Ketanserine Administration of the Present Invention

In order to confirm the fatty liver improvement effect of the mouse by the ketanserine administration of the present invention, i) a general diet group, ii) a general diet and ketanserine administration group, iii) a high fat diet group, iv by the method described in Example 1-1 ) Breeding was divided into high fat diet and ketanserine administration group, and liver tissue was observed by H & E staining by the method described in Examples 3-2 and 3-3, and the amount of triglyceride was quantified. Ketanserine was intragastrically administered.

As a result, it was confirmed that iv) the accumulation of hepatic fat by the high fat diet was reduced in the ketanserine-administered group, thereby improving the fatty liver (see FIG. 12), and the amount of triglycerides in the liver tissue was also significantly reduced. (See Figure 13).

Example 8 Investigation of Lipid Metabolism Enzyme Change of Hepatocytes by Ketanserine of the Present Invention

In order to confirm whether the results of the ketanserine of the present invention are directly induced by the action of liver cells, the hepatocytes of the mouse were first cultured, and the ketaneserine and the HTR2A agonist DOI (1- (2,5-dimethoxy-4) -iodophenyl) -2-aminopropane) was administered and the expression levels of genes involved in fat production were measured.

Specifically, for the first culture of mouse liver cells (Klaunig et al., 1981, In Vitro . 17: 913-925; Li et al., 2010, Methods Mol Biol . 633: 185-196), hepatocytes of the mouse were isolated by a two-step perfusion method described in. The hepatocytes are high glucose DMEM containing 1% antibiotic-antimycotic solution (Invitrogen, Carlsbad, CA) and 10% bovine calf serum (Invitrogen, Carlsbad, CA) The growth medium, incubated in a humid atmosphere of 5% carbon dioxide and 37 ℃ temperature conditions.

Ketanserine, which is an HTR2A antagonist, or DOI, which is an HTR2A agonist, was treated to a concentration of 1 μM, respectively, and after 24 hours, RNA was extracted by the same method as in <Example 2> to synthesize cDNA, followed by realtime PCR. Primers used for PCR were as shown in Table 2 above.

The results are shown in FIGS. 14 and 15.

As shown in Figure 14, when treated with ketanserine, the HTR2A antagonist of the present invention, a decrease in the expression of genes involved in fat production appeared. On the other hand, as shown in Figure 15, administration of DOI, an agonist of HTR2A, a target receptor for ketanserin, increased expression of genes involved in fat production.

Example  9: of the present invention Liver tissue  singularity Htr2a  Remove mouse ( Htr2a LKO Confirmation of changes in fatty liver

9-1. Liver Tissue-Specific Htr2a Gene-free Mouse

Htr2a liver-specific knockout (Htr2a LKO) was generated by crossing Htr2a floxed mice and Alb-Cre mice (see FIGS. 16A and 16B). Liver tissues of the prepared Htr2a LKO mice were collected and subjected to RT-PCR for the Htr2a gene to confirm that knockout was well performed (see FIG. 16C).

9-2. Breeding of Experimental Animals

To observe the phenotypes associated with high-fat diets in Htr2a liver-specific knockout (Htr2a LKO), the HT2a-specific knockout mice (WT, wild type) and Htr2a LKO mice were examined. SCD, standar chow diet and high fat diet (HFD). i) Normal diet group fed normal diet for 4-20 weeks, ii) High-fat diet fed normal diet for 4-12 weeks, and high diet for 13-20 weeks.

9- 3. Liver  Tissue specificity Htr2a  Remove mouse ( Htr2a LKO A) liver tissue Naked and Microscopic findings

Liver tissue-specific Htr2a-removed mice (Htr2a LKO) and wild-type mice (WT) prepared in Example 9-1 were bred by the method described in Example 9-2, and liver was extracted by the method described in Example 1-2. It was. As a result of comparing the liver tissues of the Htr2a LKO mice fed the high fat diet and the wild type control mice (WT) fed the high fat diet, it was confirmed that the livers of the Htr2a LKO mice were smaller (FIG. 17A). The livers were also fixed in 10% neutral formalin solution to confirm histological differences, embedded in paraffin, cut to 5 μm thickness and adhered to slides. After the deparaffin and water-containing process, it was stained with hematoxylin and Eosin (Hematoxylin & Eosin). As a result, it was confirmed that in the liver tissue-specific Htr2a-removed mice (Htr2a LKO), fat accumulation in fat by the high fat diet was reduced (see FIGS. 17B and 17C). Therefore, it was found that the inhibition of expression of the Htr2a receptor of the present invention has an effect of improving fatty liver.

9-4. Liver tissue specificity Htr2a  Remove mouse ( Htr2a LKO Determination of Triglycerides in Liver Tissue

To quantify triglycerides in liver tissue of liver tissue specific Htr2a-removing mice (Htr2a LKO) prepared in Example 9-1, liver was extracted by the method described in Example 1-2, followed by 5% NP-40 solution. After pulverizing in and heated to dissolve all lipid components. Triglyceride Reagent (Sigma) was used to decompose triglycerides into Glycerol, and Glycerol Reagent (Sigma) was used to quantify the amount of Glycerol by color reaction. The protein amount was measured by BCA Protein Assay Kit (Pierce) to correct the triglyceride amount to the amount of protein in the tissue.

As a result, it was confirmed that the liver triglyceride amount was reduced in the normal diet and the high-fat diet in liver tissue-specific Htr2a-removed mice (Htr2a LKO). Therefore, it can be seen that the inhibition of expression of the Htr2a receptor of the present invention is also associated with the decrease of triglycerides in the liver.

9-5. Liver tissue specificity Htr2a  Remove mouse ( Htr2a LKO Body weight and organ weight

To determine the metabolic profiles of Htr2a liver-specific knockout (Htr2a LKO) and wild-type (WT, wild type) mice, the mice were divided into normal and high-fat diets. Feed was fed and weighed for 4-20 weeks. In addition, the weight of other tissues (eWAT, epididymal white adipose tissue; iWAT, inguinal white adipose tissue; BAT, brown adipose tissue; Quadriceps; kidney) was measured. As a result, there was no difference in weight between wild-type mice (WT) and Htr2a LKO mice in both the normal diet and the high-fat diet group, and there was no difference in the weight-to-organ weight ratio (see FIG. 19).

9-6. Liver tissue specificity Htr2a  Remove mouse ( Htr2a LKO )of Glucose tolerance  Changes in insulin and insulin resistance

According to the method described in Example 9-2, to confirm the effect of improving glucose tolerance and insulin resistance in liver tissue-specific Htr2a gene-free mice (Htr2a liver-specific knockout, Htr2a LKO) of the present invention, i) Groups were divided into general diet wild type mouse group, ii) high fat diet wild type mouse group, iii) general diet Htr2a LKO group, and iv) high fat diet Htr2a LKO group, and blood was collected from the caudal vein of the mouse to measure blood glucose. After fasting, glucose solution was administered intraperitoneally with 2g / kg of glucose solution, and blood glucose was measured after 0, 15, 30, 60, 90, and 120 minutes (18 weeks of age). Insulin resistance measured blood glucose levels after 0, 15, 30, 60, 90, and 120 minutes of intraperitoneal administration of 0.75 U or 1 U of insulin solution after fasting (19 weeks of age). As a result, it was confirmed that there was no difference in glucose tolerance (FIG. 20a) and insulin resistance between wild-type mice and Htr2a LKO mice in both the normal diet and the high-fat diet group (FIG. 20B).

9-7. Liver tissue specificity Htr2a  Remove mouse ( Htr2a LKO )of In plasma  Identify changes in lipid profile

In order to confirm the effect on plasma lipid levels in the liver tissue-specific Htr2a gene-depleted mice (Htr2a liver-specific knockout, Htr2a LKO) of the present invention, i. A) general diet wild type mouse group, ii) high fat diet wild type mouse group, iii) general diet Htr2a LKO group, and iv) high fat diet Htr2a LKO group, and then raised blood from the veins of the mice to measure blood glucose. As a result, it was confirmed that there was no difference in total cholesterol, fatty acid, triglyceride, and HDL cholesterol levels between wild-type mice and Htr2a LKO mice in both the normal diet group and the high-fat diet group (FIG. 21).

Example  10: liver tissue specific Htr2a  Remove mouse ( Htr2a LKO Changes in gene expression related to fat metabolism in liver tissue

In order to compare the expression level of adipose metabolism-related genes in liver tissues of liver tissue-specific Htr2a-removed mice (Htr2a LKO) and normal mice (WT), from the liver tissues extracted by the method described in Example 1-2, Example 2 RNA was extracted by the method described in the above, cDNA was synthesized, and realtime PCR was performed. As the primer used for PCR, the sequence described in Table 2 of Example 4 was used. Application of high-fat diet to Htr2a LKO mice resulted in genes related to de novo lipogenesis and triglyceride synthesis (Srebp1c, Fasn, Gpam, Agpat1, Mogat1) and fatty acid uptake It was confirmed that the expression of the gene (Cd36) associated with is reduced (see FIGS. 22A-22C).

Example 11 Improvement of Fatty Liver by Administration of Safogrelate of the Present Invention

In order to confirm the effect of improving the fatty liver of mice by administration of safogrelate of the present invention, C57BL6 / J mice from 12 to 20 weeks of age i) general diet + vehicle (vehicle, phosphate buffered saline) ii) general diet + safogrerel Liver (3) high fat diet + vehicle, iv) high fat diet + safogrelate administration group, and then weighed, and weighed the liver tissue by the method described in Examples 3-2 and 3-3 above. Was observed under a microscope by H & E staining, triglyceride amount was quantified. The safogrelate was intragastric injection at 30 mg / kg / day.

As a result, no significant weight difference was observed between the i) vehicle and ii) safogrelate groups in the normal diet group, but the body weight gain was increased in the iii) vehicle group in the high-fat diet group. iv) It was confirmed that the weight gain was significantly reduced in the safogrelate administration group (see FIG. 23).

In addition, there was no difference in the accumulation of liver fat in the group fed the normal diet in the result of H & E staining by liver tissue extraction, but in the group fed the high fat diet iv) the accumulation of liver fat in the group fed safogrelate This decrease was confirmed to improve fatty liver (see FIGS. 24A and 24B).

It was confirmed that the amount of hepatic triglyceride in liver tissue was significantly reduced in the sapogrelate administration group as well as the weight and liver tissue results (see FIG. 25).

Claims (13)

1. A pharmaceutical composition for preventing or treating fatty liver, comprising an HTR2A (5-hydroxytrptamine receptor 2A) inhibitor as an active ingredient.
2. The composition of claim 1, wherein the HTR2A inhibitor is an HTR2A antagonist.
3. The method of claim 2, wherein the HTR2A antagonist is Sapogrelate, 5-I-R91150, 5-MeO-NBpBrT, Adatanserin, Altanserin, AMDA (9-Aminomethyl-9, 10-dihydroanthracene, Amperozide, Asenapine, BL-1020, Sinanserin, Clozapine, Deramciclane, Fananserin, Flybanserine Flibanserin, Glemanserin, Iferanserin, Ketanserin, KML-010, Lidanserin, Lubazodone, Lumatezolone, Lumateperone, LY-367,265, Medi Medifoxamine, Mepiprazole, MIN-101, Naphtidrofuryl, Nefazodone, Ollanzapine, Phenoxybenzamine, Pipamperone, Pruvann Pruvanserin, Lauwolscine, Quetiapine, Risperidone, Ritanserin, Setoperone, Blood Peron (Spiperone), Bolivar I serine (Volinanserin), and xylene lamina composition being selected from the group consisting of a Dean (Xylamidine).
4. 4. The composition of claim 3 wherein the HTR2A antagonist is ketanserine or safogrelate.
5. The composition of claim 1, wherein the HTR2A inhibitor is an HTR2A expression inhibitor selected from the group consisting of antisense nucleotides, siRNAs, shRNAs and ribozymes that complementarily bind to mRNA of the HTR2A gene.
6. The composition of claim 1, wherein the fatty liver is alcoholic fatty liver or non-alcoholic fatty liver.
7. A food composition for preventing or improving fatty liver, comprising an HTR2A (5-hydroxytrptamine receptor 2A) inhibitor as an active ingredient.
8. According to claim 7, wherein the HTR2A inhibitor is Sapogrelate (Sarpogrelate), 5-I-R91150, 5-MeO-NBpBrT, Adatanserin, Altanserin, AMDA (9-Aminomethyl-9, 10-dihydroanthracene, Amperozide, Asenapine, BL-1020, Sinanserin, Clozapine, Deramciclane, Fananserin, Flybanserine Flibanserin, Glemanserin, Iferanserin, Ketanserin, KML-010, Lidanserin, Lubazodone, Lumatezolone, Lumateperone, LY-367,265, Medi Medifoxamine, Mepiprazole, MIN-101, Naphtidrofuryl, Nefazodone, Ollanzapine, Phenoxybenzamine, Pipamperone, Pruvann Pruvanserin, Lauwolscine, Quetiapine, Risperidone, Ritanserin, Setoperone, Blood Peron (Spiperone), Bolivar I serine (Volinanserin), and compositions, characterized in that the selected HTR2A antagonist from the group consisting of xylene lamina Dean (Xylamidine).
9. Screening methods for candidates for the prevention or treatment of fatty liver, comprising the following steps:

   (a) contacting a test substance with an isolated cell comprising a 5-hydroxytrptamine receptor 2A (HTR2A) gene or protein; And

   (b) measuring the expression level of the HTR2A gene, or the amount or activity of the HTR2A protein:

   When the expression level of the HTR2A gene, or the amount or activity of the HTR2A protein is down-regulated in comparison with a cell that does not contact the test substance, the test substance is determined as a candidate for preventing or treating fatty liver.
10. The method of claim 9, wherein the cell of step (a) is characterized in that hepatocytes.
11. 10. The method of claim 9, wherein the test substance of step (a) is selected from the group consisting of extracts, compounds, antisense nucleotides, and proteins.
12. 10. The method according to claim 9, wherein the amount of HTR2A gene expression, or the amount or activity of HTR2A protein in step (b) is RT-PCR, Northern blot, microarray, radioimmunoprecipitation, immunoprecipitation, ELISA, Western blot. Measuring by any one of the selected techniques.
13. A method for preventing or treating fatty liver, comprising administering to a subject a pharmaceutical composition comprising the HTR2A (5-hydroxytrptamine receptor 2A) inhibitor of any one of claims 1 to 6 as an active ingredient.

Images